JP4903159B2 - A highly safe intranasal gene vaccine for the treatment of Alzheimer's disease - Google Patents

Description

  The present invention relates to a vaccine for treating Alzheimer's disease based on a minus-strand RNA viral vector.

  In Japan, which is facing a rapidly aging society, senile dementia has become a major social problem, including nursing problems. Indeed, about 10% of elderly people over the age of 65 in Japan are reported to have senile dementia. Alzheimer's disease is one of the two leading causes of dementia, and although it accounts for about 50% of the affected population, no effective treatment is currently available.

  The pathological findings of Alzheimer's disease have the following three characteristics: atrophy / deletion of neurons; formation of senile plaques by aggregation and deposition of amyloid β (hereinafter sometimes referred to as “Aβ”) protein; and abnormal tau Neurofibrillary tangles composed of proteins. The major amyloid β protein that occurs in the brains of Alzheimer's disease patients consists of 40-43 amino acids resulting from cleavage of the amyloid precursor protein by β and γ secretases. Senile plaques are aggregates composed of central amyloid β and surrounding microglia, fibrous astroglia, and dystrophic neurites. At present, the “amyloid cascade hypothesis”, which is caused by the formation of senile plaques due to amyloid β aggregation and deposition, is a promising pathologic hypothesis of Alzheimer's disease.

  Based on this hypothesis, vaccine (immuno) therapy as a new treatment method for Alzheimer's disease has attracted attention. Alzheimer's disease vaccine therapy is a method of removing brain amyloid β by immunological techniques. Echen's Schenk et al. Confirmed the reduction of amyloid deposition in the brain by intramuscularly administering preaggregated Aβ42 together with an adjuvant to PDAPP-transgenic mice (Patent Document 1 and Non-Patent Document 1). In a clinical trial conducted by Elan and Wyeth, a synthetic Aβ42 peptide (AN-1792) was administered intramuscularly with an adjuvant (QS21), and anti-Aβ antibodies that recognize β-sheet structure of amyloid were detected in the serum of subjects. (Non-Patent Document 2). Improvement of higher brain function has also been reported (Non-patent Document 3). Unfortunately, in Phase II, 6% (18/298) of patients had meningoencephalitis side effects, one death was reported, and the clinical trial was discontinued. The pathological examination of the brain tissue of the deceased patient confirmed the absence of senile plaques in the neocortex, suggesting the effectiveness of the vaccine. In the area where the senile plaque disappeared, an image showing the phagocytosis effect by microglia of Aβ degradation products was confirmed. This finding indicates that microglia phagocytoses the antibody bound to Aβ via the Fc receptor.

It has been confirmed that the anti-Aβ antibody does not react with neurons, glial cells, amyloid precursor protein (APP), and intracellular Aβ. Therefore, the above side effects are unlikely to be brain inflammation caused by antibodies. An adjuvant is required to administer the AN-1792 vaccine. Adjuvants have a strong immune activation effect and also induce cellular immunity by T lymphocytes. The side effect can be experimental allergic encephalomyelitis-like meningoencephalitis caused by adjuvant-induced cellular immunity caused by infiltration of Th1-type CD4 ⁺ T cells in response to Aβ or APP into the brain (Non-patent Document 4).

  AN-1792 vaccine confirmed the pathological effect of vaccine therapy using Aβ peptide. However, for clinical application of the vaccine, it is essential to reduce side effects such as meningoencephalitis. From this point of view, an immunization method involving the combined use of an Aβ peptide in which a carrier protein recognized by T cells is bound to an N-terminal fragment and a Th2 adjuvant (Patent Document 2), and Aβ peptide and cholera toxin B sub An improved vaccination method was devised, including an adenoviral vector (Patent Document 3) containing a nucleic acid encoding a fusion protein consisting of units. Furthermore, the present inventors have developed an adeno-associated virus vector containing DNA encoding a peptide fragment of Aβ peptide that induces humoral immunity as a highly safe oral vaccine (Patent Document 4). The adeno-associated virus vector vaccine does not require any adjuvant since it utilizes the intestinal mucosal immune system in which Th2 T cells are easily induced. Furthermore, it is possible to present antigens in the intestinal tract for a relatively long period of 6 months by a single administration by experiments using APP transgenic mice; to reduce brain amyloid deposition and senile plaque formation; Excellent features have been confirmed, such as the absence of any observable inflammation in any organ. However, for the practical application of vaccine therapy for Alzheimer's disease, a vaccine with further improved safety and effectiveness is required.

WO 99/27944 WO 02/096350 WO 2004/050876 WO 2004/111250 WO 00/70070 JP2000-253876 WO 2001/072340 Schenk D. et al, Nature 400: 173-177, 1999 Hock C. et al., Nat. Med. 8: 1270-1275, 2002 Hock C. et al., Neuron 38, 547-554, 2003 Linyi and Research 82 (3): 439-444, 2005

  The present invention has been achieved in view of the above situation. The object of the present invention is to provide a safe and highly effective vaccine therapy for Alzheimer's disease.

  In order to achieve the above-mentioned object, the present inventors made extensive efforts and attempted to develop a novel vaccine therapy for Alzheimer's disease. The present inventors have experience in developing vectors that can be used for gene transfer and gene therapy using Sendai virus (SeV). Sendai virus is a minus (−) strand RNA virus. Viruses do not integrate into the chromosome because they only grow in the cytoplasm of the host cell and do not have a DNA phase in their life cycle. Viruses therefore ensure high genetic safety when used as a vector for gene transfer. In developing a gene transfer vector based on Sendai virus, the present inventors deleted a gene from the Sendai virus genome in order to further improve safety and make the vector suitable for a target disease. By deleting the gene of the membrane fusion protein (F protein) involved in virus entry into the host cell from the genome, we succeeded in improving the vector to a highly safe and non-infectious vector. An efficient reconstruction system has also been established (WO 00/70070). Furthermore, the development of influenza vaccines (JP 2000-253876) and AIDS vaccines (WO 2001/072340) using Sendai virus vectors has been successful.

  Th2 cytokines such as IL-10 play an important role in the Th1 / Th2 balance, which is closely related to the immune response in vivo. Th1 cells produce IFN-γ and enhance cellular immunity. IFN-γ produced by Th1 cells suppresses IL-10 production of Th2 cells. On the other hand, Th2 cells produce IL-10 and enhance humoral immunity. IL-10 produced by Th2 cells suppresses production of IFN-γ and the like in Th1 cells. The present inventors considered introducing a gene encoding Th2 cytokine together with Aβ into the Sendai virus vector, and attempted to produce a vaccine against Alzheimer's disease that suppresses side effects such as cerebral meningitis due to cellular immunity. Next, the present inventors constructed a Sendai virus vector encoding Aβ1-43 and IL-10, and examined its effect. First, the vector was administered intranasally to 24-25 month old APP transgenic mice. Serum anti-Aβ42 antibody levels were measured 4 and 8 weeks after treatment. In the control group of mice, anti-Aβ antibodies were detected only at low levels and increased with time. In contrast, in the group of mice that received the vector of the present invention, high levels of anti-Aβ antibody were detected in the blood and the antibody level was found to be slightly lower after 8 weeks than after 4 weeks. . Histological examination showed a marked reduction in senile plaques in the frontal lobe, parietal lobe, and hippocampus by administration of the vector of the present invention. Furthermore, the amount of Aβ in the brain tissue was measured by ELISA. The results showed a significant decrease in Aβ in brain tissue. In addition, CD3 and Iba-1 were used as indicators to examine whether this vector administration caused lymphocyte infiltration in the central nervous system. The results showed that neither lymphocyte infiltration nor microglial pathological (extreme) activity occurred.

From the above examination, the extremely excellent characteristics of the minus-strand RNA viral vector expressing Aβ peptide were revealed. First, this vector showed a significant Aβ reduction effect in very old Alzheimer's disease model mice. The Tg2576 mice used in the above experiments were 24-25 months old and were nearly near the lifespan. Previous studies of Alzheimer's disease treatment methods have been conducted using mice up to 18 months. This is the first time that a therapeutic effect has been confirmed in such an aged mouse. In such elderly mice, the amount of Aβ deposited in the brain is enormous. Therefore, there is a possibility that the vector of the present invention can exhibit high effectiveness even for patients with more advanced Alzheimer's disease. Secondly, the vectors of the present invention were effective at lower doses and fewer doses compared to conventional vaccine therapy. For example, when a conventional method using an Aβ peptide and an adjuvant in combination is applied, generally, multiple administrations are necessary for establishing immunity. In fact, several to a dozen doses were administered in the AN-1792 clinical trial. In contrast, the vectors of the present invention showed significant efficacy after a single dose. Furthermore, in vaccine therapy with adeno-associated virus vectors (WO 2004/111250), vaccination is performed by a single dose similar to that performed in the examples described herein, and the dosage is 5 × 10 5. ¹¹ genomes / individual. In contrast, the dose applied to the examples described herein was 5 × 10 ⁶ CIU (Cell Infectious Unit) / individual (approximately 5 × 10 ⁷ genome / individual when converted to genome copy number). It was. The dosage of these two vectors is about ¹⁰⁴ things opening. Thirdly, administration of the vector in the examples did not cause meningoencephalitis in a mouse model. Meningoencephalitis observed in an AN-1792 clinical trial has been reported in a mouse model (M. Shoji, et al., 44th Annual Meeting of Japanese Society of Neurology, May 15-17, 2003) ). The occurrence of meningoencephalitis was also reported in normal non-model mice (C57B6 mice) immunized with Aβ peptide and adjuvant (Furlan R, et al., Vaccination with amyloid-beta peptide induces autoimmune encephalomyelitis in C57 / BL6 mice, Brain 126: 285-291, 2003). The results described herein suggest that the vectors of the present invention are safe even when administered to humans.

  As described above, the vector of the present invention showed a high Aβ elimination effect at a low dose and a small number of administrations. It has been confirmed that the effects of AIDS vaccines based on Sendai virus vectors are partially due to cellular immunity (WO 2001/072340). Despite the intentional design of the vectors used in the examples to rely on humoral immunity rather than cellular immunity to prevent side effects, the superior vaccine efficacy presented here is effective in treating Alzheimer's disease. It suggests the importance of humoral immunity in vaccines. Side effects can be reduced by using Th2 cytokines or Th2 adjuvants to dominate humoral immunity. That is, the present invention provides a minus-strand RNA viral vector encoding Aβ and use thereof, particularly the following invention.

[1] A minus-strand RNA viral vector comprising a nucleic acid encoding amyloid β.
[2] The minus-strand RNA viral vector according to [1], further comprising a nucleic acid encoding Th2 cytokine or a partial peptide thereof.
[3] The minus-strand RNA viral vector according to [2], wherein the Th2 cytokine or a partial peptide thereof is IL-10 or a partial peptide thereof.
[4] The vector according to any one of [1] to [3], wherein the minus-strand RNA viral vector is a paramyxovirus vector.
[5] The vector of [4], wherein the paramyxovirus vector is a Sendai virus vector.
[6] The vector according to any one of [1] to [5], wherein amyloid β is Aβ43 or a partial peptide thereof.
[7] The vector according to any one of [1] to [6], wherein amyloid β is derived from a human.
[8] The vector according to any one of [3] to [7], wherein IL-10 is derived from mouse or human.
[9] The vector according to any one of [1] to [8], wherein amyloid β is a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1 or a part thereof.
[10] The vector of any one of [3] to [9], wherein IL-10 is a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 2 or 3.
[11] The minus-strand RNA viral vector of any one of [1] to [10], which comprises the nucleic acid of SEQ ID NO: 5.
[12] A composition comprising the vector of any one of [1] to [11] and a pharmaceutically acceptable carrier.
[13] The composition of [12], further comprising (i) a nucleic acid encoding a Th2 cytokine or a partial peptide thereof in an expressible manner, (ii) a Th2 cytokine or a partial peptide thereof, or (iii) a Th2 adjuvant.
[14] The composition of [13], comprising Th2 cytokine, a partial peptide thereof, or a Th2 adjuvant.
[15] The composition of [13], comprising a nucleic acid encoding a Th2 cytokine or a partial peptide thereof in an expressible manner.
[16] The composition of [15], wherein the Th2 cytokine is encoded by a minus-strand RNA viral vector comprising a nucleic acid encoding amyloid β.
[17] The composition according to [15], wherein the Th2 cytokine is encoded by a vector other than a minus-strand RNA viral vector containing a nucleic acid encoding amyloid β.
[18] The composition of any one of [12] to [17], which is a pharmaceutical composition.
[19] A pharmaceutical composition used for treating or preventing Alzheimer's disease, comprising the vector according to any one of [1] to [18].
[20] The composition of [19], further comprising (i) a nucleic acid encoding a Th2 cytokine or a partial peptide thereof in an expressible manner, (ii) a Th2 cytokine or a partial peptide thereof, or (iii) a Th2 adjuvant.
[21] The pharmaceutical composition of [18] or [20] for use in intranasal administration.
[22] A method for reducing amyloid β deposition, comprising administering the vector according to any one of [1] to [11], or a composition containing the vector.
[23] A method for treating or preventing Alzheimer's disease, comprising administering the vector according to any one of [1] to [11] or a composition containing the vector.
[24] The method of [22] or [23], wherein the administration is intranasal administration.
[25] The method of [22] or [23], wherein the administration is intramuscular administration.
[26] The method of any one of [22] to [25], further comprising administering a Th2 cytokine, a partial peptide thereof, a Th2 adjuvant, or a vector encoding the Th2 cytokine or a partial peptide thereof.
[27] The method of [26], wherein a Th2 cytokine, a partial peptide thereof, or a Th2 adjuvant is administered.
[28] The composition of [26], wherein a vector encoding Th2 cytokine or a partial peptide thereof is administered.

  According to the present invention, a novel minus-strand RNA viral vector capable of effectively reducing amyloid β deposition at a low dose and a small number of administrations has been provided. It has been confirmed that the vector described in this example does not induce inflammation in the central nervous system, and administration of the vector of the present invention may cause cerebral meningitis as occurs when a conventional vaccine is administered. Is low. The vector of the present invention can be used as an extremely effective means for treating Alzheimer's disease.

  The present invention relates to a minus-strand RNA viral vector comprising a nucleic acid encoding amyloid β.

  In the present invention, a gene refers to a nucleic acid that encodes genetic material or a transcription unit. The gene may be RNA or DNA. In the present invention, a nucleic acid encoding a protein is called a gene of the protein. The gene may not encode a protein, for example, the gene may encode a functional RNA such as a ribozyme or an antisense RNA. Genes can be naturally occurring or artificially designed sequences. As used herein, “DNA” includes single-stranded DNA and double-stranded DNA. The phrase “encodes a protein” means that the polynucleotide includes an ORF encoding the amino acid sequence of the protein in sense or antisense orientation so that the polynucleotide can be expressed under appropriate conditions.

