JP4889263B2 - Specimen processing method, mastitis test method and bacterial disease test kit - Google Patents

Description

  The present invention relates to a sample processing method, a mastitis inspection method, and a bacterial disease test kit, and more particularly, a sample processing method for processing a sample in which bacteria and cells are mixed, a mastitis inspection method using the same, And a bacterial disease test kit.

In order to control bacterial diseases such as bacterial mastitis, it is important to find early infected individuals or infected quarters and provide appropriate treatment, and to prevent the spread of infection such as movement, squeezing or disuse. Become. For Staphylococcus aureus, which is considered to be particularly infectious, it is extremely important to identify infected cattle at an early stage of infection before spreading to the herd.
Currently, bacterial culture test and immuno-antibody method are widely used as detection methods for Staphylococcus aureus in milk, but the operation is complicated and the time required is long, so it is frequent and numerous. It is impractical to use as a regular infection monitoring, perhaps in the unit of a bunch.
In order to solve such problems, a method for quantitative detection of S. aureus genes using bacterial gene growth, that is, PCR (polymerase chain reaction) has been developed (Non-Patent Documents 1 to 3). In this method, milk of only about 1 ml can be used as a specimen and Staphylococcus aureus can be detected at the gene level, so that mastitis can be detected stably and in large quantities with high accuracy.

Thus, in the inspection of bacterial diseases, it is important to detect the presence or absence of bacteria in the specimen. Samples often contain contaminants such as cells derived from the test subject in addition to the causative bacteria, and the causative bacteria must be collected efficiently in order to identify and quantitatively detect the causative bacteria. is required.
For example, in Patent Document 1, in order to separate bacteria in blood from blood cells, blood cells are removed using an alkali metal hydroxide or the like. In Patent Document 2, centrifugation is performed using a filter capable of capturing microorganisms, and microorganisms can be collected easily and in a short time.
International Publication No. 2003/035899 Pamphlet JP 2004-180551 A Proceedings of the Japan Mastitis Study Group, 2003, Vol. 8, p.34-37 Livestock Technology, 2004, 593, p.2-5 Veterinary and Livestock Newspaper JVM, 2005, Vol. 58, No. 7, p. 587-590

However, the milk of severe mastitis is contaminated with a large amount of cells such as neutrophils, lymphocytes, and shed cells from the mammary gland simultaneously with the contamination of bacteria. In addition to mastitis, in severe disease, if a large amount of non-tested cells are mixed in the sample, the filter cannot perform its function sufficiently and cannot be separated sufficiently. . In addition, the solution treatment complicates the operation, and the cells cannot be removed efficiently.
Therefore, the present invention is a mixture of pathogenic bacteria of bacterial diseases (hereinafter sometimes simply referred to as “bacteria”) and somatic cells derived from specimens (hereinafter sometimes simply referred to as “cells”) . An object of the present invention is to enable examination of bacterial diseases, such as mastitis, on a specimen in a short time with high accuracy.

  The sample processing method of the present invention is a sample processing method for processing a sample in which bacteria and cells are mixed. The sample processing method mixes a sample and an adsorbing solution to prepare a sample solution, and based on the surface charge. The method includes contacting a cell-adsorbing carrier having affinity for cells rather than bacteria with the sample solution, and collecting the sample solution after contact with the cell-adsorbing carrier.

  The method for examining mastitis according to the present invention comprises preparing a sample liquid by mixing a specimen derived from milk and an adsorbent, a cell adsorbent carrier having affinity for cells rather than bacteria based on surface charge, and the sample Contacting the solution, collecting the sample solution after contact with the cell adsorption carrier, and performing PCR using a S. aureus detection probe on the collected sample solution. .

The bacterial disease test kit of the present invention comprises a cell adsorption carrier having affinity for cells rather than bacteria based on surface charge.
Here, it is preferable to further include at least one of an adsorption solution for preparing a sample solution by mixing with a specimen and a desorption solution for separating bacteria adsorbed on the cell adsorption carrier.

