JP4942044B2 - Psychiatric disorder-related genes and their use - Google Patents

Description

  The present invention relates to the use of novel psychiatric disorder-related genes in the medical field and research field. Specifically, the present invention provides a screening method using a novel psychiatric disorder-related gene, an antipsychotic drug, and the like.

  As the population ages, the number of patients with mental disorders is expected to continue to increase. In addition, the social structure has changed and it is now called the `` stress era '', and it is exposed to various stresses on a daily basis from children to adults. Mental abnormalities caused by stress are a problem of specific age groups. is not. On the other hand, addiction related to stimulants, that is, drug addiction is a big social problem.

Under these circumstances, the development of treatments for mental disorders such as schizophrenia and drug addiction is an extremely urgent issue. However, no radical treatment has been established. By the way, in order to perform an appropriate therapeutic treatment, it is important to accurately and objectively determine or grasp the presence / absence of a disease and a disease state. However, at present, the diagnosis of mental disorders largely depends on the patient's own declaration, so there are many cases where a correct diagnosis cannot be made. Empirical facts also indicate that due to the variety of pathological conditions, it is sometimes mistaken to select an appropriate treatment. On the other hand, if the risk of morbidity can be evaluated in advance, it is hoped that the number of patients will be significantly reduced by taking preventive measures, and the contribution to the medical community is immeasurable. In addition, there are many unclear points regarding the onset and progression mechanism of mental disorders, and the accumulation of future research results is expected.
In view of the above problems, an object of the present invention is to provide a useful means for treatment and diagnosis of mental disorders. With regard to therapeutic use, the present invention aims to contribute to the establishment of a therapeutic method by providing a method for selecting drug candidates for mental disorders. With regard to diagnostic use, in particular, it is an object to provide a means that enables determination of the presence or absence of disease, grasp of a disease state, and evaluation of disease risk. Another object of the present invention is to provide a means that is directly effective in treating mental disorders. Another object of the present invention is to provide a research tool effective for research purposes such as investigation of the cause of mental disorders.

Under the above objective, the present inventors tried to identify genes involved in mental disorders. First, we prepared mice with mental disorders associated with drug dependence, and selected genes associated with the development of mental disorders. Here, mice administered with methamphetamine show excessive momentum, but the daily increase in the amount of exercise increases. This can be regarded as a mental disorder associated with drug dependence. A search was made for genes whose expression level was markedly increased in the nucleus accumbens of this mouse. As a result, three new candidate genes have been found. As a result of further research, there was a clear relationship between the expression level of these genes and symptoms characteristic of drug addiction, confirming that these three genes are related to mental disorders. . That is, it succeeded in identifying a novel gene related to mental disorders. This makes it possible to develop drugs for mental disorders using the gene as a target molecule, while also making it possible to study the onset and progression mechanisms of mental disorders.
The present inventors further conducted a homology search using a public database under the expectation that a human homologous gene exists for a gene that was successfully identified. As a result, the presence of human homologous genes for each gene was confirmed. That is, the present inventors succeeded in identifying a human gene that is considered to be related to a mental disorder. These genes can be used in the treatment or diagnosis of psychiatric disorders (including onset risk diagnosis), in the development of drugs for psychiatric disorders, and in the investigation of the onset or progression mechanism of psychiatric disorders, and are very useful. Very expensive.
The present invention is mainly based on the above results or knowledge, and provides the following configuration. That is, the first aspect of the present invention is a method for screening a compound effective for mental disorders, comprising: (1) a gene having the base sequence of SEQ ID NO: 1, a gene having the base sequence of SEQ ID NO: 2, Preparing a cell expressing a gene having a base sequence and a gene (target gene) selected from the group consisting of these homologous genes, (2) exposing the test compound to the cell, and (3) a test compound Measuring the expression level of the target gene in the cell after exposure to (4), and (4) determining a change in the expression level of the target gene due to exposure of the test compound.
In one embodiment of the present invention, a screening method using an animal individual is provided. The screening method includes (i) a step of preparing a non-human animal, (ii) a step of administering a test compound to the non-human animal, and (iii) after administration of the test compound, in the central nervous system tissue of the non-human animal. A gene (target gene) selected from the group consisting of a gene having the base sequence of SEQ ID NO: 1, a gene having the base sequence of SEQ ID NO: 2, a gene having the base sequence of SEQ ID NO: 3, and homologous genes thereof Measuring the expression level, and (iv) determining a change in the expression level of the gene of interest by administration of the test compound.
In one embodiment of the present invention, a non-human animal exhibiting a psychiatric disorder is used as the non-human animal.
In the screening method of the present invention, for example, a mouse is used as a non-human animal. In this case, the gene to be detected is the gene having the base sequence of column number 1, the gene having the base sequence of sequence number 2, or the gene having the base sequence of sequence number 3.
The screening method of the present invention, in a preferred form thereof, aims to select and identify compounds effective for drug dependence.
Another aspect of the present invention relates to the application of psychiatric disorder-related genes to diagnostic applications. In this aspect, a method for acquiring information for psychiatric disorder diagnosis is provided. The method includes: a) preparing a biological sample collected from a subject; and b) a gene having the base sequence of SEQ ID NO: 4, a gene having the base sequence of SEQ ID NO: 5, and a gene having the base sequence of SEQ ID NO: 6. And measuring the expression level in the biological sample of a gene selected from the group consisting of these natural variants.
Yet another aspect of the present invention relates to the application of psychiatric disorder-related genes to therapeutic uses. In this aspect, a target of a gene selected from the group consisting of a gene having the base sequence of SEQ ID NO: 4, a gene having the base sequence of SEQ ID NO: 5, a gene having the base sequence of SEQ ID NO: 6, and their natural variants An antipsychotic drug comprising a compound that increases the expression level in a tissue is provided.
In one embodiment of the present invention, as an active ingredient of an antipsychotic drug, an isolated protein having the amino acid sequence of SEQ ID NO: 10, an isolated protein having the amino acid sequence of SEQ ID NO: 11, the amino acid sequence of SEQ ID NO: 12 Isolated proteins having these, natural variants thereof, isolated nucleic acids encoding the amino acid sequence of SEQ ID NO: 10, isolated nucleic acids encoding the amino acid sequence of SEQ ID NO: 11, amino acid sequence of SEQ ID NO: 12 And a compound selected from the group consisting of an isolated nucleic acid encoding and an isolated nucleic acid encoding the natural variant.
A further aspect of the present invention relates to the application of psychiatric disorder-related genes to research use. In this aspect, a reagent for researching mental disorders containing an isolated nucleic acid having any one of the nucleotide sequences of SEQ ID NOs: 1 to 6 or a kit containing the same is provided.
The present invention further provides an expression vector for treating psychiatric disorders or for researching psychiatric disorders, which retains a nucleic acid encoding any one of the amino acid sequences of SEQ ID NOs: 7 to 12. The present invention also provides an isolated antibody for treating psychiatric disorders, diagnosing psychiatric disorders, or researching psychiatric disorders, against a protein comprising any one of the amino acid sequences of SEQ ID NOs: 7 to 12. In a preferred embodiment, the antibody of the present invention has a specific binding property to a peptide consisting of the amino acid sequence of SEQ ID NO: 19 or 20.