  A minus-strand RNA virus refers to a virus that contains a minus-strand RNA (an antisense strand complementary to a sense strand encoding a viral protein) as a genome. Negative strand RNA viruses are also called negative strand RNA viruses. The minus-strand RNA virus used in the present invention is particularly preferably a single-strand minus-strand RNA virus (also referred to as a non-segmented minus-strand RNA virus). “Single-stranded minus-strand RNA virus” refers to a virus having a single-stranded minus-strand RNA as a genome. Such viruses include Paramyxovirus (including Paramyxovirus, Paramyxovirus, Morbillivirus, Rubulavirus, and Pneumovirus), Rhabdoviridae, and others. (Including Vesiculovirus, Lyssavirus, and Ephemerovirus genus), Filovirus (Filoviridae), Orthomyxoviridae (Influenza virus A, B, And C, including Thogoto-like virus), Bunyaviridae (Bunyavirus, Hantavirus, Nairovirus, Phlebovirus, etc.) ), And viruses belonging to the family such as Arenaviridae It is.

  Specific examples of minus-strand RNA viruses particularly preferably used in the present invention include Sendai virus belonging to the Paramyxoviridae family (Sendai virus), Newcastle disease virus (Newcastle disease virus), Mumps virus (Mumps virus), measles virus ( Measles virus), RS virus (Respiratory syncytial virus), rinderpest virus, distemper virus, simian parainfluenza virus (SV5), human parainfluenza virus types 1, 2, and 3; Orthomyxoviridae Influenza viruses belonging to the family; Vesicular stomatitis virus and Rabies virus belonging to the Rhabdoviridae family.

  In the present invention, preferably a paramyxovirus is used. Paramyxovirus refers to a virus belonging to the Paramyxoviridae family or a derivative thereof. Paramyxovirus is a group of viruses having non-segmented negative-strand RNA as their genome, Paramyxovirinae (Respirovirus, also called Paramyxovirus, Respirovirus, Rubravirus, And Pneumovirinae (including Pneumovirus and Metapneumovirus). Specific examples of paramyxovirus applicable to the present invention include Sendai virus, Newcastle disease virus, mumps virus, measles virus, RS virus, rinderpest virus, distemper virus, simian parainfluenza virus (SV5), and human parainfluenza virus 1 , 2 and 3 types. More specifically, such examples include Sendai virus (SeV), human parainfluenza virus-1 (HPIV-1), human parainfluenza virus-3 (HPIV-3), seal distemper virus (PDV), dogs Distemper virus (CDV), dolphin morbillivirus (DMV), small ruminant virus (Peste-des-petits-ruminants virus) (PDPR), measles virus (MV), rinderpest virus (RPV), Hendra virus (Hendra virus) (Hendra), Nipah virus (Nipah), human parainfluenza virus-2 (HPIV-2), simian parainfluenza virus 5 (SV5), human parainfluenza virus-4a (HPIV-4a), human Includes parainfluenza virus-4b (HPIV-4b), mumps virus (mumps), and Newcastle disease virus (NDV). More preferred examples include Sendai virus (SeV), human parainfluenza virus-1 (HPIV-1), human parainfluenza virus-3 (HPIV-3), seal distemper virus (PDV), canine distemper virus (CDV), dolphin A virus selected from the group consisting of Mobilivirus (DMV), Small Ruminant Disease Virus (PDPR), Measles Virus (MV), Rinderpest Virus (RPV), Hendra Virus (Hendra), and Nipah Virus (Nipah) is there. The virus of the present invention is preferably a virus belonging to the Paramyxovirinae (including the Respirovirus genus, Rubravirus genus, and Morbilivirus genus), or a derivative thereof, more preferably the Respirovirus genus (Paramixoviridae). Virus or a derivative thereof. Examples of respirovirus viruses applicable to the present invention are human parainfluenza virus-1 (HPIV-1), human parainfluenza virus-3 (HPIV-3), bovine parainfluenza virus-3 (BPIV-3) Sendai virus (also called mouse parainfluenza virus-1), and simian parainfluenza virus-10 (SPIV-10). In the present invention, Sendai virus is most preferably used. These viruses may be derived from natural strains, wild strains, mutant strains, laboratory passage strains, artificially constructed strains, and the like.

  In the present invention, a “vector” is a carrier for introducing a nucleic acid into a cell. A minus-strand RNA viral vector is a carrier for introducing nucleic acid into cells derived from a minus-strand RNA virus. Minus-strand RNA viruses such as SeV are excellent as gene transfer vectors. Minus-strand RNA viruses do not have a DNA phase and transcribe and replicate only in the cytoplasm of the host cell, so no chromosomal integration occurs. Therefore, there are no safety problems such as canceration or immortalization due to chromosomal abnormalities. This feature of the minus-strand RNA virus greatly contributes to safety when used as a vector. When used for heterologous gene expression, even when SeV is serially passaged, few nucleotide mutations are observed, indicating high stability of its genome and stable expression of the inserted heterologous gene over a long period of time (Yu, D. et al., Genes Cells 2: 457-466, 1997). In addition, the deletion of the capsid structural protein in SeV provides qualitative benefits, such as the size of the inserted gene and its packaging flexibility. A transmissible SeV vector can introduce a foreign gene of at least 5.5 kb, and two or more genes can be expressed simultaneously by adding a transcription unit.

  Sendai virus is known to be pathogenic to rodents and cause pneumonia, but no pathogenicity has been reported to humans. This was supported by previous reports that intranasal administration of wild-type Sendai virus to non-human primates and humans did not cause serious side effects (Hurwitz, JL et al., Vaccine 15: 533-540 , 1997, Slobod, KS et al., Vaccine 22: 3182-3186, 2004). Further examples of advantages include the following two points, “high infectivity” and “high expression level”. SeV vectors are infected by binding to sialic acid in cell membrane glycolipids and glycoproteins. This sialic acid is expressed in most mammalian and avian cells, which broadens the infection spectrum, ie leads to high infectivity. When transmissible vectors based on SeV replicons release the virus, they also re-infect surrounding cells. A large number of RNPs are replicated in the cytoplasm of infected cells and are distributed to daughter cells via cell division, so sustained expression is expected. Furthermore, SeV vectors can be applied to a very wide range of tissues. Furthermore, their characteristic expression mechanism that transcription and replication occur only in the cytoplasm indicates that the inserted gene is expressed at very high levels (Moriya, C. et al., FEBS Lett. 425 (1): 105-111, 1998; WO 00/70070). In addition, SeV vectors that have been made non-transmissible by deleting the envelope gene have also been successfully recovered (WO 00/70070; Li, HO. Et al., J. Virol. 74 (14): 6654 -6569, 2000). In order to maintain “high infectivity” and “high expression level” and further enhance “safety”, SeV vectors have been improved.

  The minus-strand RNA viral vector of the present invention contains genomic RNA of a minus-strand RNA virus. Genomic RNA refers to RNA having a function of forming an RNP containing a viral protein of a minus-strand RNA virus, which causes a gene in the genome to be expressed. Thus, the nucleic acid is replicated and a daughter RNP is formed. The RNA of the minus-strand RNA virus encodes the gene as an antisense sequence. In general, in the genome of a minus-strand RNA virus, a viral gene is aligned as an antisense sequence between the 3 ′ leader region and the 5 ′ trailer region. Between each gene's ORF, there is a transcription termination sequence (E sequence)-an intervening sequence (I sequence)-a transcription initiation sequence (S sequence), so that the RNA encoding each gene's ORF is a separate cistron. Transcribed. Genomic RNA in the vector of the present invention is a viral protein necessary for the expression of a group of genes encoded by the RNA and autonomous replication of the RNA itself (also referred to as nucleocapsid or nucleoprotein (NP)), P Includes antisense RNA sequences encoding (phospho) and L (large) proteins. The RNA may also encode an M (matrix) protein necessary for the formation of viral particles. Further, the RNA may encode an envelope protein necessary for virus particle infection. Envelope proteins of minus-strand RNA viruses include F (fusion) proteins that cause cell membrane fusion, and HN (hemagglutinin-neuraminidase) or H (hemagglutinin) proteins that are required for virus attachment to cells. However, some cells do not require HN protein for infection (Markwell, MA et al., Proc. Natl. Acad. Sci. USA 82 (4): 978-982, 1985), and infection is established with F protein alone. To do. The RNA may encode an envelope protein other than F protein and / or HN protein.

  The minus-strand RNA viral vector of the present invention may be, for example, a complex composed of a minus-strand RNA virus genomic RNA and a viral protein, that is, a ribonucleoprotein (RNP). RNPs can be introduced into cells, for example, in combination with a desired transfection reagent. Such an RNP is specifically a complex comprising negative-strand RNA virus genomic RNA, N protein, P protein, and L protein. When RNP is introduced into a cell, cistron encoding the viral protein is transcribed from the genomic RNA by the action of the viral protein, and the genome itself is replicated to form a daughter RNP. Genomic RNA replication can be confirmed by detecting an increase in the RNA copy number by RT-PCR, Northern blot hybridization, or the like.

  Furthermore, the minus-strand RNA virus vector of the present invention is preferably a minus-strand RNA virus virus particle. “Viral particles” refer to microparticles containing nucleic acids that are released from cells by the action of viral proteins. The minus-strand RNA virus virus particle has a structure in which the RNP containing genomic RNA and viral protein is contained in a lipid membrane (referred to as an envelope) derived from a cell membrane. Viral particles may be infectious. Infectivity refers to the ability of a virus particle to introduce nucleic acid retained in an adherent cell based on the cell adhesion ability and membrane fusion ability of a minus-strand RNA viral vector. The minus-strand RNA viral vector of the present invention may be a transmissible or non-transmissible vector. “Transmissible” means that when a viral vector infects a host cell, the virus replicates itself in the cell to produce infectious viral particles.

For example, each gene in a virus belonging to the Paramyxovirus subfamily is generally expressed as follows. In general, the N gene is also referred to as “NP”.
Respirovirus NP P / C / VMF HN-L
Rubravirus NP P / VMF HN (SH) L
Mobilivirus NP P / C / VMFH-L

  For example, the accession numbers in the nucleotide sequence database of each gene of Sendai virus are as follows: M29343, M30202, M30203, M30204, M51331, M55565, M69046, and X17218 for the N gene; M30202, M30203, M30204 for the P gene , M55565, M69046, X00583, X17007, and X17008; for the M gene, D11446, K02742, M30202, M30203, M30204, M69046, U31956, X00584, and X53056; for the F gene, D00152, D11446, D17334, D17335, M30202, M30203 , M30204, M69046, X00152, and X02131; for the HN gene D26475, M12397, M30202, M30203, M30204, M69046, X00586, X02808, and X56131; for the L gene, D00053, M30202, M30203, M30204, M69040, X00587, X58886 . Examples of viral genes encoded by other viruses are: CDV, AF014953; DMV, X75961; HPIV-1, D01070; HPIV-2, M55320; HPIV-2, D10025; Mapuera, X85128; Mumps for the N gene , D86172; MV, K01711; NDV, AF064091; PDPR, X74443; PDV, X75717; RPV, X68311; SeV, X00087; SV5, M81442; and Tupaia, AF079780; For the P gene, CDV, X51869; DMV, Z47758; HPIV -l, M74081; HPIV-3, X04721; HPIV-4a, M55975; HPIV-4b, M55976; Mumps, D86173; MV, M89920; NDV, M20302; PDV, X75960; RPV, X68311; SeV, M30202; SV5, AF052755 And Tupaia, AF079780; for C gene, CDV, AF014953; DMV, Z47758; HPIV-1, M74081; HPIV-3, D00047; MV, ABO16162; RPV, X68311; SeV, AB005796; and Tupaia, AF079780; , CDV, M12669; DMV, Z30087; HPIV-1, S38067; HPIV-2, M62734; HPIV-3, D00130; HPIV-4a, D10241; HPIV-4b, D10242; Mumps, D86171; MV, AB012948; NDV, AF089819 PDPR, Z47977; PDV, X75717; RPV, M34018; SeV, U31956; and SV5, M32248; F gene, CDV, M21849; DMV, AJ224704; HPN-1, M22347; HPIV-2, M60182; HPIV-3, X05303, HPIV-4a, D49821; HPIV-4b, D49822; Mumps, D86169; MV, AB003178; NDV, AF048763; PDPR, Z37017; PDV, AJ224706; RPV, M21514; SeV, D17334; and SV5, AB021962; HN (H Or G) for genes, CDV, AF112189; DMV, AJ224705; HPIV-1, U709498; HPIV-2, D000865; HPIV-3, AB012132; HPIV-4A, M34033; HPIV-4B, AB006954; Mumps, X99040; MV, K01711; NDV, AF204872; PDPR, Z81358; PDV, Z36979; RPV, AF132934; SeV, U06433; and SV-5, S76876. However, several strains are known for each virus, and there are also genes containing sequences other than those exemplified above due to strain differences.

  The ORFs of these viral proteins are aligned as antisense sequences in the genomic RNA using the E-I-S sequence described above. The ORF closest to the 3 ′ end of the genomic RNA requires only the S sequence between the 3 ′ leader region and the ORF, and does not require the E and I sequences. Furthermore, the ORF closest to the 5 ′ end of the genomic RNA requires only the E sequence between the 5 ′ trailer region and the ORF, and does not require the I and S sequences. In addition, the two ORFs can be transcribed as a single cistron using, for example, an IRES sequence. In such a case, no E-I-S sequence is required between these two ORFs. For example, in the case of wild-type paramyxoviruses, a typical RNA genome is antisense to the 3 'leader region, six ORFs encoding N, P, M, F, HN, and L proteins, and the 5' trailer region. In order. In the genomic RNA of the present invention, the arrangement of the gene is not limited to this, but preferably N, P, M, F, which are arranged in this order following the 3 ′ leader region, similarly to the wild type virus. ORFs encoding H, HN, and L proteins followed by a 5 'trailer region. Certain minus-strand RNA viruses do not contain all six viral genes, but even in such cases it is preferred to place those viral genes as in the wild type described above. In general, vectors carrying N, P, and L genes can autonomously express genes from the RNA genome in the cell, thereby replicating the genomic RNA. Furthermore, infectious virus particles are formed and released extracellularly by the action of genes encoding envelope-constituting proteins such as F and HN (or H) genes and M genes. Thus, such vectors become transmissible viral vectors. A gene encoding a polypeptide containing Aβ or IL-10 may be inserted into a non-protein coding region in this genome, as described below.

