JP5183265B2 - High gene expression system - Google Patents

Description

  The present invention relates to an expression regulator associated with nitrile metabolism and a gene high expression system using the expression regulator.

  The present inventor has already developed a protein (H-nitrile hydratase) inducible expression system derived from Rhodococcus rhodochrous J1 (FERM BP-1478), which is a kind of actinomycetes (see Non-Patent Document 1). This expression system contains a large amount of H-nitrile hydratase (an enzyme that hydrates nitriles to amides) that accounts for 50% or more of the total soluble protein in cell-free extracts when urea is added to the medium as an inducer. Expressed in That is, in the expression system, an inducible promoter having a very strong transcription activity is involved.

However, since the above findings were obtained only for some actinomycetes, Rhodococcus rhodochrous J1, strains, expression systems derived from bacteria belonging to other genera can be used to broaden the application range of expression systems. It is hoped that.
Proc. Natl. Acad. Sci. USA, vol.93, p.4267-4272 (1996)

  Therefore, the problem to be solved by the present invention is to develop an expression regulator related to nitrile metabolism in addition to the inducible expression regulation mechanism of a protein (H-nitrile hydratase) developed in Rhodococcus microorganisms. To do. Furthermore, it aims at the application to mass production of various proteins or physiologically active substances using the said expression system.

The present inventor has intensively studied to solve the above problems. As a result, it was found that Pseudomonas chlororaphis B23 strain has an expression regulatory factor involved in nitrile metabolism, and the present invention has been completed.
That is, the present invention is as follows.

(1) A gene encoding the following protein (a) or (b).
(a) a protein comprising the amino acid sequence represented by SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having an activity of regulating gene expression (2) Or a gene containing the DNA of (b).
(a) DNA containing the base sequence represented by SEQ ID NO: 1
(b) a DNA that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 1 and encodes a protein having a gene expression regulating activity

  According to the present invention, it has been revealed that a nitrile metabolism expression regulator derived from Pseudomonas bacteria regulates the expression of various enzyme genes involved in the nitrile metabolism pathway. Since this expression regulatory factor can be used as a high expression system for the target gene, it can be applied to various microorganisms widely used industrially as producing bacteria for various useful substances. Furthermore, the expression system of the present invention enables a large-scale expression system of useful proteins other than nitrile hydratase, and can be used in various fields where production of antibiotics or physiologically active substances or production of useful enzymes is essential. Very useful.

Hereinafter, the present invention will be described in detail.
The present invention relates to the NhpR gene (nhpR) that regulates the expression of the nitrile metabolic pathway of Pseudomonas chlororaphis strain B23. Aldoxime dehydratase gene and its downstream gene are expressed by NhpR, which is an expression product of NhpR gene, and the nitrile metabolic pathway functions (FIG. 1).
The present invention produces a target gene (structural gene) by preparing a construct comprising a NhpR gene and a promoter controlled by the NhpR gene, or a gene expression cassette in which the target protein gene is linked to the construct and introducing it into a host bacterium. ) Is capable of producing the expressed substance with extremely high efficiency.
In the B23 strain used in the present invention, nitrile hydratase (NHase) expresses 50% of the total soluble protein by using amide as an inducer. The present inventor paid attention to this point, and carried out diligent studies on the assumption that a very strong inducible promoter exists in the B23 strain. And when the inducer and various enzyme activities were measured, it was found that induction was caused by the reaction product of the enzyme.
In general, induction is performed with a substrate, but an inducible promoter that is induced with a product has not been known so far. In other general inducible promoter systems, the added inducer is also used as a substrate, so the effective inducer concentration decreases over time. However, using this system, the added inducer is degraded. Therefore, it is practical because the effective duration is kept long.
In the present invention, non-toxic and inexpensive amide can be used as an inducer, so that it can be applied to heterogeneous protein production and useful substance production. Furthermore, the NhpR gene results in an expression level that accounts for 50% of the total soluble protein despite being one copy on the chromosome. This expression system surpasses the large amount of expression reported so far, and the inducible high expression system of the present invention can be expected to contribute as a tool such as lac, tac promoter and T7 expression system in Escherichia coli. .

1. Production of NhpR gene
The NhpR gene can be obtained by a chemical synthesis method, a PCR method, a gene walking method, a hybridization method using a gene fragment having the base sequence as a probe, or the like. In the present invention, cloning can be performed by collecting genomic DNA from the B23 strain and obtaining the upstream of the Aldoxime dehydratase gene by walking (chromosome walking).
The techniques of chemical synthesis, chromosome walking, PCR, and hybridization are well known in the art, and reagents, conditions, etc. to be used can be appropriately set by those skilled in the art, and commercially available kits are used. You can also.
The base sequence of the NhpR gene responsible for the expression regulation mechanism of the nitrile metabolic pathway is shown in SEQ ID NO: 1, and the amino acid sequence encoded by SEQ ID NO: 1 is shown in SEQ ID NO: 2.
In the present invention, in addition to the amino acid sequence shown in SEQ ID NO: 2, one or several (for example, about 1 to 10, preferably about 1 to 5) amino acids are deleted, substituted or substituted in the amino acid sequence. A protein containing the added amino acid sequence and having NhpR activity (mutant NhpR) is also included in the present invention. In addition to DNA containing the base sequence shown in SEQ ID NO: 1, a gene containing DNA that hybridizes with a base sequence complementary to the base sequence under stringent conditions and encodes a protein having NhpR activity (Mutant NhpR gene) is also included in the present invention. Here, “stringent conditions” means washing conditions after hybridization, for example, the salt (sodium) concentration is 150 to 900 mM, the temperature is 55 to 75 ° C., preferably the salt concentration is The condition is 600 to 900 mM and the temperature is 60 to 70 ° C.
NhpR activity refers to the activity of positively regulating the gene group constituting the NHase gene cluster and NitR itself.

