JP4798521B2 - Sugar phosphorylating agent and sugar phosphorylation method - Google Patents

Description

  The present invention relates to a protein having a novel sugar phosphorylation activity, a nucleic acid encoding the protein, a recombinant vector containing the nucleic acid, and a transformant transformed with the recombinant vector. The present invention also relates to a sugar phosphorylating agent and a sugar phosphorylation method using the protein, nucleic acid, recombinant vector and transformant. Furthermore, the present invention relates to a method for producing a food additive or pharmaceutical additive containing α-sugar monophosphate using the sugar phosphorylating agent.

  Kinase is a general term for enzymes that catalyze the reaction of transferring ATP phosphate, and includes enzymes useful for the production of sugar phosphates. Conventionally, only galactokinase has been known as a kinase that synthesizes a sugar monophosphate (see, for example, Patent Document 1). This enzyme produces α-galactose monophosphate and ADP using galactose and ATP as substrates, but the substrate specificity is relatively strict and does not show the activity to phosphorylate sugars other than galactose. It has been reported that human-derived galactokinase uses not only galactose but also N-acetylgalactosamine as a substrate, but other sugars such as N-acetylglucosamine cannot be phosphorylated at all. Conventionally, an enzyme that catalyzes the conversion of N acetylglucosamine directly to N acetylglucosamine monophosphate has not been discovered, and its synthesis has to use chemical synthesis or multistage enzymatic reactions.

  In addition, sugar monophosphate is a useful substance that is expected to be developed in the future as a food material and a pharmaceutical material (see, for example, Patent Document 2).

  Therefore, it has been desired to develop an enzyme that exhibits a wide range of substrate specificities and catalyzes a sugar phosphorylation reaction with high efficiency.

Japanese National Patent Publication No. 10-506529 Japanese Patent Laid-Open No. 5-95765

  An object of the present invention is to find a novel enzyme having sugar phosphorylation activity, and to use this to efficiently phosphorylate a sugar to produce a sugar monophosphate ester.

  The present inventors have found that the protein encoded by the nucleic acid isolated based on the sequence information of the unidentified gene BL1642 (SEQ ID NO: 1) of Bifidobacterium belongs to sugar phosphorylation activity, that is, sugar 1 Finding that it has the activity of catalyzing the reaction of transferring the phosphate group of ATP to the carbon atom at the position to produce α-sugar monophosphate and ADP, and this activity can be utilized for sugar phosphorylation The present invention has been completed.

That is, the present invention is the following protein (a) or (b):
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 2, or (b) an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 2, And a protein having sugar phosphorylation activity, wherein the protein does not have the amino acid sequence shown in SEQ ID NO: 8.

The present invention also provides the following nucleic acid (a) or (b):
(A) a nucleic acid encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 2, or (b) an amino acid in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 2 A nucleic acid encoding the above protein, which consists of a sequence and has sugar phosphorylation activity, but does not have the amino acid sequence shown in SEQ ID NO: 8.

Furthermore, the present invention is the following nucleic acid (a) or (b):
(A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1, or (b) a nucleic acid comprising a sequence complementary to the base sequence represented by SEQ ID NO: 1 under stringent conditions, and sugar phosphorus A nucleic acid encoding a protein having oxidative activity, provided that the nucleic acid does not have the base sequence shown in SEQ ID NO: 7.

The present invention is also a recombinant vector containing any of the above nucleic acids.
The present invention is a transformant transformed with the above recombinant vector.
The present invention further provides a method for producing a protein having sugar phosphorylation activity, which comprises culturing the transformant and collecting the protein from the obtained culture.

