JP4824985B2 - Method for producing farnesyl diphosphate - Google Patents

Description

  The present invention relates to a method for producing farnesyl diphosphate (hereinafter sometimes referred to as FDP).

  FDP is supplied as a chemically synthesized product only at a very expensive price for reagent use (FDP Trimmonium Salt, Funakoshi Co., Ltd.). Although this FDP is useful as an intermediate for various terpenoids, it is hardly used in industry.

FDP is one of the terpenoids essential for maintaining the life of organisms, and is also a biosynthetic intermediate for various terpenoids such as carotenoids, plant hormones, and ubiquinones. Terpenoids are a general term for a group of organic compounds having a 5 carbon isoprene unit as a basic skeleton, and are biosynthesized by polymerization of isopentenyl pyrophosphate (IPP). In addition to (C ₅ H ₈ ) n unsaturated hydrocarbons, their redox products (alcohols, ketones, acids, etc.), carbon-depleted compounds, etc. have been found in many plants and animals. Terpenoids are hemiterpenes (C5), monoterpenes (C10), sesquiterpenes (C15), diterpenes (C20), sesterterpenes (C25), triterpenes (C30), tetraterpenes (C40, carotenoids), and other polyterpenes. Can be classified. There are many compounds that exhibit physiological activity such as abscisic acid, juvenile hormone, gibberellin, forskolin, and phorbol. In addition, chlorophyll, vitamin K, ubiquinone, tRNA, and the like are used as complex terpenes having an isoprene structure as a part of the structure, and these also exhibit useful physiological activities.

  For example, ubiquinone, a kind of terpenoid compound, plays an important role in the body as an essential component of the electron transport system, and is used as a drug effective for heart disease. Has increased. Vitamin K is an important vitamin involved in the blood clotting system and is used as a hemostatic agent. Recently, it has been suggested to be involved in bone metabolism and is expected to be used in the treatment of osteoporosis. Menaquinone is permitted as a pharmaceutical.

  In addition, ubiquinone and vitamin K have an action of inhibiting the adhesion of shellfish to structures such as hulls and bridge piers, and are expected to be applied to shellfish adhesion prevention paints. Furthermore, carotenoids have an antioxidant action, and some are expected to have cancer prevention and immunostimulatory activities, such as β-carotene, astaxanthin, and cryptoxanthin. Thus, terpenoids contain substances useful for living organisms, but these compounds are all biosynthesized via isopentenyl pyrophosphate (hereinafter sometimes referred to as IPP) which is a basic skeleton unit. It is known that

IPP, which is the basic skeleton of terpenoid compounds, has been proven to be biosynthesized from acetyl-CoA via mevalonic acid (mevalonic acid pathway) in eukaryotes such as animals and yeasts. In the mevalonate pathway, 3-hydroxy-3-methylglutaryl CoA (hereinafter abbreviated as HMG CoA) reductase present in eukaryotes such as animals and yeasts is considered to be a rate-limiting enzyme (non-native). Patent Document 2). In addition, microbial synthesis of mevalonic acid labeled with ¹³ C has been reported, and is expected to be used for metabolomic research related to terpenoids (Japanese Patent Application No. 2004-087756).

  FDPs useful as intermediates for such various terpenoid compounds can be biosynthesized by the reaction of isopentenyl diphosphate and dimethylallyl diphosphate formed by isomerization of isopentenyl diphosphate. Are known. The biosynthesis of isopentenyl diphosphate has long been believed to be biosynthesized only from the mevalonate pathway, but Seto and Katsurayama et al. Reported that animal cells, plant cell cytoplasm, fungi such as mold and yeast, In addition to the mevalonate pathway via mevalonic acid present in bacteria, it was revealed that biosynthesis is performed via the methylerythritol phosphate (MEP) pathway present in many eubacteria and plant plastids ( Non-patent document 1).

  As a means for producing this FDP, in addition to the chemical synthesis method described above, a method using organisms or enzymes using mevalonic acid or acetic acid as a raw material can be considered but has not been put into practical use. Mevalonic acid is an important group of physiologically active substances, and there are natural R-mevalonic acid, which is a biosynthetic intermediate of a group of substances called terpenoids essential for life support, and non-natural S-mevalonic acid. Are known. In many cases, the natural type is obtained by the fermentation method (Patent Documents 12 and 13), and the racemic body that is an equal mixture of the natural type and the non-natural type is obtained by the chemical synthesis method. In the anhydrous state, mevalonic acid is easily dehydrated and intramolecularly esterified (lactonized) to form mevalonolactone, but easily reacts with water in an aqueous solution or an alkaline aqueous solution to form mevalonic acid or mevalonate.