2. Preparation of DNA construct for expression
(1) Promoter The present invention relates to a DNA construct comprising a NhpR gene and a promoter controlled by the gene. The present invention also relates to a gene expression cassette in which a gene encoding a protein contained in the NHase gene cluster and / or a target gene for expression are linked to the DNA construct.

The NHase gene cluster means a plurality of gene groups whose expression is regulated by a promoter controlled by NhpR, and there are three types of clusters depending on the type of gene contained in the cluster and the transcription start point.
That is, the NHase gene cluster includes a gene encoding NhpR (nhpR), a gene encoding aldoxime dehydratase (oxdA), a gene encoding amidase (amiA), nitrile hydratase (NHaseα and β ) Encoding genes (nhpA and nhpB, respectively), a gene encoding a protein with unknown function (nhpC), a gene encoding a protein with unknown function (nhpS), and a gene encoding an acyl CoA synthase (acsA), There are three transcription initiation sites upstream of oxdA, upstream of nhpA and upstream of acsA (FIG. 2). There are three transcription units from oxdA to nhpC (oxdA-nhpC), nhpA to nhpC (nhpA-nhpC), and nhpS to acsA (nhpS-acsA) ((1) to (3) in FIG. 2). Arrow). In addition, NhpR promotes transcription from oxdA to acsA and nhpR itself.
The DNA construct of the present invention utilizes the NhpR expression regulatory mechanism. This NhpR expression regulation mechanism can be considered to be a mechanism in which the transcription start site encoded in the upstream region of the gene to be expressed controls the expression of the transcription activation protein gene existing downstream thereof (FIG. 2).
In the present invention, among these NHase expression regulation mechanisms, the NhpR gene, the following promoters, and protein genes that are transcriptionally regulated thereby are used to construct an inducible high expression system model.

The promoters 1-3 controlled by the NhpR gene and gene clusters transcribed by these promoters are shown below.
(i) Promoter 1
Location: upstream of oxdA Transcriptionally regulated gene cluster: oxdA, amiA, nhpA, nhpB and nhpC (oxdA-nhpC)
(ii) Promoter 2
Location: Upstream of nhpA Gene clusters that regulate transcription: nhpA, nhpB, and nhpC (nhpA-nhpC)
(iii) Promoter 3
Location: upstream of nhpS Gene cluster that regulates transcription: nhpS and acsA (nhpS-acsA)

  The promoter that can be used in the present invention can be excised from a bacterial cell carrying the NHase gene using a restriction enzyme, but a convenient restriction enzyme site is not always present for excision. Therefore, by designing a primer with an appropriate restriction enzyme recognition site and amplifying by PCR using the desired promoter region in the upstream region of the NHase structural gene as a template, a DNA fragment of the promoter region that can be used in the present invention is obtained. Can be obtained. It is also possible to chemically synthesize based on the promoter base sequence information found in the present invention.

Here, the “promoter activity” means an activity in which a transcription factor binds to the promoter region of the present invention and induces transcription. For example, the promoter activity of promoter 1 means the activity that regulates transcription of oxdA-nhpC, the promoter activity of promoter 2 means the activity that regulates transcription of nhpA-nhpC, and the promoter activity of promoter 3 means nhpS -Activity that regulates transcription of acsA.
The “stringent conditions” mean washing conditions after hybridization, for example, a salt (sodium) concentration of 150 to 900 mM, a temperature of 55 to 75 ° C., and preferably a salt concentration of 600. -900 mM, and refers to conditions at a temperature of 60-70 ° C.

The introduction of the mutation into the promoter is carried out by a known method such as the Kunkel method or the Gapped duplex method using a site-directed mutagenesis kit such as the TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-K Super Express Km etc. (manufactured by Takara Bio Inc.), QuikChange ^™ Site-Directed Mutagenesis Kit (manufactured by Stratagene), GeneTailor ^™ Site-Directed Mutagenesis System (manufactured by Invitrogen) and the like.

(2) Regulatory protein gene In the present invention, the oxdA gene, nhpA gene, nhpB gene, nhpC gene, nhpS gene, and acsA gene can be excised from the bacterial cells carrying the NHase gene using restriction enzymes. However, there are not always convenient restriction enzyme sites for excision. Thus, a DNA fragment of the gene can be obtained by amplifying a desired gene region by PCR using a primer provided with a restriction enzyme recognition site. It is also possible to chemically synthesize the gene based on the already known base sequence information.

Table 1 shows the base sequence of the gene used in the present invention and the amino acid sequence encoded by the base sequence.

  In the present invention, mutants of genes shown in Table 1 (mutant genes) can also be used. A mutant gene can be prepared by a method similar to the method for introducing a mutation into a promoter.

The mutant form of the gene includes any of the following (a) to (c).
(a) consisting of an amino acid sequence in which one or several (for example, about 1 to 10, preferably about 1 to 5) amino acids have been deleted, substituted or added in the amino acid sequence shown in Table 1, and , Genes encoding proteins with their respective activities
(b) A mutant gene in which one or several (for example, about 1 to 10, preferably about 1 to 5) of base sequences of the genes shown in Table 1 have been deleted, substituted or added. A gene encoding a protein having each activity
(c) It hybridizes under stringent conditions with the base sequence of the gene shown in Table 1 or the base sequence of the gene of the above (a) or (b) and has each activity. Here, the activity of each protein is as follows.
OxdA: Aldoxime dehydratase activity
NhpA: α subunit constituting NHase
NhpB: β subunit constituting NHase
NhpC: Function unknown
NhpS: Function unknown
AcsA: Acyl CoA synthase activity

  The “stringent conditions” mean washing conditions after hybridization, for example, a salt (sodium) concentration of 150 to 900 mM, a temperature of 55 to 75 ° C., and preferably a salt concentration of 600. -900 mM, and refers to conditions at a temperature of 60-70 ° C.

  The introduction of the mutation into the gene can be carried out using a mutation introduction kit using site-directed mutagenesis as in the method described in the section of the promoter.

  In the DNA construct of the present invention, a cis element such as an enhancer, a splicing signal, a selection marker, a terminator and the like can be linked as desired.

