JP4873599B2 - Animal model of autoimmune disease - Google Patents

Description

  The present invention relates to an autoimmune disease model animal, a method for producing the same, and a method for screening a substance useful for the prevention, amelioration, or treatment of an autoimmune disease using the autoimmune disease model animal.

  Autoimmune diseases such as systemic lupus erythematosus, Graves' disease, myasthenia gravis, and insulin-resistant diabetes mellitus are associated with anti-nuclear antibodies, anti-TSH receptor antibodies, anti-acetylcholine receptor antibodies, and anti-insulin receptor antibodies, respectively. It is known to result from increased production.

In recent years, model animals that develop such autoimmune diseases, such as mice lacking the function of Fas or Fas ligand (see Non-Patent Documents 1 and 2), and mice deficient in the DNaseI gene (see Non-Patent Document 3). Attempts have been made to develop substances useful for the prevention, amelioration, or treatment of autoimmune diseases.
Cell 76, 969-976, 1994 Nature 356, 314-317, 1992 Nat. Genet. 25, 177-181, 2000

  An object of the present invention is to provide a novel autoimmune disease model animal, a method for producing the same, and a method for screening a substance useful for the prevention, amelioration, or treatment of the autoimmune disease using the autoimmune disease model animal. .

  DNaseγ dissociates double-stranded DNA when cleaving DNA. When a mutation is introduced into one of the two Hiss (160 and 279th His in the amino acid sequence of GenBank Accession No. AAD09222) present in the active center to which one of the DNA strands binds, the DNase activity of DNaseγ is completely eliminated. It is clear that it can be suppressed.

  Therefore, in order to clarify the role of DNaseγ in vivo, the present inventors produced a knockout mouse in which a part of exon 5 containing a nucleotide encoding 160th His was deleted and made homozygous. Thus, DNaseγ-deficient mice were obtained. In the serum of this DNaseγ-deficient mouse, the concentration of the autoantibody (anti-dsDNA antibody) was increased compared to the wild-type mouse. From this result, it was shown that autoimmune disease develops in the animal by deficient in the function of DNaseγ, and the present inventors have completed the present invention.

  That is, the autoimmune disease model animal according to the present invention is a vertebrate other than a human and is characterized in that the DNaseγ function is completely or partially lost. The function of DNaseγ is, for example, DNase activity. The model animal may be characterized in that the DNaseγ function is completely or partially lost due to mutation of the DNaseγ gene.

  The autoimmune disease is preferably a disease caused by production of anti-dsDNA antibodies, for example. Specifically, systemic lupus erythematosus.

  In addition, the method for producing an autoimmune disease model animal according to the present invention includes a step of completely or partially deficient in the function of DNaseγ in vertebrates other than humans. The function of DNaseγ is, for example, DNase activity. The production method described above may include a step of completely or partially deleting the DNaseγ function by mutating the DNaseγ gene.

  Furthermore, the screening method according to the present invention is a method for screening a substance useful for prevention, amelioration, or treatment of an autoimmune disease, and is a non-human vertebrate animal that lacks DNaseγ function. It is characterized by using. The screening method may include a step of measuring the amount of autoantibodies in the model animal before and after administering the substance to be screened to the model animal, and comparing the amount of autoantibodies before and after administering the substance. .

  The autoimmune disease model animal of the present invention is a non-human vertebrate such as a mouse or a rat, for example.

  In the present invention, the “autoimmune disease” refers to a disease caused by autoantibody production. Examples of autoantibodies include anti-dsDNA antibodies.

  ADVANTAGE OF THE INVENTION According to this invention, the novel autoimmune disease model animal, its preparation method, and the screening method of a substance useful for the prevention, improvement, or treatment of an autoimmune disease using an autoimmune disease model animal can be provided. .