Patent Documents 1 to 11 and the like have been reported as methods relating to the production of FDP. These reports mainly relate to improvement of stability and productivity of FDP synthase. For example, the heat resistance is improved by modifying the amino acid sequence constituting the enzyme. However, these inventions are methods for obtaining FDP by transforming a host cell with DNA and culturing the host. The culture of microorganisms is complicated, and various products other than the target product are included. Therefore, a complicated purification process is indispensable for increasing the purity.
JP 2005-137287 A JP 2005-052046 A Japanese Patent Laid-Open No. 2003-088368 JP 2002-199884 JP JP 2002-199883 JP Japanese Patent Laid-Open No. 10-136984 Japanese Patent Laid-Open No. 10-033184 Japanese Unexamined Patent Publication No. 08-214877 Japanese Patent Laid-Open No. 05-219961 JP 2002-238572 A Special Table 2004-527265 JP-A-2-215389 Japanese Patent Laid-Open No. 3-210174 Rohmer, M. In Comprehensive Natural Products Chemistry, Vol. 2: Isoprenoids Including Carotenoids and Steroids; Barton, D. Nakanishi, K. Eds. Elsevier: Amsterdam, 1999; pp. 45-67 Mol. Biol. Cell, 5,655 (1994)

An object of the present invention is to provide an efficient and inexpensive method for producing FDP from mevalonic acid. Farnesyl diphosphate, when obtained by culturing the microorganisms in order to also include products other than the objective FDP in the cell, it is difficult to mass-get FDP. That is, in the cells of the microorganisms, since sometimes another product from intermediate in the mevalonate pathway for biosynthesis of FDP from mevalonate is synthesized, not only Ruwa only FDP object is synthesized. Therefore, since the ratio of FDP to the total amount of protein in the cell is small, purification of FDP is complicated and difficult.

  As a result of intensive studies to solve the above problems, the present inventor has found that mevalonate phosphotransferase (hereinafter sometimes referred to as MVK), phosphomevalon, which is an enzyme for biosynthesis of FDP from mevalonate. Acid phosphotransferase (hereinafter sometimes referred to as PMVK), diphosphomevalonate decarboxylase (hereinafter sometimes referred to as DPMVC), isopentenyl diphosphate isomerase (hereinafter also referred to as IPPI) And farnesyl diphosphate synthase (hereinafter sometimes referred to as FPS), it was found that farnesyl diphosphate can be biosynthesized efficiently by acting on mevalonic acid in a cell-free system.

That is, the present invention
(1) Allow mevalonate to react with mevalonate phosphotransferase, phosphomevalonate phosphotransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase and farnesyl diphosphate synthase in a cell-free system. A method for producing farnesyl diphosphate is provided.

  (2) In addition, the mevalonate phosphoryltransferase, phosphomevalonate phosphoryltransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase and / or farnesyl diphosphate synthase is a red spruce (Neurospora crassa). The method for producing farnesyl diphosphate according to (1) is provided.

  (3) Further, the mevalonate phosphoryltransferase, phosphomevalonate phosphoryltransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase and / or farnesyl diphosphate synthase is a red spruce (Neurospora crassa). The method for producing farnesyl diphosphate according to (1) or (2) is characterized in that the gene cloned from (1) is expressed in a host cell.

  (4) Moreover, the manufacturing method of the farnesyl diphosphate as described in (2) or (3) whose said red bread mold (Neurospora crassa) is FGSC2489 strain | stump | stock.

  (5) Furthermore, adenosine triphosphate (ATP) and a magnesium salt are added as cofactors to the cell-free system, and the farnesyl diphosphate according to any one of (1) to (4), A method for producing phosphoric acid is provided.

  (6) The method for producing labeled farnesyl diphosphate according to any one of (1) to (5), wherein the mevalonic acid is labeled mevalonic acid.

  (7) Also, an enzyme cocktail including mevalonate phosphotransferase, phosphomevalonate phosphotransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase and farnesyl diphosphate synthase is provided.

  According to the present invention, natural R-farnesyl diphosphate (FDP) can be provided efficiently and inexpensively. The synthesis comprising an enzyme cocktail is simpler and easier to control than the production by microbial culture. Since it is an enzymatic reaction, the intended FDP can be obtained with high purity, and no unintended impurities are produced.

Hereinafter, the present invention will be described in detail.
In the present specification, the “cell-free system” means that a reaction in which an enzyme is allowed to act on a substrate to produce a target product is not performed in a cell but in a system in which no cell exists. . However, it does not exclude that cells are mixed so as not to substantially affect the production of the target product.