It is a graph which shows that the amount of spontaneous exercise increases by administering methamphetamine continuously to a mouse. Mice were given methamphetamine (2 mg / kg, s.c.) for 6 days. The results are shown as mean ± standard error (n = 20-30). * P <0.05 vs saline-administered group. Significant differences were observed in repeated two-way analysis of variance. It is the list | wrist of the gene by which the significant increase in expression was recognized in the mouse nucleus accumbens as a result of the screening. The result of BLAST search based on the base sequence of Gene1 is shown. In the lower column, primers for specifically amplifying only a partial region are shown. The result of BLAST search based on the base sequence of Gene2 is shown. In the lower column, primers for specifically amplifying only a partial region are shown. It is a figure which shows the expression change of Gene1 mRNA after methamphetamine continuous administration. Mice received methamphetamine (2 mg / kg, s.c.) for 6 days and were decapitated 2 hours after the last dose (n = 4-5). It is a figure which shows the expression change of Gene1 mRNA after the methamphetamine continuous administration in the magnitude | size of Gene1 and a nucleus accumbens. Mice were administered methamphetamine (2 mg / kg, s.c.) for 6 days and decapitated 2 hours after the final administration (n = 4-5). The expression change of Gene1 mRNA was examined by Northern hybridization. Data were corrected using GAPDH mRNA. The expression change of Gene2 mRNA after methamphetamine continuous administration is shown. Mice were administered methamphetamine (2 mg / kg, s.c.) for 6 days and decapitated 2 hours after the final administration (n = 4-5). It is a figure which shows the expression change of Gene2 mRNA after the methamphetamine continuous administration in the size of Gene2, and nucleus accumbens. Mice were administered methamphetamine (2 mg / kg, s.c.) for 6 days and decapitated 2 hours after the final administration (n = 4-5). The expression change of Gene2 mRNA was examined by Northern hybridization. Data were corrected using GAPDH mRNA. It is a figure which shows the expression change of Piccolo mRNA in the nucleus accumbens after methamphetamine administration. Mice were administered methamphetamine (2 mg / kg, subcutaneous administration) for 6 days, and the nucleus accumbens from the brain taken 24 hours after the final administration was used as a sample. It is a figure which shows the expression change of Gene1 mRNA after a methamphetamine single time and continuous administration. Mice were administered methamphetamine (2 mg / kg, s.c.) for 6 days and decapitated 2 hours after the final dose. The results are shown as mean ± standard error (n = 8). * P <0.05-pair physiological saline administration group. It is a figure which shows the expression change of Gene2 mRNA after a methamphetamine single time and continuous administration. Mice were administered methamphetamine (2 mg / kg, s.c.) for 6 days and decapitated 2 hours after the final dose. The results are shown as mean ± standard error (n = 8). * P <0.05-pair physiological saline administration group. It is a figure which shows the expression change of Piccolo (Gene3) mRNA after the methamphetamine treatment in a mouse | mouth. Mice were given a single continuous dose of methamphetamine (1 mg / kg, subcutaneous administration) for 6 days. The sample was decapitated 2 hours after the final administration and used as a sample. The number of individuals was 5 to 8 in each group. * P <0.05-pair physiological saline administration group. The figure which shows the expression level of Gene1 in each mouse | mouth biological tissue. It is a figure which shows the effect of Gene1 antisense oligonucleotide in methamphetamine induction | guidance | derivation of the spontaneous exercise moment enhancement. Mice were administered methamphetamine (1 mg / kg, s.c.) for 5 days. Spontaneous exercise was measured for 2 hours. Right ventricle (AP-0.5 mm, ML +1.0 mm from bregma, DV-2.0 mm from the skull) with Gene1 antisense oligonucleotide (Gene1-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene1-SC ), Artificial cerebrospinal fluid (CSF) was infused continuously by osmotic pump. The results are shown as mean ± standard error (n = 5-7). Significant differences were observed in repeated two-way analysis of variance. * P <0.05-pair physiological saline + CSF-treatment group. # P <0.05-pair physiological saline + Gene1-SC-treatment group. It is a figure which shows the effect of the Gene2 antisense oligonucleotide in methamphetamine induction | guidance | derivation of the spontaneous exercise moment enhancement. Mice were administered methamphetamine (1 mg / kg, s.c.) for 5 days. Spontaneous exercise was measured for 2 hours. Right ventricle (AP-0.5 mm, ML +1.0 mm from bregma, DV-2.0 mm from the skull) with Gene2 antisense oligonucleotide (Gene2-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene2-SC ), Artificial cerebrospinal fluid (CSF) was continuously infused by an osmotic pump. The results are shown as mean ± standard error (n = 3-5). It is a figure which shows the effect of Gene1 antisense oligonucleotide in formation of place preference by methamphetamine. During conditioning, mice were administered methamphetamine (0.3 mg / kg, s.c.) or saline. Right ventricle (AP-0.5 mm, ML +1.0 mm from bregma, DV-2.0 mm from the skull) with Gene1 antisense oligonucleotide (Gene1-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene1-SC ), Artificial cerebrospinal fluid (CSF) was continuously infused by an osmotic pump. The results are shown as mean ± standard error (n = 5-12). * P <0.05-pair physiological saline-treatment group. # P <0.05-pair methamphetamine + CSF-treatment group and methamphetamine + Gene1-SC-treatment group. It is a figure which shows the effect of Gene2 antisense oligonucleotide in formation of place preference by methamphetamine. During conditioning, mice were administered methamphetamine (0.3 mg / kg, s.c.) or saline. Right ventricle (AP-0.5 mm, ML +1.0 mm from bregma, DV-2.0 mm from the skull) with Gene2 antisense oligonucleotide (Gene2-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene2-SC ), Artificial cerebrospinal fluid (CSF) was continuously infused by an osmotic pump. The results are shown as mean ± standard error (n = 4-8). * P <0.05-pair physiological saline-treatment group. # P <0.05-pair methamphetamine + CSF-treatment group. It is a figure which shows the influence of endogenous Piccolo (Gene3) with respect to methamphetamine-induced reverse tolerance. Piccolo antisense oligonucleotide (antisense concentration 0.6 nmol / 6 μl / day), sense oligonucleotide (sense concentration 0.6 nmol / 6 μl / day), and artificial cerebrospinal fluid were continuously infused into the ventricle using an osmotic minipump. The administration site was 0.5 mm backward from Bregma, 1 mm left, and 2 mm deep. Methamphetamine was administered for 6 days. The number of individuals was 4-5. The figure which shows the expression change of Gene1 mRNA by the methamphetamine continuous administration in the Gene1 antisense oligonucleotide injection treatment mouse | mouth. * P <0.05-pair physiological saline + CSF-treatment group. # P <0.05-pair physiological saline + Gene1-SC-treatment group. $ P <0.05 vs saline + Gene1-AC-treatment group. + P <0.05-pair methamphetamine + Gene1-SC-treatment group. The figure which shows the effect of the dopamine D1 receptor antagonist R (+)-SCH23390 and the dopamine D2 receptor antagonist raclopride in the expression increase of methamphetamine induction Gene1 mRNA in the nucleus accumbens. * P <0.05 vs vehicle / saline-administered group. # P <0.05 vs vehicle / methamphetamine-administered group. The figure which shows the expression change of TNF- (alpha) mRNA by the methamphetamine continuous administration in a Gene1 antisense oligonucleotide injection | pouring mouse | mouth. * P <0.05-pair physiological saline-administration group. # P <0.05-pair physiological saline + CSF-treatment group and physiological saline + Gene1-SC-treatment group. $ P <0.05 vs methamphetamine + Gene1-SC treatment group. The figure which shows the in vivo effect of Gene1 antisense oligonucleotide in the increase in the amount of methamphetamine induction extracellular dopamine. * P <0.05-pair Gene1-SC-injection group. It shows the effect of Gene1 in reducing methamphetamine-induced synaptosomes ^[3 H] DA uptake. * P <0.05-pair physiological saline + CSF-injection group. # P <0.05 Methamphetamine + Gene1-SC-injection group. The figure which shows the effect of Gene1 in the fall of a methamphetamine induction | guidance | derivation synapto vesicle [< ³ > H] DA uptake. * P <0.05-pair physiological saline + CSF-treated group and physiological saline + Gene1-SC-treated group. # P <0.05 Methamphetamine + Gene1-SC-treated group. Construction of expression vector (pcDNA-DEST53) used for expression experiment of full length or fragment of Gene1. The region of bases 1650 and 3312 was replaced with Gene1 DNA (full length or fragment). One of the following was recombined at the site of attR1. Base numbers 1643 to 1767. Base numbers 3202 to 3326. The figure which shows the effect of the transfected Gene1 in the methamphetamine induction [< ³ > H] DA uptake reduction. * P <0.05 vs. pcDNA-DEST53 vector-introduced cells. # P <0.05 vs. Gene1 full length transfected cells. $ P <0.05 vs. Gene1 fragment-introduced cells. + P <0.05-pair methamphetamine + pcDNA-DEST53 vector introduction | transduction cell. The figure which shows the Gene1 mRNA expression level change after the methamphetamine action in PC12 cell which introduce | transduced the Gene1 full length expression vector. PC12 cells were transfected with an expression vector that expresses Gene1 full length, an expression vector that expresses a Gene1 fragment, or a pcDNA-DEST vector (empty vector) using lipofectamine. Cells were cultured in 24-well plates for 2-3 days and then pretreated with methamphetamine (1.0 μM) for 30 minutes. Thereafter, the expression level of Gene1 mRNA in the cells was measured by the RT-PCR method. The results are shown as mean ± standard error (n = 8). * P <0.05 vs pcDNA-DEST53 vector treated cells, # P <0.05 vs Gene1 full length treated cells, $ P <0.05 vs Gene1 fragment treated cells, + P <0.05 vs methamphetamine + pcDNA-DEST53 vector treated cells. The figure which shows the localization of Gene1 in the nucleus accumbens after methamphetamine continuous administration. Mice were administered methamphetamine (2 mg / kg, s.c.) for 6 days and decapitated 24 hours after the final dose. The nucleus accumbens was immunostained with a polyclonal antibody against a partial peptide encoded by Gene1. Methamphetamine / Gene1 is the result of staining with a polyclonal antibody against the Gene1 partial peptide. Methamphetamine / NeuN is stained with anti-NeuN (nerve cell marker) antibody, methamphetamine / MAP2 is stained with anti-MAP2 (nerve cell marker) antibody, and methamphetamine / GFAP is stained with anti-GFAP (glial cell marker) antibody. is there. Each methamphetamine / merge in the right column is a composite of the left two staining results. Scale bar: 20 μm. The figure which shows the expression change of Gene1 mRNA in nicotine, alcohol, and phencyclidine. * P <0.05-pair physiological saline-administration group. The figure which shows the expression of Piccolo protein in a nerve cell. TH: immunostained image using anti-TH (tyrosine hydroxylase) antibody, Piccolo: immunostained image using anti-Piccolo antibody, Merge: synthesis of left two stained images. The figure which shows the expression of Piccolo protein in the nerve prenode of a midbrain dopamine nerve. TH: immunostained image using anti-TH (tyrosine hydroxylase) antibody, Piccolo: immunostained image using anti-Piccolo antibody, Merge: synthesis of left two stained images. The figure which shows the effect | action of the Piccolo C2A domain with respect to dopamine uptake | capture suppression in PC12 cell which forcedly expressed the human dopamine transporter. The figure which shows the effect of Piccolo expression suppression with respect to dopamine uptake | capture in PC12 cell which forcedly expressed the human dopamine transporter. The figure which shows the effect | action of Piccolo with respect to the intracellular movement of the dopamine transporter by a methamphetamine. The figure which shows the localization of Piccolo in a dopaminergic nerve cell. The figure which put together the relationship between the dopamine transporter and Piccolo protein in PC12 cell. When methamphetamine is allowed to act, the internalization of the dopamine transporter occurs (FIG. 36 (a)). In addition, the C2A domain of dopamine transporter and Piccolo are expressed in the same place (FIG. 36 (b)).

Psychiatric disorders are generally based on the etiology of intrinsic mental disorders (such as schizophrenia), extrinsic mental disorders, organic mental disorders (such as dementia), symptomatic mental disorders (such as manic depression), addictive mental disorders (Alcohol dependence, drug dependence, etc.) and psychogenic psychiatric disorders (neuropathy, psychosomatic disorders, etc.). The present invention is preferably directed to endogenous psychiatric disorders and addictive psychiatric disorders, more preferably schizophrenia, which is one of intrinsic psychiatric disorders, or drug dependence, which is one of addictive psychiatric disorders. More preferably, it is intended for drug addiction, and most preferably among the drug addictions, which is a preferred drug addiction. Depending on the causative drug, drug addiction depends on the mental dependence (effect) of the drug, physical dependence to avoid biological reactions associated with withdrawal, or acquisition of tolerance (or a combination of these) ). Examples of drugs that cause drug addiction include methamphetamine, morphine, cocaine, nicotine, alcohol, phencyclidine, benzodiazepines and the like (including various salts), but the drug addiction targeted by the present invention is It is not limited to those related to these drugs.
As used herein, the term “antipsychotic drug” is a drug used for suppressing the onset of a mental disorder, or used to improve (including partial or complete cure) symptoms of a mental disorder It refers to drugs. Accordingly, the antipsychotic drugs of the present invention include drugs that can be used for preventive treatment of mental disorders and drugs that can be used to treat mental disorders.
When referring to genes in the present invention, their natural variants are also considered.

(Screening method)
One aspect of the present invention provides a method for screening a compound effective against psychiatric disorders. The compounds selected by the screening method of the present invention are expected to be effective for medical measures relating to mental disorders. That is, the compound selected by the screening method of the present invention is a promising candidate for a drug for mental disorders or a useful material for developing such a drug. When the selected compound has a sufficient medicinal effect on mental disorders, it can be used as it is as an active ingredient of a drug. On the other hand, when it does not have a sufficient medicinal effect, it can be used as an active ingredient of a drug after it has been modified by chemical modification to enhance its medicinal effect. Of course, even if it has a sufficient medicinal effect, the same modification may be applied for the purpose of further increasing the medicinal effect.
The screening method of the present invention can be carried out using specific cells or animal individuals.

(Cell-based screening method)
In one aspect of the invention, a cell-based screening method is provided. In this embodiment, it is examined whether or not the expression level of a specific gene in a cell is changed by exposure (administration, addition) of a test compound. Specifically, the following steps are performed in the screening method of the present invention.
Step 1: A gene (target gene) selected from the group consisting of a gene having the base sequence of SEQ ID NO: 1, a gene having the base sequence of SEQ ID NO: 2, a gene having the base sequence of SEQ ID NO: 3, and homologous genes thereof Preparing a cell that expresses.
Step 2: exposing the test compound to the cells.
Step 3: measuring the expression level of the target gene in the cells after exposure to the test compound.
Step 4: A step of obtaining a change in the expression level of the target gene due to exposure of the test compound.
Hereinafter, the details will be described for each step.

1. Step 1
In step 1, a cell expressing a gene to be detected (referred to as “target gene” in this specification) is prepared. The target gene is a gene having the base sequence of SEQ ID NO: 1 (also referred to as “target mouse gene 1” in the present specification), and a gene having the base sequence of SEQ ID NO: 2 is also referred to as “target mouse gene 2” in the present specification. , A gene having the base sequence of SEQ ID NO: 3 (also referred to herein as “target mouse gene 3”), and homologous genes thereof are selected. These two or more types may be detected. Note that the target mouse genes 1 to 3 are all genes of mice that are associated with drug dependence (see Examples described later).

