JP5097495B2 - Biomolecule detection element and method for producing biomolecule detection element - Google Patents

Description

  The present invention relates to a detection element for sensing a biomolecule, a manufacturing method thereof, and a biomolecule detection method.

  In recent years, since the decoding of human genomic DNA has almost been completed, research to elucidate the function of genes has been actively conducted. In this case, it is necessary to specifically and comprehensively detect genes and proteins in the living body, and development of gene / protein detection techniques is being promoted worldwide. On the other hand, techniques for identifying pathogenic bacteria and viruses that have entered the living body at the gene or protein level have been studied and are being put into practical use. Various biosensors are used as means for detecting biomolecules such as specific genes and proteins in accordance with such purposes. The most common biosensor structure has a probe molecule that captures a biomolecule immobilized on a solid surface. When capturing nucleic acids, nucleic acids are mainly used as probe molecules, and when capturing proteins, proteins are mainly used as probe molecules. The merit of a biosensor in which probe molecules are immobilized on a substrate is that many types of probe molecules can be immobilized on the same substrate by using a method such as spotting or inkjet. By using this biosensor substrate, it is possible to quickly perform a comprehensive analysis on many types of biomolecules at once. Typical examples of biosensors using the substrate surface are biomolecule detection elements such as DNA microarrays and protein chips. Biomolecule detection elements represented by DNA microarrays are expected to be used for medical diagnosis including diagnosis of diseases such as cancer in the future. When a DNA microarray is used for medical diagnosis, high reliability is required for data obtained from the microarray. Moreover, in order to detect a trace amount of biomolecules in a specimen, it is also required to detect with high sensitivity. Thus, among various detection methods, a fluorescence method in which a fluorescent dye is added to a relatively high sensitivity biomolecule is mainly used.

  On the other hand, as shown in Patent Document 1 to Non-Patent Document 1, recently, single molecule-based sequencing (SBS) is aimed at greatly improving the accuracy of gene expression analysis as performed in DNA microarrays. (Sequencing by Synthesis method, etc.) have been developed. In this method, a sample polynucleotide modified with an appropriate primer is immobilized on the surface of a substrate, and by using this as a template, a base-by-base extension reaction is performed to form a complementary strand of the sample polynucleotide. . In each step of this single-base extension, a unique fluorescent dye is introduced at the purine or pyrimidine moiety of each of the four different nucleotides or at the end of the phosphate group of triphosphate. Single nucleotide fluorescence detection is performed to identify the introduced nucleotides. This step is repeated, and the sequence for each single polynucleotide fixing site is read to comprehensively acquire the sequence information of the specimen. Here, it is important to detect with a high S / N ratio and improve the accuracy of sequencing during sequencing.

  In order to detect a small amount of sample using microarray or sequencing which is a means for analyzing these DNAs, it is necessary to increase the fluorescence detection sensitivity. A method of using fluorescence enhancement to improve the fluorescence detection sensitivity is reported in Non-Patent Document 2. In Non-Patent Document 2, silver nanoparticles modified with DNA as a probe molecule are immobilized on a substrate and reacted with molecules in a fluorescently labeled sample. When fluorescence excitation light is irradiated to detect the reaction amount, free electrons of silver nanoparticles cause resonance vibration, that is, localized plasmon resonance, and fluorescence is enhanced. It is said that sensitivity can be improved by using this phenomenon.

  On the other hand, Non-Patent Document 3 reports an example in which the change in the fluorescence radiation rate when the fluorescent molecule is located in the vicinity of the metal fine particle, that is, the change in the quantum efficiency of the fluorescent molecule is calculated. Fluorescence radiation speed increases when the fluorescent molecule is in the vicinity of the metal fine particle due to the relationship between the potential around the metal fine particle, the dipole moment of the metal fine particle and the dipole moment of the fluorescent molecule located in the vicinity of the metal fine particle. It indicates that there is a possibility. Patent Document 2 discloses an apparatus that enhances the fluorescence without quenching the metal by providing a spacer between the particulate or film metal and the fluorescent molecule.

Non-Patent Document 4 reports that Raman scattered light from molecules adsorbed on the surface of silver fine particles is enhanced by about 10 ¹⁴ . On the surface of all silver fine particles, a strong enhancement is not found, but a very strong enhancement can be obtained at a limited site of about 10%, and the site is called a hot site. On the other hand, Non-Patent Document 5 reports that very strong Raman scattering enhancement is observed at the joint between silver particles and silver particles. Similarly, Non-Patent Document 6 suggests that a relatively strong electromagnetic field is generated between metal fine particles when two metal fine particles are arranged in a straight line and when three metal fine particles are arranged in a triangle. .

U.S. Patent No. 6,787,308 Special table 2005-524084 Proc. Natl. Acad. Sci. USA, Vol. 100 (7), pp3960, 2003 Biochem. Biophys. Res. Comm. 306, p.213 (2003) J. Chem. Phys. 75 (3), p.1139 (1981). Science 275, p. 1102 (1997). Phys. Rev. Lett. 83, p. 4357 (1999). Surface Science 158, p. 165 (1985).

  When detection is performed using a DNA microarray, the extracted DNA is usually amplified in the previous step of the detection step. This is to obtain an amount of DNA that exceeds the detection limit of the array. In an amplification process such as PCR (Polymerase Chain Reaction), the entire extracted DNA sequence is not amplified, but specific DNA is amplified. Therefore, there is a problem that DNA fragments that are not amplified are not detected. In addition, this amplification process not only complicates the inspection process, but also has a problem that it is difficult to quantitatively interpret the inspection result due to variations during amplification. In order to perform medical diagnosis or pathological analysis, it is important to quantitatively detect DNA extracted from the specimen. Therefore, it is necessary to greatly improve the sensitivity of the DNA microarray in order to perform detection without this amplification step. The DNA detection method using silver island fluorescence enhancement disclosed in Non-Patent Document 2 uses an array in which a plurality of DNAs serving as probe molecules are immobilized on a silver island. It has been reported that when the fluorescein-capped DNA to be captured and the probe molecule react and bind, a 12-fold increase in fluorescence can be obtained. However, in order to detect DNA without amplification, it is necessary to further enhance fluorescence, for example, two or more orders of magnitude. Therefore, it is necessary to form a strong fluorescence enhancement field. In the aforementioned Patent Document 2, there is no specific description regarding the metal arrangement and density for obtaining high fluorescence intensity, or the distance between the metal and the fluorescent molecule.

  On the other hand, at the time of single molecule DNA sequencing, when a single base (A, T, C, G) is extended to DNA, the fluorescence from the fluorescent molecule added to the single base is measured with one pixel of a CCD camera, for example. To perform sequencing. In this case, fluorescence measurement at a single molecule level is required for each extension step. In order to improve the detection throughput and S / N ratio of fluorescence detection, it is necessary to greatly increase the fluorescence intensity from the fluorescent molecule. If the intensity of single molecule fluorescence can be increased, the exposure time of fluorescence can be shortened, and therefore the detection time can be shortened. It is also necessary to form a fluorescence enhancement field only in the detection portion and enhance only the signal component. That is, it is necessary to improve the S / N ratio without enhancing noise components such as fluorescence intensity from nonspecifically adsorbed fluorescent molecules.

  For the above reasons, it is an object of the present invention to form a locally high fluorescence enhancement field in the detection portion from the viewpoint of improving detection throughput and S / N ratio. It is also an object of the present invention to design a fluorescence enhancement field suitable for the excitation wavelength of each fluorescent dye used.

  In the present invention, a plurality of metal fine particles and probe molecules are regularly arranged on the surface of the substrate, and a plurality of detection spots each including a plurality of metal fine particles and probe molecules are provided. By arranging them close to each other, a biomolecule detection element capable of obtaining a high fluorescence enhancement effect locally is realized. The plurality of metal fine particles contained in the detection spot are preferably fixed on the substrate surface in a rotationally symmetrical manner. Here, the rotational symmetry means that the metal fine particles are arranged on the substrate surface on the same circumference with respect to an axis passing through the center of mass of the metal fine particle group and perpendicular to the substrate surface. Adjacent metal fine particles may be in contact with each other or may have a certain gap. If the radius of the metal fine particle is r and the distance between the centers of the adjacent metal fine particles is d, for example, d = 2r when the metal fine particles contact each other. By setting the range of d between 2r and 4r (2r ≦ d ≦ 4r), a strong fluorescence enhancement field is formed between the metal fine particles.

  Further, high fluorescence enhancement is obtained by allowing fluorescent molecules modified with probe molecules fixed on the substrate to exist at a distance of 6r (R ≦ 6r) from the center of gravity of the metal fine particle group fixed in an axial symmetry. Therefore, the probe molecule is present at a distance of 6r from the center of gravity. At this time, the entire probe molecule is included within a distance of 6r from the center of gravity of the metal fine particle group. Further, by fixing the probe molecule to the metal fine particle having a diameter different from the particle diameter of the metal fine particle group forming the fluorescence enhancement field, the fluorescent molecule modified with the probe molecule is effectively placed in the fluorescence enhancement field. That is, the distance R from the center of gravity of the metal fine particle group of the fluorescent molecule can be easily controlled within R ≦ 6r.

  As the material for the metal fine particles, a noble metal, a noble metal alloy, or a noble metal laminate is preferable. Fluorescence intensity is enhanced by utilizing the near-field effect of fluorescence excitation light and plasmon resonance of metal particles. When the distance between adjacent metal fine particles is changed, the wavelength of localized plasmon resonance shifts to the longer wavelength side (Optics Communications 220, p. 137 (2003)). By optimizing the arrangement and size of the metal fine particle group, the excitation wavelength of the fluorescent dye used for detection and the localized plasmon resonance wavelength are matched to obtain strong fluorescence enhancement.