Furthermore, the present invention is a sugar phosphorylating agent comprising at least one of the following (a) to (e):
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 2, and a sugar Protein having phosphorylation activity (b) Nucleic acid encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 2, or one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 are substituted, deleted, inserted or added A nucleic acid encoding the protein having sugar phosphorylation activity (c) a nucleic acid consisting of the base sequence shown in SEQ ID NO: 1, or a sequence complementary to the base sequence shown in SEQ ID NO: 1 A protein that hybridizes under stringent conditions and has sugar phosphorylation activity. Nucleic acid encoding (d) above (b) or transformant which is transformed with a recombinant vector of the recombinant vector (e) (d) above comprising a nucleic acid of (c).

  In the sugar phosphorylating agent, the sugar is not limited, but is at least one selected from the group consisting of hexose, N-acetylhexosamine, and deoxyhexose. More specifically, the sugar is at least one selected from the group consisting of glucose, galactose, mannose, talose, N-acetylglucosamine, N-acetylgalactosamine, N-acetylmannosamine, and 2-deoxyglucose, for example. The sugar phosphorylation activity is, for example, N acetylhexosamine kinase activity.

The protein (a) or the nucleic acid (b) or (c) contained in the sugar phosphorylating agent may preferably be derived from Bifidobacterium longum.
The sugar phosphorylating agent may further contain ATP and / or magnesium.

The present invention also provides a method for producing α-sugar monophosphate, wherein α-sugar monophosphate is produced by reacting sugar with ATP in the presence of any of the above sugar phosphorylating agents. is there.
In the above method, the sugar to be used is at least one selected from the group consisting of hexose, N-acetylhexosamine, and deoxyhexose, although not limited thereto. Specifically, the sugar used is, for example, at least one selected from the group consisting of glucose, galactose, mannose, talose, N-acetylglucosamine, N-acetylgalactosamine, N-acetylmannosamine, and 2-deoxyglucose. .

  Furthermore, the present invention provides an α-sugar monophosphate characterized in that a sugar and ATP are reacted in the presence of any of the above sugar phosphorylating agents to formulate the produced α-sugar monophosphate. Is a method for producing a food additive or pharmaceutical additive containing

  According to the present invention, a sugar phosphorylating agent and a sugar phosphorylation method are provided. Proteins and the like used in the present invention efficiently catalyze the phosphorylation reaction of sugars and have a low sugar substrate specificity, and therefore can phosphorylate all kinds of sugars. Such sugar phosphorylating agents and sugar phosphorylation methods are useful for efficiently producing various α-sugar monophosphates useful in the fields of food processing and pharmaceutical industry, for example.

  Hereinafter, the present invention will be described in detail.

The present invention relates to a protein encoded by a nucleic acid isolated from Bifidobacterium longum JCM 1217 strain based on the sequence information of Bifidobacterium genus function unidentified gene BL1642 (SEQ ID NO: 1). This is based on the knowledge that it has sugar phosphorylation activity. Accordingly, in the sugar phosphorylating agent and the sugar phosphorylation method according to the present invention, at least one of the following (a) to (d) is used:
(A) a protein having sugar phosphorylation activity (b) a nucleic acid encoding a protein having sugar phosphorylation activity (c) a recombinant vector comprising the nucleic acid of (b) above (d) the nucleic acid of (b) above or ( A transformant containing the recombinant vector of c).

  In the present invention, “sugar phosphorylation activity” means an activity that catalyzes a reaction of phosphorylating sugar (producing sugar phosphate) using sugar and ATP as substrates. More specifically, the sugar phosphorylation activity means the activity of catalyzing the reaction of transferring the phosphate group of ATP to the carbon atom at the 1-position of sugar to produce α-sugar monophosphate and ADP. A protein having such an activity has not been reported so far, and therefore the protein according to the present invention is an enzyme having a novel activity.