In the sample processing method, mastitis test method and test kit, the cell adsorption carrier is at least one selected from the group consisting of silica, aminosilica, cellulose, sepharose, zeolite, ion exchange resin, vinyl polymer, and chitosan. It is preferable that it is comprised by one. In the present invention, at least one cell adsorption carrier selected from the group consisting of silica, cellulose, sepharose, zeolite, ion exchange resin, vinyl polymer, and chitosan, the cell adsorption carrier having an amino group on the surface is provided. Used .
Moreover, it is preferable to contact the cell adsorption carrier after collecting the sample solution with a desorption solution for separating the adsorbed bacteria.

In the present invention, a specimen in which bacteria and cells are mixed is mixed with an adsorption solution to prepare a sample solution, and then contacted with a cell adsorption carrier having affinity for cells rather than bacteria based on the surface charge. The cells in the sample are adsorbed on the cell adsorption carrier, and only the bacteria are released in the sample solution. As a result, only bacteria are present in the sample solution collected after contact with the cell adsorption carrier. Thereby, the cells and bacteria in the specimen can be easily separated.
At this time, if the desorption solution is further used, the bacteria adsorbed on the cell adsorption carrier can be separated from the cell adsorption carrier, so that almost all the bacteria in the specimen can be recovered. Thereby, bacteria can be separated with higher accuracy.

  ADVANTAGE OF THE INVENTION According to this invention, the test | inspection of a bacterial disease, for example, a mastitis, can be implemented accurately and in a short time with respect to the sample in which bacteria and cells are mixed.

The sample processing method of the present invention is a sample processing method for processing a sample in which bacteria and cells are mixed, and the sample and adsorbed liquid are mixed to prepare a sample solution (preparation step), surface Contacting a cell-adsorbing carrier having affinity for cells rather than bacteria with the sample solution based on the charge (adsorption step), recovering the sample solution after contact with the cell-adsorbing carrier (collecting step), Is included.
In the present invention, cells and bacteria are separated based on the difference in surface charge by bringing the sample solution into contact with the cell adsorption carrier. That is, there is a difference in the surface charge between bacteria and cells mixed in the specimen, and the cells are more negatively charged. For this reason, the cells and bacteria in the specimen can be separated by using a cell adsorption carrier having affinity for cells rather than bacteria based on the surface charge, for example, a positively charged cell adsorption carrier.

  The cell-adsorbing carrier in the present invention is not particularly limited as long as it has an affinity for cells rather than bacteria based on the surface charge, and can be selected based on the zeta potential, for example. That is, under conditions where the cells and bacteria are stable at around pH 7, the somatic cell's zeta potential is more strongly negatively charged than the bacteria's zeta potential, so a positively charged substance should be selected as the cell adsorption carrier. That's fine. The cell adsorption carrier may be in a dispersible state, for example, in the form of powder or beads, or may be solidified, for example, packed in a column or the like. Since it is easy to adsorb, it is preferably in a dispersed state.

Such cells adsorption carrier, silica, amino silica, cellulose, Joseph § B over scan, zeolites, ion exchange resins, such as polystyrene, Toyopearl (TM) vinyl polymers such as chitosan, such Chitopearl (registered trademark) Can be mentioned. Among these, those having an amino group on the surface or those subjected to surface amino treatment are preferable because of high adsorption to cells. Examples of such surface amino groups include aminoalkyl groups having 1 to 8 carbon atoms, preferably 1 to 4 carbon atoms. In particular, amino silica that is physicochemically stable and easy to handle in a sample solution is preferable.
The particle diameter of such aminosilica can be 10 to 1000 μm, preferably 100 to 200 μm. If it is 10 μm or more, natural sedimentation is possible, and excessive centrifugal operation can be made unnecessary. Moreover, if it is 1000 micrometers or less, a volume is not bulky and the surface area per reaction weight is larger and preferable.

In the preparation step, the sample liquid is mixed with the specimen and the sample liquid is prepared.
The adsorbing solution in the present invention may be any ordinary buffer used for cells and bacteria, and examples thereof include Good's buffer, phosphate buffer, and physiological saline. Among these, A good buffer with a salt concentration relatively close to physiological conditions and moderate to cells is preferred. Examples of such good buffers include MOPS, TES, HEPES, collamine chloride, BES and the like.
Mixing of the adsorbed liquid and the sample is not particularly limited, and conditions that can be adjusted to a final pH (for example, pH 4 to 9) and viscosity so that cells and bacteria can be kept free upon contact with the cell adsorption carrier. Any condition can be applied.