  According to the present invention, extremely high fluorescence intensity can be obtained by exposing fluorescent molecules for biomolecule detection to a strong fluorescence enhancement field formed by metal fine particle groups. When the present invention is used for a biochip such as a microarray, the sensitivity of the array can be greatly improved by the fluorescence enhancement effect. Therefore, after extracting the DNA from the specimen sample, the extracted DNA can be measured as it is without being amplified. By omitting the amplification process that generates detection variation, it contributes to the improvement of the quantitativeness of detection.

  Next, when the present invention is used for a single-molecule DNA sequencer, it is possible to achieve fluorescence enhancement of only the detection portion by utilizing a local fluorescence enhancement field. Therefore, it is possible to stably detect fluorescence from a single fluorescent molecule with a high S / N ratio. Further, since fluorescence enhancement is obtained, the exposure time can be greatly shortened, and the detection throughput can be improved.

  Furthermore, by obtaining a strong fluorescence enhancement field by matching the excitation wavelength of the fluorescent dye with the localized plasmon resonance wavelength, it is possible to improve the sensitivity for various fluorescent dyes.

  From the above, it is possible to provide a biomolecule detection element that can simultaneously obtain the three effects of improved detection sensitivity, improved quantitativeness of detected data, and improved detection throughput.

  FIG. 1 shows an example of the surface structure of a biomolecule detection element according to the present invention. First, a linker pattern 102 is formed on the surface of the carrier substrate 101. At this time, as shown in FIG. 1, the pattern includes a dot pattern 102 for fixing the fluorescence-enhanced metal fine particles 104 placed symmetrically with respect to the axis 108 perpendicular to the substrate, and a probe molecule-fixing pattern. It consists of a dot pattern 103 for fixing the metal fine particles 105. Here, the linker is a molecule that has a functional group that has a strong interaction with a metal such as an amino group or a thiol group on the opposite side of the substrate, or a close contact between the substrate and metal fine particles. It is a metal thin film for improving the properties. By binding the linker and metal fine particles, one metal fine particle is fixed on one metal fine particle fixing dot. A group of metal fine particles 104 arranged symmetrically with respect to the axis 108 is for forming a fluorescence enhancement field, and the metal particle 105 at the center is a particle for fixing a probe molecule. Probe molecules 106 are fixed on the surface of the metal fine particles 105.

  Adsorption inhibiting molecules for preventing non-specific adsorption of various biomolecules are fixed to the area where the metal fine particles are fixed on the surface of the carrier substrate, that is, the area other than the metal fine particle fixed dot pattern. Form. Furthermore, a second adsorption-inhibiting molecule is immobilized on the surface of the probe molecule-fixing metal fine particle 105 where the probe molecule is not bound, and nonspecific adsorption of various biomolecules onto the metal fine particle surface. Also prevent. Note that the adsorption inhibition layer on the surface of the metal fine particles is omitted in FIG. The fluorescent molecule for detection is modified with the probe molecule 106.

Next, an example of a process concept for manufacturing the biomolecule detection element of the present invention will be described with reference to FIG. Here, a process using pattern formation by direct electron beam drawing using a positive electron beam resist is taken up. The manufacturing process consists of the following 10 steps.
(1) Application of positive electron beam resist to the substrate surface
(2) Opening by electron beam drawing and development
(3) Formation of linker molecule layer I (metal fine particle fixed dot: linker molecule A)
(4) Immobilization of metal particles for fluorescence enhancement
(5) Immobilization of metal fine particles for probe molecule immobilization
(6) Remove resist
(7) Formation of linker molecular layer II
(8) Formation of adsorption-inhibiting molecule I (Adsorption-inhibiting molecule C)
(9) Immobilization of probe molecules
(10) Formation of surface adsorption-inhibiting molecules II (metal particle surface: adsorption-inhibiting molecule D)

Each step will be described below.
(1) Application of positive electron beam resist to substrate surface: Fig. 2 (a)
First, the carrier substrate 201 is cleaned. Specifically, for example, the substrate 201 is washed with an alkaline aqueous solution such as an NaOH aqueous solution, then washed with an acidic aqueous solution such as an HCl aqueous solution, rinsed with pure water, and then dried. Alternatively, the organic contamination is washed with a solution in which sulfuric acid and hydrogen peroxide are mixed at about 4: 1. As the substrate, a glass substrate (slide glass), a quartz substrate, a plastic substrate, or the like can be used. Further, a metal coated substrate or the like may be used. The material of the substrate is preferably one having a silanol group on the surface.

  Next, a positive electron beam resist 202 is spin-coated on the substrate, and dry-baked at a predetermined temperature. In the present invention, it is desirable that the resist film thickness be as thin as possible on the assumption that the uniformity of the coating film can be ensured, but it is preferably at least 100 nm or less, more preferably 60 nm or less, from the results of through process studies.

  In the process of FIG. 2, it is assumed that electron beam drawing is performed on a conductive substrate such as a Si wafer with an oxide film. However, the oxide film is thick, for example, 10 nm or more, or quartz or glass is used. When electron beam drawing is performed on such an insulating substrate, an ultrathin film of a water-soluble conductive resin is further formed on the surface of the electron beam resist in order to prevent charge-up of the substrate. This conductive resin thin film can also be easily formed by spin coating, and hardly affects the electron beam sensitivity of the resist. Moreover, after drawing, it is easily dissolved and removed by washing with water, and does not affect the next resist development process.

  Although a positive electron beam resist is used here, a negative resist may be used depending on the drawing pattern.

(2) Opening by electron beam drawing and development: Fig. 2 (b)
The electron beam drawing is executed by an electron beam drawing apparatus that satisfies a target resolution. Here, a dot pattern is drawn using a field emission electron beam drawing apparatus having an effective resolution (minimum processing dimension) of 10 nm. The basic pattern is a circle, and the minimum size is about 20 nmφ to 100 nmφ. The electron beam scanning field is in the range of 75 μm to 2400 μm square, and the scanning fields are connected as necessary to ensure the irradiation area. The scanning field is divided into tens of thousands of steps in each of the x and y directions, and EB (electron beam) with a spot diameter of about 2 to 3 nm is pulsed at each step. A high-precision alignment mechanism using a laser interferometer is used, and the scanning field joining accuracy is secured to about 50 nm or less (when the scanning field is 600 μm) at 3σ. The electron beam drawing pattern is designed as CAD data, and drawing is executed by computer control. The drawing pattern is nanopore processing, and a positive resist is suitable from the viewpoint of throughput. In order to fix fluorescence-enhanced metal fine particles by drawing an electron beam on a positive-type electron beam resist-coated substrate and then immersing it in a predetermined organic solvent-based developer to remove the resist on the irradiated area and washing with a rinse solution The opening pattern 203 and the opening pattern 204 for fixing the metal fine particles for fixing the probe molecules are obtained. Since an aperture pattern of φ20 nm to φ100 nm cannot be observed with an optical microscope, pattern resolution inspection is performed using an electron microscope and an atomic force microscope (AFM).

  Here, for example, the hole diameter of the opening 203 for fixing the fluorescence enhancing metal fine particles is made larger than the hole diameter of the opening 204 for fixing the probe molecule fixing metal fine particles. This is to fix the metal fine particles for enhancing fluorescence and immobilizing the probe molecules separately. That is, first, fluorescent enhancement metal fine particles having a relatively large diameter are put into the opening 203, and then, metal particles for fixing probe molecules having a relatively small diameter are put into the opening 204.

  Further, as described in the effect of the invention, in order to obtain strong fluorescence enhancement, assuming that the radius of the metal particle for fluorescence enhancement is r and the distance between the centers of adjacent metal particles is d, d is 2r ≦ It must be in the range of d ≦ 4r. Therefore, the distance d ′ between the openings 203 for fixing the adjacent fluorescence enhancing metal fine particles is set to 2r ≦ d ′ ≦ 4r.

(3) Formation of linker molecular layer I (metal fine particle fixed dot): Fig. 2 (c)
The substrate on which the electron beam resist opening pattern is formed is immersed in a solution of the linker molecule A and reacted with the oxide film (SiO ₂ ) surface at the bottom of the opening pattern. As the linker molecule A, a silane coupling agent having an active group that binds to metal fine particles is used. Examples of the silane coupling agent include 3-aminopropyltrimthoxysilane, 3-aminopropyltriethoxysilane, N- (when fixing an amino group on the substrate surface. 2-aminoethyl) -3-aminopropyltrimethoxysilane), (aminoethyl-aminomethyl) phenethyltrimethoxysilane, and the like can be used. On the other hand, when fixing a thiol group to the substrate surface, 3-mercaptopropyltrimethoxysilane or the like can be used. As the solvent, for example, ethanol, methanol, toluene, benzene, water and the like can be used. The reaction temperature is usually in the range of 20 ° C to 85 ° C. Here, the linker molecule A is fixed to the surface of the oxide film in the opening by a covalent bond with the silanol group, but is physically adsorbed on the resist surface portion because there is no bonding group on the surface. The amino group or thiol group of the linker molecule A is exposed on the side opposite to the substrate, thereby binding to the metal fine particles in the next step.

  Here, after forming an electron beam resist opening pattern in steps (1) and (2), a linker molecule layer was formed in step (3). An electron beam resist opening pattern may be formed through the steps (1) and (2) after molecules are bonded.

  Alternatively, as described above, an inorganic material may be used without using an organic material as a linker molecule. For example, a thin film such as Ti or Cr may be formed by sputtering deposition on a substrate on which an electron beam resist opening pattern is formed.