  Here, the “homologous gene” is a homologous gene such as human or rat corresponding to any one of the target mouse genes 1 to 3 which are mouse genes. The human homologous genes corresponding to the target mouse gene 1, the target mouse gene 2, and the target mouse gene 3 each have a gene having the base sequence of SEQ ID NO: 4 (also referred to as “target human gene 1” in this specification), SEQ ID NO: 5 And a gene having the nucleotide sequence of SEQ ID NO: 6 (also referred to as “target human gene 3” in the present specification). Other homologous genes can be found by homology search (for example, BLAST search) using a public database.

Mammalian cells are preferably used as “cells” herein. Examples of mammalian cells include rodent cells such as mice, rats and guinea pigs, and primate cells such as humans, monkeys and chimpanzees. The origin of the cell is not particularly limited, but it is preferable to use a cell derived from a central nervous system tissue. Among central nervous system tissues, it is particularly preferable to use cells derived from the prefrontal cortex, nucleus accumbens, striatum, midbrain, or hippocampus of the forebrain.
A cell that is not separated from a living body (that is, a state constituting a living body) may be used on the condition that it is an animal cell other than a human (for example, mouse, rat, rabbit, chicken, etc.).

  Instead of cells in a dispersed state, a group of cells (for example, cells that have formed a specific tissue) in which network formation is observed between the cells can also be used for screening. Moreover, you may implement the screening method of this invention using together two or more types of different cells.

  In addition to cells that naturally express the target gene, cells that have expressed the target gene as a result of artificial manipulation can also be used. For example, a transformed cell obtained by introducing the target gene in a state where it can be expressed may be used. Examples of cells that can be used for transformation include HeLa cells, COS cells, and CHO cells. These cells are readily available from cell banks such as ATCC.

The number of cells to be used is not particularly limited and can be determined in consideration of detection sensitivity, experimental equipment, and the like. For example, 1 to 10 ⁵ cells, preferably 10 to 10 ⁴ cells, more preferably 10 ² to 10 ³ cells can be used.

2. Step 2
In step 2, the test compound is exposed to the prepared cells. The test compound is exposed, for example, by culturing the cells for a predetermined time under the condition where the test compound is present in the culture medium. Alternatively, the test compound or a solution containing the test compound may be directly brought into contact with the cells.
The amount of exposure can be set arbitrarily. For example, the maximum exposure possible as long as it does not have a lethal effect on the cells can be employed.
The exposure time is not particularly limited. For example, the exposure time can be set within a range of 1 minute to 10 days. Exposure may be continuous at intervals.

  Test compounds used in the screening method of the present invention include organic compounds of various molecular sizes (nucleic acids, peptides, proteins, lipids (simple lipids, complex lipids (phosphoglycerides, sphingolipids, glycosylglycerides, cerebrosides, etc.), prostaglandins) , Isoprenoids, terpenes, steroids, etc.)) or inorganic compounds. The test compound may be derived from natural products or may be synthetic. In the latter case, an efficient screening system can be constructed using, for example, a combinatorial synthesis technique. Cell extracts, culture supernatants, and the like may be used as test compounds.

3. Step 3
In step 3, the expression level of the target gene is measured using the cells after exposure to the test compound. In one embodiment of the present invention, the amount of mRNA that is a transcription product of a target gene is measured as the expression level of the target gene. For detection of mRNA, conventional methods such as RT-PCR and various hybridization methods using specific probes (eg, Southern hybridization, in situ hybridization) can be employed.
In another embodiment of the present invention, the amount of protein that is the expression product of the gene of interest is measured. For example, detection (measurement) can be performed using a compound that specifically binds to the target protein. The detection method (or measurement method) is not limited to this, but is preferably an immunological technique. In the immunological technique, an antibody against a specific protein is used, and the protein is detected using the binding property (binding amount) of the antibody as an index. The term “antibody” herein includes polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, CDR grafted antibodies, humanized antibodies, or fragments thereof. The antibody in the present invention can be prepared using an immunological technique, a phage display method, a ribosome display method, and the like.
The immunological detection method enables rapid and sensitive detection. Also, the operation is simple. Examples of the detection method include ELISA, radioimmunoassay, FACS, immunoprecipitation, immunoblotting, and the like.

By using a labeled antibody, the above detection and the like can be easily performed. For labeling of antibodies, for example, fluorescent dyes such as fluorescein, rhodamine, Texas red, oregon green, enzymes such as horseradish peroxidase, microperoxidase, alkaline phosphatase, β-D-galactosidase, luminol, acridine dye, etc. Compounds, radioisotopes such as ³² P, ¹³¹ I, and ¹²⁵ I, biotin, and the like can be used.

4). Step 4
In step 4, the expression level change of the target gene is determined using the measurement result of the above step. For example, prepare cells exposed to the test compound (exposed group) and cells not exposed to the test compound (non-exposed group, control group), measure the expression level of the target gene for each of the exposed group and non-exposed group, Compare In addition, when the expression level of the target gene when the test compound is not exposed is known in advance, this expression level can also be used as the expression level of the non-exposed group. From the comparison result, the degree to which the expression of the target gene has changed as a result of exposure to the test compound (change in expression level) is determined. In this way, the effect of the test compound on the expression level of the target gene is evaluated.
When the expression level of the exposed group is higher than that of the non-exposed group, that is, when the test compound shows an increase in the expression level, it can be determined that the test compound is an effective compound for mental disorders. If a significant increase in the expression level is observed in the exposed group, it can be determined that the test compound is a particularly effective compound for mental disorders.
As described above, the effectiveness of the test compound against mental disorders is evaluated using the result of this step.

  The effect of a test compound can also be evaluated by comparing gene expression levels before and after exposure in a certain cell (cell group). For example, (1) Prepare cells in which the target gene is introduced together with the reporter gene (for example, luciferase gene). (2) Use the expression level of the introduced target gene as an indicator of the expression level of the reporter gene before and after exposure to the test compound. Measure (reporter assay) and compare measurement results.

(Animal individual-based screening method)
Screening for compounds effective for psychiatric disorders can also be performed using individual animals. That is, the present invention also provides an animal individual-based screening method comprising the following steps.
Step i: A step of preparing a non-human animal.
Step ii: administering a test compound to the non-human animal.
Step iii: After administration of the test compound, the gene having the base sequence of SEQ ID NO: 1, the gene having the base sequence of SEQ ID NO: 2, and the gene having the base sequence of SEQ ID NO: 3 in the central nervous system tissue of the non-human animal And measuring the expression level of a gene (target gene) selected from the group consisting of these homologous genes.
Step iv: A step of determining the expression level change of the target gene by administration of the test compound.
Hereinafter, the details will be described for each step, but the corresponding description in the description of the cell-based screening method described above is used for matters not particularly mentioned.

1. Step i
In step i, a non-human animal is prepared. Non-human animals include, for example, non-human primates (such as monkeys and chimpanzees), mice, rats, rabbits, cows, horses, sheep, dogs, cats, and the like. Among these, a mouse or a rat can be preferably used.
Non-human animals usually express their species-specific homologous genes for the target mouse genes 1-3. As described below, with the exception of using genetically modified animals, the expression level of this homologous gene is usually the detection target in this screening method.
It is preferable to use a non-human animal exhibiting a psychiatric disorder. If such a disease model animal is used, the effect of the test compound on the expression of the target gene in a mental disorder state can be examined. In other words, the screening system assumes actual treatment. According to such a screening system, it is possible to efficiently select a compound that actually acts on a mental disorder and has excellent effectiveness. On the other hand, by observing changes in the pathology of non-human animals in parallel with the measurement of the expression level of the target gene, the correlation between the change in the expression level of the target gene and the pathological condition can be investigated. Useful information can be obtained in evaluating the effects.
As a non-human animal exhibiting a pathological condition of mental disorder, an animal that exhibits a specific pathological condition by genetic modification and / or rearing under specific conditions can be used. For example, it has been proposed that genetically modified mice lacking the NMDA receptors ε1 and ε4 are effective as model animals for schizophrenia (Miyamoto, Y., Yamada, K., Noda, Y., Mori, H. , Mishina, M. and Nabeshima, T .: Hyperfunction of dopaminergic and serotonergic neuronal systems in mice lacking the NMDA receptor ε1 subunit .: FASEB J., 15, 1407-1409 (2001), Miyamoto, Y., Yamada, K. , Noda, Y., Mori., H., Mishina, M. and Nabeshima, T.,: Lower sensitivity to stress and altered monoaminergic neuronal function in mice lacking the NDMA receptor ε4 subunit .: J. Neurosci., 21, 750 -757 (2001)), these non-human animals can be used in the present invention. In addition, mice in which symptoms of schizophrenia were reproduced by administration of phencyclidine (PCP) to mice (Noda Y, et al., Repeated phencyclidine treatment induces negative symptom-like behavior in forced swimming test in mice: imbalance Neuropsychopharmacology. 2000 Oct. 23 (4): 375-87) can be used in the present invention as a model animal for schizophrenia. On the other hand, as shown in Examples described later, mice receiving continuous administration of methamphetamine or the like exhibit a disease state of drug dependence. Therefore, a mouse treated under such conditions can be suitably used in the present invention as a model animal for drug dependence.

2. Step ii
In step ii, the test compound is administered to the non-human animal. The administration route is not particularly limited, and oral administration, intravenous administration (injection), intradermal administration (injection), subcutaneous administration (injection), transdermal administration, buccal administration, direct administration to target tissues (injection), etc. Appropriate ones can be selected. The target tissue here is a tissue involved in mental disorders. Typically, the central nervous system tissue (the prefrontal cortex, nucleus accumbens, striatum, midbrain, hippocampus, etc.) Applicable.
The dose can be set arbitrarily. For example, the maximum possible dose can be used as long as it does not cause lethal effects on non-human animals.
The number of administrations can also be set arbitrarily. For example, the number of administrations is in the range of 1 to 20 times.

3. Step iii
In step iii, expression of the gene of interest in central nervous system tissues (frontal cortex, nucleus accumbens, striatum, midbrain, hippocampus, etc., among the forebrain) using non-human animals after administration of the test compound Measure the amount. That is, the amount of mRNA and / or expression product (protein) of the target gene in a specific central nervous tissue is measured. Note that either measurement using a tissue extract or measurement using a tissue section (for example, immunohistochemical staining) may be performed.
Here, if the non-human animal to be used is a mouse, any one of the target mouse genes 1 to 3 (or any combination thereof) is set as a detection target. If the non-human animal to be used is a species other than a mouse, a homologous gene of the species corresponding to the target mouse gene 1 to 3 is targeted for detection. For example, when a rat is used, a rat homologous gene is a detection target. However, when a non-human animal (genetically modified animal) that expresses a homologous gene of another species is used, the homologous gene can be a detection target. In this way, a screening method for detecting a gene that is not originally expressed by the animal species may be constructed using genetic recombination technology.

4). Step iv
In step iv, a change in the expression level of the target gene is obtained from the measurement result in the above step. For example, first, an animal individual (administration group) to which the test compound is administered and an animal individual (non-administration group) to which the test compound is not administered are prepared, and the expression level of the target gene is measured for each of the administration group and the non-administration group. Subsequently, the expression level of the administration group is compared with the expression level of the non-administration group. From the comparison result, the degree of change in the expression of the target gene as a result of administration of the test compound (change in expression level) is obtained. In this way, the effect of the test compound on the expression level of the target gene is evaluated.
When the expression level of the administration group is higher than that of the non-administration group, that is, when the test compound shows an increase in the expression level, it can be determined that the test compound is an effective compound for mental disorders. If a significant increase in the expression level is observed in the administration group, it can be determined that the test compound is a particularly effective compound for mental disorders.
As described above, the effectiveness of the test compound against mental disorders is evaluated using the result of this step.
As in the cell-based screening method, the effect of the test compound may be evaluated by comparing the gene expression level before and after the test compound administration in a certain animal individual (animal group).

