JP5115954B2 - Functional magnetic bacteria - Google Patents

Description

The present invention relates to a functional magnetic bacterium. More specifically, the present invention relates to a functional magnetic bacterium having an excellent heavy metal recovery capability. The present invention also relates to a method for recovering heavy metals using the functional magnetic bacteria.

In recent years, so-called cell display technology has been proposed as a method for producing functional microorganisms. For example, it is possible to give a function to a microorganism by displaying a metal-binding peptide, an enzyme, an antigen and the like on the cell surface layer.

Phage display method, which is one of cell display technologies, is a method for specifying a DNA sequence encoding a peptide to be screened by specific physical association with a target molecule. This phage displays peptides and proteins on the protein on the capsid enclosing the phage genome (for example, Patent Document 1).

As a mini cell display method, a method of screening a target substance using a peptide display library using a mini cell display encoded by a plasmid or an expression vector is disclosed (for example, Patent Document 2). In the above display method, a minicell display library for peptides having desired functional properties and binding properties can be prepared, and the target oligonucleotide or peptide can be selected.

In addition, as an enzyme display method, for example, a genetic method for binding a polypeptide to a cell wall of a yeast cell in a form accessible to a protein-protein bond is disclosed. Specifically, a method of genetically binding a target polypeptide to the C-terminus of yeast Aga2P cell wall protein is disclosed (for example, Patent Document 3). It is described that proteins having phenotypic characteristics can be identified by these genetic joining methods.

As described above, in the cell display technology, a molecule to be displayed is selected according to the function required for the functional cell, and the molecular size is controlled, and further, the stability of the functional microorganism after the cell display is taken into consideration. It will be necessary. In other words, it is extremely important to select not only the functional microorganism itself but also a carrier protein suitable for the purpose.

On the other hand, magnetic bacteria are reported to be bacteria that retain about 20 magnetic fine particles (biomagnetite) made of magnetite having a single magnetic domain of 50 to 100 nm and migrate along the lines of magnetic force (for example, Non-patent document 1). Since such magnetic bacteria have magnetic fine particles in the body, it is suggested that magnetic bacteria (bacteria) can be collected and concentrated by applying a magnetic field with a magnet or the like (for example, Non-Patent Document 2). ). However, there have been no reported examples of further improving the function of magnetic bacteria as functional microorganisms using the carrier protein possessed by magnetic bacteria, taking advantage of such characteristics of magnetic bacteria. Regarding the OmpA protein derived from E. coli, the three-dimensional structure has already been determined, and an example of use in cell surface display has been reported (for example, Non-Patent Document 3).

In addition, a fusion protein in which a functional peptide is bound to Mms16, which is a magnetic microparticle membrane-specific protein derived from magnetic bacteria (Magnetospirillum sp.) AMB-1, is disclosed, and this fusion protein has GTPase activity ability. (For example, Patent Document 4). However, when Mms16, which is the fusion protein, is used as a carrier protein,
It is said that functional peptides are expressed on magnetic fine particles, and there are significant problems in processing time such as cell breakage and washing process when making a library.

As prior art documents related to the present invention, there are the following.

US Pat. No. 5,571,698 JP 2005-218415 A Japanese Patent Publication No. 2002-508977 JP 2002-176989 A “Invitation to Biotechnology”, page 103 (Zen Matsunaga, Haruko Takeyama et al., Asakura Shoten Co., Ltd.) JP 2004-261169 A JP 2004-290039 A

In view of the situation as described above, the problem of the present invention is to utilize the unique properties of magnetic bacteria,
An object of the present invention is to provide a functional magnetic bacterium which is functionally superior by inserting one or more amino acids having the ability to bind heavy metals into the extracellular region of a protein present in the cell membrane of the magnetic bacterium. Moreover, the subject of this invention is providing the collection | recovery method of the heavy metal using the said functional magnetic bacteria.
Furthermore, the subject of this invention is providing the method of collect | recovering cadmium which is one of the heavy metals causing the water quality environment pollution using the said functional magnetic bacteria.