(4) Immobilization of metal particles for fluorescence enhancement: Fig. 2 (d)
The metal fine particles are fixed to the substrate surface by the interaction between the active groups on the substrate surface and the metal fine particles. FIG. 2D shows the state of the carrier surface on which the metal fine particles 205 are fixed. As the metal fine particle material, any of noble metals such as gold, silver, platinum, palladium, rhodium, iridium, ruthenium, osmium, or an alloy thereof can be used. Alternatively, fine particles made of these precious metals coated with other precious metals, for example, fine metal particles coated with silver on gold fine particles may be used. The metal fine particle diameter is desirably 10 nm or more from the viewpoint of the stability of fixing the metal fine particles to the substrate. On the other hand, from the viewpoint of enhancing fluorescence, it is preferable to use a particle size within a range in which the fluorescence enhancement effect can be obtained.

  The metal fine particles for enhancing fluorescence are used only for forming a fluorescence enhancement field. Therefore, it is necessary to prevent the reaction of probe molecules and the like on the surface. Therefore, a reaction blocking layer 206 is provided on the surface of the metal particles for enhancing fluorescence. On the other hand, since it is necessary to fix the metal fine particles for fluorescence enhancement through the linker molecule shown in “(3) Formation of linker molecule layer I”, it must have a binding site with the linker molecule. Therefore, for example, as a molecule for forming a reaction blocking layer, the molecule has a thiol group that reacts with metal fine particles at the end of the molecule, and an NHS ester or carboxyl group that binds to an amino group, for example, isothiocyanate at the other end. A molecule having a group, an epoxy group, an aldehyde group or the like is used.

  The concentration of the metal fine particles is usually 30 wt% or less, and the reaction temperature is usually in the range of 20 ° C to 85 ° C. The reaction time is between 0.5 hours and 50 hours. The reaction time of the metal fine particles is determined with reference to the reaction time on a simple surface with only a linker molecule without a resist pattern. At this time, the metal fine particles 205 reach the bottom surface of the resist opening 203, and are reacted for a sufficient time to react and fix the surface active groups and the metal fine particles.

  Here, the hole diameter of the resist opening 204 for fixing the metal fine particles for fixing the probe molecules is smaller than the diameter of the metal fine particles 205 for enhancing fluorescence, and no metal fine particles enter the opening 204 in this step.

(5) Fixing metal fine particles for probe molecule fixation: Fig. 2 (e)
Similar to the step (4), the metal fine particles for immobilizing probe molecules are immobilized on the substrate surface by the interaction between the active groups on the substrate surface and the metal fine particles. FIG. 2 (e) shows the state of the surface of the carrier on which the metal fine particles 207 for immobilizing probe molecules are immobilized. As a material for the metal fine particles 207, any of noble metals such as gold, silver, platinum, palladium, rhodium, iridium, ruthenium, osmium, or an alloy thereof can be used. Alternatively, fine particles made of these precious metals coated with other precious metals, for example, fine metal particles coated with silver on gold fine particles may be used. The metal fine particle diameter is desirably 10 nm or more from the viewpoint of the stability of fixing the metal fine particles to the substrate. On the other hand, it is desirable that it is smaller than the metal fine particles for enhancing fluorescence.

  Water, ethanol, or toluene can be used as a fixing reaction solvent for the metal fine particles. A protective agent is used in order to prevent aggregation of metal fine particles in the solution. As a protective agent, citric acid, mercaptosuccinic acid, polyvinylpyrrolidone, polyacrylic acid, tetramethylammonium, polyethyleneimine, 1-decanethiol, 1-octanethiol, decylamine, phosphine (bis (p-sulfonatophenyl) phenylphosphine), etc. are used. be able to.

  The concentration of the metal fine particles is usually 30 wt% or less, and the reaction temperature is usually in the range of 20 ° C. to 85 ° C. The reaction time is between 0.5 hours and 50 hours.

  Here, in order to fix the metal fine particles one by one without entering each site and to keep the fixed filling rate of the metal fine particles into the opening pattern portion, the metal fine particle diameter and the electron beam resist opening diameter The relationship should satisfy the following conditions: That is, when the ratio of the metal fine particle diameter / electron beam resist opening diameter is γ, 0.5 ≦ γ ≦ 1 should be satisfied. When γ is smaller than 0.5, since the metal fine particle diameter is sufficiently smaller than the electron beam resist opening diameter, a plurality of metal fine particles enter each site. On the other hand, if γ is greater than 1, the metal fine particles cannot diffuse into the bottom of the electron beam resist opening hole, and the filling rate is significantly reduced.

  Here, in the steps (4) and (5), the method of fixing the metal fine particles dispersed in the solution on the substrate has been shown. For example, the noble metals gold, silver, platinum, palladium, rhodium, iridium, ruthenium Alternatively, any of osmium or an alloy thereof may be formed by sputtering deposition.

(6) Resist removal: Fig. 2 (f)
The substrate after step (5) is immersed in a dedicated resist stripper to dissolve and remove the resist. At this time, the metal fine particles and the linker molecules A adsorbed on the resist are removed by lift-off, and only the fine particle fixing dots composed of the linker molecules A covalently bonded to the substrate surface and the metal fine particles fixed thereon are left. What is important at this stage is that the metal fine particles are fixed to each site one by one, the metal fine particle fixed filling rate to the dot pattern is high, and there is no residual adhesion of metal fine particles in the area outside the dots. That is.

  Here, the resist stripping in step (6) is performed after fixing the metal fine particles in steps (4) and (5), but after the resist stripping in step (6), the probe molecule fixing in step (5) The metal fine particles may be fixed. That is, the resist may be peeled off, and the metal particle solution may be fixed by reacting the pattern surface of the linker molecule layer with the metal particle solution.

(7) Formation of linker molecular layer II (outer surface of fine particle fixed dots): FIG. 2 (g)
There is a high possibility that biomolecules and reagents will be non-specifically adsorbed on the surface of the substrate where metal fine particles are not fixed in a later process. These non-specific adsorptions cause noise when used as a device and must be thoroughly prevented. For this reason, an adsorption inhibiting molecule is fixed in an area other than the metal fine particle fixed dot pattern, and a countermeasure is taken. FIG. 2 (g) shows how the linker molecule B is first formed for this purpose. Here, when the silane coupling agent containing an amino group or thiol group used for the metal fine particle fixed dot is used, it reacts with the surface of the metal fine particle already fixed on the surface, so that the final metal fine particle It can also be an obstacle to fixing the probe to the surface. Therefore, here, a linker molecule that does not interact with the metal fine particles and reacts only with the substrate surface is desirable. As such a substance, for example, a silane coupling agent having an epoxy group or a carboxyl group is promising.

(8) Formation of adsorption-inhibiting molecule I (adsorption-inhibiting molecule C): Fig. 2 (h)
On the linker molecule B formed in the step (7), an adsorption inhibiting molecule C is bound as a molecule for preventing nonspecific adsorption of the biomolecule. In the case where the linker molecule B is a silane coupling agent having the above epoxy group, an adsorption inhibiting molecule having an amino group or a hydroxyl group that reacts with the epoxy group or the carboxyl group is effective. Low molecular weight polyethylene glycol (PEG) and carboxymethyl dextran (CM-Dextran) having a hydroxyl group can be used. However, when the nonspecific adsorption can be sufficiently prevented only by the linker molecule B, the adsorption inhibiting molecule C is not necessarily required.

(9) Probe molecule immobilization process: Fig. 2 (i)
In this step, probe molecules having a functional group capable of binding to the metal fine particles are reacted on the metal fine particles for fixing the probe molecules, and the probe molecules are fixed on the metal fine particles. FIG. 2 (i) shows the state of the substrate surface with P as the probe molecule.

  When detecting biomolecules using this substrate, in order to obtain a strong signal when the probe molecule reacts with the molecule to be detected, for example, the fluorescent molecule serving as the detection label is positioned within the fluorescence enhancement field, that is, the fluorescent molecule and The distance R from the barycentric point 207 of the fluorescence enhancing metal fine particle group must be within R ≦ 6r. The conditions for fluorescence enhancement will be described later. Therefore, the length of the probe DNA to which the target labeled with a fluorescent molecule is bound is preferably within R ≦ 6r as shown in FIG. 2 (i).

  Here, a case where gold nanoparticles are used as the metal fine particles and probe DNA having a thiol group at the 5 'end is used as the probe molecule will be described. First, for the purpose of calculating probe DNA immobilization conditions, gold nanoparticles were uniformly dispersed and immobilized, and coated with adsorption-inhibiting molecules that prevent non-specific adsorption in the steps (6) and (7) above. A substrate is used, and thiol-terminated DNA is reacted with the substrate. Thiol reacts and adsorbs only on the gold nanoparticle surface, and this adsorption behavior was quantified using the SPR method (Surface plasmon resonance). When the relationship between the DNA solution concentration and the number of immobilized probe molecules was measured, it was found that a simple Langmuir type adsorption curve was shown. From this curve, the relationship between the number of probe molecules immobilized per gold nanoparticle and the concentration of the DNA solution can be grasped. A substrate on which gold nanoparticles were fixed was immersed in a DNA solution adjusted to a concentration capable of fixing the target number of probe molecules, reacted at a predetermined temperature for a predetermined time, washed with a cleaning solution, and dried.

  As a solution for dissolving the probe DNA, a neutral aqueous solution such as a phosphate buffer can be used. The probe DNA is dissolved in this solution. The concentration of the probe DNA at this time is usually 0.5 μM to 100 μM, for example, in a conventional DNA chip. For example, when a single molecule of probe DNA is immobilized on gold nanoparticles, the concentration of the probe DNA is several nM. The following are suitable. The optimum concentration of probe DNA depends on the state of the immobilization surface, and specifically varies depending on the size and immobilization density of gold fine particles. Therefore, the optimum concentration of probe DNA is determined according to the design of the metal fine particle immobilization pattern.