(Diagnostic use)
Another aspect of the present invention relates to diagnostic use of genes that we have successfully identified. One aspect of this aspect relates to a method for acquiring information for diagnosing a mental disorder, and includes the following steps.
Step a: A step of preparing a biological sample collected from a subject.
Step b: the living body of a gene selected from the group consisting of a gene having the base sequence of SEQ ID NO: 4, a gene having the base sequence of SEQ ID NO: 5, a gene having the base sequence of SEQ ID NO: 6, and their natural variants Measuring the expression level in the sample;
Information obtained by this method is used for diagnosis of mental disorders. For example, information obtained by implementing the above method for a mentally ill patient can be used for evaluation or grasping of the patient's disease state, evaluation of therapeutic effect, and the like. For example, if the method of the present invention is performed in parallel with the treatment of mental disorders, the therapeutic effect can be evaluated based on the information obtained as a result. Specifically, by implementing the method of the present invention after drug administration, changes in the expression level of a specific gene can be examined, and the therapeutic effect can be determined from the increase or decrease in the expression level. Thus, you may utilize the method of this invention for the monitoring of a therapeutic effect.
On the other hand, information obtained when targeting a person other than a patient, that is, a person who has not been recognized as having a mental disorder, can be used to determine the presence or absence of the mental disorder and to evaluate the risk of the disease.
According to the method of the present invention, it is possible to diagnose a mental disorder based on an objective expression index of gene expression level. Therefore, in the field of mental disorder diagnosis that was difficult to diagnose objectively in the past. Its value is very high.

1. Step a
In step a, a biological sample collected from a subject (subject) is prepared. Not only patients with mental disorders but also healthy persons (including persons with a risk of mental disorders) can be targeted here. For example, a tissue piece, cell extract, cerebrospinal fluid or the like collected from a subject can be used as the biological sample. A nucleic acid sample is preferably used as the biological sample. A nucleic acid sample can be prepared from blood, skin cells, mucosal cells, hair, etc. of a subject (subject) using a known extraction method or purification method.

2. Step b
In step b, the expression level of a specific gene is measured using a biological sample. The gene to be measured is a gene having the base sequence of SEQ ID NO: 4 (target human gene 1), a gene having the base sequence of SEQ ID NO: 5 (target human gene 2), or a gene having the base sequence of SEQ ID NO: 6 (target Human gene 3). Natural variants of these genes may be measured. When there are a plurality of natural mutants, one or any combination among them can be measured.
Both standard genes and mutant genes may be measured. For example, both the standard gene and the mutant gene can be measured simultaneously, and the total expression level obtained can be used as diagnostic information. Alternatively, the expression level of the standard gene and the expression level of the mutant gene may be obtained, and the comparison data between the two may be used as diagnostic information.
It should be noted that the expression level of a specific gene can be determined by measuring the corresponding mRNA level or protein level (see the above screening method column for specific measurement methods).

The present invention further relates to application of the subject human genes 1 to 3 to risk diagnosis of mental disorders. That is, this aspect relates to a method for obtaining information for diagnosing a mental disorder risk, and includes the following steps.
Step A: A step of preparing a nucleic acid sample collected from a subject.
Step B: Analyzing the type of a gene selected from the group consisting of a gene having a base sequence of SEQ ID NO: 4, a gene having a base sequence of SEQ ID NO: 5 and a gene having a base sequence of SEQ ID NO: 6 in a nucleic acid sample Step to do.

  Step A can be performed in the same manner as step a. The nucleic acid sample in Step A can be prepared from a subject's (subject) blood, skin cells, mucosal cells, hair, and the like using a known extraction method and purification method. As long as it contains the gene to be analyzed, genomic DNA of any length can be used as the nucleic acid sample. When a plurality of genes are to be analyzed, it is not always necessary to use a nucleic acid sample in which all of the genes to be analyzed exist on one nucleic acid. That is, as the nucleic acid sample of the present invention, any of those in which all the genes to be analyzed exist on one nucleic acid and those in which the genes to be analyzed exist separately on a plurality of nucleic acids should be used. Can do. In addition, even if the gene to be analyzed is not in a complete state (that is, a state in which the full length of the gene exists) in the nucleic acid sample, at least a site (that is, a polymorphic site) necessary for gene type analysis exists. As long as it is fragmented, it may be a partial state.

In step B, the gene type is analyzed. That is, polymorphism analysis of a specific gene is performed. In general, there are individual differences in the DNA sequence that constitutes a gene. This individual difference is called genetic polymorphism. Gene polymorphisms are those in which one base is replaced with another base (SNP (single nucleotide polymorphism)), and usually one to several tens of bases are deleted or inserted (insertion / deletion polymorphism). Type), those having a different number of repeats in a repetitive sequence consisting of 2 to several bases (VNTR (variable number of tandem repeat) and microsatellite polymorphism), and the like are known. These gene polymorphisms may regulate the expression state of the gene or affect the function by changing the amino acid in the protein encoded by the gene. Therefore, by analyzing the polymorphism of a certain gene, the potential function of the protein encoded by the gene can be evaluated.
Information regarding the genotype obtained as a result of Step B can be used for risk diagnosis of mental disorders. For example, the degree of genetic risk of mental disorder can be determined based on the genotype (specific allele combination).

  The polymorphism analysis method is not particularly limited. For example, an allele-specific primer (and probe) is used to amplify by PCR, and to analyze the polymorphism of the amplification product by fluorescence or luminescence, or PCR (polymerase chain reaction) PCR-RFLP (restriction fragment length polymorphism) method, PCR-SSCP (single strand conformation polymorphism) method (Orita, M. et al.,) Proc. Natl. Acad. Sci., USA, 86, 2766-2770 (1989), etc.), PCR-SSO (specific sequence oligonucleotide) method, PCR-SSO method combined with dot hybridization method ASO (allele specific oligonucleotide) hybridization method (Saiki, Nature, 324, 163-166 (1986), etc.) or TaqMan-PCR method (Livak, KJ, Genet Anal, 14, 143 (1999), Morris , T. et al., J. Clin. Microbiol., 34, 2933 (1996)), Invader method (Lyamichev V et al., Nat Biotechnol, 17, 292 (1999)), MALDI-TOF / MS (matrix) method using primer extension (Haff LA, Smirnov IP, Genome Res 7,378 (1997)), RCA (rolling cycle amplification) (Lizardi PM et al., Nat Genet 19,225 (1998)), DNA chip or microarray method (Wang DG et al., Science 280,1077 (1998), etc.), primer extension method, Southern blot hybridization method A known method such as a dot hybridization method (Southern, E., J. Mol. Biol. 98, 503-517 (1975)) can be employed. Furthermore, the analysis may be performed by directly sequencing the polymorphic portion to be analyzed. Note that polymorphism analysis may be performed by arbitrarily combining these methods. In addition, any of the above analysis methods can be applied after a nucleic acid sample is amplified in advance (including amplification of a partial region of the nucleic acid sample) by a PCR method or a nucleic acid amplification method such as a method applying the PCR method.

  When analyzing a large number of nucleic acid samples, allele-specific PCR method, allele-specific hybridization method, TaqMan-PCR method, Invader method, MALDI-TOF / MS (matrix) method using primer extension method, RCA ( It is particularly preferable to use an analysis method capable of analyzing a large number of specimens in a relatively short time, such as a rolling cycle amplification method or a method using a DNA chip or a microarray.

  It is also possible to analyze polymorphisms of each gene using mRNA which is a transcription product of the gene to be analyzed. For example, after extracting and purifying mRNA of a gene to be analyzed from blood, urine, etc. of a subject, Northern blotting (Molecular Cloning, Third Edition, 7.42, Cold Spring Harbor Laboratory Press, New York), dot blotting (Molecular Cloning) , Third Edition, 7.46, Cold Spring Harbor Laboratory Press, New York), RT-PCR (Molecular Cloning, Third Edition, 8.46, Cold Spring Harbor Laboratory Press, New York), methods using DNA chip (DNA array), etc. By executing the above, polymorphism analysis can be performed using mRNA as a starting material.

Polymorphism analysis can also be performed using the expression product of the gene to be analyzed. In this case, as long as the amino acid corresponding to the polymorphic site is included, even a partial protein or partial peptide can be used as a sample for analysis.
Examples of the method of analyzing using the expression product of such a gene include a method of directly analyzing the amino acid at the polymorphic site, or a method of immunological analysis using changes in the three-dimensional structure and the like. As the former, a well-known amino acid sequence analysis method (method using Edman method) can be used. Examples of the latter include ELISA (enzyme-linked immunosorbent assay), radioimmunoassay using a monoclonal antibody or polyclonal antibody having specific binding activity to the expression product of a gene having any of the genotypes constituting the polymorphism, An immunoprecipitation method, an immunodiffusion method, or the like can be used.

(Therapeutic use)
A further aspect of the invention relates to the therapeutic use of genes that we have successfully identified. In one embodiment of this aspect, an antipsychotic drug is provided. The antipsychotic drug of the present invention includes a gene having the base sequence of SEQ ID NO: 4 (target human gene 1), a gene having the base sequence of SEQ ID NO: 5 (target human gene 2), and a gene having the base sequence of SEQ ID NO: 6. (Target human gene 3), and a compound that increases the expression level in a target tissue of a gene selected from the group consisting of these natural variants. Thus, the antipsychotic agent of the present invention has an action of increasing the expression level of a specific gene in the target tissue.
Usually, the central nervous system tissue is the “target tissue” here. If the expression level of the gene is increased in the central nervous system tissue, a direct action against mental disorders can be expected.

  Specific examples of the compound (active ingredient) contained in the agent of the present invention include an isolated protein having the amino acid sequence of SEQ ID NO: 10, an isolated protein having the amino acid sequence of SEQ ID NO: 11, or Mention may be made of isolated proteins having an amino acid sequence. These proteins are the expression products of the target human genes 1 to 3, respectively. Therefore, according to the drug containing these proteins, the amount of the expression product of the target human gene is increased in the target tissue by being delivered into the target tissue. A natural mutant of any of the above proteins (corresponding to a natural mutant of the target human gene) can also be used as an active ingredient.

As used herein, “isolated” when used with respect to a protein means that it has been removed from its original environment (for example, the natural environment in the case of a natural substance), that is, it exists by human manipulation. It means to exist in a state different from the state.
The “isolated” state when the protein in the present invention is derived from a natural material is usually substantially free of components other than the protein in the natural material (especially substantially free of contaminating proteins). ) State. Specifically, in the isolated protein of the present invention, the content of contaminating protein is, for example, less than about 20%, preferably less than about 10%, more preferably less than about 5%, even more preferably in terms of weight. Less than about 1%.
On the other hand, an “isolated” state when the protein is produced by recombinant DNA technology is usually a state that does not substantially contain other components or culture medium derived from the host cell used. Say. Specifically, in the isolated protein, the content of contaminant components in terms of weight is, for example, less than about 20%, preferably less than about 10%, more preferably less than about 5%, and even more preferably about 1%. Is less than.
In addition, the “isolated” state when the protein is produced by chemical synthesis usually means a state substantially free of precursors (raw materials), chemical substances used in the synthesis process, and the like. . Specifically, in an isolated protein, the precursor content is, for example, less than about 20%, preferably less than about 10%, more preferably less than about 5%, and even more preferably about 1%, based on weight. Is less than.