  In the present specification, the term “enzyme cocktail” means a mixture of enzymes that produce a desired product from a substrate. The enzyme mixture only needs to contain an enzyme necessary for synthesizing the target compound from the substrate. In addition, cofactors for enzyme reaction may be included. Furthermore, impurities that do not affect the enzyme reaction may be included.

  In the present specification, “one to several bases are deleted, substituted, added and / or inserted” is, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10. More preferably, it means that 1 to 5 arbitrary numbers of bases are deleted, substituted, added and / or inserted. In the present specification, “one to several amino acids are deleted, substituted, added and / or inserted” is, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10. This means that any number of amino acids, more preferably 1 to 5, are deleted, substituted, added and / or inserted.

  Also, in this specification, “can hybridize under stringent conditions” means that DNA is used as a probe and colony hybridization method, plaque hybridization method, Southern blot hybridization method or the like is used. Specifically, hybridization is performed at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which DNA derived from colonies or plaques or a fragment of the DNA is immobilized. After washing, the filter is washed under a condition of 65 ° C. using an SSC solution of about 0.1 to 2 times (the composition of the SSC solution of 1 time concentration consists of 150 mM sodium chloride and 15 mM sodium citrate). DNAs that can be identified by

  Hybridization conforms to the method described in Molecular Cloning: A laboratory Mannual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY., 1989. (hereinafter referred to as Molecular Cloning Second Edition). Can be done. Examples of DNA that can hybridize under stringent conditions include DNA having a certain degree of homology with the base sequence of DNA used as a probe. The homology is, for example, 60% or more, preferably 70% or more. More preferably, it is 80% or more, more preferably 90% or more, particularly preferably 95% or more, and most preferably 98% or more.

  The present invention includes A) acquisition of DNA encoding mevalonate phosphotransferase, B) acquisition of DNA encoding phosphomevalonate phosphotransferase, C) acquisition of DNA encoding diphosphomevalonate decarboxylase, D) Acquisition of DNA encoding isopentenyl diphosphate isomerase, E) Acquisition of DNA encoding FDP synthase, F) Transformant having DNA encoding enzyme protein of A to E) above, 5 types in total And expression of the enzyme protein in a total of 5 types of transformants having DNA encoding the enzyme protein, G) and production of FDP from R-mevalonic acid by the action of 5 enzyme cocktails.

  Specifically, for example, the following procedure can be used. In other words, DNAs A) to E) for encoding the respective enzymes were extracted from total red RNA using an RNA kit from red spider mold (Neurospora crassa) cells, followed by uniform superparamagnetic polymer beads. The mRNA is purified by forming a hydrogen bond between the poly (A) + residue present at the 3 ′ end of the mRNA and the residue on the bead surface. As the polymer beads, Dynabeads Oligo (dT) 25 from Dynal can be used. Next, cDNA is obtained by reverse transcriptase reaction, and a DNA fragment containing an open reading frame (hereinafter referred to as ORF) encoding the protein of each enzyme is obtained using gene-specific sequence primers and a commercially available PCR kit. Commercially available kits such as NTECH's Advantage HF2 can be used. PCR is performed according to the protocol, and the obtained DNA is incorporated into a TA cloning vector to confirm the sequence.

  Next, a transformant having DNA encoding the five enzyme proteins of F) is prepared, and the enzyme protein is expressed in the transformant having DNA encoding the enzyme protein. A DNA fragment containing the ORF whose sequence has been confirmed is incorporated into a pQE30 vector or a pGEX4T-3 vector, and transformed using an Escherichia coli strain or the like. IPTG is added to the transformed strain at 1 mM (final concentration) to induce production of the target protein. After cell collection, a soluble fraction is prepared by lysozyme and ultrasonic disruption, and production of the target protein is confirmed by SDS-PAGE (CBB staining) of a 10% polyacrylamide gel.

  To obtain a large excess of enzyme compared to the amount of those enzymes normally present in cells by performing genetic recombination using E. coli transformants and expressing enzymes involved in FDP biosynthesis. Is possible. Therefore, even if E. coli is disrupted and the soluble fraction is used as a crude enzyme solution and allowed to act on mevalonic acid, sufficient FDP can be synthesized. Of course, this crude enzyme solution can be purified by a conventional method and allowed to act. Expression of a large excess of these enzymes may be possible simply by transforming E. coli with a vector. However, it is usually possible by adding isopropyl-β-D-thiogalactopyranoside (IPTG) or the like to the transformant and inducing protein production. The expression of a large excess of protein can be confirmed visually by electrophoresis on SDS-PAGE of 10% polyacrylamide gel and CBB staining.