  In addition, a terminator other than the terminator of (5) above may be linked to the DNA construct of the present invention, and the terminator region is preferably present, for example, upstream of the H-NHase gene promoter.

3. Expression of target structural gene
(1) Production of recombinant expression vector The recombinant expression vector of the present invention functionally contains the DNA construct of the present invention in a vector DNA. Here, “functionally” means that the DNA construct of the present invention is expressed or functioned, and means a state in which each gene can be expressed when introduced into a host described below.

  The order in which the DNA construct of the present invention is ligated and inserted into the vector DNA is not limited as long as it is the above “functional” (as long as the transcription direction is taken into consideration). It is preferable that they are linked in the order of the target gene for expression.

  It is also possible to prepare a gene expression cassette in which a promoter and a terminator are linked in advance to a gene to be expressed (target gene), and to incorporate this into a vector.

  The recombinant expression vector of the present invention is required to be retained in a host cell and participate in autonomous replication in the host cell. Therefore, the recombinant expression vector of the present invention is a vector functionally containing the DNA construct of the present invention and DNA involved in autonomous replication in the host cell. However, when used as an integration vector, it can also be a vector that does not participate in autonomous replication in the host cell.

  Here, “involved in autonomous replication” means that it participates in a function that controls autonomous replication in the host cell, and this autonomous replication is performed by a sequence including an origin of replication.

  Examples of the vector involved in the autonomous replication include plasmid DNA, virus, bacteriophage, bacterial chromosome and the like. In addition, as a recombinant DNA fragment for expression to be introduced by genome integration, it is also possible to use those produced by PCR or chemical synthesis.

  Examples of plasmid DNA include actinomycete-derived plasmids (for example, pIJ486), E. coli-derived plasmids (ColE-based plasmids such as pBR322, pUC18, pUC19, pUC118, pUC119, and pBluescript), yeast-derived plasmids (for example, YEp13, YEp24, YCp50) and the like, and examples of phage DNA include λ phage (Charon4A, Charon21A, EMBL3, EMBL4, λgt10, λgt11) and the like.

  In addition, the expression vector of the present invention can function as an expression vector stable in a desired host. A gene construct containing the NhpR gene and the above promoter can be incorporated into the host, and the target gene present in the host can be expressed by the expression control function of the construct. For example, when a construct of the NhpR gene and the promoter 1 is introduced into a host, transcriptional activity of gene clusters of oxdA, amiA, nhpA, nhpB and nhpC in the host can be generated. In addition, when a construct of the NhpR gene and the promoter 3 is introduced into the host, transcriptional activity of the nhpS and acsA gene clusters in the host can be generated. Combining promoter 1 and promoter 3 can produce transcriptional activity of all gene clusters shown in FIG. 2 in the host.

(2) Target Structural Gene In the present invention, a structural gene for expression (target gene) can be incorporated into a multicloning site (MCS) of a desired plasmid and used.

  The target gene can be arbitrarily selected from animal-derived genes, plant-derived genes, microorganism-derived genes, and the like, and is not limited. Specifically, nitrilase gene, aldoxime dehydratase gene, nitrile hydratase gene, isonitrile hydratase gene, catechol 2,3-dioxygenase gene, N-substituted formamide degrading enzyme gene, amidase gene, β-galactosidase gene and cholesterol oxidase gene Etc. can be preferably exemplified. Hereinafter, the case where the nitrile hydratase (NHase) gene and the nitrilase gene are structural genes will be described as an example.

(i) NHase gene In the present invention, a bacterium having an NHase structural gene to be expressed is a bacterium having nitrile hydratase enzyme activity and capable of producing a corresponding amide compound by hydrating a nitrile compound. There is no particular limitation as long as it is present. For example, the following microorganisms can be mentioned as suitable examples.

Pseudomonas chlororaphis B23 Nocardia sp. N-775 (Japanese Patent Publication No. 56-17918)
Rhodococcus rhodochrous J-1 (No. 06-55148)
Klebsiella sp. MCI2609 (Japanese Patent Laid-Open No. 05-30982)
Aeromonas sp. MCI2614 (Japanese Patent Laid-Open No. 05-30983)
Citrobacter freundii MCI2615 (JP 05-30984)
Agrobacterium rhizogenes IAM13570 and Agrobacterium tumefaciens (Japanese Patent Laid-Open No. 05-103681)
Xanthobacter flavas JCM1204 (Japanese Patent Laid-Open No. 05-161495)
Erwinia nigrifluens MAFF03-01435
Enterobacter sp. MCI2707 (Japanese Patent Laid-Open No. 05-236975)
Streptomyces sp. MCI2691 (Japanese Patent Laid-Open No. 05-236976)
Rhizobium sp. MCI2610, Rhizobium spi MCI2643, Rhizobium loti IAM13588, Rhizobium legminosarum IAM12609 and Rhizobium12611

Candida guilliermondii NH-2, Pantoea agglomerans NH-3 and Klebsiella pneumoniae subsp. Pneumoniae NH-26T2 (JP 05-15384) issue)
Agrobacterium radiobacter SC-C15-1 (Japanese Patent Laid-Open No. 06-14786)
Bacillus smithii SC-J05-1 (JP 07-25494)
Pseudonocardia thermophila ATCC 19285 (JP 08-56684)
Pseudonocardia thermophila JCM3095 (JP 09-275978)

  Cloning of the NHase gene from the cells can be obtained by any known method (Sabrook J., Molecular Cloning, CSHL Press (2001), Methods in Enzymology 194 (1991)). The amino acid sequence of NHase and the nucleotide sequence of the gene encoding NHase are described in, for example, J. Bacteriol. 173 (8), 2465-2472 (1991).