  In the case of a gold nanoparticle fixed substrate using a Si wafer or a glass substrate as a carrier, a reaction solution in which probe DNA is dissolved can be spotted at a desired position on the substrate. At this time, it is possible to spot many kinds of probe DNAs on the substrate, which can be used as, for example, a DNA microarray. The reaction temperature is usually in the range of 25 ° C to 40 ° C. The reaction time is usually in the range of 2 to 24 hours. In order to prevent the solution from drying during the reaction, the reaction is carried out in a sufficiently humid environment.

  Since gold and a thiol group are easily bonded, a probe DNA having a thiol group at the end is immobilized only on the gold nanoparticle. Since the region where gold nanoparticles are not fixed (the region outside the gold fine particle fixed dot) is covered with the adsorption-inhibiting molecules B or C, the probe DNA hardly adsorbs. Hereinafter, coating with adsorption-inhibiting molecules is called blocking.

  Here, after fixing the metal fine particles to the substrate, the substrate surface other than the portion where the metal fine particles are fixed is blocked, and then the probe molecules are fixed. However, after fixing the probe molecules to the metal fine particles, It may be fixed on the surface, and then the substrate surface other than the portion where the metal fine particles are fixed may be blocked.

(10) Formation process II of adsorption-inhibiting molecules (metal fine particle surface): Fig. 2 (j)
A region where the probe DNA is not immobilized on the surface of the metal fine particle for immobilizing the probe molecule may adsorb the biomolecule of the specimen. Therefore, the metal fine particle surface other than the probe DNA fixing part is blocked. FIG. 2 (j) shows the state of the substrate surface after blocking the surface of the metal fine particles using the adsorption inhibiting molecule D.

  Here, when gold nanoparticles are used as the metal fine particles, 1-mercaptohexanol, 2-mercaptoethanol, phosphine (bis (p-sulfonatophenyl) phenylphosphine) can be used as a blocking agent that easily reacts with gold and hardly adsorbs biomolecules. ) Etc. can be used. The aqueous solution in which these blocking agents are dissolved and the surface of the carrier are reacted to fix the blocking material.

  The reaction temperature is usually in the range of 4 ° C to 35 ° C, and the reaction time is usually 0.5 hours to 10 hours. In this reaction, when the concentration of the blocking agent in the aqueous solution is high, the blocking agent reacts with the gold nanoparticles to cover the gold nanoparticles, thereby weakening the binding force between the metal fine particles and the carrier. As a result, the metal fine particles may diffuse on the support surface and the metal fine particles may aggregate on the surface. Therefore, the concentration of the blocking agent reaction solution was set to a range of 100 μM or less.

  Here, the adsorption inhibition molecule D is immobilized after immobilizing the probe DNA to the metal fine particles, but the probe DNA and the adsorption inhibition molecule D may be immobilized simultaneously. That is, the adsorption inhibiting molecule D may be mixed in a solution in which the probe DNA is dissolved, and the solution and the metal fine particles may be reacted.

 Here, in the gold nanoparticle grid array substrate, the case where an array substrate in which the probe molecule immobilized on the gold nanoparticle is probe DNA is used as a DNA microarray will be described in the following (11).

(11) Detection process using DNA microarray: FIGS. 3 and 4
The specimen sample solution modified with fluorescence is reacted with the surface of the biomolecule detection element prepared through the steps described in (1) to (10) above. Here, a case where a probe DNA is used as the probe molecule 304 and a nucleic acid is used as a detection biomolecule will be described with reference to FIG. For simplification, illustration of linker molecules, adsorption-inhibiting molecules, etc. is omitted. On the other hand, FIG. 3A shows a situation in which the target DNA 306 that is fluorescently modified with the fluorescent molecule 305 is supplied as the specimen sample. Here, when the base sequences of the probe DNA and the target DNA are completely complementary, they react with each other quickly to form a double-stranded DNA bonded with a complementary hydrogen bond 307 as shown in FIG. This is a hybridization reaction.

  As specific conditions for the hybridization reaction, the fluorescence-modified nucleic acid for detection is dissolved in an SSC (Standard Saline Citrate) solution to which a surfactant is added, and this solution is brought into contact with the surface of the biomolecule detection element. . The amount of nucleic acid in the solution is 0.1 amol to 1 nmol, the reaction temperature is usually 25 ° C. to 60 ° C., and the reaction time is usually 1 hour to 24 hours. Under these conditions, when the nucleic acid for detection is completely complementary to the sequence of the probe DNA, it reacts quickly to produce double-stranded DNA formed by complementary hydrogen bonding. In the case of DNA microarrays, probe DNAs of various types are spotted on the substrate surface, these probe DNAs and specimen samples are hybridized, and the fluorescence intensity from each spot is measured with a scanner and converted into data. .

  What is important here is that the fluorescence enhancement can be effectively used by fixing the group of fluorescence enhancement metal fine particles 205 to the surface of the substrate 201 in an axisymmetric manner. The fluorescence intensity enhancement inherent to the metal fine particles will be described. This phenomenon is described in detail in Non-Patent Document 3. When light is incident on the metal fine particles, free electrons in the metal fine particles are polarized and vibrated. Resonance between the vibration of free electrons in the fine metal particles and the oscillating electric field of incident light is called localized plasmon resonance. When localized plasmon resonance occurs, the electric field intensity on the surface of the metal fine particles becomes larger in each stage than the electric field intensity of the incident light.

  Next, two factors for the above-described fluorescence enhancement will be described. One of the factors that enhance fluorescence is the improvement of quantum efficiency of fluorescent molecules by electric field enhancement. When metal fine particles are present in the vicinity of the fluorescent molecule, the emission speed is accelerated in the fluorescence emission process due to the interaction between the dipole moment of the metal fine particle and the dipole moment of the fluorescent molecule due to the effect of the electric field enhancement. Therefore, the quantum efficiency of the fluorescent molecule is increased. However, since the quantum efficiency does not exceed 1, a fluorescent molecule having a quantum efficiency of 1 cannot be expected to increase the quantum efficiency due to the metal fine particles. However, many fluorescent molecules that are actually used in biosensors have a quantum efficiency of about 0.04-0.3, and an improvement in quantum efficiency can be expected from these fluorescent molecules by metal fine particles.

  The second factor is an increase in light scattering intensity due to an electric field enhancement near the metal fine particles. When the polarizability of the metal fine particles is increased by local plasmon resonance and the electric field in the vicinity is enhanced, the intensity of scattered light from the metal fine particles is also enhanced. When the scattered light intensity increases, the incident energy density for exciting the fluorescent molecules increases, and thus the light absorption amount of the fluorescent molecules also increases. The fluorescence intensity increases due to the above two factors.

  On the other hand, when the fluorescent molecule is in close proximity to the metal, fluorescence quenching is observed. This is because when the excitation energy of the fluorescent molecule exceeds the Fermi level of free electrons in the gold nanoparticle and is at a close distance, the excitation energy is transferred to the metal fine particles. In the case of metal fine particles, this moving speed is inversely proportional to the sixth power of the distance between the fluorescent molecule and the metal fine particles. Therefore, only when the fluorescent molecule is located on the extreme surface of the metal fine particle, the fluorescence enhancement intensity may be reduced by this fluorescence quenching. As shown in FIG. 3, when a probe molecule and a molecule to be detected with a fluorescent molecule are reacted, for example, when DNA is used as the probe molecule, the double-stranded DNA formed after the reaction has a rigid structure. The probability that the fluorescent molecules come into contact with the metal fine particles is extremely low. Furthermore, since these metal fine particles are coated with a reaction inhibition layer, an adsorption inhibition molecular layer, or the like, the possibility that the fluorescent molecules are in direct contact with the metal fine particles is low.

  Here, as shown in FIG. 4, a system is considered in which gold nanoparticles 401 having a diameter of 50 nm are placed on a glass 402 and a 532 nm p-polarized laser 403 is incident from the glass side in a total reflection mode to generate evanescent light. The medium around the gold nanoparticles is water 404. The electric field direction of the evanescent light is indicated by 405. In this system, a simulation using the FDTD (Finite Difference Time Domain) method is performed, and the electric field intensity generated around the gold nanoparticle when the laser beam (electromagnetic field) is incident in the total reflection mode is calculated. Shown in (a). As a result of calculation, the electric field intensity was amplified up to about 20 times near the gold nanoparticle pole. In addition, the electric field strength decreased as the distance from the gold nanoparticle 401 increased. The region with the largest electric field intensity amplification was 503, and then the electric field intensity amplification value decreased in the order of the region 504 and then the region 505. In the region outside 505, almost no electric field amplification is observed. The enhanced electric field in the vicinity of these gold nanoparticles causes fluorescence enhancement.

  On the other hand, FIG. 5 (b) shows a simulation result using the FDTD method when two gold nanoparticles 401 are adjacent to each other. In this case, the electric field strength increased in the vicinity of the contact point of the two gold nanoparticles, and the electric field strength was amplified up to about 90 times. The region with the largest electric field intensity amplification was 507, and then the electric field intensity amplification factor decreased in the order of 508 region, then 509 region, and then 510 region. In the region outside 510, there is almost no electric field amplification. The filled marks in the regions 503 to 505 and 507 to 510 in FIGS. 5A and 5B represent the magnitude of the electric field intensity amplification factor, and the same mark has the same amplification factor. For example, FIG. 5A region 503 and FIG. 5B region 508 have the same electric field intensity amplification factor. Comparing FIG. 5 (a) and FIG. 5 (b), when the two gold nanoparticles in FIG. 5 (b) are adjacent to each other, the region where the electric field strength is amplified is the gold nano particle in FIG. 5 (a). Compared to the time of one, it became wider. In addition, when the two gold nanoparticles were adjacent to each other, a region (507) having a larger electric field intensity gain occurred.