  Next, R-mevalon by the action of enzyme cocktail of 5 types of G) (mevalonate phosphotransferase, phosphomevalonate phosphotransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase, FDP synthase) Production of FDP from acid.

  Mevalonate phosphotransferase, phosphomevalonate phosphotransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase and farnesyl diphosphate synthase used in the present invention are, for example, naturally occurring enzymes or Obtained by genetic engineering using genes encoding mevalonate phosphotransferase, phosphomevalonate phosphotransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase and farnesyl diphosphate synthase It can be a substitute.

The mevalonate phosphotransferase gene may be a DNA sequence that substantially encodes mevalonate phosphotransferase, that is, an enzyme protein having an activity of catalyzing a reaction for producing phosphomevalonate from mevalonate and ATP. For example, the nucleotide sequence of SEQ ID NO: 1 which is a mevalonate phosphotransferase gene derived from the strain of Neurospora crassa FGSC2489, or one to several nucleotide sequences in SEQ ID NO: 1 are deleted, substituted, added and / or The inserted base sequence can be hybridized under stringent conditions with the base sequence encoding all the sequences necessary for functioning mevalonate phosphotransferase, or the base sequence of SEQ ID NO: 1. The nucleotide sequence includes a nucleotide sequence that encodes all sequences necessary for functioning mevalonate phosphotransferase. Furthermore, the present invention provides an enzyme protein produced by expressing these genes by a conventional method. Further, if a cofactor such as Mg ²⁺ is required for the enzyme reaction, a necessary amount thereof may be added.

The phosphomevalonate phosphotransferase gene may be a DNA sequence that substantially encodes an phosphomevalonate phosphotransferase, that is, an enzyme protein having an activity of catalyzing a reaction for producing diphosphomevalonate from phosphomevalonate and ATP. For example, the nucleotide sequence of SEQ ID NO: 2 which is a phosphomevalonate phosphotransferase gene derived from the strain of Neurospora crassa FGSC2489, or one to several nucleotide sequences in SEQ ID NO: 2 are deleted, substituted, added and / or It can be hybridized under stringent conditions with the inserted base sequence and encoding the base sequence that encodes all the sequences necessary for functioning phosphomevalonate phosphotransferase. The nucleotide sequence includes a nucleotide sequence that encodes all sequences necessary for functioning phosphomevalonate phosphotransferase. Furthermore, the present invention provides an enzyme protein produced by expressing these genes by a conventional method. In addition, if a cofactor such as Mg ²⁺ is required for the enzyme reaction, a necessary amount may be added.

The diphosphomevalonate decarboxylase gene may be a DNA sequence that substantially encodes a diphosphomevalonate phosphotransferase, that is, an enzyme protein having an activity of catalyzing a reaction of decarboxylating diphosphomevalonate to produce isopentenyl diphosphate. That's fine. For example, the nucleotide sequence of SEQ ID NO: 3 which is a diphosphomevalonate decarboxylase gene derived from the strain Neurospora crassa FGSC2489, or one to several nucleotide sequences in SEQ ID NO: 3 are deleted, substituted, added and / or inserted. A nucleotide sequence that encodes all sequences necessary for the function of diphosphomevalonate decarboxylase, or a nucleotide sequence that can hybridize with the nucleotide sequence of SEQ ID NO: 3 under stringent conditions It contains a base sequence that encodes all sequences necessary for the function of diphosphomevalonate decarboxylase. Furthermore, the present invention provides an enzyme protein produced by expressing these genes by a conventional method. In addition, if a cofactor such as Mg ²⁺ is required for the enzyme reaction, a necessary amount may be added.

The isopentenyl diphosphate isomerase gene is an isopentenyl diphosphate isomerase, that is, an enzyme protein having an activity of catalyzing a reaction of isomerizing isopentenyl diphosphate to dimethylallyl diphosphate. Any DNA sequence may be used. For example, the nucleotide sequence of SEQ ID NO: 4 which is an isopentenyl diphosphate isomerase gene derived from the strain of Neurospora crassa FGSC2489, or one to several nucleotide sequences in SEQ ID NO: 4 are deleted, substituted, added and Hybridization under stringent conditions with the inserted base sequence that encodes all the sequences necessary for the function of isopentenyl diphosphate isomerase, or the base sequence of SEQ ID NO: 4 A nucleotide sequence that can be generated and that encodes all the sequences necessary for the function of isopentenyl diphosphate isomerase. Furthermore, the present invention provides an enzyme protein produced by expressing these genes by a conventional method. In addition, if a cofactor such as Mg ²⁺ is required for the enzyme reaction, a necessary amount may be added.