  Hereinafter, embodiments of the present invention completed based on the above knowledge will be described in detail with reference to examples. Unless otherwise stated in the embodiments and examples, J. Sambrook, EF Fritsch & T. Maniatis (Ed.), Molecular cloning, a laboratory manual (3rd edition), Cold Spring Harbor Press, Cold Spring Harbor, New York (2001); FM Ausubel, R. Brent, RE Kingston, DD Moore, JG Seidman, JA Smith, K. Struhl (Ed.), Standard Protocols in Molecular Biology, John Wiley & Sons Ltd. The method described in the protocol collection, or a modified or modified method thereof is used. In addition, when using commercially available reagent kits and measuring devices, unless otherwise explained, protocols attached to them are used.

  The objects, features, advantages, and ideas of the present invention will be apparent to those skilled in the art from the description of the present specification, and those skilled in the art can easily reproduce the present invention from the description of the present specification. it can. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention, and are shown for illustration or explanation. It is not limited. It will be apparent to those skilled in the art that various modifications and variations can be made based on the description of the present specification within the spirit and scope of the present invention disclosed herein.

== Usefulness of autoimmune disease model animals ==
DNaseγ is known as an enzyme that cleaves DNA at the final stage of apoptosis. A knockout mouse in which a part of exon 5 of the DNaseγ gene containing a nucleotide encoding the 160th His residue, which is one of the DNase active centers of DNaseγ, was created. It was revealed to show (increase in autoantibodies in serum). This increase in autoantibodies is caused by the deletion of a part of exon 5 of the DNaseγ gene, which results in the deletion or reduction of DNaseγ DNase activity, and release of a large amount of uncut DNA from cells that have undergone apoptosis. Thus, it is thought to have been caused by acting as a self-antigen.

  From the above, it is considered that an animal in which DNase activity of DNaseγ is deficient or reduced is useful as a model of human autoimmune disease. Since this model animal shows an increase in anti-dsDNA antibodies, systemic lupus erythematosus (especially active lupus nephritis and discoid lupus), collagen diseases such as Sjogren's syndrome, mixed connective tissue disease, autoimmune rheumatic diseases, etc. This is considered to be useful as a model.

  Furthermore, it is considered that a substance for preventing, ameliorating or treating the above diseases can be screened by using an animal in which DNase activity of DNaseγ is deficient or reduced.

== Production of autoimmune disease model animal ==
An autoimmune disease model animal can be produced by subjecting an animal individual to a treatment that deletes or reduces the function of DNaseγ (DNase activity that cleaves DNA). In order to lack or reduce the DNaseγ function in an animal, at least a site important for the DNaseγ function, or a DNA encoding the same or a transcription product thereof is targeted. For example, creating mutants (including conditional mutants) by introducing mutations (including deletions, substitutions, additions, insertions, etc.) into the DNaseγ gene using homologous recombination, mutations with dominant negative mutations It can be carried out by using the production of a transgenic animal having a protein, the production of a knockdown animal using antisense RNA or RNAi, or DNA encoding them.

  As a site important for the above-mentioned DNaseγ function, the C-terminal domain of DNaseγ having nuclear translocation activity (amino acid sequence 302 to 306 in the amino acid sequence of GenBank Accession No. AAD09222) while dissociating double-stranded DNA DNaseγ enzyme activity center (region containing 160th and 279th His in the amino acid sequence of GenBank Accession No. AAD09222) to which the DNA strand to be cleaved binds when cleaving DNA, and the DNA strand to be cleaved Is an amino acid residue that is thought to constitute a DNA binding pocket to which another different DNA strand binds (GenBank Accession No. AAD09222 amino acid sequence 35-39, 64-69, 97, 102-106) Examples of the amino acid residues are not limited to these.

  In addition, in the above, a site important for the function of DNaseγ or a region containing it, or DNA or RNA encoding them is targeted, but if the function of DNaseγ is impaired by mutating the gene, It is not limited to these.

  As another means, a DNaseγ function in an animal individual may be lost or reduced using a substance that inhibits or suppresses the DNaseγ function. For example, DNaseγ moves into the nucleus when apoptosis is induced and cleaves DNA. In addition to deleting the DNaseγ gene, DNaseγ has functions such as nuclear translocation activity and DNase activity that cleaves DNA. It is considered that the function of DNaseγ can be deficient or reduced by inhibiting.