In the adsorption step, the cell adsorption carrier and the sample liquid as described above are brought into contact with each other, and the cells in the sample liquid are adsorbed on the cell adsorption carrier. The contact between the sample solution and the cell adsorption carrier may be any conditions as long as the bacteria and cells in the sample solution can uniformly contact the cell adsorption carrier, and the sample solution is allowed to pass through like a column packed with a cell adsorption carrier. Although it may be in a form, slow stirring and mixing are preferable because they can be adsorbed uniformly to the carrier. From the viewpoint of simple operation, it is preferable to use the cell-adsorbing carrier in a dispersed state and make contact by stirring and mixing.
When contacting by mixing, it is sufficient that the cell-adsorbing carrier and the sample solution can be sufficiently mixed and contacted. The mixing may be performed for a time during which cells can be adsorbed, for example, 10 to 60 minutes, preferably about 30 to 60 minutes.
In the case of contact by passage, the sample solution may be flowed at a speed at which the cells and the cell adsorption carrier can react, and the flow rate may be adjusted to be constant.

In the recovery step, the sample liquid after contact is recovered. Since the sample liquid after contact with the cell adsorption carrier contains bacteria that have not been adsorbed on the cell adsorption carrier, the bacteria and cells can be easily separated by collecting them.
When the cell adsorption carrier is brought into contact with the cells in a dispersed state, a sample solution containing bacteria may be separated from the cell adsorption carrier. As a means for separation, for example, moderate centrifugation may be performed, but when a cell-adsorbing carrier such as silica is used as a cell-adsorbing carrier, the sample solution can be separated only by standing or these can be used. Can be combined.

In some cases, some bacteria are weakly adsorbed on the cell-adsorbing carrier after the sample solution is collected in the collecting step. For this reason, in order to further collect the bacteria adsorbed on the cell adsorption carrier, it is preferable to contact the cell adsorption carrier with a desorption solution for separating the bacteria adsorbed on the cell adsorption carrier (desorption step).
The desorption solution used here may be any compound that is mild to cells from the viewpoint of pH and ionic strength and that relatively reduces the adsorption between the cell adsorption carrier and the bacteria. Examples thereof include compounds having a higher affinity for carriers than bacteria and compounds that weaken the binding between cell-adsorbing carriers and bacteria. Examples of such a desorption solution include sodium chloride solution, surfactant, chelating agent, citric acid solution, etc. Among them, citric acid having higher affinity for cell adsorption carrier than bacteria and cell adsorption carrier It is preferable to contain a surfactant capable of weakening the hydrophobic bond between bacteria and bacteria, or both.

The desorption solution may be used in an amount that can be uniformly mixed with the cell adsorption carrier after the sample solution is collected. For example, the desorption solution may be 1 to 2 ml, preferably 1 ml per 25 mg of the cell adsorption carrier. The desorption time is a time during which cells can be desorbed, for example, 5 minutes to 30 minutes, preferably 10 to 20 minutes. The subsequent recovery of the desorption liquid may be performed under the same conditions as in the recovery process.
The collected desorption liquid contains bacteria adsorbed on the cell-adsorbing carrier. By mixing with the sample liquid collected earlier, only the bacteria mixed with cells in the sample are high. Separation can be achieved with a recovery rate.

Since the specimen processing method of the present invention can efficiently separate bacteria from a specimen in which bacteria and cells are mixed, it is preferable for specimens in which cells that are not to be detected are mixed, such as bacterial diseases. Can be used.
The specimen in the present invention is isolated from a living body in order to test for a specific bacterial disease, and is effective in testing for a disease and is easy to mix causative bacteria and somatic cells. For example, specimens derived from biological samples such as milk, urine, blood, lymph, saliva, feces, cerebrospinal fluid, and ascites can be mentioned. These are not limited to liquids, but may be gels, solids, or powders. In the case of a gel, solid, or powder, it may be prepared in an appropriate form using the above-described adsorbent.