  Proteins in the present invention are preferably prepared using genetic engineering techniques. For example, the target protein can be obtained by introducing a nucleic acid encoding the target protein into an appropriate host cell and recovering the protein expressed in the transformant. The recovered protein is purified as necessary. The target protein can also be obtained using a cell-free protein synthesis system. The cell-free protein synthesis system does not use living cells, but uses ribosomes derived from living cells (or obtained by genetic engineering techniques), transcription / translation factors, etc., as the template nucleic acid (DNA or mRNA). ) To synthesize in vitro the mRNA and protein that it encodes. In a cell-free synthesis system, a cell extract obtained by purifying a cell disruption solution as needed is generally used. Cell extracts generally contain ribosomes necessary for protein synthesis, various factors such as initiation factors, and various enzymes such as tRNA. When protein is synthesized, various substances necessary for protein synthesis such as various amino acids, energy sources such as ATP and GTP, and creatine phosphate are added to the cell extract. Of course, a ribosome, various factors, and / or various enzymes prepared separately may be supplemented as necessary during protein synthesis. Development of a transcription / translation system that reconstitutes each molecule (factor) necessary for protein synthesis has also been reported (Shimizu, Y. et al .: Nature Biotech., 19, 751-755, 2001). In this synthesis system, three types of initiation factors constituting bacterial protein synthesis system, three types of elongation factors, four types of factors involved in termination, 20 types of aminoacyl-tRNA synthetases that bind each amino acid to tRNA, and Thirty-one factor genes consisting of methionyl tRNA formyltransferase are amplified from the E. coli genome, and the protein synthesis system is reconstructed in vitro using these genes. In the present invention, such a reconstructed synthesis system may be used.

The term “cell-free transcription / translation system” is used interchangeably with cell-free protein synthesis system, in vitro translation system or in vitro transcription / translation system. In an in vitro translation system, RNA is used as a template to synthesize proteins. As the template RNA, total RNA, mRNA, in vitro transcript and the like are used. The other in vitro transcription / translation system uses DNA as a template. The template DNA should contain a ribosome binding region and preferably contain an appropriate terminator sequence. In the in vitro transcription / translation system, conditions to which factors necessary for each reaction are added are set so that the transcription reaction and the translation reaction proceed continuously.
The cell-free synthesis systems currently widely used include the following. That is, an E. coli S30 fraction extract system (prokaryotic system), a wheat germ extract system (eukaryotic system), and a rabbit reticulocyte lysate system (eukaryotic system). These systems are also commercially available as kits and can be used easily.
The target protein can also be prepared by separation and purification from a natural source (obtained source). Examples of the protein source in the present invention include animal cells (including humans), plant cells, body fluids (blood, urine, etc.) and the like.

  Other specific examples of the compound (active ingredient) contained in the antipsychotic agent of the present invention include an isolated nucleic acid encoding any of the above proteins. That is, as an example of an active ingredient, an isolated nucleic acid encoding the amino acid sequence of SEQ ID NO: 10, an isolated nucleic acid encoding the amino acid sequence of SEQ ID NO: 11, and an isolation encoding the amino acid sequence of SEQ ID NO: 12. Can be mentioned. These nucleic acids are contained in a state that can be expressed in the target tissue when the antipsychotic agent of the present invention is administered. For example, the nucleic acid inserted in a suitable expression vector is used. That is, the present invention provides an expression vector that holds a nucleic acid encoding any one of the amino acid sequences of SEQ ID NOs: 7 to 12 (specifically, for example, a DNA having any one of the nucleotide sequences of SEQ ID NOs: 1 to 6). The nucleic acid is inserted into the expression vector in an operably linked manner with appropriate control sequences that act in the target tissue.

  The term “nucleic acid” as used herein includes DNA (including cDNA and genomic DNA), RNA (including mRNA), DNA analogs, and RNA analogs. The form of the nucleic acid of the present invention is not limited, that is, it may be either single-stranded or double-stranded. Double-stranded DNA is preferable. Codon degeneracy is also considered. That is, in the case of a nucleic acid encoding a protein, it may have an arbitrary base sequence as long as the protein is obtained as its expression product.

In the present specification, the “nucleic acid encoding a protein” refers to a nucleic acid obtained when the protein is expressed, and of course includes a nucleic acid having a base sequence corresponding to the amino acid sequence of the protein, It also includes a nucleic acid (for example, a DNA containing one or more introns) obtained by adding a sequence that does not encode an amino acid sequence to such a nucleic acid.
In addition, in the present specification, the term “isolated nucleic acid” refers to a nucleic acid originally naturally occurring (for example, a nucleic acid in a human body), typically from other nucleic acids that coexist in a natural state. A nucleic acid in a separated state. However, some other nucleic acid components such as adjacent nucleic acid sequences in the natural state may be included. For example, a preferred form of “isolated nucleic acid” in the case of genomic DNA is substantially free of other DNA components that coexist in the natural state (including DNA sequences flanking in the natural state).
An “isolated nucleic acid” in the case of a nucleic acid produced by genetic recombination technology, such as a cDNA molecule, preferably refers to a nucleic acid that is substantially free of cell components, culture medium, and the like. Similarly, an “isolated nucleic acid” in the case of a nucleic acid produced by chemical synthesis is preferably in a state substantially free of precursors (raw materials) such as dDNTP, chemical substances used in the synthesis process, and the like. Refers to nucleic acid.
Whether the nucleic acid is present as part of a vector or composition or present in a cell as an exogenous molecule, it is an “isolated nucleic acid” as long as it exists as a result of artificial manipulation.

Nucleic acids used in the present invention can be obtained by using standard genetic engineering techniques, molecular biological techniques, biochemical techniques, etc. with reference to the sequence information disclosed in this specification or the attached sequence listing. It can be prepared in a “separated state”. For example, it can be isolated using a hybridization method using the whole or part of the base sequence of the target nucleic acid or its complementary sequence as a probe. Further, it can be amplified and isolated using a nucleic acid amplification reaction (for example, PCR) using a synthetic oligonucleotide primer designed to specifically hybridize to a part of the base sequence. In general, oligonucleotide primers can be easily synthesized using a commercially available automated DNA synthesizer.
The nucleic acid used in the present invention has a nucleotide sequence of any one of SEQ ID NOs: 4 to 6 as a preferred embodiment. In another embodiment of the present invention, one or more of the 5 ′ untranslated region or part thereof and the 3 ′ untranslated region or part thereof are missing from any one of the nucleotide sequences of SEQ ID NOS: 4 to 6. Use lost DNA molecules (eg, nucleic acids consisting only of the coding region). A nucleic acid in which a non-translated region different from the original non-translated region is combined with the coding region may be used on the condition that the translation of the coding region is not adversely affected.

  The pharmaceutical preparation of the present invention can be formulated according to a conventional method. In the case of formulating, other pharmaceutically acceptable ingredients (for example, carriers, excipients, disintegrants, buffers, emulsifiers, suspending agents, soothing agents, stabilizers, preservatives, preservatives, physiological Saline solution and the like). As the excipient, lactose, starch, sorbitol, D-mannitol, sucrose and the like can be used. As the disintegrant, starch, carboxymethylcellulose, calcium carbonate and the like can be used. Phosphate, citrate, acetate, etc. can be used as the buffer. As the emulsifier, gum arabic, sodium alginate, tragacanth and the like can be used. As the suspending agent, glyceryl monostearate, aluminum monostearate, methyl cellulose, carboxymethyl cellulose, hydroxymethyl cellulose, sodium lauryl sulfate and the like can be used. As the soothing agent, benzyl alcohol, chlorobutanol, sorbitol and the like can be used. As the stabilizer, propylene glycol, diethylin sulfite, ascorbic acid or the like can be used. As preservatives, phenol, benzalkonium chloride, benzyl alcohol, chlorobutanol, methylparaben, and the like can be used. As preservatives, benzalkonium chloride, paraoxybenzoic acid, chlorobutanol and the like can be used.

The dosage form for formulation is not particularly limited, and can be prepared as, for example, tablets, powders, fine granules, granules, capsules, syrups, injections, external preparations, and suppositories.
The drug of the present invention thus formulated can be applied to a patient by oral administration or parenteral administration (intravenous, intraarterial, subcutaneous, intramuscular, intraperitoneal injection, etc.) depending on the form.
The content of the active ingredient (compound) in the drug of the present invention generally varies depending on the dosage form, but is, for example, about 0.001% by weight to about 90% by weight so that a desired dose can be achieved.

  In another aspect of the present invention, there is provided a method for preventing or treating a mental disorder using the above drugs (hereinafter, these two methods are collectively referred to as “therapeutic methods”). The treatment method of the present invention includes a step of administering the antipsychotic drug of the present invention to a living body. The administration route is not particularly limited, and examples thereof include oral, intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, transdermal, and transmucosal. The dose of the drug varies depending on symptoms, patient age, sex, weight, and the like, but those skilled in the art can appropriately set an appropriate dose. For example, the dose can be set so that the amount of active ingredient per day is about 0.001 mg to about 100 mg for adults (body weight about 60 kg). As the administration schedule, for example, once to several times a day, once every two days, or once every three days can be adopted. In setting the administration schedule, it is possible to take into account the patient's medical condition and the duration of the drug effect.

(Research use)
The invention further relates to research applications for genes that have been successfully identified. In one embodiment of this aspect, there is provided an isolated nucleic acid having any one of the nucleotide sequences of SEQ ID NOs: 1 to 6, or a psychiatric disorder research reagent comprising the homologous nucleic acid. In another aspect of the present invention, there is provided an isolated protein having any one of the amino acid sequences of SEQ ID NOs: 7 to 12, or a psychiatric disorder research reagent comprising a homologous protein thereof.
The reagent of the present invention can be used as an experimental tool for studying the onset mechanism of psychiatric disorders and the mechanism of symptom progression. Moreover, it can utilize as a reagent for implementing the method (screening method, the method of acquiring the information for diagnosis, etc.) of this invention, or as a structural component of the chemical | medical agent of this invention. The reagent of the present invention can also be used for the production of chimeric mice and transgenic mice as model animals for mental disorders.
In the reagent of the present invention, the nucleic acid is contained, for example, in a state inserted into an appropriate vector (for example, an expression vector). That is, the present invention provides an expression vector holding a nucleic acid encoding any one of the amino acid sequences of SEQ ID NOs: 7-12. In a specific embodiment of the expression vector of the present invention, DNA having any one of the sequence numbers 1 to 6 is retained.

  The term “homologous nucleic acid” as used herein refers to one whose function of the protein encoded by it is equivalent to that of the reference nucleic acid when compared with the reference nucleic acid (nucleic acid having any one of the nucleotide sequences of SEQ ID NOs: 1 to 6). Nucleic acids with different base sequences in the part. As an example of a homologous nucleic acid, it consists of a base sequence containing substitution, deletion, insertion, addition, or inversion of one or more bases based on any one of SEQ ID NOs: 1 to 6, and is related to mental disorders And a DNA encoding a protein having the characteristic that the expression level increases. Base substitution or deletion may occur at a plurality of sites. The term “plurality” as used herein refers to, for example, 2 to 40 bases, preferably 2 to 20 bases, more preferably 2 to 10 bases, although it varies depending on the position and type of amino acid residues in the three-dimensional structure of the protein encoded by the nucleic acid. It is. The homologous nucleic acid as described above has any sequence of SEQ ID NOs: 1 to 6 so as to include base substitution, deletion, insertion, addition, or inversion at a specific site using, for example, site-specific mutagenesis. It can be obtained by genetically modifying the nucleic acid. Homologous nucleic acids can also be obtained by other methods such as ultraviolet irradiation.