As a substance that inhibits or suppresses the above-mentioned DNaseγ function, for example, a compound of any one of the following formulas (1) to (4) that inhibits the DNase activity of DNaseγ, an anti-DNaseγ antibody, and the like can be used.

== Screening method using autoimmune disease model animal ==
By using the autoimmune disease model animal of the present invention, a substance useful for prevention, amelioration or treatment of autoimmune disease can be screened.

  For example, a substance to be screened is administered to an autoimmune disease model animal deficient in DNaseγ function. Then, before and after administration, serum is collected from the autoimmune disease model animal, and the amount of autoantibodies in the serum is measured. The amount of autoantibodies is, for example, EIA (enzyme immunoassay), ELISA (Enzyme Iinked Immunosorbent Assay), PHA (Passive Hemagglutination Assay), double immunodiffusion method (FAT), FAT (fluorescent antibody test), PA (Particle Agglutination), RIA (radioimmunoassay), etc.

  By comparing the amount of autoantibodies before and after administration and examining whether the amount of autoantibodies is reduced after administration, substances useful for prevention, amelioration or treatment of autoimmune diseases can be identified. The amount of autoantibodies in animals administered with the substance to be screened is compared with the amount of autoantibodies before administration of the same animal individual, but may be compared with the amount of autoantibodies in normal animal individuals of the same type. .

  Examples of the present invention will be described in detail below.

[Example 1] Preparation of DNaseγ knockout mouse 1-1 Isolation of genomic DNA of mouse DNaseγ gene
The mouse DNaseγ gene was screened from the C57BL / 6 mouse genomic library by plaque hybridization.

First, transfer about 1 × 10 ⁶ plaques to Biodyne A nylon membrane (PALL), denature the filter in Alkaline Solution (1.5M NaCl, 0.5N NaOH) (5 min), Neutralizing Solution (1.5M NaCl, After neutralization with 0.5M Tris-HCl (5 minutes) and rinsing with 2 × SSC (5 minutes), phage DNA was immobilized on the filter by UV irradiation. The filter was randomly labeled with ³² P in hybridization buffer (50% formamide, 5 × SSPE (0.15M NaCl, 10 mM NaHPO ₄ (pH7.4), 1 mM EDTA), 5% Irish Cream, 0.1% SDS). Hybridization was performed overnight at 42 ° C. using a 0.5 kb EcoRI / DNA fragment containing exon 5 as a probe. After washing with 2 x SSC-0.1% SDS (65 ° C, 30 minutes), washing with 0.1 x SSC-0.1% SDS (65 ° C, 30 minutes x 2 times) Sensitized at 80 ° C. The DNA of the isolated phage clone was extracted with a lambda DNA Maxi preparation kit (QIAGEN), and a 14.5 kb DNA fragment (see A in FIG. 1) containing part of exon 8 from intron 4 of DNaseγ gene was pBSSK (+) Subcloned into vector (STRATAGENE) (inserted into NotI site).

1-2. Preparation of mouse DNaseγ gene targeting vector (pLNTK-γ-KO3) 5'-arm subcloning Using cloned DNaseγ genomic DNA and primers (DNaseF8 (SalI linker; GACGTCGACCCCCAACAACTTGGCTATGGGTCC: SEQ ID NO: 1) and DNaseR4 (SpeI linker; CTCACTAGTGGGGACAATCACGAAGTCCTTGAC: SEQ ID NO: 2)), PfuTurATA DNA Polymerase PCR was carried out to amplify the 5′-side homology region of the targeting vector. The amplified 4.9 kb fragment was subcloned into pCR-XL-TOPO (STRATAGENE).

B. Subcloning of 3′-arm The cloned DNaseγ genomic DNA was cleaved with Acc I and subjected to Klenow treatment to make it blunt, and then the 6.0 kb fragment was subcloned into the Sma I site of pUK21 (GenBank Accession No. AF223640).