In addition, when many contaminants other than cells and bacteria exist in the form isolated from the living body (for example, milk components in the case of milk), it is preferable to remove these contaminants in advance. . Examples of such pretreatment include several times of centrifugation, and about 1 to 3 times of centrifugation can be preferably applied.
Here, the specimen derived from various biological samples may be a biological sample itself separated from the living body, and also includes a sample that has been subjected to a specific process to such an extent that the process of the present invention can be performed.

In addition, the bacterial disease to which the present invention can be applied may be any disease that can cause causative bacteria to be mixed in a specimen isolated from a living body, such as mastitis, cystitis, bronchitis, pneumonia, peritonitis, salmonella enteritis, etc. Can be mentioned. The specimen may be derived from a living body contaminated with causative bacteria, and examples include birds and mammals, and in particular, cows, horses, sheep, pigs, and humans.
Bacteria that can be efficiently separated according to the present invention include E. coli, micrococcus, staphylococci, streptococci, and the like, depending on the type of mixed cells, and in particular, staphylococci that are causative agents for mastitis. Can be efficiently separated from cells with high efficiency.

Therefore, the present invention also includes a method for examining mastitis.
This mastitis test method comprises mixing a specimen derived from milk and an adsorbent to prepare a sample liquid (preparation step), a cell adsorbent carrier having affinity for cells rather than bacteria based on surface charge, and Contacting the sample solution (adsorption step), recovering the sample solution after contact with the cell adsorption carrier (recovery step), and using a S. aureus detection probe for the recovered sample solution Performing PCR (PCR step).
According to this mastitis inspection method, bacteria in milk can be efficiently separated from contaminating cells, so that subsequent PCR using a S. aureus detection probe can be performed accurately and quantitatively. It is possible to accurately check for mastitis.

In the present inspection method, the above-described contents can be applied as they are, and the preparation process, the adsorption process, and the recovery process can be performed in the same manner as described above. Further, after the recovery step, the above-described desorption step can be preferably performed.
In the PCR step, PCR is performed on the bacteria in each solution obtained in the recovery step and optionally the desorption step. The conditions for carrying out PCR can be applied as they are for normal bacteria.

  As a detection probe used for PCR, it is preferable to select a probe capable of accurately recognizing a characteristic gene region in order to accurately detect Staphylococcus aureus that causes mastitis. . Examples of such a gene region include a 23S-rRNA gene, and a 23S-rRNA gene is particularly preferable.

The present invention also includes a kit for easily performing a method for examining various bacterial diseases.
Such a test kit includes a cell adsorption carrier having affinity for cells rather than bacteria based on surface charge. By using this kit, mastitis can be examined easily and accurately.
This kit contains at least one of an adsorption solution for preparing a sample solution by mixing with a specimen and a desorption solution for separating bacteria adsorbed on a cell adsorption carrier in order to make it easier to use. Furthermore, it is preferable to include it.

In addition, in order to efficiently detect a bacterial disease, this kit may also include a PCR test probe that can efficiently detect the bacterial disease. In addition to the above-described probe for mastitis, such a probe for inspection can be applied as it is for known bacterial diseases.
Each solution contained in the kit may be contained in a suitable container, or may be contained as a stock solution so that the concentration can be adjusted.
The cell adsorption carrier may be contained in the form of a powder, or may be contained in the form of a container already filled with the cell adsorption carrier, such as a tube or a column.

  Examples of the present invention will be described below, but the present invention is not limited thereto. Further,% in the examples is based on weight (mass) unless otherwise specified. In the following examples, unless otherwise specified, an inverter micro cooling centrifuge (KUBOTA1720) manufactured by Kubota Corporation was used. Each centrifugation condition is indicated by the number of rotations of the centrifuge.