As a result of earnest research to solve the above problems, the present inventors adopted a specific magnetic bacterium, based on the genome of the carrier protein, the proteome analysis results,
The inventors have found that one or a plurality of amino acids having the ability to identify the extracellular region of a protein present in the cell membrane of a magnetic bacterium and bind to a heavy metal can be easily displayed, thereby completing the present invention. The present invention is composed of the following technical matters. That is,
(1) A functional magnetic bacterium characterized in that one or a plurality of amino acids having the ability to bind heavy metals are inserted into the extracellular region of a protein present in the cell membrane of the magnetic bacterium.
(2) The functional magnetic bacterium according to (1), wherein one or more amino acids are inserted into the amino acid sequence described in SEQ ID NO: 1 at or near the following site.
148th Val, 163rd Asn, 238th Leu, 263th Phe,
285th Ala
(3) The functional magnetic bacterium according to (1) or (2), wherein the plurality of amino acids are Histags.
(4) A gene encoding the functional magnetic bacterium according to any one of (1) to (3).
(5) A vector comprising the gene according to (4).
(6) contacting the functional magnetic bacteria of (1) to (3) with an aqueous solution containing heavy metal,
A method for recovering heavy metals, comprising adsorbing heavy metals in the aqueous solution to the functional magnetic bacteria.
(7) The heavy metal relates to the heavy metal recovery method according to (7), wherein the heavy metal is cadmium.

According to the present invention, there is provided a functional magnetic bacterium in which one or a plurality of amino acids having the ability to bind heavy metals are displayed in an extracellular region of a protein present in a cell membrane of a magnetic bacterium that generates magnetic fine particles (biomagnetite). Provided. That is, the functional magnetic bacterium of the present invention displays one or more amino acids such as a metal-binding peptide in the extracellular region of the protein present in the cell membrane of the magnetic bacterium. The function which a functional molecule has can be exhibited. For example, when a plurality of amino acids are metal-binding peptides, they can be used as a magnetic bacterial host that can be recovered magnetically, and heavy metals such as cadmium, lead, and chromium in industrial wastewater can be easily and easily recovered. it can.

Further, since the heavy metal recovery method of the present invention uses the functional magnetic bacteria, it is possible to recover heavy metals in sewage efficiently and inexpensively, and can be suitably applied to so-called bioremediation. it can. In particular, since the heavy metal recovery method of the present invention does not require energy in the recovery reaction of heavy metals, the cost for environmental purification can be extremely reduced.

Hereinafter, embodiments of the present invention will be described in detail.

The functional magnetic bacterium of the present invention is characterized in that one or a plurality of amino acids having the ability to bind heavy metals are inserted into the extracellular region of a protein present in the cell membrane of the magnetic bacterium. As a protein present in the cell membrane of the magnetic bacterium constituting the functional magnetic bacterium of the present invention, a membrane specific protein 1 (hereinafter referred to as a magnetic particle-specific protein consisting of an amino acid sequence described in SEQ ID NO: 1 in the Sequence Listing) Abbreviated as Msp1) and a protein composed of amino acids in which one or several amino acids are deleted, substituted or added in the amino acid sequence set forth in SEQ ID NO: 1. This is due to the comprehensive identification of proteins present in the cell membrane held by magnetic bacteria, and in addition to Msp1, a carrier protein can be selected according to the properties of the functional peptide.

Among the proteins present in the cell membrane of the magnetic bacteria, it is preferable to use the aforementioned Msp1 as a carrier protein because it is localized in the outer cell membrane and has the highest expression level among the magnetic bacteria.

In addition, examples of the protein present in the cell membrane of the magnetic bacterium of the present invention include a recombinant protein that specifically binds to an antibody that specifically binds to these proteins. These proteins can be prepared by a known method based on DNA sequence information as described later. For example, magnetic bacteria magnetospirillum magneticum AMB-1 (hereinafter referred to as “AMB-1”) It can also be easily prepared by dividing three fractions of isomagnetic bacterial cell lysates and comparing the SDS-PAGE profiles of each protein.

In addition, the gene to be the subject of the present invention is a gene encoding a protein Msp1 present in a cell membrane specific to a magnetic bacterium consisting of the amino acid sequence described in SEQ ID NO: 1, and the amino acid sequence described in SEQ ID NO: 1 A gene encoding a protein consisting of amino acids in which one or several amino acids have been deleted, substituted or added, the base sequence set forth in SEQ ID NO: 2 or its complementary sequence, and part or all of these sequences The gene containing can be illustrated.

These genes can be prepared by a known method based on DNA sequence information. In addition, hybridization was performed under stringent conditions on various DNA libraries using the base sequence described in SEQ ID NO: 2 or a complementary sequence thereof and a part or all of these sequences as probes. By isolating DNA that hybridizes to DNA, DNA encoding a protein having the same activity as that of Msp1 DNA, which is a protein present in a cell membrane specific to magnetic bacteria, can also be obtained. Hybridization conditions for obtaining such DNA can be appropriately set according to factors that affect the stringency of hybridization.