  In the present invention, it is also possible to use a mutant (mutant gene) of the NHase gene. Furthermore, by constructing a vector containing a fusion gene of the NHase gene or a variant thereof and another gene or a variant thereof, the polypeptide produced by the expression of the NHase gene and the other gene may become a fusion protein. In addition, both genes can be combined. In the present invention, such a gene constructed by linking two or more kinds of genes so that the expression product becomes a fusion protein is referred to as a “fusion gene”. To create a fusion gene, one DNA is cleaved with an appropriate restriction enzyme, and the other DNA that has been cleaved with the same restriction enzyme is not misaligned in the reading frame of the amino acid sequence of the encoded protein. A method of connecting them is adopted.

The mutant form of the NHase gene includes any of the following (a) to (c).
(a) It consists of an amino acid sequence in which one or several (for example, about 1 to 10, preferably about 1 to 5) amino acids are deleted, substituted or added in the amino acid sequence of NHase, and nitrile Gene encoding a protein having hydratase enzyme activity (NHase activity)
(b) A mutant gene in which one or several (for example, about 1 to 10, preferably about 1 to 5) bases are deleted, substituted, or added in the NHase gene base sequence. Gene encoding a protein having activity

(c) A gene that hybridizes with a base sequence complementary to the base sequence of the NHase gene under a stringent condition and encodes a protein having NHase activity. Means washing conditions after soy, for example, salt (sodium) concentration is 150-900 mM, temperature is 55-75 ° C., preferably salt concentration is 600-900 mM, temperature is 60-70 ° C. The condition of. The “NHase activity” means an activity that catalyzes a reaction of hydrating a nitrile to produce an amide (the following formula I).
R-CN + H ₂ O → R-CONH ₂ (I)
The NHase activity can be measured by quantifying the amide produced by reacting with nitrile as a substrate (in the case of NHase B23, the amount of propioamide produced by reacting with propionitrile as a substrate).

(ii) Nitrilase Gene The nitrilase structural gene can be obtained from a bacterium having nitrilase enzyme activity and capable of hydrolyzing a nitrile compound to produce the corresponding organic acid and ammonia. Preferred examples of the bacterium having a nitrilase structural gene include the following microorganisms.

Rhodococcus rhodochrous J1
Rhodococcus rhodochrous NCIMB40757 (Special Publication 2000-501610)
Rhodococcus rhodochrous NCIMB40833 (Special Publication 2000-501610)
Corynebacterium sp. KO-2-4 strain (Japanese Patent Publication No. 2002-527106)
Alkali Genes Fecaris 1650 (Japanese Patent Publication No. 2002-527106)
Acinetobacter sp. AK226 (FERM P-08271) (JP 2005-176639)
Earth Lobacter SP NSSC104 [FERM BP-5829] (JP 2003-274933)
Earth Lobacter SP NSSC204 [FERM BP-7662] (JP 2003-274933)
Escherichia coli (Special Table 2005-509407)
Pseudomonas fluorescens (Special Table 2005-509407)
Streptomyces diversa (Special Table 2005-509407)
Lactobacillus gasseri (Special Table 2005-509407)
Lactococcus lactis (Special Table 2005-509407)
Lactococcus cremoris (Special Table 2005-509407)
Bacillus subtilis (Special Table 2005-509407)
Saccharomyces cerevisiae (Special Table 2005-509407)
Schizosaccharomyces pombe (Special Table 2005-509407)
Pichia pastoris (Special Table 2005-509407)
Kluyveromyces lactis (Special Table 2005-509407)
Hansenula plymorpha (Special Table 2005-509407)
Aspergillus niger (Special Table 2005-509407)
Cloning of the nitrilase gene from the various microorganisms described above can be performed by any known technique (Sambrook J., Molecular Cloning, CSHL Press (2001), Methods in Enzymology 194 (1991)). The nucleotide sequence of the structural gene of nitrilase and the amino acid sequence of nitrilase are described, for example, in J. Biol. Chem. 267 (29), 20746-20751 (1992).

  In the present invention, it is also possible to use a nitrilase gene mutant (mutant gene). In addition, a vector containing a fusion gene of the nitrilase gene or a variant thereof and another gene or a variant thereof is constructed so that the polypeptide produced by the expression of the nitrilase gene and the other gene becomes a fusion protein. In addition, both genes can be combined. In the present invention, such a gene constructed by linking two or more kinds of genes so that the expression product becomes a fusion protein is referred to as a “fusion gene”. To create a fusion gene, one DNA is cleaved with an appropriate restriction enzyme, and the other DNA that has been cleaved with the same restriction enzyme is not misaligned in the reading frame of the amino acid sequence of the encoded protein. A method of connecting them is adopted.

The mutant form of the nitrilase gene includes any of the following (a) to (c).
(a) It consists of an amino acid sequence in which one or several (for example, about 1 to 10, preferably about 1 to 5) amino acids have been deleted, substituted or added in the amino acid sequence of nitrilase, and nitrilase Genes encoding proteins with enzymatic activity
(b) A mutant gene in which one or several (for example, about 1 to 10, preferably about 1 to 5) bases are deleted, substituted or added in the nitrilase gene base sequence, and nitrilase Gene encoding a protein having activity
(c) A protein that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence of the nitrilase gene or the gene sequence of (a) or (b) above and encodes a protein having nitrilase activity. Gene Here, “stringent conditions” means washing conditions after hybridization, for example, salt (sodium) concentration is 150-900 mM, temperature is 55-75 ° C., preferably salt concentration Is 600 to 900 mM, and the temperature is 60 to 70 ° C.

  The “nitrilase activity” means an activity of catalyzing a reaction (the following formula (II)) in which a nitrile group is hydrolyzed to generate carboxylic acid and ammonia.

R-CN + 2H ₂ O → R-COOH + NH ₃ (II)
The catalytic activity can be measured by quantifying benzoic acid produced by reacting benzonitrile as a substrate.

(3) Transformation Introduction (transformation) of an expression vector into a host can be performed by a known method. In addition, confirmation that the vector DNA has been introduced into the host can be performed using a selectable marker gene (eg, ampicillin resistance gene, tetracycline resistance gene, chloramphenicol resistance gene, kanamycin resistance gene, etc.).