[Example 1]
Adsorption of Staphylococcus aureus and somatic cells (1) Preparation of cells S. aureus (ATCC 19095, zeta potential: -1.09 ± 3.45) was cultured in dry broth (Nissui) so-called Nutrient Broth for 16 hours. used. Somatic cells (zeta potential: −9.29 ± 6.72) were obtained by purifying blood-derived cells and fractionating cells based on cell surface antigens. That is, heparinized bovine blood (manufactured by Tokyo Shibaura Organs Co., Ltd.) is obtained, the blood is centrifuged (2,500 rpm, 30 minutes), and the white buffy coat (including monocytes, leukocytes, neutrophils) in the intermediate layer ) Was collected with a Komagome pipette. To the collected buffy coat layer, an equal amount of ACK dissolution buffer (8.29 g / l NH ₄ Cl, 1.00 g / l KHCO ₃ , 0.037 g / l EDTA, pH 7.3) was added and The erythrocytes were lysed by standing for 3 minutes. Thereafter, a large amount of PBS ⁻ was added to suspend, and centrifuged (1,400 rpm, 5 to 7 minutes). The PBS ^- was repeated twice washing by. It was suspended in 10 mM MOPS and 150 mM NaCl (pH 7.0) and adjusted to a concentration according to the experiment.

The cells (granulocytes / monocytes) derived from the buffy coat layer were analyzed using flow cytometry.
GM cells suspended in PBS at 6 × 10 ⁶ cells / ml were centrifuged (1,500 rpm, 5 minutes), the supernatant was removed, and then the primary antibody (mouse anti-GM1 (SWC3) IgG (No. M35001, VMRD (manufactured by VMRD) was added 10 μl at a time and incubated for 30 minutes. Add 2 ml of FACS buffer, centrifuge (1,500 rpm, 5 minutes) and add 10 μl of various secondary antibodies (FITC-conjugated goat F (ab ′) ₂ anti-mouse IgG (H + L) antibody (No, M35001, CALTAG)) Incubated for 30 minutes, 2 ml of FACS buffer was added, washed and centrifuged, and the obtained cells were analyzed by flow cytometry (FACS Calibur).
As a result, it was confirmed that most were white blood cells. The cells thus obtained were used as somatic cells for the following treatment.
The zeta potential was measured using NICOMP380ZLS (manufactured by Particle Sizing System Co.) under conditions of 150 mM NaCl, 10 mM MOPS (pH 7.0) and room temperature.

(2) Adsorption onto cell-adsorbing carrier In order to separate them based on the difference in surface electricity between S. aureus and somatic cells, the amount of aminosilica and pure silica adsorbed on S. aureus and somatic cells was confirmed.
Staphylococcus aureus and somatic cells were mixed with the adsorbent so as to obtain the indicated number of cells to prepare a sample solution. The adsorbent was an aqueous solution containing 150 mM NaCl and 10 mM MOPS, and the pH was 7.

As the carrier, aminosilica (NH-DM1020, manufactured by Fuji Silysia Co., Ltd.) and pure silica (MB-5D, manufactured by Fuji Silysia Co., Ltd.) were used, and 25 mg each was filled in a 1.5 ml tube.
1 ml of the sample solution was added to each tube and mixed, and the reaction was allowed to stir at room temperature for 1 hour. After 1 hour, the supernatant was collected with a pipette. The number of bacteria in the supernatant was counted with a bacteria calculation board. The results are shown in FIG. In FIG. 1, the horizontal axis represents the number of added cells, and the vertical axis represents the number of cells in the supernatant or carrier after the reaction.

  As shown in FIG. 1, Staphylococcus aureus becomes difficult to adsorb as the number of cells increases, but shows the same tendency in both amino silica and pure silica (see FIG. 1 (A)). Thus, it was shown that somatic cells adsorb very strongly to aminosilica, hardly adsorb to pure silica, and do not adsorb to pure silica as the number of cells increases (see FIG. 1B). . Therefore, it is clear that somatic cells can be more efficiently separated from S. aureus by adsorbing somatic cells on aminosilica, especially as the number of cells increases.