  Furthermore, the minus-strand RNA viral vector of the present invention may be one lacking any of the wild-type minus-strand RNA virus genes. As long as the viral genomic RNA encodes the viral proteins (N, L, and P) required for the reconstitution of RNP, it replicates in the cell and expresses the gene even if it does not encode the envelope protein. Can do. For example, depending on the type of virus, vectors lacking at least one of genes encoding envelope-constituting proteins such as F, H, HN, G, M, and M1 can be exemplified (WO 00/70055 and WO 00). / 70070; Li, H.-O. et al., J. Virol. 74 (14): 6564-6569, 2000). For example, a viral vector that does not contain the M, F, or HN gene, or any combination thereof can also be suitably used as the vector of the present invention. Such a viral vector can be reconstructed, for example, by supplying a defective gene product exogenously. The virus vector thus prepared adheres to the host cell and causes cell fusion in the same manner as the wild type virus. However, since the vector genome introduced into the cell lacks any of the original viral genes, Daughter virus particles with the same infectivity as viruses are not formed. For this reason, such viruses are safe and useful viral vectors for one-time gene transfer. Examples of genes to be deleted from the genome include F gene and / or HN gene. For example, by transfecting a host cell with a plasmid vector that expresses a recombinant minus-strand RNA virus genome deficient in the F gene together with an expression vector for the F protein and an expression vector for the NP, P, and L proteins, (WO 00/70055 and WO 00/70070; Li, H.-O. et al., J. Virol. 74 (14): 6564-6569, 2000)). For example, a virus can be produced using a host cell in which the F gene is integrated into the chromosome. When these proteins are supplied from the outside, their amino acid sequences do not have to be the same as the original viral sequences, and if the activity in introducing the nucleic acid is equal to or higher than that of the natural type, they are derived from mutations or other viruses A homologous gene may be substituted.

  Furthermore, as the viral vector of the present invention, a vector containing a protein different from the viral envelope protein from which the vector genome is derived can be produced. For example, at the time of virus reconstitution, a viral vector containing a desired envelope protein can be produced by expressing an envelope protein other than the original viral envelope protein of the vector in a packaging cell. Such proteins are not particularly limited, and include, for example, envelope proteins of other viruses such as vesicular stomatitis virus G protein (VSV-G) (J. Virology 39: 519-528, 1981). The viral vector of the present invention includes a pseudo-type viral vector containing an envelope protein derived from a virus other than the virus from which the genome is derived, such as a VSV-G protein. By designing the envelope protein not to be encoded in the viral RNA genome, this protein will not be expressed after the virus particle has infected the cell.

  Furthermore, the viral vector of the present invention has, for example, a protein, an antibody or a fragment thereof capable of adhering to specific cells such as an adhesion factor, a ligand and a receptor on the envelope surface; or these proteins in the extracellular domain, It may be a vector containing a chimeric protein having an envelope-derived polypeptide in the intracellular domain. Thereby, the vector which targets a specific tissue can also be produced. Such proteins may be encoded within the viral genome or supplied upon expression of a gene other than the viral genome (e.g., another expression vector or a gene on the host cell chromosome) upon reconstitution of the viral vector. Also good.

  Furthermore, in the vector of the present invention, any viral gene contained in the vector may be modified from the wild-type gene, for example, to reduce immunogenicity due to viral proteins or to increase RNA transcription efficiency or replication efficiency. Good. Specifically, for example, in a minus-strand RNA viral vector, it is considered that at least one of N, P, and L genes, which are replication factors, is modified to increase transcription or replication efficiency. Furthermore, one of the envelope proteins, HN protein, has both hemagglutination activity and neuraminidase activity. For example, when the former activity is weakened, the stability of the virus in the blood can be improved, and when the latter activity is altered, the infectivity can be regulated. Furthermore, membrane fusion ability can also be regulated by modifying the F protein. For example, it is possible to analyze antigen-presenting epitopes of F protein or HN protein, both of which can be antigen molecules on the cell surface, and to produce viral vectors that weaken the antigenicity of these proteins. Furthermore, in order to suppress the release of secondary release particles or VLP (virus-like particles), a temperature-sensitive mutation may be introduced into the viral gene (WO 2003/025570). For example, G69E, T116A, and A183S are introduced into the M gene; A262T, G264, and K461G are introduced into the HN gene; L511F is introduced into the P gene; mutations such as N1197S and K1795E are introduced into the L gene. can do. The temperature-sensitive mutations that can be introduced are not limited to the above mutations (see WO 2003/025570).

  Furthermore, the vector of the present invention may be one lacking an accessory gene. For example, knocking out the V gene, which is one of the SeV accessory genes, significantly reduces the virulence of SeV against hosts such as mice without impairing gene expression and replication in cultured cells (Kato, A. et al., J. Virol. 71: 7266-7272, 1997; Kato, A. et al., EMBO J. 16: 578-587, 1997; Curran, J. et al., WO 01/04272, EP1067179) . Such attenuated vectors are particularly useful as non-toxic viral vectors for gene transfer in vivo or ex vivo.

  The vector of the present invention contains a nucleic acid encoding Aβ as a foreign gene in the genome of the minus-strand RNA viral vector. The number of amino acids encoding Aβ is not limited. For example, Aβ1-40, Aβ1-42, and Aβ1-43 are all acceptable. As Aβ, a desired fragment having the antigenicity of natural full-length Aβ or a polypeptide containing the fragment can also be used. Such a polypeptide has 6 or more consecutive amino acids derived from the amino acid sequence of natural Aβ (for example, Aβ43), preferably 7 or more consecutive amino acids, or 8 or more consecutive amino acids in order to exhibit antigenicity against Aβ. (Harlow, Antibodies: A laboratory Manual, 1998; Chapter 5 page 76). For example, most of the B cell epitopes for Aβ42 (SEQ ID NO: 27 1-42) are concentrated in the N-terminal 1-15 amino acid region (Cribbs, DH et al., Int. Immunol). 15 (4): 505-14, 2003). Accordingly, a polypeptide containing the first to 15th amino acids of Aβ42 can be suitably used as the Aβ peptide expressed from the vector. Alternatively, a polypeptide containing the first to 21st amino acids or the fourth to 10th amino acids of Aβ42 may be expressed (Japanese Patent Laid-Open No. 2005-21149). Furthermore, anti-Aβ monoclonal antibodies 10D5 and 6C6, known for their ability to inhibit amyloid fibril formation and protect nerves, are 4 amino acid epitopes corresponding to the 3rd to 6th amino acids of Aβ42 (EFRH; SEQ ID NO: 27-3). 6) has been reported (Frenkel, D. et al., J. Neuroimmunol. 88: 85-90, 1998; Frenkel, D. et al., J. Neuroimmunol. 95: 136-142, 1999). A monoclonal antibody 508F that recognizes the same epitope also inhibits Aβ-induced neurotoxicity (Frenkel, D. et al., J. Neuroimmunol. 106: 23-31, 2000). Therefore, a polypeptide having 6 to 8 amino acids or more in the Aβ sequence containing this sequence can be preferably used. Cellular immunity epitopes are concentrated in the C-terminal region of Aβ. Therefore, by expressing a fragment containing an N-terminal fragment such as Aβ1-21 and not including a sequence near the C-terminus as Aβ22-43 (SEQ ID NO: 27, 22nd to 43rd) Can also predominate humoral immunity. As a vector of the present invention, a naturally occurring Aβ peptide (Aβ39, Aβ40, Aβ41, Aβ42 corresponding to SEQ ID NO: 27 of 1 to 39, 1 to 40, 1 to 41, 1 to 42, and 1 to 43, respectively). , And a vector encoding a polypeptide containing the sequence of Aβ43) can also be suitably used. Short Aβ peptide fragments may be used to generate polypeptides fused to appropriate carrier proteins and increase immunogenicity. Carrier proteins include keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), rabbit serum albumin (RSA), human serum albumin (HSA), ovalbumin (OVA), thyroglobulin (TG), etc. . Short peptides can be fused to a carrier protein through a spacer of about 1-5 amino acids. The length of the antigen polypeptide (in the case of the secreted form, mature polypeptide) (amino acid length excluding the carrier protein portion) is preferably 10 to 200 amino acids, more preferably 15 to 100 amino acids, still more preferably 20 to 80 amino acids Range.

  In addition, the vector-encoded Aβ polypeptide preferably includes a secretion signal to ensure its secretion from the cell. As the secretory signal sequence, signal sequences of desired secreted proteins such as interleukin (IL) -2 and tissue plasminogen activator (tPA) can be used, preferably the N-terminal signal of amyloid precursor protein (APP) An array is used. Specifically, it contains a secretory signal sequence of accession number NP_958817 (for nucleotide sequence, see, for example, accession number NM_201414). Thus, a suitable vector of the invention encodes an Aβ peptide with an added secretion signal.

  Furthermore, the vector of the present invention may contain a nucleic acid encoding Th2 cytokine and / or anti-inflammatory cytokine as a foreign gene. Th2 cytokines refer to cytokines that are produced predominantly by type 2 helper T cells (Th2 cells) over type 1 helper T cells (Th1 cells). Specifically, IL-4, IL-5, IL-6, IL-9, IL-10, and IL-13 are included. In the present invention, the cytokine encoded by the vector is preferably selected from the group consisting of IL-4, IL-10, and IL-13, and most preferably encodes IL-10. The nucleotide sequence of each cytokine gene and its amino acid sequence are known (IL-4: NM_000589, NP_000580, AAH66277, AAH67515, NP_758858, NP_067258, NP_958427; IL-5: NM_000879, NP_000870, CAA31210, NP_034688, NP_068606; IL-6 : NM_000600, NP_000591, XP_518992, AAB30962, NP_112445; IL-9: NM_000590, NP_000581, AAH66284, AAH66287, NP_032399, XP_341488; IL-10: NM_000572, NP_000563, CAG46825, NP_034678, NP_036986; IL-13: NM_810021 , NP_032381, NP_446280).

  The vector-encoded Th2 cytokine such as IL-10 may be full length (ie, wild type) or a partial peptide (ie, active fragment) as long as the activity is maintained. For example, the N-terminal signal sequence may be appropriately replaced by other signal sequences. Alternatively, cytokines may be expressed as fusion proteins with other peptides.

  There is no restriction on the origin of cytokines such as Aβ and IL-10 encoded in the vector, any mouse, rat, guinea pig, rabbit, pig, cow, horse, donkey, goat, dog, chimpanzee, monkey, and human Mammals can also be used. The origin of Aβ and cytokine may be the same or different. It is appropriate to use Aβ and cytokine derived from the same species as the administration subject. Nucleotide sequences of nucleic acids encoding these cytokines can be obtained from the above databases. By way of further example, Genbank accession numbers AY410237 and NM_010548 are available for mouse IL-10, and Genbank accession numbers AY029171 and NM_000572 are available for human IL-10. An “Aβ-encoding nucleic acid” that can be suitably used as the vector of the present invention is human Aβ cDNA (SEQ ID NO: 1). “Nucleic acid encoding IL-10” which can be preferably used is mouse IL-10 cDNA sequence (SEQ ID NO: 2) and human IL-10 cDNA sequence (SEQ ID NO: 3). Nucleic acids having a sequence different from the nucleotide sequence of SEQ ID NOs: 1 to 3 are the same as the sequences of SEQ ID NOs: 1 to 3 as long as they have the same amino acid sequence as the nucleotide sequence as a result of codon degeneracy. Similarly, it can be suitably used as the vector of the present invention. The insertion region of the foreign gene can be selected, for example, at a desired site in the protein non-coding region of the genome. For example, inserting a foreign gene between the 3 ′ leader region and the viral protein ORF closest to the 3 ′ end; between each viral protein ORF; and / or between the viral protein ORF closest to the 5 ′ end and the 5 ′ trailer region can do. Furthermore, in the genome from which the F or HN gene or the like is deleted, it can be inserted into the deleted region. When a foreign gene is introduced into a paramyxovirus, the length of the polynucleotide inserted into the genome is preferably a multiple of 6 (J. Virology, 67 (8): 4822-4830, 1993). One set of E-I-S sequences is placed between the inserted foreign gene and the viral ORF. Two or more foreign genes can be inserted in tandem using the E-I-S sequence. Alternatively, a desired foreign gene may be inserted using IRES.

  The expression level of a foreign gene carried by a vector can be regulated by the type of transcription initiation sequence added upstream (3 ′ side of the minus strand) of the gene (WO 01/18223). The expression level can be controlled by the insertion position of the foreign gene in the genome; the expression level is higher as it is inserted near the 3 ′ end of the minus strand; the expression level is lower as it is inserted near the 5 ′ end . Thus, the insertion position of the foreign gene can be appropriately adjusted in order to obtain a desired gene expression level or so that the combination with a gene encoding a viral protein in the vicinity of the foreign gene is optimal. In general, it would be advantageous to obtain a high expression level of Aβ, so a foreign gene encoding Aβ is linked to a highly efficient transcription initiation sequence and inserted near the 3 ′ end of the minus-strand genome. It is preferable. Specifically, the foreign gene is inserted between the 3 ′ leader region and the viral protein ORF closest to the 3 ′ end. Alternatively, the foreign gene may be inserted between the viral gene closest to the 3 ′ end and the ORF of the second gene. In the wild-type paramyxovirus, the viral protein gene closest to the 3 ′ end of the genome is the N gene, and the second closest gene is the P gene. Alternatively, if a high expression level of the transgene is not desired, in order to obtain an appropriate effect, for example, by inserting a foreign gene in the vector at a position as 5 ′ of the minus-strand genome as possible, or a low-efficiency transcription initiation sequence By selecting, the gene expression level from the viral vector can be kept low.

  In order to express two polypeptides, a polypeptide containing Aβ and a polypeptide containing Th2 cytokine, from the vector, a nucleic acid encoding each polypeptide is inserted into the genome of the vector. The two nucleic acids may be inserted at separate sites, or inserted in one site in tandem via the E-I-S sequence. It is preferable to use a sequence with high transcription initiation efficiency as the S sequence. For example, 3′-UCCCACUUU-5 ′ (minus strand RNA; SEQ ID NO: 6), 3′-UCCCAGUUU-5 ′ (minus strand RNA; SEQ ID NO: 7), or 3′-UCCCACUUA-5 ′ (minus strand RNA; SEQ ID NO: 8) can be suitably used as the S sequence.

  The vector of the present invention may retain other foreign genes at positions other than those into which genes encoding Aβ and Th2 cytokines have been inserted. Such foreign genes are not limited. For example, it may be a marker gene for monitoring vector infections, or immune system regulatory genes such as cytokines and hormones. The vectors of the present invention may carry one or more genes encoding signaling regulators, cytokines, hormones, receptors, antibodies, and fragments thereof. The vector of the present invention can be administered either directly (in vivo) to a target site in a living body or indirectly (ex vivo) by infecting a patient-derived cell or other cells with the vector and injecting the cell into the target site. Genes can be introduced.