In the present invention, the one or more amino acids displayed on the outer membrane of the cell surface protein may exhibit a predetermined function possessed by one or more amino acids without inhibiting the function inherently possessed by magnetic bacteria. It is not particularly limited if possible. For example, as a plurality of amino acids that can be displayed, epitope tags such as 6His (HHHHHH), HA (hemagglutinin), FLAG (DYKDDDDK), and MYC (EQKLISEEDL) can be used. Examples of the affinity tag include GST, maltose binding protein, biotinylated peptide, oligobistidine and the like.

Among the plurality of amino acids, it is a tag having metal affinity, and from the viewpoint of easily recovering heavy metals in sewage, His tag (His: (HHHHHH)) is particularly preferable.

Furthermore, the functional magnetic bacterium of the present invention is a functional peptide which is a structural unit consisting of a sequence of 6 to 10 amino acids and 5 to 8 monosaccharides capable of recognizing and binding heavy metals in sewage. Can also be displayed in the extracellular region of proteins present in the cell membrane of magnetic bacteria. In other words, a base sequence encoding an amino acid sequence capable of recognizing a specific heavy metal such as cadmium is used as a label, introduced into the extracellular region of a protein present in the cell membrane of a magnetic bacterium, and heavy metals are detected with a functional peptide. In addition, heavy metals and the like in the solution can be separated. In addition, these functional peptides can be easily prepared according to a conventional method.

Next, a method for producing the functional magnetic bacterium of the present invention will be described. First, when producing a functional magnetic bacterium, it is necessary to clarify the protein present in the cell membrane of the above-mentioned functional peptide. The method for clarifying the structure of the protein is not particularly limited, but the structure information of the membrane protein can be revealed by a known method such as a secondary structure prediction program as shown in the examples described later. . Thus, after clarifying the structure of the protein present in the cell membrane of magnetic bacteria, the insertion position of one or more amino acids is determined. By analyzing the structure of the membrane protein, a position corresponding to the extracellular region (loop) can be detected, and the position can be determined as an amino acid insertion position. In addition, the insertion location of an amino acid is not limited to one, A multiple insertion location can be set as needed.

In the functional magnetic bacterium of the present invention, the insertion position of one or a plurality of amino acids is defined as the extracellular region of the protein present in the cell membrane of the magnetic bacterium, and this is determined based on the structural information of the protein. Alternatively, a plurality of amino acids are inserted. In order to insert one or a plurality of amino acids, a primer set necessary for the insertion is designed, and a functional tag is inserted by a known method such as Site-directed mutagenesis method. Similarly, one or more amino acids can be inserted by homologous recombination.

Since the present invention aims to recover heavy metals using magnetism, it is characterized by adopting magnetic bacteria as host cells. The magnetic bacterium that can be used is not particularly limited as long as it has magnetic fine particles therein. For example, magnetospirillum magneticcam AMB-1 (FERM BP 5458), desulphovibrio magnene. Magnetic bacteria such as Tikas RS-1 (Desulfovibrio magneticus RS-1, FERM P-13283) can be used. The magnetic bacteria can be cultured at a predetermined temperature by adding an enzyme such as a carbon source and yeast extract to the medium for separation under anaerobic conditions.

The expression system that can be used in the present invention is not particularly limited as long as it is an expression system that can express a protein present in the cell membrane of a magnetic bacterium in the magnetic bacterium. Examples include vectors derived from papovavirus, vaccinia virus, adenovirus, retrovirus, and the like derived from origin. In the present invention, a recombinant plasmid vector having a promoter derived from magnetic bacteria is preferred.

In another aspect, the present invention relates to a method for recovering heavy metals using functional magnetic bacteria. That is, by contacting the functional magnetic bacterium of the present invention with sewage containing heavy metal such as cadmium, the heavy metal is adsorbed by a plurality of amino acids displayed on the membrane protein of the functional magnetic bacterium, and the heavy metal in the sewage is removed. It can be recovered. In the heavy metal recovery method, the heavy metal to be recovered can be appropriately selected according to one or a plurality of amino acids to be displayed on the membrane protein. The recoverable heavy metals are not particularly limited, but examples include cadmium, lead and other heavy metals that are the main cause of water pollution, as well as terium, lithium, cerium, magnesium, strontium, barium, zinc, etc. can do. For example, when producing magnetic bacteria having a function of recovering heavy metals such as cadmium in wastewater, it is preferable to use a histag as the functional peptide.

EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, this invention is not restrict | limited to this at all.

Example 1
<Construction of expression vector>
In this example, pUMG, which is conventionally used as a shuttle vector for Escherichia coli and magnetic bacteria, was adopted, and the sequence of the promoter region of the Msp1 protein, which is most highly expressed in magnetic bacteria, was ligated to this shuttle vector. An expression vector pUMP1 was constructed. An outline for constructing pUMP1 is shown in FIG. First, PCR was performed using a primer set that adds an Nsi1 site to the 3 ′ end of the promoter region of the Msp1 protein. PCR was performed under the predetermined conditions using the following primers.
forward primer: TTGACTGGCGGCGCCCATCATGGCGTG (SEQ ID NO: 3)
reverse primer: atgcatTGGCCGCGACCGCTATCCAAATGA (SEQ ID NO: 4)
In the above SEQ ID Nos., Uppercase letters indicate template complementary sequences, and lowercase letters indicate restriction enzyme site sequences (the same applies to the sequences shown below).

The amplified gene fragment of the promoter region of Msp1 obtained by the PCR was ligated to the Ssp1 site of pUMG to transform E. coli DH5a. A plasmid was extracted from the obtained colonies, and the insert was confirmed and the sequence was confirmed by a sequencer using Ssp1 and Nsi1.

From the restriction enzyme digestion pattern with Ssp1 and Nsi1, it was shown that the promoter sequence of Msp1 protein was cloned into the Ssp1 site of pUMG, and immediately after that the Nsi1 site was inserted. Furthermore, when the sequence was confirmed by the DNA sequence, it was confirmed that these sequences were correctly cloned.

(Example 2)
<Selection and cloning of membrane proteins>
PCR was performed using a primer set in which Nsi1 sites were added to both ends of the Msp1 gene. PCR was performed under the predetermined conditions using the following primers.
forward primer: atgcatTTGGGGGTCGTTTTCGCAAAG (SEQ ID NO: 5)
reverse primer: atgcatTTAGAAGGACAGCGACAGAC (SEQ ID NO: 6)

TA cloning into pGEM-T Easy vector. The plasmid of the obtained colony was extracted, and the sequence was confirmed by restriction enzyme digestion and sequencer. The Msp1 gene was digested with Nsi1 and purified, and then ligated to the Nsi1 site of pUMP1 to construct pUMP1Msp1 as a fusion protein. The constructed MP1Msp1 is shown in FIG.

Example 3
<Histag sequence fusion to carrier protein gene>
Since the three-dimensional structure of Msp1 has not been determined, the structure was predicted using a secondary structure prediction program, and the Histag insertion site was selected. FIG. 3 shows a two-dimensional structure of Msp1. Further, Table 1 shows the insertion site of Histag based on the analysis result of FIG. Primer sets for inserting a Histag (Histag) and Nhel site at each insertion site were designed. Table 1 shows the designed primer sets (SEQ ID NO: 7 to SEQ ID NO: 29).

When the secondary structure of Msp1 used as a carrier protein in this example was analyzed, it was shown that β-strand structures were regularly arranged. From this, it was considered that Msp1 has a β-barrel structure also found in a general outer membrane protein (OmpA protein derived from E. coli). It is considered that the His tag can be inserted outside the cell by inserting the His tag continuously in several places during the predicted β-strand (loop part). Therefore, 11 sites considered to be Msp1 loops were selected and a histag was inserted. FIG. 3 shows the predicted secondary structure of Msp1 and the determined histag insertion site.

Example 4
<Confirmation of plasmid retention in magnetic bacterial transformant>
The magnetic bacteria were aerobically cultured until OD (600) = 0.3, and centrifuged at 8,000 × g and 4 ° C. for 10 minutes. Furthermore, competent cells of magnetic bacteria were prepared by washing twice with TES buffer. Thereafter, the prepared competent cells were transformed using the prepared His tag insertion plasmid. The plasmid of the subcultured transformant was extracted and digested with Nhe1 and Kph1 to confirm that the plasmid was retained. The results are shown in FIG. According to FIG. 4, the expected band patterns (around 5.0 kbp, around 3.0 kbp) are obtained. At this time, depending on the position where the histag is inserted, the mobility of the restriction enzyme digestion fragments in each plasmid is slightly higher It was confirmed that each was different. From this, it was revealed that Msp1 was produced a transformant carrying 11 types of pUMP1.