The FDP synthase gene may be a DNA sequence that substantially encodes an FDP synthase, that is, an enzyme protein having an activity of catalyzing the reaction of generating FDP from isopentenyl diphosphate and dimethylallyl diphosphate. For example, the base sequence of SEQ ID NO: 5 which is an FDP synthase gene derived from Neurospora crassa FGSC2489 strain, or 1 to several base sequences in SEQ ID NO: 5 are deleted, substituted, added and / or inserted. A base sequence that encodes all sequences necessary for functioning FDP synthase, or a base sequence that can hybridize with the base sequence of SEQ ID NO: 5 under stringent conditions, It contains a base sequence that encodes all sequences necessary for the function of FDP synthase. Furthermore, the present invention provides an enzyme protein produced by expressing these genes by a conventional method. In addition, if a cofactor such as Mg ²⁺ is required for the enzyme reaction, a necessary amount may be added.

  The mevalonate phosphotransferase gene, phosphomevalonate phosphotransferase gene, diphosphomevalonate decarboxylase gene, isopentenyl diphosphate isomerase gene FDP synthase gene used in the present invention can be derived from any organism. Although it does not matter, it is preferably derived from a red knot mold which is a eukaryote. Acquisition of the target gene from red-knot mold is performed by a conventional method, but the outline is as follows. 1) Extract the gene of interest from the genome information database of red mold and synthesize primers based on the obtained sequence information. 2) Prepare the cDNA library (genomic library) from red mold cells. 3) The cDNA library (genomic library) ) To obtain a sequence containing the gene of interest using a primer. The above operation is carried out by the following five enzyme genes: mevalonate phosphotransferase gene, phosphomevalonate phosphotransferase gene, diphosphomevalonate decarboxylase gene, isopentenyl diphosphate isomerase gene and FDP synthase gene Do about.

  The obtained DNA fragments containing the five types of enzyme genes are each incorporated into a plasmid vector, and a host (for example, E. coli) is transformed with the obtained plasmid vector. The transformed host is cultured by a conventional method, and the obtained cells are collected by centrifugation and then disrupted to obtain a crude enzyme solution. The crude enzyme solution can be purified as necessary. In addition, if the host such as Escherichia coli that expresses the enzyme gene used in the present invention cannot express the target enzyme protein in an active form and forms an inclusion body or the like, a peptide capable of active expression is used. It may be expressed in a fused form with a gene encoding.

  The host cell used in the present invention is not particularly limited, but a strain that can be easily handled, such as Escherichia coli, Bacillus subtilis, actinomycetes, baker's yeast, and red mold, is preferable. For example, as a strain of E. coli, E. coli derived from K-12 strain such as JM109 strain, DH5α strain, XL1-blue strain, HB101 strain, or B strain such as BL21 can be used. Furthermore, insect cells, plant cells, animal cells and the like can also be used as host cells.

  As the expression vector, those that can replicate autonomously in the above hosts, such as Escherichia coli and baker's yeast, or can be integrated into the chromosome and have high expression efficiency of the foreign protein are preferable. The expression vector for expressing the DNA is preferably a recombinant vector that is capable of autonomous replication in the microorganism and is composed of a promoter, a ribosome binding sequence, the DNA and a transcription termination sequence. A gene that controls the promoter may also be included.

  Specific examples of expression vectors include pBTrp2, pBTac1, pBTac2 (all available from Boehringer Mannheim), pKK233-2 (Pharmacia), pSE280 (Invitrogen), pGEMEX-1 (Promega), pQE-8 (manufactured by QIAGEN), pQE-30 (manufactured by QIAGEN), pKYP10 (Japanese Patent Laid-Open No. 58-110600), pKYP200 [Agricultural Biological Chemistry, 48, 669 (1984)], pLSA1 [Agric. Biol. Chem. , 53, 277 (1989)], pGEL1 [Proc. Natl. Acad. Sci. USA, 82, 4306 (1985)], pBluescriptII SK +, pBluescriptII SK (-) (Stratagene), pTrS30 (FERMBP-5407), pTrS32 (FERM BP-5408), pGEX (Pharmacia), pET-3 (Novagen), pTerm2 (US4686191, US4939094, US5160735), pSupex, pUB110, pTP5, pC194, pUC18 [gene, 33, 103 (1985) )], PUC19 [Gene, 33, 103 (1985)], pSTV28 (Takara Shuzo), pSTV29 (Takara Shuzo), pUC118 (Takara Shuzo), pPA1 (Japanese Patent Laid-Open No. 63-233798), pEG400 [ J. Bacteriol., 172, 2392 (1990)], pQE-30 (manufactured by QIAGEN), etc. Can be illustrated.