Another example of a homologous nucleic acid is a nucleic acid that hybridizes under stringent conditions to a complementary strand of a nucleic acid comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 6. The “stringent conditions” here are conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. Such stringent conditions are known to those skilled in the art, such as Molecular Cloning (Third Edition, Cold Spring Harbor Laboratory Press, New York) and Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987). Can be set with reference to. As stringent conditions, for example, hybridization solution (50% formaldehyde, 10 × SSC (0.15M NaCl, 15 mM sodium citrate, pH 7.0), 5 × Denhardt solution, 1% SDS, 10% dextran sulfate, 10 μg / ml denaturation Conditions of incubation at about 42 ° C. to about 50 ° C. using salmon sperm DNA, 50 mM phosphate buffer (pH 7.5), and then washing at about 65 ° C. to about 70 ° C. using 0.1 × SSC, 0.1% SDS Can be mentioned. As more preferable stringent conditions, for example, 50% formaldehyde as a hybridization solution, 5 × SSC (0.15M NaCl, 15 mM sodium citrate, pH 7.0), 1 × Denhardt solution, 1% SDS, 10% dextran sulfate, 10 μg / ml Of denatured salmon sperm DNA, 50 mM phosphate buffer (pH 7.5)).
Still another example of a homologous nucleic acid is a nucleic acid in which a base difference as described above is recognized due to a polymorphism typified by SNP.

(Kit used in the present invention)
Each method of the present invention (screening method, method for obtaining diagnostic information, etc.) may be carried out using a kit reagent or the like. Another aspect of the present invention provides kits used for such purposes. For example, nucleic acids (probes or primers), reaction reagents, diluents, reaction vessels, and the like used for detection in the method of the present invention can be included in the kit. The kit of the present invention usually includes instructions for use.

(Antibodies to the protein of the present invention)
The present invention further provides an isolated antibody having specific binding property to a protein (target protein) comprising any one of the amino acid sequences of SEQ ID NOs: 7 to 12. The antibody of the present invention is useful as a research tool for mental disorders. For example, the antibody of the present invention can be used for detection, measurement, and quantification of a target protein, and is expected to contribute to elucidation of the action mechanism of mental disorders. The antibody of the present invention is also expected to be applied to treatment or diagnosis of mental disorders.

The antibody of the present invention may be any of a polyclonal antibody, an oligoclonal antibody (a mixture of several to several tens of antibodies), and a monoclonal antibody. As a polyclonal antibody or an oligoclonal antibody, an anti-serum-derived IgG fraction obtained by animal immunization, or an affinity-purified antibody using an antigen can be used. The anti-IgSF4 antibody may be an antibody fragment such as Fab, Fab ′, F (ab ′) ₂ , scFv, or dsFv antibody.

  The antibody of the present invention can be prepared using immunological techniques, phage display methods, ribosome display methods, and the like. Preparation of a polyclonal antibody by an immunological technique can be performed by the following procedure. An antigen (target protein or a part thereof) is prepared, and an animal such as a rabbit, mouse or rat is immunized using the antigen. The antigen can be obtained by purifying a biological sample. A recombinant protein (or peptide) can also be used as an antigen. As will be described later, the present inventors use two types of partial peptides (CNTAFRGLRQHPRTQLL: SEQ ID NO: 19, CMSVDSRFRGKGIAKALG: SEQ ID NO: 20) as antigens and have specific binding properties to a protein consisting of the amino acid sequence of SEQ ID NO: 7. Antibody is obtained.

A recombinant protein (or peptide) as an antigen can be obtained, for example, by introducing a gene (which may be a part of a gene) encoding the amino acid sequence of SEQ ID NOs: 7 to 12 into a suitable host using a vector. Prepared by expressing in a recombinant cell produced.
In order to enhance the immunity-inducing action, an antigen bound with a carrier protein may be used. As the carrier protein, KLM (Keyhole Light Hemocyanin), BSA (Bovine Serum Albumin), OVA (Ovalbumin) and the like are used. The carbodiimide method, the glutaraldehyde method, the diazo condensation method, the MBS (maleimidobenzoyloxysuccinimide) method, etc. can be used for the coupling | bonding of carrier protein. On the other hand, an antigen in which the target protein (or part thereof) is expressed as a fusion protein with GST, β-galactosidase, maltose-binding protein, histidine (His) tag or the like can also be used. Such a fusion protein can be easily purified by a general method.

Immunization is repeated as necessary, and blood is collected when the antibody titer sufficiently increases, and serum is obtained by centrifugation or the like. The obtained antiserum is affinity purified to obtain a polyclonal antibody.
On the other hand, a monoclonal antibody can be prepared by the following procedure. First, an immunization operation is performed in the same procedure as described above. Immunization is repeated as necessary, and antibody-producing cells are removed from the immunized animal when the antibody titer sufficiently increases. Next, the obtained antibody-producing cells and myeloma cells are fused to obtain a hybridoma. Subsequently, after this hybridoma is monoclonalized, a clone that produces an antibody having high specificity for the target protein is selected. The target antibody can be obtained by purifying the culture medium of the selected clone. On the other hand, the desired antibody can be obtained by growing the hybridoma to a desired number or more, then transplanting it into the abdominal cavity of an animal (for example, a mouse), growing it in ascites, and purifying the ascites. For purification of the culture medium or ascites, affinity chromatography using protein G, protein A or the like is preferably used. Alternatively, affinity chromatography in which an antigen is immobilized may be used. Furthermore, methods such as ion exchange chromatography, gel filtration chromatography, ammonium sulfate fractionation, and centrifugation can also be used. These methods can be used alone or in any combination.

1. Experimental materials and methods
1-1. Search for drug-dependent genes
1-1-1. Extraction of mRNA
Using RNeasy mini kit (Qiagen), mRNA was prepared by the following procedure. Remove the mouse brain and separate the tissue to 30 mg or less. Dissolve brain tissue in the eluate containing protein denaturant and spin down with a spin column. The ethanol precipitation is repeated, and finally the mRNA is purified on silica gel.
1-1-2.cDNA subtraction
Using CLONTECH PCR-Select ^™ cDNA Subtraction Kit (Clontech), the procedure was performed according to the attached instructions.
1-2. Place preference experiment
1-2-1. Animals For the experiment, c57 / black6 male mice (Japan SLC, Hamamatsu), 8 weeks old at the start, were used. Mice are housed under a light / dark cycle of 12 hours (lighted A.M8: 00), room temperature 23 ± 1 ° C, humidity 50 ± 5%, and food (CE2: Clea Japan, Tokyo) and water are given freely. It was. This research plan was approved by the Animal Experiment Committee of Nagoya University School of Medicine, and conformed to the guidelines for animal experiments at Nagoya University School of Medicine and the Principles of Laboratory Animal Care (National Institutes of Health Publication 85-23, 1985).

1-2-2. Drug Methamphetamine hydrochloride (Hiropon, Dainippon Pharmaceutical, Osaka) was dissolved in physiological saline (saline) and used for the experiment.

1-2-3. Experimental apparatus The experiment consists of two chambers, light and dark, with a partition that prevents the mouse from moving between the two chambers (15 cm long, 15 cm wide, 15 cm high, respectively) ) It was used. The residence time of each box was measured using SCANET (Neuroscience, Tokyo).

1-2-4. Conditioned place preference test
The conditioned place preference test was performed by the method of Noda et al. (Noda Y, Miyamoto Y, Mamiya T, Kamei H, Furukawa H, Nabeshima T: Involvement of dopaminergic system in phencyclidine-induced place preference in mice pretreated with phencyclidine repeatedly. Ther 286: 44-51 (1998)). In the two-day pre-conditioning test, mice move freely between the chambers for 15 minutes 3 days a day, and after acclimatization to the device, the residence time (pre-value) of each chamber is measured on the third day. did. Following the pre-conditioning test, a 6-day conditioning test was performed. In the Conditioning test, a partition was inserted between each chamber so that the mouse stayed in only one of the chambers. On days 4, 6, and 8, methamphetamine or morphine was administered subcutaneously and immediately after the subcutaneous administration, the preference was low (the residence time was short in the pre-conditioning test). On days 5, 7, and 9, saline was applied. Immediately after subcutaneous administration, it was placed in the reverse chamber. In the post conditioning test, the mouse was moved back and forth freely in both chambers, and the residence time in each chamber, ie, the post-value was measured. Place preference was calculated by (post-value)-(pre-value). Leu-Ile was administered intraperitoneally 1 hour before placing the mouse in the chamber on all days of the test period.

1-2-5. Statistical analysis All results are shown as mean and standard error. For statistical analysis, one-way analysis of variance was performed. When a significant difference was observed, Bonferroni's multiple comparison test was further performed. In addition, when there was a difference when the risk rate was 5% or less, there was a significant difference.

1-3. Measurement of spontaneous momentum
1-3-1. Animals For the experiments, ICR male mice (Japan SLC, Hamamatsu) 8 weeks old at the start were used. Mice are raised under a light / dark cycle of 12 hours (lighting A.M8: 00), room temperature 23 ± 1 ° C, humidity 50 ± 5%, and food (CE2: Clea Japan, Tokyo) and water are given freely. It was. This research plan was approved by the Animal Experiment Committee of Nagoya University School of Medicine, and conformed to the guidelines for animal experiments at Nagoya University School of Medicine and the Principles of Laboratory Animal Care (National Institutes of Health Publication 85-23, 1985).

1-3-2. Drug For the experiment, methamphetamine hydrochloride (Hiropon, Dainippon Pharmaceutical, Osaka) was dissolved in saline.

1-3-3. Experimental equipment For the experiment, the same kind of acrylic cage as the home cage (length 28 cm, width 17 cm, height 13 cm) was used, and a small amount of breeding chips were placed on the floor. From the experiment start date to the end date, the cage and the breeding chip at the time of measurement were the same for each mouse. The behavioral quantity was measured using an infrared detector (Neuroscience, Tokyo) and analyzed by AB305 Measure and ABTEXT (Neuroscience, Tokyo).

1-3-4. Momentum measurement test On the first to third days, the mice were placed in a measurement cage for 2 hours to be accustomed to the measurement environment. From day 4 onwards, methamphetamine was administered subcutaneously once a day, and the total exercise amount was measured for 2 hours immediately after administration.

1-3-5. Statistical analysis All results are shown as mean and standard error. For statistical analysis, two-way repeated measures analysis of variance was performed. If a significant difference was observed, Bonferroni's multiple comparison test was further performed. In addition, when there was a difference when the risk rate was 5% or less, there was a significant difference.

2. Search for new genes related to drug dependence
2-1. Search for new genes using model animals Mice treated with methamphetamine show excessive momentum, but the daily increase in the amount of exercise increases. This can be regarded as a mental disorder associated with drug dependence (FIG. 1). Therefore, mRNA was extracted from the nucleus accumbens of mice that were administered methamphetamine continuously for 10 days (C57black6), and cDNA subtraction (Clontech) was performed based on them. Compared with the control, mRNA expression level was higher in mice that received methamphetamine. We searched for genes that increased more than 20 times. As a result, 5 genes met the conditions (FIG. 2). Among them, three genes except CREB3 and Odz4 were used in the subsequent experiments. For convenience of explanation, each gene is referred to as Gene1, Gene2, Gene3 (Piccolo).
Gene1, 2 and 3 were searched by BLAST search. cDNA 8430437G11 gene (8430437G11Rik), mRNA .: SEQ ID NO: 2), and Piccolo or Aczonin (GenBank Accession No. NM_011995, Mus musculus piccolo (presynaptic cytomatrix protein) (Pclo), mRNA .: SEQ ID NO: 3) It completely matched the partial sequence of the gene (FIGS. 3 and 4). The amino acid sequences encoded by Gene1 (BC034068), 2 (8430437G11Rik), and 3 (Piccolo or Aczonin) are shown in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively. Gene1 was registered in GeneBank under the name of mouse Shati (Accession No. DQ174094).