  The vector of the present invention can be used as an extremely excellent means for treating, preventing or inhibiting Alzheimer's disease. The vector of the present invention showed a significant Aβ elimination effect in 24- to 25-month-old APP Tg mice that normally accumulate large amounts of Aβ. This effect is confirmed by a single intranasal administration, and the vector of the present invention may be a less invasive treatment for patients. The finding that there was no inflammation in the central nervous system also demonstrates the high safety of the vectors used.

  Presence of viral proteins (i.e., N, P, and L proteins) necessary for reconstitution of RNP containing genomic RNA (or its complementary strand) of minus-strand RNA virus in mammalian cells to produce the vector of the present invention Below, the cDNA encoding the genomic RNA of the minus-strand RNA virus of the present invention is transcribed. Viral RNPs can be reconstituted by generating either a minus-strand genome (ie, similar to the viral genome antisense strand) or a plus strand (sense strand encoding the viral protein) by transcription. In order to increase the reconstitution efficiency of the vector, a plus strand is preferably generated. The RNA ends preferably reflect the ends of the 3 ′ leader sequence and the 5 ′ trailer sequence as accurately as the native viral genome. In order to accurately control the 5 ′ end of the transcription product, for example, a T7 RNA polymerase recognition sequence may be used as a transcription initiation site, and the RNA polymerase may be expressed in a cell. In order to control the 3 ′ end of the transcript, for example, a self-cleaving ribozyme can be encoded at the 3 ′ end of the transcript so that the ribozyme can excise the 3 ′ end exactly (Hasan, MK et al ., J. Gen. Virol. 78: 2813-2820, 1997; Kato, A. et al., EMBO J. 16: 578-587, 1997; and Yu, D. et al., Genes Cells 2: 457- 466, 1997).

  For example, recombinant Sendai virus vectors carrying foreign genes are Hasan, MK et al., J. Gen. Virol. 78: 2813-2820, 1997; Kato, A. et al., EMBO J. 16: 578-587, 1997; and Yu, D. et al., Genes Cells 2: 457-466, 1997, can be constructed as follows.

  First, a DNA sample containing a cDNA nucleotide sequence of a target foreign gene is prepared. It is preferable that the DNA sample can be confirmed as a single plasmid by electrophoresis at a concentration of 25 ng / μl or more. Hereinafter, a case where a foreign gene is inserted into DNA encoding viral genomic RNA using the NotI site will be described as an example. If the target cDNA nucleotide sequence contains a NotI recognition site, use a site-specific mutagenesis method or the like to modify the nucleotide sequence so that the encoded amino acid sequence is not changed, and remove the NotI site in advance. It is preferable. From this sample, the gene fragment of interest is amplified by PCR and recovered. By adding a NotI site to the 5 ′ region of the two primers, both ends of the amplified fragment become NotI sites. After inserting the foreign gene into the viral genome, the E-I-S sequence or a part thereof is included in the primer so that one E-I-S sequence is placed between the ORF of the foreign gene and the ORF of the viral gene on both sides thereof.

  For example, the forward synthetic DNA sequence is guaranteed to be cleaved by NotI, any sequence of two or more nucleotides on the 5 ′ side (preferably 4 nucleotides that do not include sequences from NotI recognition sites such as GCG and GCC, And more preferably ACTT), and a NotI recognition site gcggccgc is added to the 3 ′ side thereof. As a spacer sequence, any 9 nucleotides, or 9 nucleotides plus a multiple of 6, are further added to the 3 ′ side thereof. Furthermore, a sequence corresponding to an ORF of about 25 nucleotides of the desired cDNA containing the initiation codon ATG is added to the 3 ′ side. It is preferred to select approximately 25 nucleotides from the desired cDNA such that the last nucleotide is G or C at the 3 ′ end of the forward synthetic oligo DNA.

  For the reverse synthetic DNA sequence, select any two or more nucleotides on the 5 ′ side (preferably 4 nucleotides that do not contain sequences from NotI recognition sites such as GCG and GCC, and more preferably ACTT), A NotI recognition site “gcggccgc” is added to the 3 ′ side, and an oligo DNA fragment for adjusting the length is further added to the 3 ′ side. The length of this oligo DNA is designed so that the chain length of the NotI fragment, which is the final PCR amplification product containing the added EIS sequence, is a multiple of 6 nucleotides (so-called `` rule of 6 '' six) ": Kolakofski, D., et al., J. Virol. 72: 891-899, 1998; Calain, P. and Roux, L., J. Virol. 67: 4822-4830, 1993; Calain, P and Roux, L., J. Virol. 67: 4822-4830, 1993). When an EIS sequence is added to the 3 ′ side of the oligo DNA fragment into which this primer has been inserted, a complementary strand sequence to the S sequence of Sendai virus, preferably 5′-TTTCACCCT-3 ′ (SEQ ID NO: 9), 5′- TTTGACCCT-3 ′ (SEQ ID NO: 10), or 5′-ATTCACCCT-3 ′ (SEQ ID NO: 11), a complementary strand sequence of I sequence, preferably 5′-AAG-3 ′, a complementary strand sequence of E sequence, Preferably, 5′-TTTTTCTTACTACGG-3 ′ (SEQ ID NO: 12) is added. Further, a complementary strand sequence having G or C as the last nucleotide was added to the 3 ′ side, and the length was selected to be about 25 nucleotides by counting backward from the start codon of the desired cDNA sequence. In this way, the 3 ′ end of the reverse synthetic DNA is obtained.

  PCR can be performed by conventional methods using Taq polymerase or other DNA polymerases. The amplified fragment of interest is digested with NotI and then inserted into the NotI site of a plasmid vector such as pBluescript ™ (Stratagene). The nucleotide sequence of the obtained PCR product is confirmed with a sequencer, and a plasmid containing the correct sequence is selected. Inserts are excised from these plasmids using NotI and cloned into the NotI site of the plasmid containing the genomic cDNA. It is also possible to obtain recombinant Sendai virus cDNA by directly inserting the fragment into the NotI site without using a plasmid vector.

For example, recombinant Sendai virus genomic cDNA can be constructed according to literature methods (Yu, D. et al., Genes Cells 2: 457-466, 1997; Hasan, MK et al., J. Gen. Virol. 78: 2813-2820, 1997). For example, an 18 bp spacer sequence (5 ′-(G) -CGGCCGCAGATCTTCACG-3 ′) (SEQ ID NO: 13) containing a NotI restriction site is combined with the leader sequence in the cloned Sendai virus genomic cDNA (pSeV (+)). Inserted between ORF of N protein to obtain plasmid pSeV18 ⁺ b (+) containing self-cleaving ribozyme site derived from hepatitis delta virus antigenome chain (Hasan, MK et al., J. General Virology 78: 2813) -2820, 1997). By inserting a foreign gene fragment into the NotI site of pSeV18 ⁺ b (+), a recombinant Sendai virus cDNA containing the desired foreign gene can be obtained.

  The vector of the present invention can be reconstructed by transcribing the DNA encoding the genomic RNA of the recombinant virus thus prepared in the presence of the viral proteins (L, P and N) described above. it can. The present invention provides DNA encoding the viral genomic RNA of the vector of the present invention for the production of the vector of the present invention. The invention also relates to the use of DNA encoding the genomic RNA of the vector for application to the production of the vector of the invention. Recombinant viruses can be reconstituted by known methods in the literature (WO 97/16539; WO 97/16538; WO 00/70055; WO 00/70070; WO 01/18223; WO 03/025570; Durbin, AP et al., Virology 235: 323-332, 1997; Whelan, SP et al., Proc. Natl. Acad. Sci. USA 92: 8388-8392, 1995; Schnell. MJ et al., EMBO J. 13: 4195-4203, 1994; Radecke, F. et al., EMBO J. 14: 5773-5784, 1995; Lawson, ND et al., Proc. Natl. Acad. Sci. USA 92: 4477-4481, 1995; Garcin , D. et al., EMBO J. 14: 6087-6094, 1995; Kato, A. et al., Genes Cells 1: 569-579, 1996; Baron, MD and Barrett, T., J. Virol. 71 : 1265-1271, 1997; Bridgen, A. and Elliott, RM, Proc. Natl. Acad. Sci. USA 93: 15400-15404, 1996; Hasan, MK et al., J. Gen. Virol. 78: 2813- 2820, 1997; Kato, A. et al., EMBO J. 16: 578-587, 1997; Yu, D. et al., Genes Cells 2: 457-466, 1997; Tokusumi, T. et al., Virus Res. 86: 33-38, 2002; Li, H.-O. et al., J. Virol. 74: 6564-6569, 2000). By these methods, minus-strand RNA viruses including parainfluenza virus, vesicular stomatitis virus, rabies virus, measles virus, linderpest virus, and Sendai virus can be reconstituted from DNA. According to these methods, the vector of the present invention can be reconstituted. Viral vector DNA from which the F gene, HN gene, and / or M gene has been deleted does not form infectious virus particles. However, infectious viral particles can be formed by introducing and expressing a deleted gene and / or a gene encoding an envelope protein of another virus in a host cell.

  Specifically, a virus can be prepared according to the following steps: (a) a cDNA encoding a minus-strand RNA virus genomic RNA (minus-strand RNA) or its complementary strand (plus-strand), N, P, And (b) a step of recovering an RNA complex containing the genomic RNA from the cells or the culture supernatant thereof. For transcription, the DNA encoding the genomic RNA is ligated downstream of a suitable promoter. Transcribed genomic RNA is replicated in the presence of N, L, and P proteins to form an RNP complex. Enveloped viral particles are then formed in the presence of M, HN, and F proteins. DNA encoding genomic RNA can be ligated downstream of the T7 promoter, for example, and transcribed into RNA by T7 RNA polymerase. In addition to those containing a T7 polymerase recognition sequence, a desired promoter can be used. Alternatively, cells transcribed in vitro may be transfected into cells. N, L, and P proteins can be expressed in cells using appropriate expression vectors such as plasmids. Examples of promoters include CMV promoter and CAG promoter (Niwa, H. et al. Gene. 108: 193-199, 1991; Japanese Patent Laid-Open No. 3-168087).

  Enzymes such as T7 RNA polymerase required for the initial transcription of genomic RNA from DNA induce expression of these enzymes by introducing plasmid vectors or viral vectors that express them or, for example, in the cell chromosome Can be supplied by inducing expression and inducing expression upon virus reconstitution. Furthermore, genomic RNA and viral proteins necessary for vector reconstitution are supplied, for example, by introducing plasmids that express them. In the supply of these viral proteins, it is possible to use a helper virus of a wild type or some kind of mutant minus-strand RNA virus, but it is not preferable because contamination of these viruses may occur.

  Examples of methods for introducing DNA expressing genomic RNA into cells include, for example: (i) a method for producing a DNA precipitate that can be taken up by the target cells; (ii) having low cytotoxicity; A method of making a positively charged complex containing DNA suitable for uptake by the cell of interest; and (iii) a hole of sufficient size for the DNA molecule to pass through the cell of interest by an electric pulse on the cell membrane. How to open.

In the method (ii), various transfection reagents such as DOTMA (Roche), Superfect (QIAGEN # 301305), DOTAP, DOPE, DOSPER (Roche # 1811169) can be used. An example of (i) is a transfection method using calcium phosphate. DNA transferred into cells by this method is taken up by phagocytic vesicles, but it is known that a sufficient amount of DNA also enters the nucleus. (Graham, FL and Van Der Eb, J., Virology 52: 456, 1973; Wigler, M. and Silverstein, S., Cell 11: 223, 1977). Chen and Okayama examined the optimization of the transfer technology, (1) the incubation conditions of the cells and coprecipitate were 2-4% CO ₂ , 35 ° C, 15-24 hours, and (2) linear DNA It has been reported that optimal precipitation is obtained when more circular DNA has higher activity and (3) the precipitation mixture has a DNA concentration of 20-30 μg / ml (Chen, C. and Okayama, H ., Mol. Cell. Biol. 7: 2745, 1987). The method (ii) is suitable for transient transfection. Previously, transfection methods were known in which a DEAE-dextran (Sigma # D-9885 MW 5 × 10 ⁵ ) mixture was prepared based on the desired DNA concentration ratio. Since many of the complexes are degraded in endosomes, chloroquine can be added to enhance the effect (Calos, MP, Proc. Natl. Acad. Sci. USA 80: 3015, 1983). The method (iii) is called an electroporation method and has no cell selectivity, so the methods (i) and (ii) are more versatile. The efficiency of the method is good under optimal conditions of pulse current duration, pulse shape, electric field (gap between electrodes, voltage) strength, buffer conductivity, DNA concentration, and cell density.

  Among the above three categories, the method (ii) is easy to operate and can examine a large number of samples using a large amount of cells. Therefore, transfection reagents can be used to introduce DNA into cells during vector reconstitution. Is suitable. Preferably, transfection reagents such as Superfect Transfection Reagent (QIAGEN, Cat No. 301305), DOSPER Liposomal Transfection Reagent (Roche, Cat No. 1811169), and TransIT (Mirus, Cat No. MIR2300) are used. However, it is not limited to these.

  Specifically, virus reconstitution from cDNA can be performed, for example, as follows.

  Using minimal essential medium (MEM) containing 10% fetal calf serum (FCS) and antibiotics (100 units / ml penicillin G and 100 μg / ml streptomycin), such as in a plastic plate or 100 mm petri dish with about 6-24 holes Cultivated monkey kidney-derived LLC-MK2 to almost 100% confluence, for example, recombinant vaccinia virus vTF7-3 expressing T7 RNA polymerase and inactivated by UV irradiation for 20 minutes in the presence of 1 μg / ml psoralen, 2 Infected with PFU / cell (Fuerst, TR et al., Proc. Natl. Acad. Sci. USA 83: 8122-8126,1986, Kato, A. et al., Genes Cells 1: 569-579, 1996) . The amount of psoralen added and the UV irradiation time can be adjusted appropriately. One hour after infection, 2 to 60 μg, more preferably 3 to 20 μg of DNA encoding the recombinant Sendai virus genomic RNA is converted into a plasmid (0.5 to Superfect (QIAGEN) with 24 μg pGEM-N, 0.25-12 μg pGEM-P, and 0.5-24 μg pGEM-L) (Kato, A. et al., Genes Cells 1: 569-579, 1996) Transfect by the lipofection method used. The quantity ratio of expression vectors encoding N, P, and L proteins is preferably 2: 1: 2, and the plasmid quantity is eg 1-4 μg pGEM-N, 0.5-2 μg pGEM-P, and 1 Adjusted appropriately within the range of ˜4 μg pGEM-L.