C. Production of targeting vector
A 5′-arm fragment (4.9 kb) obtained by cleaving pCR-XL-TOPO containing a 4.9 kb fragment with Sal I and Xho I was converted into pLNTK (Immunity 5, 241-252, 1996; FIG. 1B (See) Sal I site. Next, the 3′-arm fragment (6.0 kb) obtained by cleaving pUK21 containing the 6.0 kb fragment with Sal I and Xho I was inserted into the Xho I site of pLNTK containing the 5′-arm fragment. , 5'-arm, PGK-Neomycin resistance gene (NEO) containing loxP sequences at both ends, 3'-arm, and a 18.0 kb targeting vector (pLNTK-γ-) containing herpes simplex virus Thymidine kinase (HSV-TK) KO3) was produced (see FIG. 1).

1-3. Preparation of DNaseγ heterozygous mutant ES cells ES (Embryonic Stem) cell culture
Cell culture dishes (10 cm) coated with 0.1% gelatin were seeded with BALB / c-derived EF (Embryonic Fibroblast) cells (feeder cells; 3 × 10 ⁶ cells) treated with mitomycin C. The following day, C57BL / 6 ES cells derived from blastocysts (Bruce4 cell line; 5 × 10 ⁶ cells) were seeded and cultured at 37 ° C. using a CO ₂ incubator. As the culture medium, a medium composed of DMEM (Dulbecco's modified Eagle medium; GIBCO), 15% FCS, 10 μM 2-ME (2-mercaptoethanol), 5 × 10 ⁻⁴ LIF (leukemia inhibitory factor) was used.

B. Introduction of targeting vector
Using GENE PULSER II (BIORAD) and CAPACITANCE EXTENDER II (BIORAD), pLNTK-γ-KO3 (cleaved with PvuI) into 1 × 10 ⁷ ES cells in 0.8 ml culture medium under conditions of 210 V and 500 μF The operation of introducing 25 μg was repeated 3 times.

C. screening
ES cells (3 × 10 ⁷ cells) transfected with pLNTK-γ-KO3 were cultured for 48 hours, after which G418 selection (200 μg / ml) (Positive Selection) was started, and ganciclovia (GANC) two days later (2 μM) (Negative Selection) was started, and surviving G418 / GANC-resistant ES cell colonies (96 cells) were isolated.

D. Southern blot analysis DNA was extracted from isolated ES cells, and the resulting DNA was cleaved with Hind III, Spe I and Kpn I, and subjected to homologous recombination by Southern blot analysis (DNaseγ heterozygous mutant ES Cell). The Southern blot analysis was performed using two probes (5′-probe and 3′-probe) (see FIG. 1). As the 5′-probe, PCR was performed with LA-PCR polymerase (TAKARA) using C57BL / 6 genomic DNA and primers (mG3 (GCTTGAGCACAAGGCTGCTAGTGAGTC: SEQ ID NO: 3) and mNGSP4 (CTCCATCCTGATAGTCATGGTAGTGG: SEQ ID NO: 4)). Amplified by PCR using primers (DNaseF5 (CCTTGTCAACAACAACCACC: SEQ ID NO: 5) and DNaseR3 (ACCATGCCTTGCCTAGAATC: SEQ ID NO: 6)) using the 6.3 kb fragment (including exons 2 and 3 and its peripheral part) as a template. The 366 bp fragment (exon 3 and its periphery) was used. As a 3'-probe, a 306 bp fragment (exon 8 and its fragment) amplified by PCR using DNaseγ genomic DNA and primers (mGSP5 (AGTCAACTCCGTGGTTCCCCGTTCC: SEQ ID NO: 7) and HA1 (GTGATCACTGACATCCAGGG: SEQ ID NO: 8)). Peripheral part) was used.

1-4 Preparation of DNaseγ-deficient mice
DNaseγ heterozygous mutant ES cells (derived from C57BL / 6) were microinjected into blastocysts extracted from Balb / c mice, and transplanted into the ovaries of pseudopregnant mice (ICR strain), chimeric mice (heterozygotes; DNaseγ ^+/- mice). Subsequently, heterozygous mice were mated to obtain a DNaseγ-deficient mouse (DNaseγ ^{− / −} mouse) in which the DNase activity of DNaseγ disappeared.