2-2. Search for human homologous genes
For genes 1, 2 and 3, human homologous genes were searched using BLAST search. As a result, human homologous genes (referred to as Gene1 human homologous gene, Gene2 human homologous gene, and Gene3 human homologous gene, respectively) were found for Gene1, 2 and 3, respectively. Two of these human homologous genes were genes of unknown function, and the other one was a gene identified as Piccolo or Aczonin.
Gene1 human homologous gene: Homo sapiens cDNA FLJ3478 fis, clone BRAWH2013219, weakly similar to Homo sapiens N-acetyltransferase Camello 2 (CML2) mRNA (Genbank Accession No. AK094797: SEQ ID NO: 4)
Gene2 human homologous gene: Homo sapiens cDNA FLJ13576 fis, clone PLACE1008715. (Genbank Accession No. AK023638: SEQ ID NO: 5)
Gene3 human homologous gene: Homo sapiens piccolo (presynaptic cytomatrix protein) (PCLO), mRNA. (Genbank Accession No. NM_033026, XM_168530: SEQ ID NO: 6)
The amino acid sequences encoded by the Gene1 human homologous gene, Gene2 human homologous gene, and Gene3 human homologous gene are shown in SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, respectively.

3. Changes in expression of new genes
When a part of these genes was subjected to RT-PCR for Gene 1 to 3, an increase in mRNA was observed in the methamphetamine administration group compared to the control group for all primer combinations (FIGS. 5-9). ). Furthermore, when the increase in the expression level was examined by the real-time RT-PCR method, the expression levels were increased in the methamphetamine frontal cortex, the nucleus accumbens, and the striatum (FIGS. 10 to 12).
When the expression level of Gene1 in each mouse tissue was examined by RT-PCR, it was revealed that Gene1 was highly expressed in the cerebrum and cerebellum (FIG. 13). Gene1 was also highly expressed in the liver, kidney and spleen. The three types of primer sets and PCR conditions used for RT-PCR are shown below.
(1) Primer set 1
Forward primer: cttgcctccccagcccatca (SEQ ID NO: 13), reverse primer: ctgggggccagggttctgct (SEQ ID NO: 14)
Reaction conditions: After reaction at 95 ° C. for 5 minutes, a reaction cycle consisting of 94 ° C. × 30 seconds, 70 ° C. × 40 seconds, and 72 ° C. × 1 minute is repeated 35 times to carry out a reaction at 72 ° C. × 5 minutes. Left at ℃
(2) Primer set 2
Forward primer: gggtggccgggtaggtggaa (SEQ ID NO: 15), reverse primer: ggcagtgcccagcccttcct (SEQ ID NO: 16)
Reaction conditions: After a reaction at 95 ° C. for 5 minutes, a reaction cycle consisting of 94 ° C. × 30 seconds, 71 ° C. × 40 seconds, and 72 ° C. × 1 minute is repeated 35 times to carry out a reaction at 72 ° C. × 5 minutes. Left at ℃
(3) Primer set 3
Forward primer: tgtacattcctccctggtggtg (SEQ ID NO: 17), reverse primer: aatctgagagctgcaagaaaataggg (SEQ ID NO: 18)
Reaction conditions: After reaction at 95 ° C. × 5 minutes, a reaction cycle consisting of 94 ° C. × 30 seconds, 65 ° C. × 40 seconds, and 72 ° C. × 1 minute is repeated 35 times to carry out a reaction at 72 ° C. × 5 minutes. Left at ℃

4. Expression suppression experiment
4-1. Effects of Gene1 antisense oligonucleotide and Gene2 antisense oligonucleotide on methamphetamine-induced spontaneous motor momentum
For Gene 1 and 2, each antisense nucleotide is continuously infused into the mouse ventricle using a mini-osmotic pump, the animal is administered methamphetamine daily, and the locomotor activity on days 1, 3 and 5 is measured. did. Mice were administered methamphetamine (1 mg / kg, sc) for 5 days. Locomotor activity was measured for 2 hours. In the right ventricle (AP -0.5 mm, ML +1.0 mm from bregma, DV -2.0 mm from the skull), antisense oligonucleotide (Gene1-AS or Gene2-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide ( Gene1-SC or Gene2-SC) and artificial cerebrospinal fluid (CSF) were continuously infused by an osmotic pump.
The measurement results for Gene1 are shown in FIG. 14, and the measurement results for Gene2 are shown in FIG. The results are shown as mean ± standard error (Gene1: n = 5-7, Gene2: n = 3-5). For Gene1, in a repeated two-way analysis of variance, there was a significant difference between the Gene1 antisense oligonucleotide treatment group and the control and scrambled control oligonucleotide groups (* P <0.05 vs. saline) + CSF-treated group, #P <0.05 vs saline + Gene1-SC-treated group).

4-2. Effect of Gene1 antisense oligonucleotide and Gene2 antisense oligonucleotide on the formation of place preference by methamphetamine
For Gene1 and Gene2, a place preference test was performed using antisense oligonucleotides. Mice were administered methamphetamine (0.3 mg / kg, sc) or saline during conditioning. In the right ventricle (AP-0.5 mm, ML +1.0 mm from bregma, DV -2.0 mm from the skull), antisense oligonucleotide (Gene1-AS or Gene2-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide ( Gene1-SC or Gene2-SC) and artificial cerebrospinal fluid (CSF) were continuously infused by an osmotic pump.
The measurement results for Gene1 are shown in FIG. 16, and the measurement results for Gene2 are shown in FIG. The results are shown as mean ± standard error (n = 5-12). There was a significant difference between the Gene1 antisense oligonucleotide treatment group and the control and scrambled control oligonucleotide groups (* P <0.05 vs. saline-treated group. # P <0.05 vs. methamphetamine + CSF-treated) Group and methamphetamine + Gene1-SC-treatment group).

4-3. Effects of Gene3 antisense oligonucleotides on methamphetamine-induced locomotor activity
For Gene3 (piccolo), antisense nucleotides were continuously infused into the ventricle using a mini-osmotic pump, the animals were administered methamphetamine daily, and the locomotor activity on days 1, 3 and 5 was measured. Mice were continuously administered methamphetamine (1 mg / kg, subcutaneous) for 6 days. The sample was decapitated 24 hours after the final administration to prepare a sample. The number of individuals was 5 in each group.
The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 5). In a repeated two-way analysis of variance, a significant difference was observed between the Gene3 antisense oligonucleotide treated group, the control group and the sense oligonucleotide group (*** p <0.0005 vs. physiological saline).

4-4. Gene1 mRNA expression change in mice treated with Gene1 antisense oligonucleotide by continuous administration of methamphetamine
Gene1 antisense nucleotides were continuously infused into the mouse ventricle using a mini-osmotic pump, and the animals were administered methamphetamine daily. On day 3 from the start of the experiment, the mice were decapitated, and the Gene 1 expression level in the nucleus accumbens was measured by real-time RT-PCR. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 8). In repeated two-way analysis of variance, there was a significant difference between the Gene1 antisense oligonucleotide treated group, the control group, and the scrambled control oligonucleotide group (* P <0.05 vs. saline + CSF-treated group) #P <0.05 vs saline + Gene1-SC-treated group. $ P <0.05 vs saline + Gene1-AC-treated group. + P <0.05 vs methamphetamine + Gene1-SC-treated group).

5. Action and mechanism of Gene1
5-1. Effects of dopamine D1 receptor antagonist R (+)-SCH23390 and dopamine D2 receptor antagonist raclopride on methamphetamine-induced Gene1 mRNA expression in the nucleus accumbens Methamphetamine (2mg / kg, sc) and dopamine D1 receptor antagonist R (+)-SCH23390 (0.1mg / kg, ip) or dopamine D2 receptor antagonist raclopride (30mg 30 minutes before methamphetamine administration) 2 mg / kg, ip) was administered. Two hours after the final administration, the mice were decapitated, and the Gene 1 expression level in the nucleus accumbens was measured by RT-PCR. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 6-8). In repeated two-way analysis of variance, a significant difference was observed between the vehicle, R (+)-SCH23390, and raclopride groups (* P <0.05 vs vehicle / saline) -Dose group # P <0.05 vs vehicle / methamphetamine-dose group). This result suggests that the increase in Gene1 mRNA expression level is controlled by a signal via the dopamine receptor.

5-2. Change in expression of TNF-α mRNA by continuous administration of methamphetamine in mice treated with Gene1 antisense oligonucleotide Metamphetamine (1 mg / kg, sc) was administered to mice for 5 days. During this time, the right ventricle (AP 0.5 mm, ML +1.0 mm from bregma, DV 2.0 mm from the skull) and Gene1 antisense oligonucleotide (Gene1-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene1 -SC), artificial cerebrospinal fluid (CSF) was continuously infused by an osmotic pump. Two hours after the final administration of methamphetamine, the mice were decapitated and the TNF-α mRNA expression level in the nucleus accumbens was measured by RT-PCR. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 8-10). Significant differences were observed between the Gene1 antisense oligonucleotide treatment group, the control (CSF treatment) group, and the scrambled control oligonucleotide group (* P <0.05 vs. saline-administered group. # P <0.05 vs. saline) Water + CSF-treated group and saline + Gene1-SC-treated group, $ P <0.05 vs methamphetamine + Gene1-SC treated group). This result suggested the possibility of Gene1 acting through TNF-α.

5-3. In vivo effect of Gene1 antisense oligonucleotide on methamphetamine-induced increase in extracellular dopamine level Mice were administered methamphetamine (1 mg / kg, sc) for 2 days. During this time, the right ventricle (AP 0.5 mm, ML +1.0 mm from bregma, DV 2.0 mm from the skull) with Gene1 antisense oligonucleotide (Gene1-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene1 -SC), or artificial cerebrospinal fluid (CSF) was continuously infused by an osmotic pump. On the third day, the amount of extracellular dopamine in the nucleus accumbens (AP +1.7 mm, ML? 0.8 mm from bregma, DV? 4.0 mm from the skull) was measured for 220 minutes after methamphetamine administration by in vivo microdialysis. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 5-6). In repeated two-way analysis of variance, significant differences were found between the Gene1 antisense oligonucleotide treated group, the control (CSF) group, and the scrambled control oligonucleotide group (* P <0.05 vs. Gene1-SC-treated) group). From these results, it was suggested that Gene1 suppresses the increase in the amount of extracellular dopamine induced by methamphetamine.