  The host used in the present invention is preferably a gram-negative bacterium. Examples of Gram-negative bacteria include Escherichia coli, Pseudomonas, and Agrobacterium, and Gram-negative belonging to Pseudomonas is preferred.

Any technique well known to those skilled in the art can be used to incorporate the expression vector into the host.
The method for introducing the recombinant vector into the host is not particularly limited, and examples thereof include a method using calcium ions and an electroporation method.

4). Production of gene expression product In the present invention, a target protein (such as NHase) or a mutant thereof as an expression product is obtained by culturing a transformant in which a target gene or a mutant gene thereof has been introduced into a host and collecting it from the culture. Can be obtained. “Culture” means any of culture supernatant, cultured cells, cultured cells, or disrupted cells or cells. The method for culturing the transformant of the present invention can be carried out according to a usual method used for culturing a host. Expression products such as NHase accumulate in the culture.

  The medium for culturing the transformant of the present invention contains a carbon source, a nitrogen source, inorganic salts, and the like that can be assimilated by the host fungus, and any natural medium can be used as long as the transformant can be cultured efficiently. Either a medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, galactose, fructose, sucrose, raffinose and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonium salts of inorganic acids or organic acids such as ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate, and other nitrogen-containing compounds. In addition, peptone, meat extract, corn steep liquor, various amino acids, and the like may be used. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.

The culture is usually performed at 10 ° C. to 40 ° C., preferably 28 ° C. for 12 to 120 hours under aerobic conditions such as shaking culture or aeration and agitation culture. The pH is adjusted using an inorganic or organic acid, an alkaline solution, or the like.
When cultured under the above culture conditions, an expression product of the target gene can be produced in high yield.

  When the expression product of the target gene is produced in cells or cells after culturing, the expression product can be collected by crushing the cells or cells by applying a homogenizer treatment or the like. On the other hand, when the target gene expression product is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Thereafter, the expression product is collected from the culture by extraction with ammonium sulfate precipitation or the like, and if necessary, further isolated and purified using various chromatography or the like.

  In the present invention, it is also possible to employ a cell-free protein synthesis method in which the reaction proceeds in an artificial container without using any living cells.

  The genetic information encoded on the DNA is converted into mRNA by transcription, and further translated into protein. In order to synthesize proteins by reproducing this transcription / translation process in an artificial container, a system that stabilizes translation factors such as ribosomes, tRNAs, and various protein factors, and constructs a system that produces mRNA according to the purpose. is necessary. In order to construct this system, for example, wheat germ can be selected in the present invention. Wheat germ is preferred in that a group of translation factors for germination of seeds for protein synthesis is preserved.

Cell-free protein synthesis can also be performed using a commercially available kit. Examples of such a kit include a reagent kit PROTEIOS ^™ (Toyobo), a synthesizer PG-Mate ^™ (Toyobo), and the like.

Confirmation that the gene expression product has been isolated and purified can be performed, for example, by SDS-PAGE, and the activity can be measured, for example, by HPLC.
Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

Cloning of NhpR Southern hybridization was carried out on the chromosomal DNA of B23 using the SphI-PstI fragment (0.15-kb) located at the most upstream of the NHase gene cluster of the cloned B23. As a result, a signal was obtained for the 5.2-kb PstI fragment. Therefore, after chromosomal DNA of B23 was treated with PstI, a 5.2-kb fragment was recovered and ligated to pUC18 cleaved with PstI to transform Escherichia coli DH10B. Colony Southern hybridization was performed using the SphI-PstI fragment (0.15-kb) as a probe, and the transformant from which a signal was obtained was designated as pPCN11. The nucleotide sequence was determined by primer walking. As a result, the NhpR gene was found to have the base sequence shown in SEQ ID NO: 1. The amino acid sequence encoded by the base sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 2.

NhpR features
(1) Homology search
In order to estimate the function of NhpR, the homology of amino acid sequences was examined. The homology search was performed by BLAST search.
As a result, nitR which regulates transcription of nitrilase of Rhodococcus rhodochrous J1 and 26%, cadR which is a protein regulating the transcription of 2,4 dichlorophenoxyacetic acid possessed by Bradyrhizobium sp. Strain HW13, 22%, Pseudomonas It was found to have 23% homology with XylS1, which regulates the transcription of putida MT53, a gene that degrades toluene and xylene.

(2) Preparation of orfR deletion mutant strain Next, an nhpR deletion mutant strain in which nhpR on the chromosome of B23 was deleted was prepared.
Deletion mutants were prepared as follows.
A HindIII-XhoI fragment (2.9-kb) containing the nhpR gene was introduced into the HindIII and SalI sites of pSTV29 that was resistant to chloramphenicol and did not replicate in B23. Separately, the kanamycin resistance gene was amplified by PCR using pUC-4K as a template. Since this kanamycin resistance gene retains HindIII and XhoI, the following primers were used, and the amino acid sequence of the kanamycin resistance enzyme was not changed and was amplified by PCR as DNA not retaining HindIII and XhoI.
Km-F: 5'-ATCGGTGCGGGCCTCTTCGC-3 '(SEQ ID NO: 15)
Km-R: 5'-CGAGTGAGTAATCCGTGGGGT-3 '(SEQ ID NO: 16)
HindIII-F: 5'-TCCGGTGAGAATGGCAACAGTTTATGCATT-3 '(SEQ ID NO: 17)
HindIII-R: 5'-TCTGGAAAGAAATGCATAAACTGTTGCCAT-3 '(SEQ ID NO: 18)
XhoI-F: 5'-TGGAATTTAATCGCGGCCTGGAACAAGACG-3 '(SEQ ID NO: 19)
XhoI-R: 5'-CAACGGGAAACGTCTTGTTCCAGGCCGCGA-3 '(SEQ ID NO: 20)
The amplified DNA was treated with HincII and introduced into the BalI site on the nhpR gene linked to pSTV29. This plasmid was introduced into B23 by electroporation, and the transformant was streaked on a kanamycin-containing plate and a chloramphenicol-containing plate. Transformants exhibiting kanamycin resistance and chloramphenicol sensitivity were used as candidates, and double crossover was confirmed by PCR and Southern hybridization.