  FIG. 5 (c) shows the electric field intensity calculation results around the gold nanoparticles when the distance between the two gold nanoparticles is increased. When the distance between the gold nanoparticles 401 is d = 4r (FIG. 5 (c)), the electric field intensity generated around the gold nanoparticles is almost the same as that of the case of one gold nanoparticle. That is, the region of stronger electric field strength amplification factor that was seen when the two gold nanoparticles in FIG. In addition, the region where fluorescence enhancement was obtained was almost the same as the case of one gold nanoparticle.

  At 2r <d <4r, which is an intermediate point between FIG. 5B and FIG. 5C, the electric field strength amplification factor and the range in which the amplification factor is high decreased as the value of d increased. Here, explanation was given by taking gold nanoparticles having a diameter of 50 nm as an example, but the same electric field intensity amplification phenomenon was also observed in gold nanoparticles having a diameter other than 50 nm. When two gold nanoparticles were brought close to each other, an increase in electric field-enhanced amplification factor and an expansion of the amplification region were observed.

  Fluorescence enhancement is observed in the region where electric field enhancement is observed. Therefore, as shown in FIG. 5 (a), when there is one gold nanoparticle of radius r, the fluorescence enhancement occurs when the distance R between the fluorescent molecule and the center of the gold nanoparticle is within R ≦ 2-3r. Is obtained. On the other hand, when two gold nanoparticles are adjacent to each other as shown in FIG. 5B, fluorescence enhancement is obtained when the distance R between the fluorescent molecule and the center of gravity of the gold nanoparticles is within R ≦ 6r. In the case of d = 4r shown in FIG. 5 (c), the region where fluorescence enhancement is obtained is almost equal to the case of one gold nanoparticle. Here, the calculation results when two gold nanoparticles are used are shown. However, as shown in the top views of FIGS. 6 (a) and 6 (b), three and four gold nanoparticles are arranged rotationally symmetrically. Similarly, stronger electric field intensity amplification was observed than in the case of a single gold nanoparticle, and the region range of strong electric field intensity amplification was increased.

  With the above mechanism, when a plurality of metal fine particles are used for the probe molecule fixation field, the analyte molecules can be detected with ultra-high sensitivity, and a significant improvement in sensitivity as a biomolecule detection element can be achieved.

  In addition, the arrangement of the metal fine particles can be constructed so that the maximum fluorescence enhancement effect can be obtained with excitation light according to the type of fluorescent dye used. By changing the distance between the metal fine particles, the localized plasmon resonance wavelength is shifted. When the localized plasmon resonance wavelength and the excitation wavelength of the fluorescent molecule coincide, a high electric field enhancement, that is, a high fluorescence enhancement is obtained. Therefore, the metal fine particles may be arranged so that the excitation light and the plasmon resonance wavelength coincide with the type of fluorescent dye to be used.

  In the above example, the gold nanoparticles are arranged two-dimensionally on the surface of the substrate, but the gold nanoparticles may be arranged three-dimensionally on an uneven surface. For example, using a solution in which gold nanoparticles and a silane coupling agent are mixed, a strong fluorescence enhancement field can be obtained even when a film in which gold nanoparticles are three-dimensionally densely formed is formed by a sol-gel method. Alternatively, the same fluorescence enhancement field can be obtained by forming gold nano-shapes using gold vapor deposition or the like.

  In the above example, the probe molecule is immobilized on the metal fine particle for immobilizing the probe molecule. However, the fluorescence enhancement effect can be obtained even if the probe molecule is immobilized on the metal fine particle for the fluorescence enhancement field.

  Next, the case where the metal fine particle fixed substrate prepared through the steps described in the above (1) to (10) is used for DNA sequencing will be described. When used for DNA sequencing, as shown in FIG. 7, a group of fluorescence enhancing metal fine particles 702 and a probe fine particle fixing metal fine particle 703 are arranged in a lattice pattern on the surface of a substrate 701. In FIG. 7, metal nanoparticle groups are arranged in a grid shape, and the lattice-like lattice refers to lattices of various shapes such as a square lattice, a triangular lattice, a hexagonal lattice, a honeycomb lattice, and a rectangular lattice. In FIG. 7, the group of fine metal particles for enhancing fluorescence and the metal fine particles for fixing probe molecules are all arranged on a straight line, but they are not necessarily arranged on a straight line. You may form so that the line which passes along the gravity center of the metal microparticle group for fluorescence enhancement may take various angles with respect to a board | substrate.

(12) DNA sequencing evaluation: Fig. 8
First, as shown in FIG. 7, the group of fine particles for enhancing fluorescence and the fine metal particles for fixing probe molecules were arranged in a grid on the substrate surface by the steps described in the above (1) to (8). In step (2), when the electron beam is drawn, the resist opening pattern is repeatedly processed into a grid shape. In step (9), as shown in FIG. 8, probe molecules 802 for immobilizing a single molecule DNA 801 to be sequenced are arranged on a substrate 701 through metal fine particles 703. Reference numeral 702 denotes metal fine particles for fluorescence enhancement arranged in an axisymmetric manner. When fixing the probe molecule, the concentration of the probe molecule fixing solution is adjusted so that one probe molecule is fixed to the metal fine particle for fixing the probe molecule.

  Next, the single molecule DNA 801 to be sequenced is reacted with the probe molecule 802 on a one-to-one basis and fixed to the substrate. As a condition for reacting the single molecule DNA 801 to be analyzed with the probe molecule 802, the single molecule DNA is dissolved in a solution containing a salt such as NaCl, and this solution is brought into contact with the surface of the array substrate on which the probe molecule is fixed. . The reaction temperature is usually 20 ° C. to 80 ° C., and the reaction time is usually about 1 hour to 24 hours. In order for the single molecule DNA to be analyzed to react with the probe molecule, the probe molecule needs to have a reaction site with the single molecule DNA. For example, when the single molecule DNA to be analyzed has a PolyA sequence such as AAAAAAAAA, a probe molecule having a PolyT sequence having a continuous T such as TTTTTTTT which is a complementary sequence to this is used.

  Next, the size of the interstitial pitch L shown in FIG. 7 will be described. In DNA sequencing, as described in the background art, a DNA sequence is read by measuring fluorescence intensity. At the time of sequencing, it is necessary to independently measure the fluorescence from a fixed single molecule and the fluorescence from a single molecule DNA adjacent to the molecule. Therefore, the pitch L needs to be equal to or larger than the resolution of the fluorescence reading optical system. For the same reason, the value needs to be larger than the size of one pixel read by the CCD camera.

  As shown in FIG. 9, nucleotide 905 is extended to the tip of probe molecule 802 by one base by polymerase reaction with polymerase 904 using probe molecule 802 as a primer. In this reaction, nucleotides are dissolved in a solution containing a salt such as magnesium chloride, and this solution is brought into contact with the substrate. In order to prevent inactivation of the polymerase, which is an enzyme, dithiothreitol (DTT), glycerol, a surfactant and the like may be mixed in the above solution. As shown in FIG. 9, a fluorescent molecule 906 is bound to the extended nucleotide. By reading the fluorescence from the fluorescent molecule, it is determined whether or not the nucleotide has been extended or the type of the extended nucleotide, for example, A, T, C, and G.

  FIG. 10 shows a sequencing reading system. In this system, excitation laser light 1001 is incident from the back surface of the substrate 701 through the quartz prism 1002 under total reflection conditions. At the time of single base extension, the fluorescent molecule 906 bound to the extended nucleotide 905 is excited by evanescent light that oozes out to the side on which the single molecule DNA 801 is fixed out of the laser light incident under total reflection conditions. The generated fluorescence 1010 is measured by a high sensitivity CCD camera 1011 placed on the upper surface of the substrate.

  A specific apparatus configuration is shown in FIG. A laser light source 1102 for making the laser incident on the substrate 701 under total reflection conditions, a mirror 1104 and a lens 1105 for adjusting the incident angle to the quartz prism 1002, a filter 1106 for adjusting the intensity of incident light, and a fluorescent molecule Objective lens 1107 for collecting the fluorescence generated from the filter, filter 1108 for detecting only the fluorescence from the fluorescent molecule, CCD camera 1011, enzymes, fluorescent molecules, nucleotides etc. that are reagents for performing the sequencing reaction Sequencing device by flow cell 1110 for supply, flow controller 1111 for adjusting the type and amount of reagent supplied in the flow cell, and data analysis system 1112 for sequencing DNA sequences from fluorescence intensity change data Is configured.

  After the nucleotide is bound by the polymerase reaction, for example, the phosphate group of the nucleotide incorporated by the polymerase is cleaved. This will be described with reference to FIG. When the fluorescent molecule is bound to the end of the phosphate group of the nucleotide, the fluorescent molecule is removed away from the single molecule DNA 801 portion to be analyzed along with the cleavage of the phosphate group. After being removed, another type of nucleotide is reacted. For example, when a solution containing nucleotide A is first brought into contact with the substrate and A is extended by one base by a polymerase reaction, fluorescence is detected by the above-described reading system. If nucleotide A is not extended, no fluorescence is detected. From this measurement result, it can be seen that at the grid site where fluorescence is detected, the single molecule DNA to be analyzed has a T complementary to A in the analysis target portion. On the other hand, it can be seen that the analysis site does not have T at the grid site where no fluorescence is detected. Next, for example, after contacting a solution containing nucleotide C with the substrate, fluorescence is detected, and at each grid site, it is determined whether or not the portion to be analyzed of single molecule DNA has G complementary to C. Next, nucleotide T or G is reacted. By repeating these operations, the sequence of single-molecule DNA immobilized on each grid site is read. Alternatively, a solution containing four types of A, T, C, and G may be brought into contact with the substrate, and the state in which these nucleotides sequentially react may be read at each point in real time.