(Example 5)
<Confirmation of expression of Histag fusion protein>
Magnetic bacteria each retaining pUMP1Msp1-124H (a plasmid in which a Histag was inserted immediately after the 124th Val in the Msp1 protein) were cultured, and the collected cells were sonicated.

The cell disruption solution was centrifuged at 8,000 × g for 10 minutes to remove uncrushed materials and inclusion bodies, and then ultracentrifuged at 152,000 × g to separate into a water-soluble fraction and a membrane fraction. . The separation process is shown in FIG.

Solubilized uncrushed and inclusion body fraction and membrane fraction buffer (40 mM Tris base7 M urea,
2Mthiourea 4% CHAPS (3-[(3-Cholamidopropyl) dimethylammonio] -1-propanesulfonate)) was used to solubilize by shaking at 4 ° C. BSA was used as a standard protein, and the protein of each obtained fraction was quantified by the Bradford method. Thereafter, SDS-PAGE was performed using a separation gel having an acrylamide concentration of 12.5% in each fraction (Laemmli, UK., 1970). After electrophoresis, the gel and PVDF membrane are mixed with A solution (0.3 M Tris, 20% Methanol, 0.02% SDS, pH: 9.5), B solution (25 mM Tris, 20% Methanol, 0.02% SDS, pH: 9.3), C solution. Semi-dry method (Andersen, K., 1984) energized for 1 hour between filter paper soaked in (25 mM Tris, 0.04 M 6-amino-n-caproic acid, 20% Methanol, 0.02% SDS, pH: 9.5) Blotting was performed. After blotting, the PVDF membrane was blocked in PBST containing 1% BSA (10 mM PBS, 0.1% Tween20) for 1 hour or longer. After washing with PBST for 10 minutes, an anti-6 × His tag antibody was reacted as a primary antibody at room temperature for 1 hour. After washing with PBST for 10 minutes three times, alkaline phosphatase-labeled anti-mouse IgG antibody (invitrogen) was reacted as a secondary antibody for 1 hour at room temperature. Furthermore, washing with PBST for 10 minutes was repeated three times, and the antigen-antibody reaction was detected by adding NBT / BCIP-Blue Liquid Substate (sigma) as a substrate to cause color development.

The protein of the magnetic bacterium carrying pUMP1Msp1-124H was fractionated, and Western blotting was performed using a 6 × His tag antibody. The result is shown in FIG. A specific band of a 43.4 kDa (Msp1-124H) His tag fusion protein was detected in each of the transformants carrying the plasmid. Each specific band was found only in the whole cell fraction, the inclusion body fraction, and the cell membrane fraction, but not in the water-soluble fraction. This suggested that Msp1-124H was expressed and localized in the cell membrane.

(Example 6)
<Evaluation of cadmium recovery ability in magnetic bacteria>
Evaluation of the cell localization of cadmium in magnetic bacteria was performed by exposing the cultured cells to cadmium and fractionating it, and then measuring the amount of cadmium contained in each fraction. An outline of the evaluation method is shown in FIG. First, the wild strain of AMB-1 was adjusted to 10 ¹⁰ cells, suspended in 10 mM HEPES buffer, cadmium having a final concentration of 100 μM was added, and incubation was performed with shaking at room temperature for 3 hours.

Thereafter, cadmium localized in each fraction was evaluated by the following method. The cells were collected by centrifugation at 8000 × g for 5 minutes, and then the cells were washed 3 times with HEPES buffer, and the supernatant was used as a washed fraction ([1] in FIG. 7). The remaining cells were washed with 10 mM EDTA, and the supernatant after centrifugation was used as the cell surface fraction and the precipitate as the intracellular fraction ([2] and [3] in FIG. 7). Each fraction was dispensed into an acid-washed test tube, and a 9.6 N nitric acid solution was added. Using an oil bath, the organic matter was decomposed at 180 ° C. and dried. After adding 2 ml of nitric acid (0.1 N), dissolution by ultrasonic waves was performed at 30 ° C. for 20 minutes. Thereafter, 3 ml of nitric acid (0.1 N) was added, the whole amount was adjusted to 5 ml, and cadmium contained in each fraction was measured with an atomic spectrophotometer. Further, a standard solution for atomic absorption analysis, 1000 ppm cadmium (Wako Pure Chemical Industries, Ltd.) was used as a standard solution, and a calibration curve was prepared by appropriately diluting with nitric acid (0.1 N) and evaluated. The results are shown in FIG.