  As a result, by inserting the kanamycin resistance gene into nhpR, it was possible to produce a mutant in which nhpR cannot function completely (FIG. 3).

(3) Growth curve
In order to examine whether nhpR regulates the expression of the NHase gene cluster, this deletion mutant was used to compare growth with wild type (WT). The experiment was performed as follows.

As usual minimal medium, 1% _{sucrose, 0.5% (NH 4) 2} SO 4, 0.05% KH 2 PO 4, 0.05% K 2 HPO 4, 0.05% MgSO 4 · 7H 2 O and 0.001% FeSO ₄ · 7H A medium having a composition of ₂ O (pH 7.0) was used. Further, as the medium with different N sources methacrylamide, 1% sucrose, 0.5% _{methacrylamide, 0.05% KH 2 PO 4,} 0.05% K 2 HPO 4, 0.05% MgSO 4 · 7H 2 O and 0.001% FeSO ₄ A medium having a composition of 7H ₂ O (pH 7.0) was used. The deletion mutants and WT were inoculated into each medium and cultured at 28 ° C.

The results are shown in FIG.
In FIG. 4, the left figure is a normal minimal medium, but both WT and deletion mutants grow in the same manner. On the other hand, in the figure on the right side, WT grew on the medium in which the N source was changed to methacrylamide, whereas the deletion mutant strain hardly grew. In order to assimilate methacrylamide as an N source, it is necessary to express the NHase gene cluster gene. Therefore, it is thought that the NHase gene cluster gene is no longer expressed in the deletion mutants in which nhpR can no longer function.

(4) Activity measurement
In order to show more directly that the NHase gene cluster gene can no longer be expressed in deletion mutants of nhpR, the activities of two enzymes, aldoxime dehydratase and NHase, in the NHase gene cluster were examined. .

  Aldoxime dehydratase activity was measured by quantifying butyronitrile produced using butylaldoxime as a substrate under reduced conditions under anaerobic conditions. One unit of aldoxime dehydratase activity was defined as the amount of enzyme that produced 1 μmol of butyronitrile per minute. NHase activity was measured by quantifying butyramide produced using butyronitrile as a substrate. One unit of NHase activity was defined as the amount of enzyme that produced 1 μmol of butyramide per minute.

The results are shown in FIG.
In WT, aldoxime dehydratase and NHase were active when induced with methacrylamide, whereas deletion mutants showed no activity in aldoxime dehydratase and NHase even when induced with methacrylamide. . This indicates that the NHase gene cluster gene is not expressed unless nhpR functions, that is, nhpR has a function of promoting transcription of the NHase gene cluster.

RT-PCR
In this example, in order to examine how nhpR controls the transcription of the NHase gene cluster, first, the transcription unit of this cluster was examined by RT-PCR. The transcription unit means which gene in the cluster is connected to which gene (ie, forms an operon).
The design positions of the primers used in the RT reaction and PCR reaction are indicated by arrows in FIG. The base sequence of each primer is shown below.

RT1: 5′-GCGTGGGGCGTGCCGATAAG-3 ′ (SEQ ID NO: 21)
RT2: 5′-ACAGGCAGGCCTTGCGCATC-3 ′ (SEQ ID NO: 22)
RT3: 5'-TTGCGCAGAATGAACCGTTG-3 '(SEQ ID NO: 23)

PCR reaction forward primer (F1): 5'-CCCATGCATCGACAACGTTC-3 '(SEQ ID NO: 24)
Forward primer (F2): 5'-AAAATGGAAGCTACCGATAC-3 '(SEQ ID NO: 25)
Forward primer (F3): 5'-GCTTGCCGACAGACTGGACC-3 '(SEQ ID NO: 26)
Reverse primer (R1): 5'-ATAAGGCCTCGGTGTCAAAG-3 '(SEQ ID NO: 27)
Reverse primer (R2): 5'-TGGGCAGATGGTCGACAAAC-3 '(SEQ ID NO: 28)

RT reaction was performed on the following reaction conditions.
RT primer was mixed with total RNA, SuperScript III reverse transcriptase was added, and reacted at 50 ° C. for 200 minutes.
Moreover, PCR reaction was performed with the following reaction liquids and reaction cycles.
Primers were mixed with the sample after RT reaction, TaKaRa LA Taq was added, reacted at 94 ° C. for 1 minute, and reacted at 98 ° C. for 10 seconds at −68 ° C. for 15 minutes for 30 cycles.

The results are shown in FIG.
When reverse transcription reaction is performed with RT1 and PCR is performed with F1 and R1, a band of 5.8k appears if aldoximedehydratase and nhpC are connected and transcribed.
In lane 1 of FIG. 6, a 5.8k band appears, and thus it was found that five genes from Aldoximedehydratase to nhpC form an operon. On the other hand, when reverse transcription was performed with RT2 and PCR was performed with F1 and R1, no band appeared (lane 2).

  When reverse transcription was performed with RT3 and PCR was performed with F3 and R2, a 2.9k band was confirmed (lane 3), whereas when PCR was performed with F2 and R2, the band could be confirmed. None (lane 4). From this, it was found that the transcription of nhpS and acsA is connected, and the transcription is interrupted between nhpC and nhpS.

Identification of transcription start point In Example 3, when there is a transcription unit starting from amidase and ending with nhase β subunit, that is, a transcription unit overlapping with a transcription unit from Aldoxime dehydratase to nhpC, Example 3 RT-PCR cannot be grasped. Therefore, in this example, an experiment for identifying the transcription start point was performed using the primer extension method.

(1) Transfer start point 1
The experimental method of primer extension method is shown below.
Primer sequence used: 5'-TGTGCAAAGGCCAGGAAGCG-3 '(SEQ ID NO: 29)
T4 polynucleotide kinase was allowed to act on the primer in the presence of γ- [ ³² P] ATP, and the 5 ′ end of the primer was labeled with [ ³² P]. The extracted total RNA was mixed with the primer labeled with [ ³² P], and SuperScript III reverse transcriptase was added to carry out an extension reaction.