  Here, as a reagent used for single-base extension, a reagent in which a fluorescent dye is labeled on the phosphate part of dNTP is used, but a reagent in which a fluorescent dye is bound to purine and pyrimidine moieties, or a fluorescent dye is attached to the 3′OH end. The sequence can be similarly deciphered using the bound reagent.

  What is important here is that the fluorescence intensity is enhanced by the combined effect of the metal fine particle group 702 for enhancing fluorescence. The reason is as described in (11). Normally, when measuring fluorescence from a single fluorescent molecule, in order to measure with high sensitivity, it is necessary to devise such as using a device that increases the power density of excitation light and amplifies photons in the detection system, The fluorescence excitation and detection system becomes large and complicated. However, by using the fluorescence enhancement effect of the present invention, the fluorescence detection system can be designed in a compact manner. Further, since the exposure time can be greatly shortened, the detection throughput can be improved. Furthermore, since only the detection region can be locally enhanced in fluorescence, only the signal component can be enhanced without enhancing the noise component from the fluorescent molecules adsorbed non-specifically outside the detection region.

  By using the metal fine particle fixed substrate of the present invention, detection can be performed with a high S / N ratio, so that the accuracy of analysis can be improved at each stage and the detection throughput can be greatly improved. Furthermore, since the location (coordinates) of the fixed DNA to be analyzed is known in advance, a step for identifying the location, for example, adding a fluorescent label to the DNA to be analyzed in advance, and before starting the analysis The step of confirming the location of the DNA to be analyzed can be omitted by mapping.

  Here, the metal fine particles are used as the fixing sites for fixing the probe molecules. However, the probe molecules may be directly fixed to the substrate without using the metal fine particles. In this case, after fixing the fluorescence enhancing metal fine particles, the probe molecules are fixed starting from the amino group of the linker molecule coated on the site where the metal fine particles for fixing the probe molecules are fixed. For example, a molecule having an isothiocyanate group that is a functional group that reacts with an amino group is reacted, and the remaining isothiocyanate group is reacted with a probe molecule having an amino group at the end. Alternatively, a probe molecule having an NHS ester, epoxy group, carboxyl group, or aldehyde group at the terminal may be directly reacted with a functional group of the linker molecule.

  In the best mode for carrying out the present invention, a group of axially symmetrical metal particles for enhancing fluorescence is formed by two metal particles, but a group of metal particles in which three and four metal particles are arranged rotationally symmetrically. The same fluorescence enhancement effect can be obtained even when the is formed. For example, if four metal fine particles are arranged in a rotationally symmetrical manner and placed on the center of the metal fine particles for fixing probe molecules, the total number of metal fine particles per detection spot is five. Further, although the case where the metal fine particles are fixed on a flat surface is shown, a high fluorescence enhancement effect can be obtained in the same manner even when a metal fine particle 3D dispersion shape in which the metal fine particles are embedded in the substrate is formed.

  In the present invention, a regular dot pattern consisting of a linker molecule is formed on the surface of a carrier substrate using a lithography process, and a bond between the active group possessed by the linker molecule and the metal fine particle is used to form a metal fine particle fixing pattern. A substrate was formed. The lithography method is not limited to electron beam lithography, and near-field lithography can be used instead of electron beam lithography. However, in that case, a membrane mask is produced by electron beam lithography, and resist processing is executed by contact exposure using this mask. In this case, since the same pattern can be repeatedly produced with high throughput, a process with high mass productivity can be achieved. It is also possible to perform a regular dot pattern of linker molecules using nanocontact printing technology or nanoimprinting technology without using lithography. Alternatively, the gold nanopattern may be formed using lithography and a metal thin film forming technique.

  Next, the present invention will be described in detail with reference to examples, but examples in particular applied to DNA microarrays and DNA sequencers will be described. In addition, this invention is not limited to the following Example, It is a basic technique which contributes to the performance improvement of the fluorescence detection element which can be used for the detection of all biomolecules, such as a nucleic acid, protein, and a sugar chain. Further, the fluorescence detection element of the present invention is not limited to the detection of biomolecules, and can also be used when detecting chemical substances in general such as environmental hormones by the fluorescence method.

In this example, an example in which the biomolecule detection element of the present invention is used in a DNA microarray is shown. A DNA microarray was prepared by the following (Step 1) to (Step 8), and a hybridization reaction was performed using the DNA microarray in (Step 9).
(Process 1) Application process of positive electron beam resist on substrate surface: FIG. 12 (a)
As the carrier substrate 1201, a 4-inch Si substrate with a highly flat thermal oxide film 100 nm was used. The substrate was washed with a 0.1 wt% NaOH aqueous solution, further washed with a 0.1 wt% HCl aqueous solution, sufficiently rinsed with pure water, and then dried. Here, the positive resist used as the resist is a main chain cutting resist. The resist was diluted with anisole and coated using a spin coater. After coating, it was baked at 180 ° C. for 20 min in N ₂ flow to remove the solvent. In this example, the resist film thickness was sufficiently thin, and the film thickness was 60 nm (resist: anisole = 1: 3 dilution) in which no film reduction was observed by EB processing. Further, a conductive polymer (polyisothianaphthene sulfonate) solution was coated on the applied resist film 1202 to prevent the substrate from being charged during EB drawing. In this solution, a conductive polymer is made into colloidal particles and dispersed using a surfactant. After coating the conductive polymer 1203 using the same spin coater, it was baked at 100 ° C. for 10 min in an N ₂ flow to remove the solvent.

(Step 2) Opening by electron beam drawing and development: FIG. 12 (b)
The electron beam scanning field is divided into 60,000 steps in each of the x and y directions, and an electron beam having a spot diameter of about 2 to 3 nm is pulsed at each step. A desired pattern is formed by designating the electron beam irradiation at which step position using CAD software. The electron beam machining opening diameter needs to be equivalent to the metal fine particles to be fixed. In this example, gold nanoparticles having a diameter of 30 nm that can be stably fixed and have a fluorescence enhancement effect were used as the gold nanoparticles for fluorescence enhancement. In addition, gold nanoparticles with a diameter of 15 nm were used as gold nanoparticles for probe molecule fixation. The EB opening diameter for fixing gold nanoparticles was set to φ35 nm so that gold nanoparticles with a diameter of 30 nm could be isolated and fixed.

FIG. 13 shows a drawing pattern used in this example. Patterns of φ35 nm and φ20 nm were arranged in a lattice pattern at a pitch of 100 nm. At this time, d ′ was 55 nm (about 3.7 r). This drawing pattern was processed into an area of 200 μm square. In addition, 100 200 μm square processing areas were created on the substrate. The processing areas were arranged in a grid pattern at a pitch of 2 mm on the substrate. The field size was 150 μm square, and electron beam drawing was performed with an electron beam current of 5 × 10 ⁻¹¹ A.

  N-amyl acetate was used as a developing solution for dissolving the portion of the main chain that was cut by electron beam irradiation. Since the conductive polymer is coated on the outermost surface, this is first removed with pure water, then immersed in an n-amyl acetate solution at 25 ° C. for 15 seconds, developed, and then rinsed with a rinsing solvent Methyl isobutyl ketone 89% / It was rinsed with an 11% solution of Isopropyl alcohol. Through these series of processes, the opening hole 1204 for fixing the fluorescence enhancing gold nanoparticles having a diameter of 30 nm and the opening hole 1205 for fixing the gold nanoparticles having a diameter of 15 nm were processed. The opening hole was confirmed with an electron microscope.

(Step 3) Formation of an aminated layer (metal fine particle fixed dots): FIG. 12 (c)
The substrate on which the electron beam resist opening pattern was formed was immersed in a 3-aminopropyltrimthoxysilane (APTMS) solution that was a silane coupling agent. Methanol was used as a solvent for diluting APTMS. The reaction temperature was room temperature and the reaction time was 5 minutes. After the reaction, the product was thoroughly washed with methanol and dried. As a result, APTMS is adsorbed on the bottom of the opening hole. This substrate was annealed at 80 ° C. for 2 hours. By this annealing process, a siloxane bond is formed between APTMS and the SiO _{2 at} the bottom of the aperture, and the aperture bottom is stably aminated. On the other hand, since APTMS is adsorbed on the resist, APTMS remains on the resist.

(Step 4) Immobilization of gold nanoparticles for fluorescence enhancement: FIG. 12 (d)
The entire surface of the gold nanoparticle having a diameter of 30 nm was coated with NHS ester 1207. Specifically, the entire surface of the gold nanoparticle was coated with a molecule having a thiol group that reacts with gold at one end and an NHS ester at the other end. Next, the coated gold nanoparticle citric acid solution was allowed to act on the substrate having the aminated bottom of the opening hole. The reaction temperature is room temperature and the reaction time is 20 hours. At this time, the gold nanoparticle is immobilized by reacting the surface NHS ester with the amino group on the surface to form an amide bond. After the gold nanoparticles were reacted, they were thoroughly washed with pure water.

(Step 5) Immobilization of gold nanoparticles for probe DNA immobilization: FIG. 12 (e)
A gold nanoparticle citric acid solution having a diameter of 15 nm was allowed to act on the substrate. The reaction temperature is room temperature and the reaction time is 20 hours. The gold nanoparticle surface is covered with citric acid and has a negative charge. On the other hand, since the aminated surface has a positive charge, the gold nanoparticle attracts the surface amino group, and the gold nanoparticle 1208 is fixed. After the gold nanoparticles were reacted, they were thoroughly washed with pure water.

(Step 6) Resist peeling: FIG. 12 (f)
The substrate was immersed in dimethylacetamide for 3 minutes to remove the resist. At this time, a sufficient amount of dimethylacetamide was used so that the gold nanoparticles adhered on the resist did not reattach to the substrate. After immersion in dimethylacetamide, ethanol washing and pure water washing were sufficiently performed. By this process, the gold nanoparticles adsorbed on the resist are also lifted off, and only the gold nanoparticles fixed in the openings remain.