Transfected cells are optionally serum-free MEM containing only 100 μg / ml rifampicin (Sigma) and cytosine arabinoside (AraC), more preferably 40 μg / ml cytosine arabinoside (AraC) (Sigma). Incubate at Optimal drug concentrations are set to minimize cytotoxicity by vaccinia virus and maximize virus recovery (Kato, A. et al., Genes Cells 1: 569-579, 1996). After culturing for 48 to 72 hours after transfection, the cells are collected, and the cells are disrupted by repeating freeze-thawing three times. The debris containing RNP is infected with LLC-MK2 cells and further cultured. Alternatively, the culture supernatant is collected, added to the culture medium of LLC-MK2 cells, infected and cultured. Transfection can be performed by forming a complex with, for example, lipofectamine or polycationic liposomes and introducing it into cells. Specifically, various transfection reagents such as DOTMA (Roche), Superfect (QIAGEN # 301305), DOTAP, DOPE, DOSPER (Roche # 1811169) can be used. Chloroquine can also be added to prevent degradation in endosomes (Calos, MP, Proc. Natl. Acad. Sci. USA 80: 3015, 1983). In cells into which RNP has been introduced, expression of viral genes from RNP and replication of RNP results in amplification of the vector. The resulting virus solution (supernatant) was diluted (e.g. 10 ⁶ times), by repeating amplification using a new cell, the vaccinia virus vTF7-3 can be completely removed. Such amplification is repeated, for example, three times or more. The resulting vector can be stored at -80 ° C. LLC-MK2 cells expressing envelope protein may be used for transfection to reconstitute viral vectors lacking the ability to propagate and lacking the gene encoding the envelope protein, or the envelope expression plasmid may be transfected together. You may Alternatively, the defective viral vector can be amplified by further layering and culturing LLK-MK2 cells expressing the envelope protein on the transfected cells (see WO 00/70055 and WO 00/70070). I want to be)

  The titer of the recovered virus can be determined, for example, by measuring CIU (Cell-Infectious Unit) or hemagglutination activity (HA) (WO 00/70070; Kato, A. et al., Genes Cells 1: 569-579, 1996; Yonemitsu, Y. & Kaneda, Y., Hemaggulutinating virus of Japan-liposome-mediated gene delivery to vascular cells. Ed. By Baker AH. Molecular Biology of Vascular Diseases, Method in Molecular Medicine: Humana Press: pp. 295-306, 1999). The titer of a vector carrying a GFP (green fluorescent protein) marker gene or the like can be quantified by directly counting infected cells using the marker as an index (for example, as GFP-CIU). The titer measured in this way can be handled in the same way as CIU (WO 00/70070).

As long as the viral vector can be reconstituted, the host cell used for reconstitution is not particularly limited. For example, in reconstitution of Sendai virus vector, etc., monkey kidney-derived LLC-MK ₂ cells (ATCC CCL-7) and CV-1 cells (for example, ATCC CCL-70), hamster kidney-derived BHK cells (for example, ATCC CCL- Cultured cells such as 10) and human-derived cells can be used. By expressing an appropriate envelope protein in these cells, infectious virus particles containing the protein in the envelope can also be obtained. Furthermore, in order to obtain a large amount of Sendai virus vector, a virus vector obtained from the above-mentioned host can be infected with a developing chicken egg to amplify the vector. A method for producing viral vectors using eggs has already been developed (Nakanishi, M. et al. Ed. `` State-of-the-Art Technology Protocol in Neuroscience Research III (Shinkei Kagaku Kenkyu-no Sentan Gijutu Protocol III)). Molecular Neuron Physiology (Bunshi Sinkeisaibou Seirigaku) ", Koseisha, Osaka, pp. 153-172, 1993). Specifically, for example, fertilized eggs are placed in an incubator and cultured at 37-38 ° C. for 9-12 days to grow embryos. Viral vectors are inoculated into the allantoic cavity and eggs are cultured for several days (eg, 3 days) to propagate the viral vectors. Conditions such as the culture period may vary depending on the recombinant Sendai virus to be amplified. Thereafter, the allantoic fluid containing the virus is collected. Sendai virus vectors can be isolated and purified from allantoic fluid according to conventional methods (Tashiro, M., `` Virus Experiment Protocol '', Nagai, Ishihama, ed., Medical View Co., Ltd., pp. 68-73, 1995).

  For example, reconstruction and production of Sendai virus vectors lacking the F gene can be performed as follows (see WO 00/70055 and WO 00/70070).

<1> Construction of F gene-deficient Sendai virus genomic cDNA and F expression plasmid Sendai virus (SeV) full-length genomic cDNA, pSeV18 ⁺ b (+) (Hasan, MK et al., J. General Virology 78: 2813-2820 1997) ("pSeV18 ⁺ b (+)" is also called "pSeV18 ⁺ ") cDNA is digested with SphI / KpnI to generate a fragment (14673bp). The fragment is cloned into pUC18 to prepare plasmid pUC18 / KS, and an F gene deletion site is constructed on pUC18 / KS. Deletions of the F gene are made by a combination of PCR and ligation methods. As a result, the FF ORF (ATG-TGA = 1698 bp) is removed. For example, ligated with atgcatgccggcagatga (SEQ ID NO: 14) to construct F gene-deficient SeV genomic cDNA (pSeV18 ⁺ / ΔF). PCR product formed using primers [forward: 5′-gttgagtactgcaagagc / SEQ ID NO: 15, reverse: 5′-tttgccggcatgcatgtttcccaaggggagagttttgcaacc / SEQ ID NO: 16] for the upstream region of F, and primer [forward: The PCR product formed using 5′-atgcatgccggcagatga / SEQ ID NO: 17, reverse: 5′-tgggtgaatgagagaatcagc / SEQ ID NO: 18] was ligated via the EcoT22I restriction enzyme site. The plasmid thus obtained is digested with SacI and SalI, and a fragment (4931 bp) covering the region containing the F gene deletion site is recovered and cloned into pUC18 to form pUC18 / dFSS. This pUC18 / dFSS is digested with DraIII, and the recovered fragment is replaced with a DraIII fragment covering the region containing the F gene of pSeV18 ⁺ via ligation to obtain plasmid pSeV18 ⁺ / ΔF.

  The foreign gene is inserted into the restriction enzyme sites of NsiI and NgoMIV at the F gene deletion site of pUC18 / dFSS, for example. For this purpose, for example, foreign gene fragments may be amplified using NsiI-tailed primers and NgoMIV-tailed primers.

<2> Preparation of helper cells expressing SeV-F protein To construct a Cre / loxP-derived plasmid that expresses the Sendai virus F gene (SeV-F), the SeV-F gene was amplified by PCR, and Cre DNA The plasmid pCALNdlw (Arai, T. et al., J. Virology 72: 1115-1121, 1998) designed to express a gene product by recombinase is inserted into a unique SwaI site to construct a pCALNdLw / F plasmid.

To recover infectious virus particles from F gene-deficient genome, a helper cell line expressing SeV-F protein is established. For example, monkey kidney-derived LLC-MK2 cells generally used for SeV growth can be used. LLC-MK2 cells are cultured in MEM supplemented with 10% heat-inactivated fetal bovine serum (FBS), penicillin G sodium (50 units / ml), and streptomycin 50 μg / ml at 37 ° C., 5% CO ₂ . Since the SeV-F gene product is cytotoxic, the above pCALNdLw / F plasmid designed to express the F gene product with Cre DNA recombinase can be obtained by a well-known protocol using the calcium phosphate method using the mammalian transfection kit (Stratagene). Transfect LLC-MK2 cells according to:

PCALNdLw / F plasmid (10 μg) was introduced into LLC-MK2 cells grown to 40% confluence on a 10 cm plate, and the cells were transferred to 10% FBS / MEM (10 ml) in a 5% CO ₂ incubator at 37 ° C. Incubate for hours. The cells are then peeled off and suspended in medium (10 ml). Seed the suspension in 5 10cm dishes: 1 5ml, 2ml each 2ml, and 2 each 0.2ml. Cells are cultured for 14 days in MEM (10 ml) containing G418 (GIBCO-BRL) (1200 μg / ml) and 10% FBS, and the medium is changed every 2 days. A cell line in which the gene is stably introduced is selected. Cells grown in the above medium are resistant to G418 and are then recovered using a cloning ring. The collected cell clones are continuously cultured until they become confluent on a 10 cm plate.

  The expression of F protein was carried out by growing cells to confluence in a 6 cm petri dish and then using the method of Saito et al. (Saito et al., Nucl. Acids Res. 23: 3816-3821, 1995; Arai, T. et al., J. Virol 72: 1115-1121, 1998), for example, by infecting cells with adenovirus AxCANCre at MOI = 3.

<3> Reconstitution and amplification of F gene deletion Sendai virus (SeV / ΔF) The above-mentioned pSeV18 ⁺ / ΔF plasmid into which a foreign gene has been inserted is transfected into LLC-MK2 cells as follows. LLC-MK2 cells are seeded in a 100 mm dish at 5 × 10 ⁶ cells / pet. When transcription of genomic RNA is performed with T7 RNA polymerase, the cells are cultured for 24 hours, and then treated with psoralen and long-wave ultraviolet light (365 nm) for 20 minutes. A recombinant vaccinia virus expressing T7 RNA polymerase (PLWUV-VacT7: Fuerst , TR et al., Proc. Natl. Acad. Sci. USA 83: 8122-8126, 1986) is infected with MOI = 2 at room temperature for 1 hour. For UV irradiation of vaccinia virus, for example, UV Stratalinker ™ 2400 (catalog number 400676 (100V), Stratagene, La Jolla, CA, USA) equipped with five 15 watt bulbs can be used. After washing the cells with serum-free MEM, the appropriate lipofection reagent is used to transfect plasmids expressing genomic RNA and expression plasmids expressing paramyxovirus N, P, L, and F plus HN proteins. . The amount of these plasmids is not limited to this, but can preferably be 6: 2: 1: 2: 2 in order. For example, genomic RNA expression plasmids and expression plasmids that express N, P, L, and F plus HN proteins (pGEM / NP, pGEM / P, pGEM / L, and pGEM / F-HN; WO 00/70070, Kato , A. et al., Genes Cells 1: 569-579, 1996) are transfected in amounts of 12 μg, 4 μg, 2 μg, 4 μg and 4 μg / dish respectively. After culturing for several hours, the cells were washed twice with serum-free MEM, 40 μg / ml cytosine β-D-arabinofuranoside (AraC: Sigma, St. Louis, MO) and 7.5 μg / ml trypsin (Gibco- BRL, Rockville, MD). These cells are collected and the pellet is suspended in Opti-MEM (10 ⁷ cells / ml). Repeat freeze-thaw three times, mix with the lipofection reagent DOSPER (Boehringer Mannheim) (10 ⁶ cells / 25 μl DOSPER), leave at room temperature for 15 minutes, and then transfect the cloned F-expressing helper cells (12-well-plate) 10 ⁶ cells / well), cultured in serum-free MEM (containing 40 μg / ml AraC and 7.5 μg / ml trypsin), and the supernatant is collected. Any virus lacking a gene other than F, such as HN and / or M gene, can be prepared by the same method.

  In the production of a viral gene-deficient vector, for example, when two or more vectors in which different viral genes are deleted from the viral genome are introduced into the same cell, the viral proteins that are deleted from each vector are derived from other vectors. Such mutual complementation allows for the construction of infectious viral particles and the amplification of viral vectors through the replication cycle. As a result, a mixture of individual viral gene-deficient viral vectors can be produced in large quantities at a low cost. Such viruses are smaller in genome size than intact viruses because they lack the viral genes. Such viruses can carry large foreign genes. In addition, such viruses that are non-transmissible due to viral gene deficiency, once released outside of the cell and simply diluted, are difficult to maintain infectivity, and thus become sterile. The advantage is that their release to the environment can be controlled. For example, a vector encoding Aβ and a vector encoding Th2 cytokine may be constructed separately so as to complement each other and used for co-infection. The present invention provides a composition comprising a minus-strand RNA viral vector encoding a polypeptide containing Aβ and a minus-strand RNA viral vector encoding a Th2 cytokine. The present invention also provides a kit comprising a minus-strand RNA viral vector encoding a polypeptide containing Aβ and a minus-strand RNA viral vector encoding a Th2 cytokine. These compositions and kits can be used to reduce amyloid β deposition.

  After administration of a transmissible minus-strand RNA viral vector to an individual or cell, for example, if it becomes necessary to inhibit viral vector growth upon completion of treatment, the host can be damaged by administering an RNA-dependent RNA polymerase inhibitor It is also possible to specifically inhibit only the growth of the viral vector without giving any.

According to the method of the present invention, the viral vector of the present invention is, for example, 1 × 10 ⁵ CIU / ml or more, preferably 1 × 10 ⁶ CIU / ml or more, more preferably 5 × 10 ⁶ CIU / ml or more, more preferably Is 1 × 10 ⁷ CIU / ml or more, more preferably 5 × 10 ⁷ CIU / ml or more, more preferably 1 × 10 ⁸ CIU / ml or more, more preferably 5 × 10 ⁸ CIU / ml or more. It can be released into the culture medium of the producer cells. Viral titers can be measured by methods described herein and elsewhere (Kiyotani, K. et al., Virology 177 (1): 65-74, 1990; WO 00/70070).

  The recovered viral vector can be purified to be substantially pure. Purification of the vector can be performed by purification and separation methods known in the literature including filtration, centrifugation, and column purification, or a combination thereof. “Substantially pure” means that the viral vector accounts for a major proportion as a component in the sample in which it is present. Typically, a substantially pure viral vector has a percentage of viral vector-derived protein of 10% or more, preferably 20% of the total protein in the sample (but excluding proteins added as carriers and stabilizers). It can be identified by confirming that it is 50% or more, preferably 70% or more, more preferably 80% or more, and still more preferably 90% or more. As an example of a specific method for purifying virus, a method using cellulose sulfate ester or crosslinked polysaccharide sulfate ester (Japanese Patent Publication No. 62-30752, Japanese Patent Publication No. 62-33879, and Japanese Patent Publication No. 62-30753), In addition, there is a method (WO 97/32010) in which a virus is adsorbed to a polysaccharide containing fucose sulfate and / or a degradation product thereof.

  In preparing a composition comprising a vector, the vector can be combined with a desired pharmaceutically acceptable carrier or vehicle as required. A “pharmaceutically acceptable carrier or vehicle” is a material that can be administered with a vector and does not significantly inhibit gene transfer by the vector. For example, the vector can be appropriately diluted with saline or phosphate buffered saline (PBS) to form a composition. When the vector is grown in chicken eggs or the like, the “pharmaceutically acceptable carrier or medium” may include allantoic fluid. Further, the composition comprising the vector may comprise a carrier or medium such as deionized water and 5% aqueous dextrose. In addition to the above, vegetable oils, suspending agents, surfactants, stabilizers, biocides and the like may be included. Preservatives or other additives can also be included. Compositions containing the vectors of the present invention are useful as reagents and drugs. The present invention relates to production of an anti-amyloid deposition drug comprising the step of producing a composition comprising a minus-strand RNA viral vector encoding Aβ peptide or a cell into which the vector is introduced, and a pharmaceutically acceptable carrier or vehicle. Regarding the method. The present invention also relates to the use of a minus-strand RNA viral vector, a cell producing the vector, or a cell into which the vector has been introduced in the manufacture of an anti-amyloid depositing drug.