As a result, it was found that there is a transcription initiation site upstream of oxdA (FIG. 7). In the electrophoresis photograph of FIG. 7, lane 1 is the induction condition and lane 2 is the non-induction condition. When a band that can be seen only in lane 1 appears, it means that there is a transcription start point, and the position can be identified by referring to the DNA marker on the left side.
The transcription start site of oxdA was 233 bases upstream from the translation initiation codon, and a consensus sequence of -12, -24 recognized by sigma 54 was found in the upstream promoter region (FIG. 7).
The nucleotide sequences including the consensus sequences of -12 and -24 are shown below.
ACCCATCGCCGTTCCGCCTAGTTTTCACCTCACAGCAGCTCATCCCCGCACTGATGAGGCACCCCATGCATCGACAACGTTCACACCCCTTGCCGGACGCTTCCTGGCCTTTGCACACGC (SEQ ID NO: 30)
The sequence containing the SD sequence and oxdA is shown below.
TGAAAATAACGAGGAGCCCAAGATGGAATCTGC (SEQ ID NO: 31)
The σ54 consensus sequence is shown below.
TGGCACGnnnnTTGCA (SEQ ID NO: 32)
The sequence near the transcription start point 1 (sequence determined by electrophoresis) is shown below.
GCCTAGTTTTCACCTCAC (SEQ ID NO: 33)

In prokaryotes, the -10, -35 consensus sequence normally recognized by Sigma 70 is often found, but not in the promoter region of oxdA.

(2) Transfer start point 2
Furthermore, a transcription start site was also found upstream of the NHase α subunit gene (FIG. 8).
Primer sequence used: 5'-TCGAAGGTGTCGCAGTCGTG-3 '(SEQ ID NO: 34)
A transcription initiation site was present 34 bases upstream of the translation initiation codon, and a sequence homologous to the -12, -24 consensus sequence recognized by Sigma 54 was found (FIG. 8).
The -12, -24 consensus sequence recognized by Sigma 54, and the sequence including the SD sequence are shown below.
TTTTACAGGCGCCGCCCCCCCTGAAGAACGATAAGAAAGACCGGCAAGTTGCAATGACTTTTCAACCGCGTTGACTGATAGGAGTTACCCCATGAGTACATCTATTTCCACGACTGCGACACCTTCGACACCCGGCGAGA (SEQ ID NO: 35)
The sequence near the transcription start point 2 (sequence determined by electrophoresis) is shown below.
CGGCAAGTTGCAATGACT (SEQ ID NO: 36)

Neither the sequence of transcription start sites 1 and 2 is highly homologous to the sigma 54 consensus sequence. However, Sigma 54 is known to be involved in the transcription of genes required for metabolizing compounds required as N sources. In addition, methacrylamide added to the medium as an inducer is metabolized as an N source. For this reason, it seems reasonable to find a sequence homologous to the sigma 54 consensus sequence in the promoter region of oxdA and NHase inducibly expressed by methacrylamide.

(3) Transfer start point 3
Primer sequence used: 5'-AGTCGCCGACAACGCTGTCC-3 '(SEQ ID NO: 37)
It was found that there is also a transcription start site upstream of nhpS (FIG. 9). A transcription start site was located 276 bases upstream from the translation initiation codon of nhpS, and a sequence homologous to the -12, -24 consensus sequence recognized by Sigma 54 was found upstream (FIG. 9).
The sequences containing the -12, -24 consensus sequences recognized by Sigma 54 are shown below.
GAACTTCATCGAGCCATCGCAATGGCCGCGGGACGAATATCGGTTGCAGGGCATCATGGCCAAGTGGGACAGCGTTGTCGGCGACTGCCGACAGGAGCTGGTCTTCATCGGCCAGGGGCTCGACACCCGCGTCTTGCAGCGCGAACTCGACCATTGTTTG (SEQ ID NO: 38)
The sequence around the transcription start point 3 (sequence determined by electrophoresis) is shown below.
TCGAGCCATCGCAATGGCC (SEQ ID NO: 39)

Analysis of transcription model The transcription model shown in FIG. 2 can be considered from the results of the above examples (RT-PCR and primer extension). In this model, there are three transcription units, oxdA to nhpC, nhpA to nhpC, and nhpS to acsA, respectively.
Therefore, in this example, real-time PCR was performed in order to determine which mRNA of these transcription units is promoting transcription by nhpR.
The experimental method of real-time PCR is shown below.
Total RNA was mixed with random hexamer as a primer, SuperScript III reverse transcriptase was added, and reverse transcription was performed at 50 ° C. for 50 minutes.
Mix each primer to the sample after reverse transcription, add SYBR Premix EX Taq, and react for 10 seconds at 95 ° C using Thermal Cycler Dice Real Time System, then 5 seconds at 95 ° C and 30 seconds at -60 ° C. The second was allowed to react for 45 cycles.
In order to examine the transcription of nhpR, the following primers were used.
nhpR-F: 5'-ACGAGAAGGTCGAGCAAAGC-3 '(SEQ ID NO: 40)
nhpR-R: 5'-ACACGGCAATGGTCCTCGAC-3 '(SEQ ID NO: 41)
In order to examine the transcription of oxdA, the following primers were used.
oxdA-F: 5'-ACGCATCTCAAATGCCCACG-3 '(SEQ ID NO: 42)
oxdA-R: 5'-TACTGCACGCCGAGATAACC-3 '(SEQ ID NO: 43)
In order to examine the transcription of amiA, the following primers were used.
amiA-F: 5'-ACAGGACATCACCGGGCATC-3 '(SEQ ID NO: 44)
amiA-R: 5'-GTCCACCGAGGCTTCAAACG-3 '(SEQ ID NO: 45)
The following primers were used to examine nhpA transcription.
nhpA-F: 5'-TCAAGAGCAAGGAACTCATC-3 '(SEQ ID NO: 46)
nhpA-R: 5'-TTCCGTCCTTGAGCAGCAGC-3 '(SEQ ID NO: 47)
In order to examine the transcription of nhpB, the following primers were used.
nhpB-F: 5'-TGCACCGCACCTCAGAGCAG-3 '(SEQ ID NO: 48)
nhpB-R: 5'-CGTCACCCCATAGATCTTTC-3 '(SEQ ID NO: 49)
The following primers were used to examine nhpC transcription.
nhpC-F: 5'-GGACGAATATCGGTTGCAGG-3 '(SEQ ID NO: 50)
nhpC-R: 5'-GCACTCAGCAAACAATGGTC-3 '(SEQ ID NO: 51)
In order to examine nhpS transcription, the following primers were used.
nhpS-F: 5'-GACACAGGAAGTCACCCAAC-3 '(SEQ ID NO: 52)
nhpS-R: 5'-GCAGCGGTTCCATTCACCTC-3 '(SEQ ID NO: 53)
In order to examine the transcription of acsA, the following primers were used.
acsA-F: 5'-GATTATCTGCAGAGCGCCAC-3 '(SEQ ID NO: 54)
acsA-R: 5'-CATGGCCATCCTGCGCTTCG-3 '(SEQ ID NO: 55)
Ribosomal rpsL gene mRNA was used as an internal standard with a constant expression level, and the mRNA level of each gene was compared as a relative value of the internal standard gene.
In order to examine the transcription of rpsL, the following primers were used.
rpsL-F: 5'-AAACCGTTGGTCAGACGCAC-3 '(SEQ ID NO: 56)
rpsL-R: 5'-ACGTCGTGGCGTATGCACTC-3 '(SEQ ID NO: 57)
The results are shown below.