(Step 7) Immobilization of adsorption-inhibiting molecular layer: FIG. 12 (g)
A substrate on which gold nanoparticles 30 nm were arranged in a lattice shape was immersed in ethanol and dried, and then coated with an epoxy group. Epoxy groups were coated on regions where gold nanoparticles were not fixed by reacting the substrate for 2 hr at 85 ° C. in a 7.7% dehydrated toluene solution of 3-Glycidoxypropyltrimethoxysilane (GOPS) to which Diisopropylethylamine 0.8% was added. After the reaction, it was washed with dehydrated toluene and ethanol and dried.

(Step 8) Immobilization of probe DNA: FIG. 12 (h)
After the substrates coated with epoxy groups in Steps 6 and 7 were washed with ethanol, a 50-mer single-stranded probe DNA solution having a substrate surface and a thiol group at the end was spotted on each 200 μm square area as a gold nanoparticle coating region. The DNA used had one type of base sequence, and one type of probe DNA (1209) was spotted at 100 points. The base sequence from the 5 ′ end side is shown below.
AGTCGAGCGGTAGCACAGAGAGCTTGCTCTCGGGTGACGAGCGGCGGACG

Probe DNA The reaction solution is a solution that dissolve the 50 mer 1-stranded DNA in 1M Phosphate buffer (pH 6.7) having a thiol group at the 5 'end. The probe DNA reaction solution and the gold nanoparticles for probe fixation were reacted at room temperature for 24 hours under 100% humidity, rinsed with 2 × SSC, 0.1% SDS solution, washed twice with pure water, and dried.

(Step 9) Hybridization A single-stranded target DNA having a sequence completely complementary to the probe DNA and labeled with the fluorescent molecule Cy3 at the 3 ′ end was hybridized on the substrate on which the probe DNA was immobilized. As a hybridization solution, a mixture of 5 × SSC (Standard Saline Citrate) and 0.5% SDS solution (Sodium Dodecyl Sulphate) was used. The amount of target DNA was changed from 0.1 amol to 1 fmol, and hybridization was performed at 42 ° C. for 20 hours, respectively. Then, it was washed with 2 × SSC, 0.1% SDS solution and 2 × SSC solution and dried. Excitation light was incident on the dried substrate surface using a fluorescence scanner, and the fluorescence intensity from the surface was measured. The wavelength of the excitation laser beam was 532 nm, and this laser beam was scanned in the spot area. The generated fluorescence was detected with a photomultiplier tube. The measured fluorescence intensity is proportional to the amount of target DNA subjected to the hybridization reaction.

  On the other hand, a substrate on which a probe DNA was immobilized was prepared by a conventional single-stranded DNA immobilization method on a Si substrate. After cleaning the Si substrate in the same manner as in the above (Step 1), the surface of the substrate was aminated by coating APTMS as a silane coupling agent by the method shown in (Step 3). Thereafter, PDC (phenylenediisothiocyanate) having an isothiocyanate group was reacted with the terminal amino group. Further, this isothiocyanate group and probe DNA having an amino group at the 5 'end were reacted and immobilized. The sequence of the probe DNA used is the same as the DNA sequence shown in (Step 8). The reaction solution used when the probe DNA was reacted was a solution in which 1 μM of the probe DNA was dissolved in a weak alkaline carbonate buffer. This solution was spotted on an isothiocyanated substrate. The number of spot points is 100, and the spot diameter is 200 μmφ. After reacting at room temperature for 24 hours and 100% humidity, the substrate was rinsed with 2 × SSC, 0.1% SDS solution, washed twice with pure water, and then dried. After the substrate was hybridized with the target DNA with fluorescent molecules by the method described above, the fluorescence intensity was measured.

  FIG. 14 shows the relationship between the average value of fluorescence intensity and the amount of target DNA. As a result, the detection sensitivity of the array of the present invention in which the gold nanoparticle group for fluorescence enhancement was fixed was improved as compared with the conventional array. In the conventional array, 100 amol is the detection limit, whereas in the array in which the fluorescence enhancement gold nanoparticle group is fixed, DNA of 0.1 amol or less can be detected. This is because large electric field intensity amplification can be obtained by the fixed gold nanoparticle group, and a larger fluorescence enhancement effect can be obtained.

  Further, FIG. 15 shows the fluorescence detection results when the lengths of the probe DNA and the target DNA having a sequence completely complementary to the probe DNA are changed. Since the fluorescent label is modified at the 5 'end of the target DNA, changing the length of the target DNA changes the distance between the fluorescent molecule and the center of gravity of the fluorescence enhancing gold nanoparticle group. As a result, it was found that when the distance between the center of gravity of the gold nanoparticle group and the fluorescent molecule was within 60 nm (4r), the fluorescence was greatly enhanced, and even within 90 nm (6r).

  In this example, an example in which the biomolecule detection element of the present invention is used for DNA sequencing is shown. In order to perform DNA sequencing, a DNA sequencing substrate was prepared according to Step 1 to Step 8 shown in Example 1.

  In this example, a quartz substrate was used instead of a Si substrate. In the opening formation by electron beam drawing and development in step 2, as shown in FIG. 16, a processing pattern of φ35 nm for arranging gold nanoparticles with a diameter of 30 nm for fluorescence enhancement and a gold nanometer with a diameter of 15 nm for probe DNA immobilization Opening patterns with a diameter of 20 nm for arranging particles were arranged in a lattice shape at a pitch of 1 μm. With this pattern, gold nanoparticles were arranged in a 1 μm pitch lattice. In this case, if one pixel of the CCD camera for detecting the fluorescence intensity is 1 μm square, the fluorescence signal from one molecule of DNA can be read by one pixel at the time of sequencing. For example, the fluorescence signal from one DNA molecule may be read with 4 pixels, or the fluorescence signal from one DNA molecule may be read with 9 pixels.

  As the probe DNA to be immobilized in Step 8, as shown in FIG. 17, an oligonucleotide 1702 having a thiol group at the 5 ′ end and 20 consecutive T sequences (TTTTT TTTTT TTTTT TTTTT (PolyT 20mer)) was used. In some cases, the oligonucleotide is immobilized by binding a thiol group at the end of the oligonucleotide and gold nanoparticles.

Thereafter, the DNA to be analyzed (1703) is hybridized to the probe DNA. Specifically, as the DNA to be analyzed, DNA (1703) having A sequence continuously from the 3 ′ end and having the following sequence was hybridized (see FIG. 17).
AAAAAAAAAAAAAAAAAAAAAGTCGAGCGGTAGCACAGAGAGCTTGCTCTCGGGTGACGAGCGGCGGACG

Next, the DNA to be analyzed was sequenced using the above PolyT20mer sequence, which is the probe DNA, as a primer. The prepared gold nanoparticle array substrate was reacted with four types of nucleotides (1704) having fluorescent label Cy3 (1705) at the phosphate group end of nucleotide triphosphate using a polymerase. The reaction solution used during the reaction was a 10 mM Tris-HCl, 5 mM MgCl ₂ solution. The nucleotide concentration is 1 μM. By the polymerase reaction, nucleotides having a base complementary to the base sequence of DNA bind to DNA. In the case of this example, when a solution in which nucleotide C is dissolved is reacted with the substrate, nucleotide C is bound. This is because nucleotide C binds to G adjacent to the PolyA sequence in the DNA sequence to be analyzed.

  Using the fluorescence detection system shown in FIGS. 10 and 11, a fluorescence image in the polymerase reaction process is acquired. The fluorescence intensity was measured from the top surface of the substrate with a high sensitivity CCD camera. When excitation light of a fluorescent molecule is applied under total reflection conditions at the time of detection, fluorescence is detected from the site where nucleotide C (1704) with fluorescent molecule is bound. When the nucleotide binds to the DNA, the phosphate group of the nucleotide incorporated by the polymerase is cleaved. As a result, the fluorescent molecule bound to the end of the phosphate group is removed from the DNA portion to be measured. Next, when the substrate is reacted with a solution in which nucleotide A is dissolved, nucleotide A binds to T adjacent to the binding point of nucleotide C. Upon binding, fluorescence can be detected. Next, when the substrate is reacted with a solution in which nucleotide T is dissolved, nucleotide T does not bind to DNA. Since the next binding site on the DNA side is C and is not complementary to nucleotide T, it was confirmed that nucleotide T did not bind and fluorescence was not detected.

  These procedures were repeated and it was possible to read the DNA sequence in each grid as well. That is, fluorescence signals from individual DNA fixing sites can be detected separately from signals from other DNA sites, and it was possible to read the DNA sequence repeatedly without producing ineffective DNA.

  In this example, a reagent in which a fluorescent dye is labeled on the phosphate portion of dNTP was used as a reagent for single base extension, but a reagent in which a fluorescent dye is bound to a purine or pyrimidine moiety, or a fluorescence at the 3′OH end. The same effect can be obtained by using a reagent to which a dye is bound.

  Further, FIG. 18 shows the result when fluorescence is detected in the state of FIG. The detected fluorescence intensity was higher than that measured by a conventional method in which gold nanoparticles were not immobilized. This is because the fluorescence intensity is greatly increased by the fluorescence enhancement effect of the gold nanoparticle group. Therefore, it is possible to perform sequencing with higher sensitivity by using the element of the present invention. Alternatively, sequencing can be performed using a simple fluorescence detection system. Further, high throughput detection is possible by reducing the exposure time.

  The present invention can be applied as a DNA microarray for quantitative analysis of DNA and mRNA, DNA sequencing for reading DNA or mRNA sequences, and a protein chip for analyzing proteins. Furthermore, the present invention is applicable not only to biomolecules but also to detection elements for detecting general chemical substances using a fluorescence method.