  The composition containing the vector of the present invention comprises an organic substance such as a biopolymer, an inorganic substance such as hydroxyapatite, specifically a collagen matrix, a polylactic acid polymer or copolymer, a polyethylene glycol polymer or copolymer, and a chemical derivative thereof as a carrier. May be included in combination.

  The composition of the invention may comprise Th2 cytokines and / or nucleic acids encoding Th2 cytokines in an expressible manner. Such Th2 cytokines may be full-length (wild-type) polypeptides or partial peptides as long as they retain activity. For example, deletion of N-terminal and / or C-terminal amino acids (e.g. 1-30 amino acids, specifically 1, 2, 3, 4, 5, 10, 15, 20, or 25 amino acids) affects cytokine activity Will not. Furthermore, the N-terminal signal sequence can be appropriately replaced by other signal sequences. Alternatively, cytokines may be expressed as fusion proteins with other peptides. The nucleic acid encoding Th2 cytokine may be inserted into an expression vector or connected to a suitable promoter such as an actin promoter, EF1 promoter, CMV promoter, CAG promoter. The nucleic acid may be contained within a minus-strand RNA viral vector or any other expression vector. When the Th2 cytokine is encoded in a minus-strand RNA viral vector, the Th2 cytokine may be encoded as Aβ in the same vector, or the Th2 cytokine may be encoded in another minus-strand RNA viral vector. Specifically, when the minus-strand RNA viral vector of the present invention encoding Aβ does not encode Th2 cytokine, Th1 / Th2 balance is achieved by combining Th2 cytokine or Th2 cytokine vector with the vector of the present invention encoding Aβ. It can be shifted to Th2 by administration. For example, Th2 cytokines that can be used are IL-4, IL-5, IL-6, IL-9, IL-10, and IL-13, or combinations thereof. The Th2 cytokine is preferably selected from the group consisting of IL-4, IL-10, and IL-13.

  The composition of the present invention may also include an adjuvant. Specifically, even if the vector of the present invention does not encode a Th2 cytokine, the Th1 / Th2 balance can be shifted to Th2 using a composition containing a Th2 adjuvant. A Th2 adjuvant refers to an adjuvant that activates type 2 helper T cells (Th2 cells) more preferentially than type 1 helper T cells (Th1 cells). Specifically, adjuvants include aluminum hydroxide (alum), cholera toxin (B subunit), Schistosoma mansoni egg extract protein (e.g. Lacto-N-fucopentaose III), etc. (Grun, JL and PH Maurer, Cellular Immunol. 121: 134-145, 1989; Holmgren, J. et al., Vaccine 11: 1179-1184, 1993; Wilson, AD et al., Vaccine 11: 113-118, 1993; Lindsay, DS et al, Int Arch. Allergy Immunol. 105: 281-288, 1994; Xu-Amano, J. et al., J. Exp. Med. 178: 1309-1320, 1993; Okano, M. et al., J. Immunol. 167 (1): 442-50, 2001). The composition of the present invention may comprise any other component. For example, they may include markers for monitoring administration, or one or more compounds such as immune system regulators, signaling regulators, cytokines, hormones, receptors, antibodies, and fragments thereof. The compositions of the present invention comprise one or more vectors encoding one or more polypeptides such as signaling regulators, signaling regulators, cytokines, hormones, receptors, antibodies, and fragments thereof. But you can.

  By administering the produced minus-strand RNA virus or a composition containing the virus to an individual, an immune response against Aβ is induced, thereby reducing Aβ deposition. The vector may be administered in combination with a Th2 cytokine, a Th2 cytokine expression vector, or a Th2 adjuvant. Administration of the vector may be in vivo or ex vivo via cells. The inoculated minus-strand RNA viral vector need not be an infectious viral particle, as long as it has the ability to express the retained antigen polypeptide gene by genomic RNA, but not the infectious viral particle and the viral core (genomic and genomic junctions). RNP complex containing viral protein). As used herein, a minus-strand RNA viral vector refers to a genomic RNA derived from a minus-strand RNA virus, and a ribonucleoprotein (RNP) complex containing a viral protein necessary for the replication of the genomic RNA and the expression of the gene carried by the virus. A complex that expresses a gene that replicates and retains the genomic RNA in an infected cell. An RNP is a complex comprising, for example, genomic RNA of a minus-strand RNA virus and N, L, and P proteins. Specifically, the minus-strand RNA viral vector of the present invention includes infectious viral particles, non-infectious particles (also referred to as virus-like particles (VLP)), and negative-strand RNA virus nucleocapsids and other genomic RNAs and genomes. RNPs containing viral proteins that bind to RNA are included. Even if it is RNP (virus core) from which the envelope has been removed from the virus particle, it can be replicated in the cell if it is introduced into the cell (WO 97/16538; WO 00/70055). RNP or VLP may desirably be inoculated in combination with, for example, a transfection reagent (WO 00/70055; WO 00/70070).

  When the vector is inoculated through cells, a minus-strand RNA viral vector is introduced into appropriate cultured cells or cells collected from the inoculated animal. When the minus-strand RNA virus is infected into cells in vitro (eg, in a test tube or petri dish), the infection is performed in vitro (or ex vivo) in the desired physiological aqueous solution, eg, culture medium or saline. The MOI (multiplicity of infection; ie the number of infectious viruses per cell) is preferably in the range between 1-1000, more preferably 2-500, even more preferably 3-300, even more preferably 5-100. . A short time is sufficient for contact between the minus-strand RNA virus and the cell. For example, it may be contacted for 1 minute or more, preferably 3 minutes or more, 5 minutes or more, 10 minutes or more, or 20 minutes or more, for example, about 1 to 60 minutes, and more specifically, about 5 to 30 minutes. . Alternatively, it may be contacted for a longer time, for example, for several days or longer.

  RNPs containing viral genomic RNA and non-infectious viral particles (virus-like particles (VLP)) can be introduced into cells by well-known transfection methods. Specifically, the calcium phosphate method (Chen, C. & Okayama, H., BioTechniques 6: 632-638, 1988; Chen, C. and Okayama, H., Mol. Cell. Biol. 7: 2745, 1987), DEAE-dextran method (Rosenthal, N., Methods Enzymol. 152: 704-709, 1987), various liposome-based transfection reagents (Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory , Cold Spring Harbor, NY, 1989), and electroporation (Ausubel, F. et al., In Current Protocols in Molecular Biology, John Wiley and Sons, NY, Vol. 1, Ch. 5 and 9, 1994) The cells can be transfected by various techniques known to those skilled in the art. To suppress endosomal degradation, chloroquine can also be added during transfection (Calos, MP, Proc. Natl. Acad. Sci. USA 80: 3015, 1983). Transfection reagents include DOTMA (Roche), Superfect Transfection Reagent (QIAGEN, Cat No. 301305), DOTAP, DOPE, DOSPER (Roche # 1811169), TransIT-LT1 (Mirus, Product No. MIR 2300), CalPhos (trademark) ) Mammalian Transfection Kit (Clontech # K2051-1), CLONfectin ™ (Clontech # 8020-1) and the like. Envelope viruses are known to take up host cell-derived proteins during virus particle formation. Such proteins have certain antigenicity when introduced into cells and can cause cytotoxicity (J. Biol. Chem., 272: 16578-16584, 1997). Therefore, there is an advantage in using RNP from which the envelope has been removed (WO 00/70055).

  Viral RNPs can also be formed directly in cells by introducing into the cell an expression vector encoding the viral genomic RNA and the viral proteins (N, P and L proteins) required for replication of the genomic RNA. it can. Cells into which a viral vector has been introduced may be prepared in this way.

  Once a cell into which a minus-strand RNA viral vector has been introduced is prepared, it may be cultured for about 12 hours to 5 days (preferably 1 to 3 days) to express the Aβ peptide. The resulting cells can be inoculated directly or as a cell lysate, but preferably cells expressing Aβ peptide are used for inoculation. Aβ having a signal peptide may be expressed from a vector and secreted extracellularly. Lysates of cells into which the vector has been introduced can be prepared by procedures that lyse cell membranes with detergents or that involve repeated freeze-thaw cycles. Nonionic surfactants such as Triton X-100 and Nonidet P-40 can be applied in a concentration range of 0.1-1%. For example, after washing with PBS, the cell mass is collected by centrifugation, resuspended in TNE buffer [25 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40], and 10 times on ice. Obtained by incubating the suspension for ˜30 minutes. If the protein used as an antigen is soluble in the cytoplasm, the prepared lysate may be centrifuged (10,000 xg, 10 minutes) to remove unnecessary insoluble fraction as a precipitate, and the resulting supernatant may be used for immunization. it can. If the lysate is administered to a site where detergent is not desired, prepare the lysate by washing and then resuspending the cells in PBS and repeating the 5-6 freeze-thaw cycles to destroy the cells. Also good. The lysate may be administered with a transfection reagent.

  Alternatively, immunity can be induced by administering a nucleic acid that generates a minus-strand RNA viral vector encoding an Aβ peptide to an animal and generating an Aβ peptide that is expressed by the minus-strand RNA viral vector in the animal's body. . A nucleic acid that produces a minus-strand RNA viral vector is a set of nucleic acids that express the RNA and proteins required for the production of a recombinant minus-strand RNA viral vector. Specifically, a nucleic acid encoding a negative strand viral genomic RNA encoding Aβ or a complementary strand thereof (antigenomic RNA; that is, a positive strand), and a group of viral proteins constituting RNP including the genomic RNA of a negative strand RNA virus A set of nucleic acids comprising a nucleic acid encoding These nucleic acids contain appropriate promoters so that the encoded RNA and protein can be expressed. Such promoters are, for example, CMV promoters (Foecking, MK, and Hofstetter H., Gene 45: 101-105, 1986), retroviral LTRs (Shinnik, TM et al., Nature, 293: 543-548, 1981). ), EF1 promoter, and CAG promoter (Niwa, H. et al., Gene. 108: 193-199, 1991, Japanese Patent Laid-Open No. 3-168087). A plasmid vector can be suitably used as the nucleic acid. The genome of the minus-strand RNA virus contains all the envelopes of the parental wild-type virus that carry the genes that encode the viral proteins (typically N, L, and P) that make up the RNP that contains the genomic RNA. Those holding a constituent protein gene are preferred. If the minus-strand RNA viral genome lacks any gene in the envelope component protein, an envelope protein that complements the formation of infectious viral particles (for example, an envelope protein that is missing in the genome or another envelope protein such as VSV-G) The encoding nucleic acid may be included in the set of nucleic acids described above. By administering these nucleic acids to animals, recombinant minus-strand RNA viruses are produced in the animals. The viral protein group constituting the RNP containing the genomic RNA of the minus-strand RNA virus refers to a protein that forms an RNP together with the viral genomic RNA and constitutes a nucleocapsid. These are a group of proteins necessary for genome replication and gene expression, and typically include N, P, and L proteins. Specifically, the present invention inoculates an animal with (i) a nucleic acid encoding a negative-strand RNA viral genomic RNA encoding Aβ or its complementary strand, and (ii) a nucleic acid encoding N, P, and L proteins. The present invention also relates to a method including the step of: In this animal, RNP containing genomic RNA is formed and Aβ peptide is expressed. The genome may further encode a Th2 cytokine.

  Alternatively, a cell into which a nucleic acid encoding genomic RNA or a complementary strand thereof and a viral protein group constituting the RNP have been introduced, or a lysate of the cell may be inoculated. For details of nucleic acids that generate minus-strand RNA viral vectors, reference can be made to the following documents: WO 97/16539; WO 97/16538; WO 00/70055; WO 00/70070; WO 01/18223; WO 03/025570; Durbin, AP et al., Virology 235: 323-332, 1997; Whelan, SP et al., Proc. Natl. Acad. Sci. USA 92: 8388-8392, 1995; Schnell. MJ et al. , EMBO J. 13: 4195-4203, 1994; Radecke, F. et al., EMBO J. 14: 5773-5784, 1995; Lawson, ND et al., Proc. Natl. Acad. Sci. USA 92: 4477 -4481, 1995; Garcin, D. et al., EMBO J. 14: 6087-6094, 1995; Kato, A. et al., Genes Cells 1: 569-579, 1996; Baron, MD and Barrett, T. , J. Virol. 71: 1265-1271, 1997; Bridgen, A. and Elliott, RM, Proc. Natl. Acad. Sci. USA 93: 15400-15404, 1996; Hasan, MK et al., J. Gen. Virol. 78: 2813-2820, 1997; Kato, A. et al., EMBO J. 16: 578-587, 1997; Yu, D. et al., Genes Cells 2: 457-466, 1997; Tokusumi, T et al., Virus Res. 2002: 86; 33-38, 1997; Li, H.-O. et al., J. Virol., 74: 6564-6569, 2000

  When an animal is inoculated with a nucleic acid that produces a minus-strand RNA viral vector, a nucleic acid that encodes genomic RNA of a minus-strand RNA virus that encodes Aβ or its complementary strand, and nucleic acids that encode N, P, and L proteins, It may be introduced into animals in a weight ratio of 5: 0.5: 0.5: 2. The ratio of nucleic acids may be adjusted appropriately. For example, when using an expression plasmid, 5 μg to 1000 μg of plasmid encoding viral genomic RNA (plus or minus strand) encoding Aβ, and 0.5 μg to 200 μg of N expression plasmid, 0.5 μg to 200 μg of P expression plasmid, and L expression plasmid Administration can be carried out using 2 μg to 500 μg. Nucleic acid administration can be performed, for example, by injecting naked DNA directly or after mixing with a transfection reagent. Transfection reagents include, for example, lipofectamine and polycationic liposomes. Specifically, DOTMA (Roche), Superfect (QIAGEN # 301305), DOTAP, DOPE, DOSPER (Roche # 1811169), TransIT-LT1 (Mirus, Product No. MIR 2300), etc. can be used.