[Example 2] Increase in autoantibody titer due to deficiency in DNase γ function The DNase γ-deficient mice obtained in Example 1 did not show any abnormalities in appearance. Therefore, in order to clarify the effects of deficiency in DNaseγ function, serum was collected from DNaseγ-deficient mice and changes in autoantibody production were examined.

  To a 96-well plate, 50 μl of 0.001% protamine sulfate diluted with distilled water was dispensed and allowed to stand at room temperature for 1 hour, followed by washing with distilled water. Then, dispense 50 μl of dsDNA (20 μg / ml at a final concentration) diluted with a solution containing 0.15 M NaCl and 0.015 M sodium citrate (pH 8.0) into a 96-well plate to ensure that the water in the well is completely It was dried at 37 ° C. for about 12-18 hours until it disappeared.

Thus the 96-well plates coated with antigen in the wells bottom in the, PBS containing 0.05% Tween ^- After washing with, PBS containing 3% BSA ^- was allowed to stand for 1 hour at 37 ° C. was dispensed one by 100μl Blocked. Subsequently, using a serum from an autoimmune disease model mouse (NZB / W F1 mouse) as a standard, a dilution series of sera collected from wild type mice, DNaseγ-deficient mice, and NZB / W F1 mice was prepared and blocked. 50 μl was added to each and left at 37 ° C. for 1 hour. Thereafter, PBS containing 0.05% Tween ^- washed with, goat anti - added solution diluted 1000 fold with a one by 50 [mu] l ^- mice IgG (H + L) -HRP ( . Southern Biotechnology Associates, Inc) in PBS And left at 37 ° C. for 1 hour. Thereafter, PBS containing 0.05% tween ^- for washing with, TMB Peroxidase EIA Substrate Kit (BIO -RAD) developed using by measuring the amount of anti-dsDNA-IgG antibody at 450nm absorbance, NZB / W F1 mice The ratio of antibody titers was determined. The result is shown in FIG.

  As shown in FIG. 2, a significant difference in the amount of anti-dsDNA-IgG antibody could not be confirmed between a 10-week-old (10W) wild-type mouse (WT) and a DNaseγ-deficient mouse (KO). It was found that the amount of anti-dsDNA-IgG antibody in DNaseγ-deficient mice increased with increasing age. In particular, the amount of antibody in mice of 70 weeks of age or higher was higher in all mice than in wild-type mice.

In one Example of this invention, it is a figure which shows the structure of the mutant allele which raise | generated homologous recombination by the wild type allele, the targeting vector, and the targeting vector, and the structure of pLNTK vector. In one Example of this invention, it is a figure which shows the result of having measured the amount of anti- dsDNA antibodies in the serum of the produced transgenic mouse. In the figure, “n” means the number of individuals, and the bar means an average value.

Claims (9)

A model animal of autoimmune disease caused by production of anti-dsDNA antibody , which is a non-human vertebrate and completely deficient in DNaseγ function.   The model animal according to claim 1, wherein the function of DNaseγ is DNase activity. The model animal according to claim 1 or 2, wherein the DNaseγ function is completely lost due to mutation of the DNaseγ gene. The model animal according to any one of claims 1 to 3 , wherein the autoimmune disease is systemic lupus erythematosus (SLE). A method for producing a model animal of an autoimmune disease caused by production of an anti-dsDNA antibody, comprising a step of completely deficient in the function of DNaseγ in a vertebrate other than human. The production method according to claim 5 , wherein the function of DNaseγ is DNase activity. The method according to claim 5 or 6 , wherein the DNaseγ function is completely deleted by mutating the DNaseγ gene. A method for screening a substance useful for prevention, amelioration or treatment of an autoimmune disease,
A non-human vertebrate, features DNaseγ is completely deficient, a screening method which comprises using a model animal of autoimmune diseases caused by the production of anti-dsDNA antibodies. Before and after administering the screening target substance to the model animal, measure the amount of autoantibodies in the model animal,
The screening method according to claim 8 , wherein the autoantibody amounts before and after administration of the substance are compared.

Images