[Example 2]
Desorption test Next, the recovery of bacteria using various desorption solutions was examined.
After the bacterial cell mixture was adsorbed on a cell-adsorbing carrier (amino silica of Example 1), S. aureus was recovered (FIG. 2). In the cell mixture, each concentration of S. aureus (IAM12544) 4.3 × 10 ⁸ cells / ml (OD ₆₀₀ = 0.5) and 7 × 10 ⁵ cells / ml obtained in Example 1 was used. It adjusted using adsorption liquid so that it might become. Adsorption was carried out in the same manner as in Example 1. After recovering the supernatant, each desorption solution having the composition shown in Table 1 below was added and mixed. After reacting for 15 minutes, the number of bacteria and the number of cells contained in the supernatant were measured by absorbance at 600 nm. The results are shown in Table 1. PEG having an average molecular weight of 6000 was used.

  As shown in Table 1, in a solution in which a NaCl solution, an EDTA solution, a citric acid solution (pH 6) and a surfactant (Pluronic (registered trademark) F-68) were mixed, Staphylococcus aureus (IAM12544 strain) It was clear that can be effectively recovered. In particular, these solutions did not have a desorption effect on somatic cells, and were shown to be effective in recovering S. aureus adsorbed on a cell-adsorbing carrier.

[Example 3]
Adsorption and Desorption Tests on Various Bacteria Next, the adsorption and desorption effects of aminosilica on the cell adsorption carrier were tested on various bacteria. The bacteria used are as described in the table.
Adsorption and desorption were performed in the same manner as in Examples 1 and 2. The results are shown in Tables 2 and 3. In the table, Adsorption, Supernatant, Desorption, and Recovery were calculated as follows.
Adsorption (%) = (number in cell suspension−number in supernatant) / number in cell suspension × 100
Supernatant (%) = number in supernatant / number in cell suspension × 100
Desorption (%) = number in desorption supernatant / adsorption amount × 100
In parentheses = number in desorption supernatant / number in cell suspension × 100
Recovery (%) = Supernatant (%) + Desorption (%)

As shown in Tables 2 and 3, very high recoveries (over 80%) were obtained for all S. aureus, and other fungi, especially E. coli, M. luteus, S. agalactiae It was found to be relatively effective. In addition, for S. aureus, using a cell suspension with a ratio different from that of somatic cells, the recovery rate is almost 100%. At this time, the recovery rate of somatic cells is only about 1 to 2%. It was shown that bacteria and somatic cells can be completely separated (data not shown).
Thus, it is clear that by adsorbing somatic cells using aminosilica, it is possible to separate only bacteria from the mixed solution of cells and bacteria in a short time with high accuracy.

[Example 4]
Detection of Staphylococcus aureus by PCR using milk FIG. 3 is a process diagram showing the DNA extraction process for mastitis examination. Separation of bacteria and cells in milk was performed as follows.
Each milk from two cattle with severe mastitis and one cattle with mild mastitis was centrifuged at 5000 rpm for 15 minutes to remove milk components (supernatant). To the resulting precipitate, 1 ml of lysis buffer (0.05% N-lauryl sarcosine, 5 mM Tris-HCl (pH 7.6), 2.5 mM EDTA) was added and washed by vortexing. Furthermore, centrifugation (5000 rpm, 15 minutes) was performed, and the supernatant was used as control A and separated from the precipitate.

To this precipitate, 1 ml of the adsorbing solution used in Example 1 and aminosilica (0 mg, 12.5 mg, 25 mg, 50 mg) were added, and the mixture was slowly stirred and subjected to an adsorption reaction for 1 hour. The supernatant after adsorption was transferred to another tube and centrifuged (5000 rpm, 15 minutes) to obtain the supernatant as an unadsorbed bacterial fraction (B). To the silica after adsorption, 1 ml of a desorption solution (0.1 M citric acid, 0.1 M NaCl, 0.05% Pluronic F68 (pH 6)) was added and stirred slowly (15 minutes). After the reaction, the supernatant (bacteria desorbed after adsorption) was used as supernatant C and mixed with the supernatant B.
The mixture of supernatant B and supernatant C was centrifuged (5000 rpm, 15 minutes), the supernatant was removed, and a precipitate was obtained (bacterial fraction). The cells in the milk were separated together with aminosilica.