The dosage of the vector of the present invention varies depending on the type of disease, the patient's weight, age, sex, and symptoms, the purpose of administration, the dosage form of the composition to be introduced, the administration method, the type of gene to be introduced, and the like. One skilled in the art can determine the appropriate dosage. The route of administration can be appropriately selected and includes, but is not limited to, transdermal, intranasal, transbronchial, intramuscular, intraperitoneal, intravenous, and subcutaneous routes. In particular, intramuscular administration (for example, gastrocnemius muscle), subcutaneous administration, nasal administration or spray, palm or footpad intradermal administration, spleen direct administration, intraperitoneal administration and the like are preferable. There may be one or more inoculation sites, for example 2 to 15 sites. The inoculation amount may be appropriately adjusted according to the target animal, the inoculation site, the number of inoculations, and the like. The vector is in an amount in the range of about 10 ⁵ to about 10 ¹¹ CIU / ml, more preferably about 10 ⁷ to about 10 ⁹ CIU / ml, most preferably about 1 × 10 ⁸ to about 5 × 10 ⁸ CIU / ml. And preferably in combination with a pharmaceutically acceptable carrier. The dose per time of human pairs, in terms of virus ^{titer, 1 × 10 4 CIU~5 × 10} 11 CIU ( cell infectious units), and preferably at ^{2 × 10 5 CIU~2 × 10 10} CIU is there. The administration can be performed once or multiple times as long as the side effects are within the clinically acceptable range. The number of administrations per day may be determined similarly. A single effect can produce a significant effect, but a stronger effect can be obtained by introducing the vector more than once.

  When administered multiple times, it may be administered again, for example, about 1 year after the initial administration. A preferred route of administration is, for example, intranasal or intramuscular. The administration may be repeated for a stronger effect. For multiple administrations, preferably the above-described minus-strand RNA viral vector carrying a nucleic acid encoding Aβ, a nucleic acid generating a viral vector, a cell into which a viral vector or a nucleic acid generating a vector has been introduced, or a cell lysate May be used.

When inoculating via cells (ex vivo administration), for example, human cells, preferably autologous cells, are infected with minus-strand RNA viral vectors, 10 ⁴ to 10 ⁹ cells, and preferably 10 ⁵ to 10 ⁸ cells, or the like Lysates can be used. This vector can also be used to inoculate non-human animals, and the dosage is converted based on the above-mentioned dosage based on, for example, the body weight of the target animal and human or the volume ratio (eg, average value) of the administration target site. can do. Subjects to be administered with the composition comprising the vector of the present invention include desired vertebrates having an immune system (human and non-human vertebrates), preferably birds and mammals, more preferably mammals (human and human). Including non-human mammals). Specifically, non-human primates such as humans and monkeys, rodents such as mice and rats, and all other mammals such as rabbits, goats, sheep, pigs, cows, and dogs. The animals to be administered include, for example, individuals suffering from Alzheimer's disease, individuals having increased Aβ levels, individuals having increased Aβ deposition, individuals having an Alzheimer type mutant gene, and the like.

  The method of the present invention induces an immune response against Aβ. The immune reaction against Aβ can be confirmed by production of anti-Aβ antibody, decrease in the amount of Aβ in brain tissue, decrease in Aβ deposition, and the like. The production of anti-Aβ antibodies may be examined by detecting anti-Aβ antibodies in the blood. The antibody level can be measured by ELISA (enzyme-linked immunosorbent assay) and oak talony method. In ELISA, for example, an antigen is adsorbed on a microplate, antiserum is prepared, the prepared antiserum is diluted 2-fold serially (starting solution 1: 1000), and an antigen-antibody reaction is performed on the diluted antiserum plate. To implement. Next, for color development, the antibody of the immunized animal is reacted with a heterologous antibody labeled with a peroxidase enzyme to obtain a secondary antibody. When the absorbance is ½ of the maximum color absorbance, the antibody titer can be calculated based on the antibody dilution factor. Alternatively, in the oak talony method, antigens and antibodies diffuse in the agar gel, and white sedimentation lines are formed as a result of the immunoprecipitation reaction. The sedimentation line can be used to measure the antibody titer, which is the dilution ratio of the antiserum when an immunoprecipitation reaction occurs. The Aβ level in brain tissue can be measured using, for example, an extract of brain tissue and a Biosource ELISA kit.

The effect of reducing Aβ deposition (senile plaques) can be measured, for example, by the following procedure: After treating brain tissue sections with 70% formic acid and inactivating endogenous peroxidase with 5% H ₂ O ₂ The anti-Aβ antibody and the section are reacted, and DAB staining is performed using a peroxidase-labeled secondary antibody. After staining, the area of the Aβ accumulation portion can be measured by observation with a microscope. It can be determined that the Aβ deposition level has decreased if the proportion of the area of the accumulation portion is reduced as compared with the case where the vector of the present invention is not administered. Alternatively, after intravenous administration of a compound with affinity for amyloid such as 1-fluoro-2,5-bis- (3-hydroxycarbonyl-4-hydroxy) styrylbenzene (FSB), a living subject using MRI Senile plaques can be observed (Higuchi M et al., Nat. Neurosci. 8 (4): 527-33, 2005; Sato, K. et al., Eur. J. Med. Chem. 39: 573 , 2004; Klunk, WE et al., Ann. Neurol. 55 (3): 306-19, 2004). The effect of the vector of the present invention can be confirmed by such a noninvasive amyloid imaging technique.

  The present invention also relates to a method for measuring an immune response against amyloid β comprising the steps of: introducing a vector of the present invention or a composition comprising the vector into a subject having amyloid β deposition, and anti-amyloid in the subject detecting β antibody. The present invention also relates to a method for measuring amyloid β deposition comprising the steps of: administering a vector of the present invention or a composition comprising a vector to a subject having amyloid β deposition, and of amyloid β deposition in a subject Detecting the level. By these methods, it is possible to monitor the immune response to amyloid β and / or the effect of reducing amyloid β deposition.

BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be specifically described below with reference to examples, but it should not be construed that the invention is limited thereto. References cited herein are incorporated by reference.

[Example 1] Construction of minus-strand RNA virus genomic cDNA carrying Aβ gene
(1-1) Construction of NotI fragment (addition of transcription signal of minus-strand RNA virus)
As a template, a secreted Aβ peptide (sequence) by adding a secretion signal (1 to 18 amino acids) of amyloid precursor protein (APP: accession number AF282245) to human Aβ peptide 1 to 43 (SEQ ID NO: 27) PCR using a gene encoding No. 28) (JP 2005-21149; SEQ ID NO: 1) and two primers phAbeta-NnotI (SEQ ID NO: 19) and phAbeta-CnotI (SEQ ID NO: 20) Went. The resulting PCR product was digested with NotI and then subcloned into pBluescript ™ II KS (Stratagene) to construct a NotI fragment (SEQ ID NO: 21) of the Aβ peptide gene containing a Sendai virus transcription signal. Similarly for mouse IL-10 (mIL10), mIL10 cDNA (accession number NM — 010548; SEQ ID NO: 2) and 2 of pmIL10-N (SEQ ID NO: 22) and pmIL10-C (SEQ ID NO: 23) were used as templates. PCR was performed using seed primers. The resulting PCR product was digested with NotI and then subcloned into pBluescript ™ II KS (Stratagene) to construct a NotI fragment (SEQ ID NO: 24) of the mIL10 gene containing a Sendai virus transcription signal.

SEQ ID NO: 1
ATGCTGCCCGGTTTGGCACTGCTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTTGATGCAGAATTCCGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTGTTCTTTGCAGAAGATGTGGGTTCAAACAAAGGTGCAATCATTGGACTCATGGTGGGCGGTGTTGTCATAGCGACTTAA
SEQ ID NO: 19
ATTGCGGCCGCCAAGGTTCACTTATGCTGCCCGGTTTGGCACTGCTCCTG
SEQ ID NO: 20
ATTGCGGCCGCGATGAACTTTCACCCTAAGTTTTTCTTACTACGGTTAAGTCGCTATGACAACACCGCCCACCATGAGTCC
SEQ ID NO: 21
gcggccgccaaggttcacttATGCTGCCCGGTTTGGCACTGCTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTTGATGCAGAATTCCGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTGTTCTTTGCAGAAGATGTGGGTTCAAACAAAGGTGCAATCATTGGACTgtagTAGTGGGCGGTGcttag
SEQ ID NO: 2

SEQ ID NO: 22
ACTTGCGGCCGCCAAAGTTCAATGCCTGGCTCAGCACTGCTATGCTGCCTG
SEQ ID NO: 23
ATCCGCGGCCGCGATGAACTTTCACCCTAAGTTTTTCTTACTACGGTTAGCTTTTCATTTTGATCATCATGTATGCTTC
SEQ ID NO: 24
gcggccgccaaagttcaATGCCTGGCTCAGCACTGCTATGCTGCCTGCTCTTACTGACTGGCATGAGGATCAGCAGGGGCCAGTACAGCCGGGAAGACAATAACTGCACCCACTTCCCAGTCGGCCAGAGCCACATGCTCCTAGAGCTGCGGACTGCCTTCAGCCAGGTGAAGACTTTCTTTCAAACAAAGGACCAGCTGGACAACATACTGCTAACCGACTCCTTAATGCAGGACTTTAAGGGTTACTTGGGTTGCCAAGCCTTATCGGAAATGATCCAGTTTTACCTGGTAGAAGTGATGCCCCAGGCAGAGAAGCATGGCCCAGAAATCAAGGAGCATTTGAATTCCCTGGGTGAGAAGCTGAAGACCCTCAGGATGCGGCTGAGGCGCTGTCATCGATTTCTCCCCTGTGAAAATAAGAGCAAGGCAGTGGAGCAGGTGAAGAGTGATTTTAATAAGCTCCAAGACCAAGGTGTCTACAAGGCCATGAATGAATTTGACATCTTCATCAACTGCATAGAAGCATACATGATGATCAAAATGAAAAGCTAAccgtagtaagaaaaacttagggtgaaagttcatcgcggccgc

(1-2) Insertion of mIL10 NotI fragment into F gene deletion site
F gene deletion type SeV vector (M protein, G69E, T116A, and A183S, HN protein; A262T, G264R, and K461G, P protein; L511F, L protein; N1197S and K1795E) introduced with 9 points WO 2003/025570) cDNA (pSeV18 + NotI / TSΔF) was digested with SalI and NheI and subcloned into Litmus38 (New England Biolabs). Next, a mutation for inserting a NotI cleavage site was introduced into the F gene deletion site of the obtained Litmus TSΔF plasmid containing the M and HN genes. A NotI cleavage site was inserted by PCR using Litmus TSΔF as a template and two primers F_lit3008_NotI (SEQ ID NO: 25) and R_lit3020_NotI (SEQ ID NO: 26) (upper FIG. 1). After digesting this Litmus TSΔF NotI with NotI, the mIL10 gene NotI fragment was inserted (bottom of FIG. 1).
Sequence number 25: AAGCGGCCGCCTCAAACAAGCACAGATCATGGATG
SEQ ID NO: 26: AGGCGGCCGCTTAATTAACCAAGCACTCACAAGG

(1-3) Construction of F gene-deficient SeV cDNA carrying Aβ gene
Inserted Aβ peptide gene NotI fragment into NotI site on pSeV18 + NotI / TSΔF digested with NotI, and constructed F gene-deficient SeV cDNA (pSeV18 + Aβ / TSΔF) retaining Aβ gene (FIG. 2) .

(1-4) Construction of F gene-deficient SeV genomic cDNA carrying both Aβ gene and IL-10
After digesting pSeV18 + Aβ / TSΔF with SalI and NheI, fragments without M and HN genes were recovered. On the other hand, Litmus TSΔF-mIL10 was digested with SalI and NheI to prepare a fragment containing M and HN genes. These two fragments were ligated to construct an F gene-deficient SeV genomic cDNA (pSeV18 + Aβ / TSΔF-mIL10) retaining both the Aβ gene and the IL-10 gene (FIG. 3).

[Example 2] Reconstitution and amplification of Sendai virus vector Reconstitution and amplification of viruses were performed according to the method reported by Li et al. (Li, H.-O. et al., J. Virology 74: 6564-6569, 2000; WO 00/70070) and its improved method (PCT / JP2005 / 00705). Since the viral vector is of the F gene deletion type, helper cells supplied with F protein were used. This helper cell was prepared using a Cre / loxP inducible expression system. This system utilizes the plasmid pCALNdLw (Arai, T. et al., J. Virol. 72: 1115-1121, 1988) designed to induce and express gene products with Cre DNA recombinase. Recombinant adenovirus expressing Cre DNA recombinase (AxCANCre) is transformed into the transformed transformant by the method of Saito et al. (Saito, I. et al., Nucl. Acid Res. 23: 3816-3821, 1995; Arai, T. et al., J. Virol. 72: 1115-1121, 1998).

  By the above method, the F gene-deficient SeV vector retaining the Aβ gene (SeV18 + Aβ / TSΔF) and the F gene-deficient SeV vector retaining both the Aβ gene and the IL-10 gene (SeV18 + Aβ / TSΔF -mIL10) was prepared. The DNA sequence encoding the plus strand of SeV18 + Aβ / TSΔF-mIL10 is shown in SEQ ID NO: 4, and the nucleotide sequence of genomic RNA (minus strand) is shown in SEQ ID NO: 5. As a control, instead of the Aβ gene and the IL-10 gene, a SeV vector (SeV18 + LacZ / TSΔF; also referred to as “SeV LacZ”) retaining the LacZ gene at the F gene deletion site was prepared.

[Example 3] Effect of intranasal administration of SeV-Aβ1-43 / mIL10 in an animal model of Alzheimer's disease
(3-1) Animal and administration method
Using 24 to 25 months old APP transgenic mice (Tg2576) (Hsiao, K., et al., Science 274: 99-102, 1996), SeV18 + Aβ / TSΔF-mIL10 (hereinafter referred to as `` SeV -Aβ1-43 / mIL-10 ”was also examined. The mice were divided into 2 groups of 4 mice, one as the treatment group and the other as the control group. The treatment group received SeV-Aβ1-43 / mIL-10 (5 × 10 ⁶ CIU per mouse) and the control group received SeV LacZ (5 × 10 ⁶ CIU per mouse) intranasally.

(3-2) Measurement of serum anti-Aβ antibody Blood was collected from the mice 4 weeks and 8 weeks after the above treatment, and the amount of anti-Aβ42 antibody in the serum was measured. Aβ1-42 peptide (5 μg / mL) was adsorbed to each well of a 96-well plate (Nunc, MaxiSorp). After blocking with 5% non-fat milk / TBS-T buffer, mouse serum was added (diluted 500 times) and detected with peroxidase-labeled anti-mouse IgG antibody. The antibody titer was evaluated by measuring absorbance (OD450) with an ELISA reader.

  The results are shown in FIG. A significant increase in antibody titer was observed in all individuals in the treatment group compared to the control group.