The figure which shows the basic composition of the fluorescence detection element by this invention. The figure which shows the manufacturing process of the fluorescence detection element by this invention. The figure which imaged DNA hybridization reaction using the fluorescence detection element by this invention. The figure which shows the system used for calculation of the electric field strength which arises around a gold nanoparticle. The figure which shows the calculation result of the electric field strength which arises around a gold nanoparticle. The figure which shows arrangement | positioning of the gold nanoparticle when using several gold nanoparticle for fluorescence enhancement. Diagram showing fine metal particle immobilization substrate used for DNA sequencing The figure which shows the detail of the metal fine particle fixed board | substrate surface used for DNA sequencing. Schematic diagram of DNA sequencing reaction. The figure which shows a DNA sequencing detection system. The figure which shows a DNA sequencing apparatus. The conceptual diagram which shows the specific example of the manufacturing process of the fluorescence detection element by this invention. The figure which shows the electron beam drawing pattern used for DNA microarray preparation in the manufacturing process of the fluorescence detection element by this invention. The figure which shows the relationship between the fluorescence intensity detected when DNA is hybridized, and the amount of target DNA. The figure which shows the relationship between the fluorescence intensity detected when DNA is hybridized, and target DNA chain length. The figure which shows the electron beam drawing pattern used for the board | substrate for DNA sequencers by the manufacturing process of the fluorescence detection element by this invention. The figure which shows a DNA sequencing sequence and a sequencing reaction. The figure which shows the fluorescence detection result at the time of DNA sequencing.

Explanation of symbols

101: carrier substrate, 102: metal fine particle fixed dot for fluorescence enhancement, 103: metal fine particle fixed dot for probe molecule fixation, 104: metal fine particle for fluorescence enhancement, 105: metal fine particle for probe molecule fixation, 106: probe molecule, 107: Adsorption inhibition layer, 108: shaft, 201: carrier substrate, 202: electron beam resist, 203: resist opening for fixing metal particles for fluorescence enhancement, 204: resist opening for fixing metal particles for probe molecule fixation, 205: Metal fine particles for fluorescence enhancement, 206: Reaction blocking layer, 207: Metal fine particles for immobilizing probe molecules, 304: Probe DNA, 305: Fluorescent molecules, 306: Target DNA, 307: Complementary hydrogen bonding, 401: Gold nanoparticles 402: Glass substrate, 403: Laser light, 404: Water, 405: Evanescent light electric field direction 503: region with high electric field strength, 504: region with electric field strength of 503 region or less but high, 505: region with electric field strength of 504 region or less but high, 507: region with high electric field strength, 508: electric field strength 507 region or less but high region, 509: electric field strength of 508 region or less but high region, 510: electric field strength of 509 region or less but high region, 701: glass substrate, 702: fluorescence enhancement metal fine particles, 703: Metal fine particles for probe molecule fixation, 801: DNA for sequence analysis (sequencing), 802: Probe molecule, 904: Polymerase, 905: Nucleotide, 906: Fluorescent molecule, 1001: Excitation laser beam, 1002: Prism, 1010: Fluorescence, 1011: CCD camera, 1102: laser light source, 1104: mirror, 1105: lens, 106: filter, 1107: objective lens, 1108: filter, 1110: flow cell, 1111: flow controller, 1112: data analysis system, 1201: substrate, 1202: electron beam resist, 1203: conductive polymer, 1204: gold for fluorescence enhancement Resist opening for fixing nanoparticles 1205: Resist opening for fixing gold nanoparticles for fixing probe molecules, 1206: Gold nanoparticles for enhancing fluorescence, 1207: Reaction blocking layer, 1208: Gold nanoparticles for fixing probe molecules Particles, 1208: Probe molecules, 1601: Substrate, 1602: Resist opening for fixing gold nanoparticles for fluorescence enhancement, 1603: Resist opening for fixing gold nanoparticles for fixing probe molecules, 1701: Gold nanoparticles, 1702: Probe molecule Poly T continuous 20 sequences, 1703: Analysis Elephant single molecule DNA, 1704: nucleotide C, 1705: fluorescent molecule Cy3

Claims (18)

A plurality of metal microparticles and probe molecules having a radius r capable of obtaining a fluorescence enhancement effect are regularly arranged on the surface of the substrate,
A plurality of detection spots each including a plurality of the metal fine particles and probe molecules are provided,
Each detection spot includes a plurality of the metal fine particles arranged adjacent to each other so that the center distance d satisfies 2r ≦ d ≦ 4r, and a probe fixed in a region surrounded by the plurality of metal fine particles arranged adjacent to each other A biomolecule detection element comprising a molecule.   The biomolecule detection element according to claim 1, wherein the metal fine particles are arranged in a rotationally symmetrical manner on the surface of the substrate in the detection spot.   2. The biomolecule detection element according to claim 1, wherein the probe molecule is within a distance of 6r from the center of gravity of the two metal fine particles closest to the probe molecule.   2. The biomolecule detection element according to claim 1, wherein the metal fine particles are made of a metal belonging to noble metals, an alloy of metals belonging to noble metals, or a laminate of metals belonging to noble metals.   The biomolecule detection element according to claim 1, wherein the number of metal fine particles contained in the one detection spot is 2 or more and 5 or less.   The biomolecule detection element according to claim 1, wherein the probe molecule is a nucleic acid.   The biomolecule detection element according to claim 1, wherein the probe molecule is fixed to metal fine particles having a radius r ′ different from the radius r. The biomolecule detection element according to claim 7 , wherein r ′ <r. 8. The biomolecule detection element according to claim 7 , wherein the metal fine particle having the radius r ′ is located between the plurality of metal fine particles having the radius r. A plurality of metal fine particles with a radius r and a probe molecule that can obtain a fluorescence enhancement effect are regularly arranged on the substrate surface, and a plurality of the metal fine particles arranged adjacent to each other so that the center distance d satisfies 2r ≦ d ≦ 4r; In the method of manufacturing a biomolecule detection element having a plurality of detection spots including probe molecules fixed in a region surrounded by the plurality of metal particles arranged adjacent to each other,
Fixing metal particles on the substrate surface;
Immobilizing adsorption-inhibiting molecules on the substrate surface;
Immobilizing probe molecules on the metal fine particles;
A method for producing a biomolecule detection element, comprising: 11. The method of manufacturing a biomolecule detection element according to claim 10 , comprising the steps of fixing first metal fine particles having a radius r to the substrate and fixing second metal fine particles having a radius r ′ smaller than the radius r. A method for producing a biomolecule detection element, wherein the probe molecule is fixed to the second metal fine particle having the radius r ′. The method of manufacturing a biomolecule detection element according to claim 10, wherein the number of the metal fine particles contained in one detection spot is 2 or more and 5 or less, and the metal fine particles rotate on the surface of the substrate in the detection spot. A method for producing a biomolecule detection element, characterized by being arranged symmetrically. A plurality of metal microparticles and probe molecules having a radius r capable of obtaining a fluorescence enhancement effect on the substrate surface are regularly arranged, and the plurality of metal microparticles are arranged adjacently so that the center distance d satisfies 2r ≦ d ≦ 4r, Using a biomolecule detection element in which the probe molecule is within a distance of 6r from the center of gravity of the plurality of metal particles arranged adjacent to each other,
Reacting the probe molecule of the biomolecule detecting element with a fluorescently labeled sample biomolecule;
Irradiating the biomolecule detection element after the reaction with excitation light;
And a step of detecting fluorescence generated from a region where the probe molecule is fixed. 14. The biomolecule detection method according to claim 13 , wherein the plurality of metal particles arranged adjacent to each other are arranged rotationally symmetrically on the surface of the substrate. A plurality of metal microparticles having a radius r and a probe nucleic acid molecule capable of obtaining a fluorescence enhancement effect are regularly arranged on the substrate surface, and the plurality of metal microparticles are arranged adjacent to each other so that the center distance d satisfies 2r ≦ d ≦ 4r. Using a biomolecule detection element in which the probe nucleic acid molecule is within a distance of 6r from the center of gravity of the plurality of metal fine particles arranged adjacent to each other,
Reacting the probe nucleic acid molecule and the nucleic acid molecule to be sequenced of the biomolecule detection element;
Reacting the sequenced nucleic acid molecule with a fluorescently labeled nucleotide;
Irradiating the biomolecular element with excitation light;
And a step of detecting fluorescence generated from the labeled nucleotide. The biomolecule detection method according to claim 15 , wherein the plurality of metal particles arranged adjacent to each other are arranged rotationally symmetrically on the surface of the substrate. In a sequencing apparatus that performs sequencing of nucleic acid molecules using a biomolecule detection element,
A plurality of metal microparticles having a radius r and a probe nucleic acid molecule capable of obtaining a fluorescence enhancement effect are regularly arranged on the substrate surface, and the plurality of metal microparticles are arranged adjacent to each other so that the center distance d satisfies 2r ≦ d ≦ 4r. A holding unit for holding a biomolecule detection element in which the probe nucleic acid molecule is within a distance of 6r from the center of gravity of the plurality of adjacently arranged metal fine particles, and the nucleic acid molecule to be sequenced is fixed to the probe nucleic acid molecule;
A flow cell for supplying reagents necessary for sequencing to the biomolecule detection element;
An irradiation system for irradiating the biomolecule detection element with excitation light;
A detection system for detecting fluorescence from the biomolecule detection element;
And a data analysis system for performing sequencing from fluorescence detection data. 18. The sequencing apparatus according to claim 17 , wherein the plurality of adjacently arranged metal fine particles are arranged rotationally symmetrically on the surface of the substrate.

Images