  To the obtained sample, 200 μl of lysostaphin solution (2 μl lysostaphin (manufactured by Wako Pure Chemical Industries, Ltd.), 198 μl dissolution buffer) was added and mixed well, followed by reaction at 55 ° C. for 60 minutes. Then, phenol (200 μl) was added, mixed well, and centrifuged (15000 rpm, 5 minutes). A phenol / chloroform (1: 1) solution (200 μl) was added to the supernatant, mixed well, and centrifuged (15000 rpm, 5 minutes). The supernatant was taken in tubes 3 and ethanol (1 ml) was added to each to precipitate DNA. The resulting precipitate was dried and dissolved in TE buffer (50 μl).

For each of the obtained DNA samples, PCR was performed on the 23S-rRNA region of Staphylococcus aureus using the primer set 5'acggagtttacaagagacgac3 '(SEQ ID NO: 1) and 5'agctcagccttatagaggacac3' (SEQ ID NO: 2). . PCR conditions were Taq DNA polymerase (Promega, catalog M1861). After reacting at 94 ° C. for 5 minutes, 35 cycles of 94 ° C. for 45 seconds, 57 ° C. for 45 seconds and 72 ° C. for 45 seconds were performed. And reacted at 72 ° C. for 10 minutes.
The results are shown in FIG.
In FIG. 4, (a) shows the case of a mild mastitis sample, and (b) and (c) show the cases of different severe mastitis samples.

As shown in FIG. 4, in the case of mild mastitis, a clear band can be shown without using aminosilica, and the causative bacteria can be identified. In this case, unless the treatment with silica is performed, the band becomes smear and effective bacteria cannot be detected (first lane in the upper stage of FIG. 4).
On the other hand, by performing the treatment using the amino silica of the present invention, even such a sample can show a clear band (see the upper sections (b) and (c) of FIG. 4). If such a clear band is shown, it is clear that the bacteria can be identified and quantitatively tested with high accuracy.
Furthermore, bacteria can be detected and identified more efficiently by changing the amount of aminosilica depending on the severity of mastitis.

  Therefore, according to the present invention, even in a specimen in which bacteria and cells are mixed, bacteria in the specimen can be accurately separated from the cells in a short time. In addition, by using this specimen processing method, it is possible to test bacterial diseases such as mastitis accurately and efficiently in a short time.

It is a graph which shows adsorption | suction of S. aureus (A) and a somatic cell (B) to the various cell adsorption carrier concerning the Example of this invention. It is process drawing which shows the process of the sample processing method concerning the Example of this invention. It is process drawing which shows the DNA extraction process for the mastitis examination concerning the Example of this invention. It is an electrophoresis photograph of DNA concerning the example of the present invention.

Claims (8)

A sample processing method for processing a sample in which pathogenic bacteria of bacterial diseases and sample-derived somatic cells are mixed,
Mix sample and adsorbate to prepare sample solution
Bringing the cell adsorption carrier that is aminosilica into contact with the sample liquid, collecting the sample liquid after contact with the cell adsorption carrier,
Only including,
The sample processing method, wherein the bacterial disease is mastitis and the sample is a sample derived from milk .   2. The sample processing according to claim 1, further comprising contacting a desorption solution for separating the pathogenic bacteria adsorbed on the cell adsorption carrier after contacting the cell adsorption carrier after collecting the sample solution, and collecting the desorption solution after the contact. Method. The suction fluid, Good's buffers, claim 1 or claim 2 sample processing method according phosphate buffer or saline. A method for examining mastitis,
Mixing a sample derived from milk and an adsorbent to prepare a sample solution;
Bringing the cell adsorption carrier that is aminosilica into contact with the sample liquid, collecting the sample liquid after contact with the cell adsorption carrier,
Performing PCR using the S. aureus detection probe on the collected sample solution,
Mastitis testing method including. The specimen processing method according to claim 4 , wherein the adsorbent is Good's buffer, phosphate buffer, or physiological saline. A mastitis test kit,
The said test kit containing the cell adsorption | suction support | carrier which is aminosilica . The test kit according to claim 6 , further comprising at least one of an adsorbing liquid for preparing a sample liquid by mixing with a specimen and a desorbing liquid for separating the pathogenic bacteria of mastitis adsorbed on the cell adsorption carrier. The sample kit according to claim 7 , wherein the adsorbed solution is Good's buffer, phosphate buffer, or physiological saline.