As can be seen from FIG. 8, the amount of cadmium adsorbed on the cells after EDTA washing was higher in the transformant than in the wild-type magnetic bacterium. This suggests that the transformant adsorbs cadmium more strongly, has some influence on the extracellular membrane, and promotes cadmium uptake.

(Example 7)
<His Tag cell surface display technology evaluation by immunostaining>
The transformant produced so far was cultured until stationary phase. The obtained microbial cells were arranged to have a cell count of 1.0 × 10 ⁸ , and a mouse-derived anti-6 × His antibody (1/1000) was reacted as a primary antibody while gently shaking overnight. After centrifugation, Phycoerythrin (PE) -labeled goat-derived anti-mouse IgG (1/500) was used as a secondary antibody and shaken for 4 h.

Then, after washing with PBS, the fluorescence intensity derived from PE was measured (ex .: 550 nm, em .: 570 nm). Furthermore, the bacterial cells of the wild strain and the strain showing the highest fluorescence intensity were observed using a fluorescence microscope.

In the transformants prepared from the cadmium binding assay, a difference was observed between the strains with and without HisTag displayed on the cell surface. Therefore, evaluation by immunostaining was performed to confirm the display on the cell surface. When the produced transformant was immunostained and the difference in fluorescence intensity was confirmed, the following results were obtained. The results are shown in FIG. As FIG. 9 shows, when HisTag was inserted into residue 238 of Msp1, it was shown to be displayed on the cell surface most efficiently. From this, it was expected that the ability to recover heavy metals was further increased in the transformant in which HisTag was inserted into residue 238 of Msp1.

Fluorescence microscopic observation also showed that the HisTag antibody did not bind to wild-type cells, and that it specifically bound only to the strain in which HisTag was inserted into residue 238 of Msp1. The results are shown in FIG. FIG. 10 shows that the cell surface display of HisTag can be performed.

(Example 8)
<Effects on growth of magnetic bacterial transformants>
When a growth curve of the transformant was prepared, no significant difference was observed compared to the wild type. Moreover, as a result of observing the morphology of the cells with a microscope, no significant difference was observed between the transformant and the wild type. The results are shown in FIG. This suggested that the expression of histag fusion protein does not affect the growth of magnetic bacteria.

The functional magnetic bacterium of the present invention can recover heavy metals such as cadmium and can greatly contribute to the development of environmental technologies such as bioremediation by applying it to nature. At the same time, it is expected to contribute to the development of chemistry and pharmaceutical medicine such as ethanol production, biopanning, screening of specific molecules.

A schematic diagram of the steps for constructing the expression vector pUMP1Msp1 is shown. The expression vector pUMP1Msp1 structure is shown. The two-dimensional structure of Msp1 and the histag insertion site are shown. The measurement photograph of the migration degree of a restriction enzyme digestion fragment is shown. An outline of a method for confirming the expression of a histag fusion protein is shown. The result of the Western blotting of Msp1-124H is shown. The schematic about the evaluation method of cadmium collection | recovery ability is shown. The adsorbed amount of cadmium in the wild type and the transformant is shown. The cell display evaluation result of Msp1 is shown. The observation photograph which observed the fluorescence microscope after the immuno-staining in a wild type and a transformant is shown. The result of having evaluated the influence on the growth in a wild type and a transformant is shown.

Claims (6)

One or a plurality of amino acids having the ability to bind to heavy metals are inserted in or near the following site, which is an extracellular region of a protein having the amino acid sequence described in SEQ ID NO: 1 and present in the cell membrane of magnetic bacteria A functional magnetic bacterium characterized by that.
148th Val, 163rd Asn, 238th Leu, 263th Phe, 285th Ala The functional magnetic bacterium according to claim 1, wherein the plurality of amino acids are Histags. The gene which codes the protein in which the said amino acid was inserted of the functional magnetic bacterium of Claim 1 or Claim 2. A vector comprising the gene according to claim 3. The functional magnetic bacterium according to claim 2 or 2 is brought into contact with an aqueous solution containing a heavy metal,
A method for recovering heavy metals, comprising adsorbing heavy metals in the aqueous solution to the functional magnetic bacteria. The heavy metal recovery method according to claim 5, wherein the heavy metal is cadmium.