5-4. Effect of Gene1 on reduction of methamphetamine-induced synaptosome [ ³ H] DA uptake Mice were administered methamphetamine (1 mg / kg, sc) for 3 days. During this time, the right ventricle (AP 0.5 mm, ML +1.0 mm from bregma, DV 2.0 mm from the skull) and Gene1 antisense oligonucleotide (Gene1-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene1 -SC), artificial cerebrospinal fluid (CSF) was continuously infused by an osmotic pump. The final concentration of [ ³ H] DA was 5 nM. Mice were decapitated 2 hours after the final administration of methamphetamine, and the amount of [ ³ H] DA in the midbrain synaptosome was measured. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 7-8). Saline + CSF-treatment group, saline + Gene1-SC-treatment group, saline + Gene1-AS-treatment group, methamphetamine + CSF-treatment group, methamphetamine + Gene1-SC-treatment group, methamphetamine + Gene1 The amount of synaptosome [ ³ H] DA uptake in the AS-treated group is 0.32 ± 0.04, 0.29 ± 0.03, 0.20 ± 0.02, 0.18 ± 0.01, 0.20 ± 0.01, 0.09 ± 0.01 pmol / 4 min / mg protein, respectively. This result suggests that Gene1 suppresses the reduction of dopamine uptake into synaptosomes induced by methamphetamine.

5-5. Effect of Gene1 on reduction of methamphetamine-induced synaptovesicle [ ³ H] DA uptake Mice were administered methamphetamine (1 mg / kg, sc) for 3 days. During this time, the right ventricle (AP 0.5 mm, ML +1.0 mm from bregma, DV 2.0 mm from the skull) and Gene1 antisense oligonucleotide (Gene1-AS, 1.8 nmol / 6 μl / day), scrambled control oligonucleotide (Gene1 -SC), artificial cerebrospinal fluid (CSF) was continuously infused by an osmotic pump. The final concentration of [ ³ H] DA was 30 nM. Mice were decapitated 2 hours after the final administration of methamphetamine, and the amount of [ ³ H] DA in the midbrain synaptosome was measured. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 8). Saline + CSF-treatment group, saline + Gene1-SC-treatment group, saline + Gene1-AS-treatment group, methamphetamine + CSF-treatment group, methamphetamine + Gene1-SC-treatment group, methamphetamine + Gene1 -AS-treated groups have uptakes of synaptovesicle [ ³ H] DA of 3.76 ± 0.25, 4.05 ± 0.29, 2.80 ± 0.20, 1.74 ± 0.21, 1.85 ± 0.14, 0.90 ± 0.14 pmol / 4 min / mg protein, respectively. . This result suggests that Gene1 suppresses the reduction of dopamine uptake into synapto vesicles induced by methamphetamine.

5-6. Effect of transfected Gene1 on methamphetamine-induced reduction of [ ³ H] DA uptake
Using pcDNA-DEST53 (Invitrogen), an expression vector into which the full length or fragment of Gene1 was inserted was constructed (FIG. 25). PC12 cells were transfected with an expression vector that expresses Gene1 full length, an expression vector that expresses a Gene1 fragment, or a pcDNA-DEST vector (empty vector) using lipofectamine. Cells were cultured in 24-well plates for 2-3 days and then pretreated with methamphetamine (1.0 μM) for 30 minutes. Thereafter, [ ³ H] DA uptake into cells was measured using Krebs-Ringer HEPES buffer supplemented with 10 μM pagyline and 10 μM ascorbic acid. The final concentration of [ ³ H] DA was 20 nM. The cells were also incubated at 22 ° C. for 10 minutes. The results are shown as mean ± standard error (n = 9-12). The measurement results are shown in FIG. In the cells transfected with the expression vector that expresses the full length of Gene1, it can be seen that the decrease in [ ³ H] DA uptake induced by methamphetamine is suppressed (* P <0.05 vs. pcDNA-DEST53 vector-treated cells. # P <0.05 vs. Gene1 full length treated cells. $ P <0.05 vs. Gene1 fragment treated cells. + P <0.05 vs. methamphetamine + pcDNA-DEST53 vector treated cells).
On the other hand, as a result of measuring the expression level of Gene1 mRNA in the cells by RT-PCR, a significant increase in Gene1 mRNA expression level was confirmed in cells transfected with an expression vector that expresses Gene1 full-length (FIG. 27).
From the above results, it was suggested that Gene1 suppresses the decrease in intracellular dopamine uptake induced by methamphetamine.

5-7. Localization of Gene1 in the nucleus accumbens after continuous administration of methamphetamine
A partial peptide encoded by Gene1 (S-3 antigen: CNTAFRGLRQHPRTQLL: SEQ ID NO: 19 or S-4 antigen: CMSVDSRFRGKGIAKALG: SEQ ID NO: 20) is used as an antigen to immunize a rabbit, and two polyclonal antibodies (Gene1 antibody S-3, Gene1 antibody S-4) was obtained. On the other hand, methamphetamine (2 mg / kg, sc) was administered to mice for 6 days, and the mice were decapitated 24 hours after the final administration. A specimen sample of nucleus accumbens was prepared, and immunostaining was performed using the polyclonal antibody (Gene1 antibody S-3) (FIG. 28). From the staining results shown in FIG. 28, it can be seen that Gene1 is localized in the cytoplasm of nerve cells. A similar stained image was obtained when Gene1 antibody S-4 was used (not shown).

6. Gene1 mRNA expression changes in nicotine, alcohol, and phencyclidine Gene1 response to nicotine, alcohol, and phencyclidine was examined.
(1) Nicotine Nicotine (0.05-1.0 mg / kg, sc) was administered to mice for 12 days. Two hours after the final administration, the mice were decapitated and the amount of Gene1 mRNA in the nucleus accumbens was measured by RT-PCR. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 5). As shown in the figure, there was a correlation between the administration of nicotine and the expression level of Gene1 (* P <0.05 vs. saline-administered group).
(2) Alcohol The mice were decapitated after ingesting 6% ethanol or water (control) for 12 days. The amount of Gene1 mRNA in the nucleus accumbens was measured by RT-PCR. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 7-8). As shown in the figure, no significant correlation was observed between the administration of ethanol and the expression level of Gene1.
(3) Phencyclidine Mice were administered phencyclidine (10 mg / kg, sc) for 14 days. Two hours after the final administration, the mice were decapitated, and the amount of Gene1 mRNA in the frontal cortex was measured by RT-PCR. The measurement results are shown in FIG. The results are shown as mean ± standard error (n = 8-9). As shown in the figure, no significant correlation was observed between the administration of phencyclidine and the expression level of Gene1.

7. Expression of Gene3 (Piccolo) The expression state of Piccolo protein in neurons was examined by the following procedure. Tyrosine hydroxylase and Piccolo were fluorescently double-stained using midbrain cultured cells taken out from rats 13 days of age. The staining results are shown in FIGS. From this result, it can be seen that Piccolo protein is expressed in the anterior segment of dopaminergic nerve and midbrain dopamine nerve.

8. Effects of Piccolo on inhibition of dopamine uptake by methamphetamine
8-1. Effect of Piccolo C2A domain on inhibition of dopamine uptake in PC12 cells forced to express human dopamine transporter
An expression vector expressing a specific domain of Piccolo (CA2, PDZ) was constructed (not shown). After this expression vector was transfected into PC12 cells in which the human dopamine transporter was forcibly expressed, 1 μM methamphetamine was allowed to act for 30 minutes, and the amount of dopamine incorporation into the cells was measured. In addition, ³ H-labeled dopamine was allowed to act for 10 minutes to a final concentration of 20 mM. The measurement results are shown in FIG. As shown in the figure, when the Piccolo C2A domain was expressed in PC12 cells in which the human dopamine transporter was forcibly expressed, the action of suppressing dopamine uptake by methamphetamine was reduced.

8-2. Effect of Suppression of Piccolo Expression on Dopamine Uptake in PC12 Cells Forced to Express Human Dopamine Transporter Introduced Piccolo Protein Oligonucleotide Antisense or Sense to PC12 Cells Overexpressed Human Dopamine Transporter Thereafter, ³ H-labeled dopamine was allowed to act for 10 minutes to a final concentration of 20 nM, and intracellular radioactivity was measured. The measurement results are shown in FIG. This result suggests that Piccolo prevents dopamine uptake suppression by methamphetamine in PC12 cells overexpressing the human dopamine transporter.

8-3. Relationship between dopamine transporter and Piccolo protein in PC12 cells
(1) Effects of Piccolo on intracellular movement of dopamine transporter by methamphetamine
The human dopamine transporter was forcibly expressed in PC12 cells, and fluorescent immunostaining was performed on the human dopamine transporter before and after the action of methamphetamine. Intracellular movement of the human dopamine transporter was observed when methamphetamine was allowed to act. In addition, when the C2A domain of Piccolo was forcibly expressed in the same cell, the intracellular localization of both proteins was the same.
From the above results, it was found that the Piccolo CA2 domain promotes intracellular movement of the dopamine transporter by methamphetamine.

(2) Localization of Piccolo in dopaminergic neurons The expression state of Piccolo protein in dopaminergic neurons was examined by the following procedure. Double staining of Piccolo and dopamine transporter was performed using dopaminergic nerves extracted from rat midbrain on fetal day 13. The staining results are shown in FIG. As can be seen from FIG. 35, the dopamine transporter and Piccolo are localized in the same region in dopaminergic neurons.
From the results of (1) and (2) above, when methamphetamine is acted, dopamine transporter internalization occurs (FIG. 36 (a)), and the C2A domain of dopamine transporter and Piccolo is expressed in the same place. (FIG. 36 (b)) was clarified.

9. Summary From the above experimental results, it has been clarified that the gene 1 to 3 that have been successfully identified increase the expression level in the central nervous system tissue with the formation of drug dependence. Gene1 was also involved in the uptake of dopamine into neurons. Gene1 was also found to be nicotine responsive. Gene3 (Piccolo) was found to be involved in the internalization of the dopamine transporter. Thus, genes with a strong association with drug dependence were identified. Moreover, the human homologous gene of Gene1-3 was also identified. These genes are expected to be useful in the diagnosis or treatment of drug addiction.

  The psychiatric disorder-related gene provided by the present invention can be used in screening of compounds effective for psychiatric disorders, treatment, diagnosis and research of psychiatric disorders.

The present invention is not limited to the description of the embodiments and examples of the invention described above. Various modifications may be included in the present invention as long as those skilled in the art can easily conceive without departing from the description of the scope of claims.
The contents of papers, published patent gazettes, patent gazettes, and the like specified in this specification are incorporated by reference in their entirety.

Claims (6)

A method for screening a compound effective for drug dependence ,
(1) providing a cell expressing a gene (target gene) selected from the group consisting of a gene having the base sequence of SEQ ID NO: 1 and a gene having the base sequence of SEQ ID NO: 4 ;
(2) exposing the test compound to the cells;
(3) measuring the expression level of the target gene in the cells after exposure to the test compound;
(4) A screening method comprising a step of determining a change in the expression level of the target gene due to exposure to a test compound. A method for screening a compound effective for drug dependence ,
(i) preparing a non-human animal;
(ii) administering a test compound to the non-human animal;
(iii) a gene selected from the group consisting of the gene having the base sequence of SEQ ID NO: 1 and the gene having the base sequence of SEQ ID NO: 4 in the central nervous system tissue of the non-human animal after administration of the test compound ( Measuring the expression level of the target gene),
(iv) obtaining a change in the expression level of the target gene by administration of the test compound;
A screening method comprising: The screening method according to claim 2, wherein the non-human animal is a model animal for drug dependence . The target gene is a gene having the nucleotide sequence of SEQ ID NO: 1,
The screening method according to claim 2 or 3, wherein the non-human animal is a mouse. a) preparing a biological sample collected from the subject;
b) measuring the expression level in the biological sample of genes having the base sequence of SEQ ID NO: 4,
A method for obtaining information for diagnosis of drug dependence, comprising: A reagent for drug dependence research, comprising an isolated nucleic acid having the base sequence of SEQ ID NO: 1 or 4 .