As the promoter, any promoter can be used so long as it can be expressed in cells such as Escherichia coli and baker's yeast. For example, trp promoter (Ptrp), lac promoter (Plac), P _L promoter, P _R promoter and P _SE promoter, promoters derived from Escherichia coli or phage, such as, SPO1 promoter, SPO2 promoter, be given penP promoter it can. In addition, artificially designed and modified promoters such as a promoter in which two Ptrps are connected in series (Ptrpx2), a tac promoter, a letI promoter, and a lacT7 promoter can be used.

  Any ribosome binding sequence can be used as long as it can be expressed in the host actinomycete cell, but an appropriate distance between the Shine-Dalgarno sequence and the initiation codon (eg, 6-18). It is preferable to use a plasmid adjusted to the base).

  As a method for introducing the recombinant vector, any method can be used as long as it is a method for introducing DNA into cells such as Escherichia coli and baker's yeast, which are the above hosts. For example, a method using calcium ions [Proc. Natl. Acad. Sci. USA, 69, 2110 (1972)], the protoplast method (Japanese Patent Laid-Open No. 63-2483942), or the method described in Gene, 17, 107 (1982) or Molecular & General Genetics, 168, 111 (1979) Etc.

  Each enzyme can be obtained by culturing host cells transformed with the expression vector. For example, in the case of Escherichia coli, Escherichia coli may be cultured in a commonly used L medium, YT medium, M9-CA medium or the like. Since an expression vector often has a drug resistance gene, it is desirable to add a corresponding drug at an appropriate concentration. When a gene encoding an enzyme is expressed, expression may be induced by using an upstream promoter in an appropriate manner. For example, expression can be induced by adding IPTG, indoleacrylic acid (IAA), or the like.

  In order to obtain the target enzyme from the cells obtained by culturing, conventional techniques such as lysozyme treatment of cells, ultrasonic disruption, centrifugation, various chromatographies and the like can be used. When the target enzyme is obtained in the soluble fraction, it can be used as it is as an enzyme solution. The soluble fraction can be purified by various chromatography, for example, affinity chromatography, gel filtration, ion exchange chromatography and the like. When the target enzyme becomes insoluble by forming insoluble granules, it can be solubilized with guanidine or urea, purified as it is or by various chromatography, refolded and used as an enzyme solution.

  Next, farnesyl diphosphate is produced from mevalonic acid in a cell-free system using each of the obtained enzymes. As the enzyme, the soluble fraction obtained from the host cell may be used as it is, or purified enzyme may be used. Mevalonic acid is used as a substrate and an enzyme solution is allowed to act on it. Enzymes are mevalonate phosphotransferase (MVK), phosphomevalonate phosphotransferase (PMVK), diphosphomevalonate decarboxylase (DPMVC), isopentenyl diphosphate isomerase (IPPI) and farnesyl diphosphate synthase ( FPS) may be sequentially added and allowed to act, but all enzymes may be mixed and act as an enzyme cocktail. The reaction volume is not particularly limited, and the reaction volume can be used in a small amount, or the reaction can be carried out in a large amount for industrial use. The substrate concentration is not particularly limited as long as the enzyme can act, but is preferably 500 to 0.1 mg / ml, more preferably 200 to 0.05 mg / ml. The enzyme concentration is not particularly limited as long as the enzyme can act, but it is preferably 50 to 0.01 mg / ml, more preferably 5 to 0.1 mg / ml. Although reaction temperature will not be specifically limited if it is the temperature which an enzyme can act on, Preferably it is 80-10 degree | times, More preferably, it is 60-20 degree | times, More preferably, it is 40-25 degree | times.

  Examples of the present invention are shown below, but the present invention is not limited to these Examples. The gene recombination experiments shown in the Examples were carried out using the method described in Molecular Cloning 2nd edition (hereinafter referred to as conventional method) unless otherwise specified.

Example 1
(A) Acquisition of DNA encoding mevalonate phosphotransferase (MVK)
Total RNA was extracted from the Neurospora crassa FGSC2489 strain using the EASYPrepRNA kit manufactured by Takara according to the attached instructions. Subsequently, mRNA was purified using Dynabeads Oligo (dT) 25 manufactured by DINAL BIOTECH in accordance with the attached instructions. CDNA was obtained from this mRNA by reverse transcriptase reaction. Gene-specific sequence primer
Fwd. ATGGTACCATGGCAGAGCAAGAACACAAC (restriction enzyme site: Kpn I) (SEQ ID NO: 11)
Rev. ATGGTACCGTCCCGGTTCTCAACC (Restriction enzyme site: Kpn I) (SEQ ID NO: 12)
PCR was performed using Advantage HF2 manufactured by CLONTECH, and a DNA fragment containing ORF was obtained.
PCR was performed in a reaction volume of 50 μl volume according to the attached instructions. The conditions were 92 ° C. for 3 min, 92 ° C. for 45 sec., 50 ° C. for 45 sec., 68 ° C. for 2 min 30 sec., 30 cycles, and finally 68 ° C. for 5 min. The obtained DNA fragment was incorporated into a TAcloning vector, and the sequence was confirmed. The sequence is shown in SEQ ID NO: 1.