(1) Real-time PCR (Figure 10)
Real-time PCR was used to compare mRNA levels of nhpR deletion mutants under the conditions of induction and non-induction with methacrylamide, and further with and without WT.
It was found that in all cases of oxdA, amidase nhpA, nhpB, nhpC nhpS, and acsA, transcription of mRNA was promoted only under WT induction conditions. In addition, when the mRNA amount of nhpR was examined, it was found that it was inducibly expressed by methacrylamide.
(2) Transcription model (Figure 2)
Real-time PCR results show that NhpR promotes transcription of all genes in the cluster from oxdA to acsA in the presence of methacrylamide.
Since there are three promoter regions in this cluster, upstream of oxdA, upstream of nhpA, and upstream of nhpS, nhpR is considered to act on these three promoter regions to promote transcription. Moreover, since the transcription of nhpR itself is also promoted in the presence of methacrylamide, it is considered that nhpR itself promotes the transcription of nhpR.

In B23 bacteria, it is known that NHase is expressed by 50% or more of the soluble classification of bacteria by adding methacrylamide in the medium. In the model found in the present invention, since there is a promoter immediately upstream of nhpA, it is considered that transcription from this promoter may be very strong. Therefore, in this example, in order to examine this possibility, an experiment was performed in which the amount of mRNA transcribed from nhpA was compared with the amount of mRNA transcribed from oxdA.
The experimental method is shown below.
Total RNA was mixed with nhpC-R as a primer, SuperScript III reverse transcriptase was added, and reverse transcription was performed at 50 ° C. for 200 minutes.
Mix each primer to the sample after reverse transcription, add SYBR Premix EX Taq, and react for 10 seconds at 95 ° C using Thermal Cycler Dice Real Time System, then 5 seconds at 95 ° C and 30 seconds at -60 ° C. The second was allowed to react for 45 cycles.
To examine the transcription of oxdA, oxdA-F and oxdA-R were used.
In order to examine the transcription of amiA, the following primers were used.
amiA2-F: 5'-TACCCTCGACCAGGTTTTAG-3 '(SEQ ID NO: 58)
amiA2-R: 5'-TAGGCGTCGAAACTCGGTTG-3 '(SEQ ID NO: 59)
nhpA-F and nhpA-R were used to examine nhpA transcription.
The results are shown in FIG.
Real-time PCR was used to compare the amounts of oxdA, amidase, and nhpA mRNA upon induction with methacrylamide.
The amount of mRNA of oxdA and amidase reflects the amount of mRNA transcribed from upstream of oxdA, and the amount of mRNA of nhpA reflects the amount of mRNA that combines transcription from upstream of oxdA and transcription from nhpA.
As a result of the experiment, the mRNA amount of nhpA was about 3 times that of oxdA and amidase. From this, it is considered that the amount ratio of mRNA transcribed from upstream of oxdA and mRNA transcribed from upstream of nhpA is 1: 2.

It is a figure which shows the nitrile metabolic pathway of Pseudomonas chlororafis B23 strain | stump | stock. It is a figure which shows the transcription | transfer model of NHase gene cluster. It is a figure which shows the outline | summary of preparation of a nhpR deletion mutant. It is a figure which shows the survival curve in a B23 wild type strain and a nhpR deletion mutant. It is the figure which compared the activity of oxdA and NHase in a B23 wild strain and a nhpR deletion mutant. It is a figure which shows the analysis result of the transcription | transfer unit by RT-PCR. It is a figure which shows that the transcription | transfer start point exists upstream of oxdA. It is a figure which shows that a transcription | transfer start point exists upstream of a NHase alpha subunit gene. It is a figure which shows that a transcription | transfer start point exists upstream of a nhpS gene. It is a figure which shows the result of the comparison experiment of each mRNA amount by real-time PCR. It is a figure which shows the result of the comparison experiment of each mRNA amount by real-time PCR.

Sequence number 15-59: Synthetic DNA
Sequence number 32: n represents a, g, c, or t (location 8-11).

Claims (2)

A gene encoding the following protein (a) or (b).
(a) a protein comprising the amino acid sequence represented by SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and which promotes the expression of a gene present in the NHase gene cluster A gene comprising the following DNA (a) :
(a) DNA containing the base sequence represented by SEQ ID NO: 1