(3-3) Senile plaque elimination effect of SeV-Aβ1-43 / mIL-10 Mice administered intranasally with the Sendai virus vector were dissected 8 weeks after administration (26 or 27 months of age), and the frontal cortex and parietal Leaf and hippocampal cortex brain tissue sections were prepared. The frozen section of the tissue was processed as follows. To detect Aβ protein or senile plaques, tissue sections were treated with 70% formic acid and endogenous peroxidase was inactivated with 5% H ₂ O ₂ . Next, the tissue section was reacted with a rabbit anti-pan-Aβ antibody (1000-fold diluted), a peroxidase-labeled secondary antibody was added, and DAB staining was performed. The stained sections were observed using a 3CCD camera connected to a microscope, the area of the Aβ accumulation portion in each region was measured, and the area ratio was calculated.

  The staining results of the sections are shown in FIG. 5 (frontal lobe), FIG. 6 (parietal lobe), and FIG. 7 (hippocampus). The Aβ deposition area ratio is shown in FIG. In any of the frontal lobe, parietal lobe, and hippocampus, it was confirmed that administration of SeV-Aβ1-43 / mIL-10 significantly reduced senile plaques to 10-20% of the control.

(3-4) Examination of the safety of SeV-Aβ1-43 / mIL administration From the treatment group and control group at 8 weeks (26 to 27 months old) after administration, the frontal lobe in the same procedure as (3-3) above. And frozen sections of hippocampal tissue were prepared. Using anti-CD3 antibody (T cell) and anti-Iba-1 antibody (microglia), frozen sections were stained by ABC method, and it was confirmed whether lymphocyte infiltration in the central nervous system and changes in microglia occurred. As shown in FIG. 9, infiltration of T lymphocytes (cells positive for pan T cell marker CD3) was not observed in both the frontal lobe and hippocampus in either the treatment group or the control group. Therefore, it was shown that the use of this vector for therapy has a very low possibility of causing inflammation of the central nervous system. Furthermore, the amount of IBA-1 positive cells, which are microglial markers, was comparable between the control group and the treatment group, and it was confirmed that no extreme activation (accumulation) occurred in the treatment group.

(3-5) Measurement of Aβ in brain tissue The mouse cerebrum and cerebellum were cut along the midline and the hemisphere was snap frozen and stored at -80 ° C. The hemisphere was homogenized in 1 ml of TBS solution and centrifuged at 100,000 g for 1 hour in a tabletop ultracentrifuge. The soluble fraction (TBS fraction) was saved. The insoluble fraction was dissolved in 2% SDS and homogenized, followed by further centrifugation at 100,000 g for 1 hour. The resulting soluble fraction (2% SDS fraction) was stored. The insoluble fraction was dissolved in 70% formic acid, homogenized, and centrifuged again at 100,000 g for 1 hour. The obtained soluble fraction (formic acid fraction) was stored. Aβ40 and 42 in brain tissue were measured using Biosource ELISA kit. The TBS fraction was diluted 4-fold; the 2% SDS fraction was diluted 400-2000-fold; the formic acid fraction was diluted 1000-fold with 1M Tris solution. The diluted fraction was then further diluted (2-10 times) with ELISA diluent for measurement.

  As shown in FIG. 10, in all of the SDS fraction, the formic acid fraction, and the TBS fraction, it was confirmed that the Aβ level in the brain tissue was significantly decreased by administration of SeV-Aβ1-43 / mIL-10.

[Example 4] Effects of intramuscular administration of SeV-Aβ1-43 / mIL-10 in an animal model of Alzheimer's disease
(4-1) Animals and administration method Except for the administration route, the same procedure as in the case of intranasal administration was performed. SeV-Aβ1-43 / mIL-10 vector was administered to the hind leg thigh muscle at a dose of 5 × 10 ⁶ CIU.

(4-2) Measurement of serum anti-Aβ antibody The amount of anti-Aβ antibody in the serum of mice administered intramuscularly with SeV-Aβ1-43 / mIL-10 vector was determined in the same manner as in the case of intranasal administration. It was measured. The results are shown in FIG.

(4-3) SeV-Aβ1-43 / mIL senile plaque elimination effect By the same method as in the case of intranasal administration, frontal lobe, parietal lobe after intramuscular administration of SeV-Aβ1-43 / mIL-10 vector, We investigated the effects of disappearing senile plaques in the hippocampus. The results are shown in FIG. 12 (frontal lobe), FIG. 13 (parietal lobe), and FIG. 14 (hippocampus). The Aβ deposition area ratio is shown in FIG. Each region showed a constant decrease in Aβ deposition.

(4-4) Examination of the safety of SeV-Aβ1-43 / mIL-10 administration The central nervous system after intramuscular administration of SeV-Aβ1-43 / mIL-10 vector by the same method as that for intranasal administration. The presence of lymphocyte infiltration in the system was confirmed. As shown in FIG. 16, infiltration of T lymphocytes in the frontal lobe was not observed in either the control group or the treatment group.

(4-5) Measurement of Aβ in brain tissue Aβ40 and Aβ42 in brain tissue after intramuscular administration of SeV-Aβ1-43 / mIL-10 vector were measured by the same method as in the case of intranasal administration. The results are shown in FIG. A decrease in Aβ levels was confirmed in several soluble fractions.

[Example 5] Increase in antibody titer by intranasal administration of SeV-Aβ1-43 / hIL-10 in normal mice
(5-1) Animal and administration method The effect of SeV18 + Aβ1-43 / TSΔF-hIL10 (hereinafter also referred to as “SeV-Aβ1-43 / hIL-10”) of the present invention was determined using 6-week-old C57BL / 6N mice. And tested. The mice were divided into 3 groups of 6 mice each. SeV-Aβ1-43 / hIL-10 (Group 1: 5 × 10 ⁵ CIU / animal, Group 2: 5 × 10 ⁶ CIU / animal, Group 3: 5 × 10 ⁷ CIU / animal) to each mouse intranasally Administered.

(5-2) Measurement of anti-Aβ antibody in plasma Before administration and 2, 4, and 8 weeks after administration, blood was collected from mice and the amount of anti-Aβ42 antibody present in plasma was measured. Aβ1-42 peptide (4 μg / mL) was adsorbed to each well of a 96-well plate (Nunc, MaxiSorp). After blocking with 1% BSA / 2% goat serum / TBS-T buffer, mouse plasma (diluted 300 times) was added and detected with a peroxidase-labeled anti-mouse IgG antibody. The antibody titer was evaluated by measuring absorbance (OD450) with an ELISA reader.

The results are shown in FIG. Anti-Aβ antibody levels increased over time in all three groups. Vector administration increased the amount of antibody in a dose-dependent manner, but there was a significant amount of antibody between group 2 (5 × 10 ⁶ CIU / mouse) and group 3 (5 × 10 ⁷ CIU / mouse). No difference was observed. The results show that the induction of anti-Aβ antibody by administration of the reagent of the present invention (SeV-Aβ1-43 / hIL-10) is not specific to Alzheimer's disease model mice (APP Tg mice), but is achieved sufficiently even in normal mice Indicates that

[Example 6] Effect of cytokine encoding therapeutic vector for Alzheimer's disease in intranasal administration to normal mice
(6-1) Animals and administration methods Genes encoding several cytokines were inserted into the above therapeutic vectors for Alzheimer's disease. The effects of these Sendai virus vectors were tested using 6-week-old C57BL / 6N mice. The mice were divided into 3 groups of 6 mice each. (Holds the gene encoding Aβ peptide, as well as the gene encoding mouse IL-4, IL-5, or IL-6; SeV-Aβ1-42 / mIL-4, SeV-Aβ1-42 /, respectively) Sendai virus vector (referred to as mIL-5 or SeV-Aβ1-42 / mIL-6) was administered intranasally to each mouse (5 × 10 ⁶ CIU / 10 μl).

(6-2) Measurement of anti-Aβ antibody in plasma Before administration and 1 and 2 weeks after administration, blood was collected from mice, and the amount of anti-Aβ antibody present in plasma was measured. Aβ1-42 peptide (4 μg / mL) was adsorbed to each well of a 96-well plate (Nunc, MaxiSorp). After blocking with 1% BSA / 2% goat serum / TBS-T buffer, mouse plasma (diluted 300 times) was added and detected with a peroxidase-labeled anti-mouse IgG antibody. The antibody titer was evaluated by measuring absorbance (OD450) with an ELISA reader.

  The results are shown in FIG. Anti-Aβ antibody levels increased over time in all three groups. The results show that IL-4, IL-5, and IL-6 are effective in inducing anti-Aβ antibodies, select nucleic acids encoding Aβ antigen, and IL-4, IL-5, and IL-6 A formulation comprising a Sendai virus vector that retains both of the one or more of the cytokines shown is preferred for inducing anti-Aβ antibodies in the treatment of Alzheimer's disease.

Industrial Applicability According to the present invention, a novel minus-strand RNA viral vector capable of effectively reducing the amyloid β deposition level has been provided. The vector of the present invention is useful for the treatment of Alzheimer's disease.

FIG. 3 is a diagram showing the construction process of Litmus SalI / NheIfrg-MtsHNtsPLmut-dF mIL10 (hereinafter abbreviated as Litmus TS-dF mIL10). A mutation was introduced into the F gene deletion site of Litmus TS-dF to create a NotI site, and the mIL-10 gene excised using NotI was inserted therein. FIG. 2 is a diagram showing the process of constructing pSeV18 + Aβ / MtsHNtsP511Lmut-dF (hereinafter abbreviated as pSeV18 + Aβ / TS-dF). The Aβ gene inserted into the NotI site of pBluescript ™ was excised and inserted into the NotI site of pSeV18 + NotI / TS-dF. FIG. 3 is a diagram showing the process of constructing pSeV18 + Aβ / MtsHNtsP511Lmut-dF mIL10 (hereinafter abbreviated as pSeV18 + Aβ / TS-dF mIL10). Necessary fragments were excised and exchanged from pSeV18 + Aβ / TS-dF and Litmus TS-dF mIL10 using SalI and NheI. It is a figure which shows the anti- A (beta) antibody level in the serum of the APP transgenic mouse 4 and 8 weeks after intranasal administration of SeV-A (beta) 1-43 / mIL-10 or a control vector. It is a figure which shows the senile plaque in the frontal lobe of the APP transgenic mouse 8 weeks after intranasal administration of SeV-Aβ1-43 / mIL-10 or a control vector. It is a figure which shows the senile plaque in the parietal lobe of the APP transgenic mouse 8 weeks after intranasal administration of SeV-Aβ1-43 / mIL-10 or a control vector. It is a figure which shows the senile plaque in the hippocampus of the APP transgenic mouse 8 weeks after intranasal administration of SeV-Aβ1-43 / mIL-10 or a control vector. It is a figure which shows the result of having quantified senile plaques (frontal lobe, parietal lobe, and hippocampus) in APP transgenic mice 8 weeks after intranasal administration of SeV-Aβ1-43 / mIL-10 or control vector. The result of examining lymphocyte infiltration in the central nervous system of APP transgenic mice 8 weeks after intranasal administration of SeV-Aβ1-43 / mIL-10 or control vector is shown. T cell infiltration in the frontal lobe was detected using CD3 as an index. Changes in microglia in the hippocampus were detected using Iba-1 as an index. It is a set of figures showing the amount of Aβ in the brain tissue of APP transgenic mice 8 weeks after intranasal administration of SeV-Aβ1-43 / mIL-10 or control vector. It is a figure which shows the A (beta) antibody level in the serum of the APP transgenic mouse 4 and 8 weeks after intramuscular administration of SeV-A (beta) 1-43 / mIL-10 or a control vector. It is a photograph showing senile plaques in the frontal lobe of APP transgenic mice 8 weeks after intramuscular administration of SeV-Aβ1-43 / mIL-10 or a control vector. It is a photograph showing senile plaques in the parietal lobe of APP transgenic mice 8 weeks after intramuscular administration of SeV-Aβ1-43 / mIL-10 or control vector. It is a photograph showing senile plaques in the hippocampus of APP transgenic mice 8 weeks after intramuscular administration of SeV-Aβ1-43 / mIL-10 or a control vector. It is a figure which shows the result of having quantified senile plaques (frontal lobe, parietal lobe, and hippocampus) in APP transgenic mice 8 weeks after intramuscular administration of SeV-Aβ1-43 / mIL-10 or control vector. It is a photograph showing the results of examining lymphocyte infiltration in the frontal lobe 8 weeks after intramuscular administration of SeV-Aβ1-43 / mIL-10 or a control vector. It is a set of figures showing the amount of Aβ in brain tissue 8 weeks after intramuscular administration of SeV-Aβ1-43 / mIL-10 or a control vector. It is a figure which shows the serum anti- Aβ antibody level of normal mice after intranasal administration of SeV-Aβ1-43 / mIL-10. It is a figure which shows the serum anti- A (beta) antibody level of the normal mouse | mouth after intranasal administration of the Sendai virus therapeutic vector which codes cytokine.

Claims (17)

A Sendai virus vector comprising a nucleic acid encoding natural amyloid β and a nucleic acid encoding IL-10 . The vector according to claim 1, wherein the amyloid β is selected from the group consisting of Aβ39, Aβ40, Aβ41, Aβ42, and Aβ43 . The amyloid β is A? 4 3, vector of claim 2 wherein.   2. The vector according to claim 1, wherein amyloid β is derived from human. The vector according to any one of claims 1 to 4 , wherein IL-10 is derived from mouse or human. Amyloid β is, SEQ ID NO: 1 nucleotide sequence is a polypeptide de coding, vector of any one of claims 1-5. The vector according to any one of claims 1 to 6, wherein IL-10 is a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 2 or 3. SEQ ID NO: 5 of a nucleic acid, any one base restrictor according to claim 1-7. A composition comprising the vector according to any one of claims 1 to 8 and a pharmaceutically acceptable carrier. (i) a nucleic acid encoding at Th2 cytokine expression can manner, nucleic acids encoded by vectors other than Sendai virus vector comprising a nucleic acid encoding the nucleic acid and IL-10 coding for the amyloid beta, (ii ) Th2 site further comprises chi down, or (iii) Th2 adjuvant composition of claim 9. Th2 cytokines comma others including Th2 adjuvant composition of claim 10, wherein. The Th2 cytokine, a nucleic acid encoding an expressible manner, comprising a nucleic acid encoded by a vector other than Sendai virus vector comprising a nucleic acid encoding the nucleic acid and IL-10 coding for the amyloid beta, claim 10. The composition according to 10 . The composition according to any one of claims 9 to 12 , which is a pharmaceutical composition. 14. The pharmaceutical composition according to claim 13, which is used for treating or preventing Alzheimer's disease. 14. A pharmaceutical composition according to claim 13, which is used to reduce amyloid β deposition . 16. A pharmaceutical composition according to any one of claims 13 to 15 for use in intranasal administration. 16. A pharmaceutical composition according to any one of claims 13 to 15 for use in intramuscular administration.

Images