Example 2
(B) Acquisition of DNA encoding phosphomevalonate phosphotransferase (PMVK)
CDNA was obtained from Neurospora crassa FGSC2489 strain by the same procedure as in Example 1. Gene-specific sequence primer
Fwd. CGCGGATCCATGGCTTTGGCCGTCTC (Restriction enzyme site: Bam HI) (SEQ ID NO: 13)
Rev. CGCGGATCCCTAAACTCGCTCCATCAACC (Restriction enzyme site: Bam HI) (SEQ ID NO: 14)
PCR was performed using Advantage HF2 manufactured by CLONTECH, and a DNA fragment containing ORF was obtained. PCR was performed according to the same protocol as in Example 1. The obtained DNA was incorporated into a TAcloning vector and the sequence was confirmed. The confirmed sequence is shown in SEQ ID NO: 3.

Example 3
(C) Acquisition of DNA encoding diphosphomevalonate decarboxylase (DPMVC)
CDNA was obtained from Neurospora crassa FGSC2489 strain by the same procedure as in Example 1. Since there was an error in the database for this enzyme, 3'-RACE and 5'-RACE were performed to determine the exact base sequence of the translation region. Gene-specific sequence primers designed based on the information obtained
Fwd. ATGGTACCATGGCTTCCGAAAAGGTC (Restriction enzyme site: Kpn I) (SEQ ID NO: 15)
Rev. atggtaccct aagaagagct cttgacc (restriction enzyme site: Kpn I) (SEQ ID NO: 16)
PCR was performed using Advantage HF2 manufactured by CLONTECH, and a DNA fragment containing ORF was obtained. PCR was performed in a reaction volume of 50 μl volume according to the protocol. The conditions were 92 ° C., 3 min treatment, 92 ° C. 30 sec., 51 ° C. 45 sec., 68 ° C. 2 min, 30 cycles, and finally 68 ° C., 5 min. The obtained DNA fragment was incorporated into a TAcloning vector, and the sequence was confirmed. The confirmed sequence is shown in SEQ ID NO: 5.

Example 4
(D) Acquisition of DNA encoding isopentenyl diphosphate isomerase (IPPI)
CDNA was obtained from Neurospora crassa FGSC2489 strain by the same procedure as in Example 1. Gene-specific sequence primer
Fwd. ATGGTACCATGTCGACCGCTACCACAAC (Restriction enzyme site: Kpn I) (SEQ ID NO: 17)
Rev. ATGGTACCTAGCATACGGCGAATCTCCTG (Restriction enzyme site: Kpn I) (SEQ ID NO: 18)
PCR was performed using Advantage HF2 manufactured by CLONTECH, and a DNA fragment containing ORF was obtained. PCR was performed in a reaction volume of 50 μl volume according to the protocol. The conditions were 95 ° C. for 3 min, 95 ° C. for 30 sec., 50 ° C. for 45 sec., 68 ° C. for 2 min, 30 cycles, and finally 68 ° C. for 2 min. The obtained DNA fragment was incorporated into a TAcloning vector, and the sequence was confirmed. The confirmed sequence is shown in SEQ ID NO: 7.

Example 5
(E) Acquisition of DNA encoding FDP synthase (FPS)
CDNA was obtained from Neurospora crassa FGSC2489 strain by the same procedure as in Example 1. Gene-specific sequence primer
Fwd. TAGGATCCATGGCCAAGACAACGACCC (Restriction enzyme site: Bam HI) (SEQ ID NO: 19)
Rev. ATAAGCTTCTTGCTGCGCTTGTAGATC (Restriction enzyme site: Hind III) (SEQ ID NO: 20)
PCR was performed using Advantage HF2 manufactured by CLONTECH, and a DNA fragment containing ORF was obtained. PCR was performed in a reaction volume of 50 μl volume according to the protocol. The conditions were 92 ° C. for 3 min, 92 ° C. for 45 sec., 52 ° C. for 45 sec., 68 ° C. for 2 min for 30 cycles, and finally 68 ° C. for 5 min. The obtained DNA fragment was incorporated into a TAcloning vector, and the sequence was confirmed. The confirmed sequence is shown in SEQ ID NO: 9.

Example 6
(F) Transformants having a DNA encoding an enzyme protein, production of a total of 5 types, and expression of the enzyme protein in a total of 5 types of transformants having a DNA encoding the enzyme protein. Use the KpnI site for the DNA fragment encoding, the KpnI site for the DNA fragment encoding DPMVC, the KpnI site for the DNA fragment encoding IPPI, the BamHI and HindIII sites for the DNA fragment encoding (FPS). The DNA fragment encoding PMVK was incorporated into the pQE30 vector using the BamHI site. The DNA fragment encoding PMVK was also incorporated into pGEX4T-3 using the BamHI site and expressed as a fusion protein with glutathione-S-transferase (GST). E. coli JM109 strain was transformed with this vector. IPTG 1 mM (final concentration) was added to the transformed Escherichia coli to induce production of the target protein. After cell recovery, a soluble fraction was prepared by sonication with lysozyme (2 mg / ml), and production of the target protein was confirmed by SDS-PAGE (CBB staining) of a 10% polyacrylamide gel. The marker used was a Low marker manufactured by Biorad. The molecular weights of the markers are 97 kDa, 66 kDa, 45 kDa, 31 kDa, 21 kDa, and 14 kDa from the largest. The target proteins incorporated and expressed in the pQE30 vector were confirmed to be around 58 kDa for MVK, 46 kDa for PMVK, 42 kDa for DPMVDC, 29 kDa for IPPI, and 40 kDa for FPS. Each electrophoretic photograph is shown in FIG.

Example 7
The protein amount of the soluble fraction obtained in Example 6 (for PMVK, the soluble fraction of the fusion protein with GST) was measured by the Bradford method to obtain a crude enzyme solution. Using an enzyme cocktail consisting of enzymes each 5 mg, as a substrate R- mevalonolactone (Asahi Denka: Ade turtle Varo gluconolactone) using 1g, adding ATP to a final concentration of 5 mM, the MgCl ₂ to a final concentration of 5 mM, the reaction The reaction was stirred at a volume of 5 ml and stirred at 26 ° C. for 5 hours. After completion of the reaction, add an equal amount of methanol and mix, then add 2 times the amount of ethyl acetate, vigorously stir and let stand, take the ethyl acetate layer, evaporate the ethyl acetate with a rotary evaporator, and convert the solute portion to GC / MS. Were identified and quantified. As a result, 2 mg of farnesyl diphosphate (R-FDP) was obtained.

  The FDP obtained in the present invention is a precursor of compounds important for living bodies such as steroids, ubiquinones, dolichols, carotenoids, prenylated proteins, animal hormones, plant hormones, and is useful in the fields of medicine, agricultural chemicals, fragrances, cosmetics and foods. It is.

It is a figure which shows the expression in Escherichia coli of each enzyme of MVK (58 kDa), PMVK (46 kDa), DPMVDC (42 kDa), IPPI (29 kDa), and FPS (40 kDa). Lane M shows a marker, and the molecular weight of the marker is 97 kDa, 66 kDa, 45 kDa, 31 kDa, 21 kDa, 14 kDa. Lane 1 shows the cells cultured without adding IPTG, and Lane 2 shows the cells induced with expression by adding IPTG.

Claims (6)

Main Baron acid phosphotransferase, phosphotransferase phosphomevalonate, Jihosuhomebaron acid decarboxylase, a gene encoding isopentenyl diphosphate isomerase and farnesyl diphosphate synthase was prepared by expression in a host cell A method for producing farnesyl diphosphate , wherein each enzyme is allowed to act on mevalonic acid in a cell-free system. The mevalonate phosphotransferase, phosphotransferase phosphomevalonate, Jihosuhomebaron acid decarboxylase, a gene encoding isopentenyl diphosphate isomerase and / or farnesyl diphosphate synthase, red Neurospora (Neurospora crassa) The manufacturing method of the farnesyl diphosphate of Claim 1 which is origin. The method for producing farnesyl diphosphate according to claim 2, wherein the red bread mold (Neurospora crassa) is FGSC2489 strain. The method for producing farnesyl diphosphate according to any one of claims 1 to 3 , wherein adenosine triphosphate (ATP) and a magnesium salt are added as cofactors to the cell-free system. The method for producing labeled farnesyl diphosphate according to any one of claims 1 to 4 , wherein the mevalonic acid is labeled mevalonic acid. Prepared by expressing in a host cell genes encoding mevalonate phosphotransferase, phosphomevalonate phosphotransferase, diphosphomevalonate decarboxylase, isopentenyl diphosphate isomerase and farnesyl diphosphate synthase , Enzyme cocktail containing each enzyme .

Images