  Here, the sugar in the sugar phosphorylation reaction is not limited, but hexose (hexose sugar), for example, D- and L-galactose, D-glucose, D-mannose, D-talose and the like; hexosamine ( Compounds 9 in which the hydroxyl group of hexose is substituted with an amino group, such as D-glucosamine, D-galactosamine and D-mannosamine, and their N-acetylated forms (N-acetylglucosamine, N-acetylgalactosamine, N-acetylmannosamine), etc. Hexosylamine (a compound in which the hemiacetal hydroxyl group of hexose is substituted with an amino group); deoxyhexose such as 2-deoxyglucose;

  The base sequence of the nucleic acid encoding the protein according to the present invention is exemplified in SEQ ID NO: 1, and the amino acid sequence of the protein is exemplified in SEQ ID NO: 2. Here, the 541st to 1620th base sequence of SEQ ID NO: 1 is a region encoding a protein.

  In addition, a protein having a sugar phosphorylation activity equivalent to or higher than that of the above-mentioned Bifidobacterium longum JCM 1217 strain is added to another Bifidobacterium longum bacterial strain, Bifidobacterium genus. Although it can be isolated from other bacteria belonging to the genus and bacteria belonging to other genera, and mutants of these bacteria, such a protein has an amino acid sequence slightly different from the amino acid sequence shown in SEQ ID NO: 2. Is expected. Furthermore, in this technical field, even if there are some amino acid mutations in the amino acid sequence, the existence of a protein that retains its activity or function is known.

  Therefore, as long as the protein comprising the amino acid sequence shown in SEQ ID NO: 2 has sugar phosphorylation activity, substitution, deletion, insertion, addition, inversion of a plurality of amino acid sequences, preferably one or several amino acids, is possible. Etc. may occur. The sugar phosphorylation activity is determined by reacting a sugar serving as a substrate with ATP in the presence of a protein having a mutation, and determining the amount of α-sugar monophosphate produced by a method known in the art (for example, a high-speed liquid). Chromatography, high-speed ion exchange chromatography, thin layer chromatography, etc.). Proteins that can be used in the present invention can be prepared from these sequences by chemical synthesis or recombinant techniques according to known methods, or may be isolated from bacteria according to known techniques.

  For example, 1 to 10, preferably 1 to 5 amino acids of the amino acid sequence shown in SEQ ID NO: 2 may be deleted, and 1 to 10 amino acids in the amino acid sequence shown in SEQ ID NO: 2, preferably 1 to Five amino acids may be added, or those in which 1 to 10, preferably 1 to 5 amino acids in the amino acid sequence shown in SEQ ID NO: 2 are substituted with other amino acids are used in the present invention. Can do.

  By the activity of the protein according to the present invention, α-sugar monophosphate having a phosphate group added at the 1-position of the sugar is produced.

  The nucleic acid that can be used in the present invention is obtained by performing PCR (polymerase chain reaction) using a primer prepared based on the nucleotide sequence shown in SEQ ID NO: 1 using DNA prepared from bacteria or a cDNA library thereof. Can be prepared. For example, the target nucleic acid can be isolated using a primer set containing the base sequences shown in SEQ ID NOs: 3 and 4, or a primer set containing the base sequences shown in SEQ ID NOs: 5 and 6. Here, a bacterium that is a source for isolating nucleic acids is a bacterium belonging to the genus Bifidobacterium, such as Bifidobacterium longum, Bifidobacterium bifidum, Bifidobacterium brebe, Bifido Examples thereof include, but are not particularly limited to, bacterial infantis and Bifidobacterium addressestis. Bacteria belonging to the genus Bifidobacterium are preferably used as the source, and Bifidobacterium longum JCM 1217 strain is particularly preferably used as the source.

  In addition, a variant of the nucleic acid according to the present invention having the above function or activity can be synthesized by site-directed mutagenesis. In order to introduce a mutation into a nucleic acid, a known method such as Kunkel method or Gapped duplex method or a method according to this can be employed. For example, mutation is introduced using a commercially available mutation introduction kit using site-directed mutagenesis. In addition, mutation introduction into a nucleic acid and construction of a chimeric gene can be performed by techniques such as error introduction PCR and DNA shuffling. Error introduction PCR and DNA shuffling are techniques known in the art. For example, for error introduction PCR, Chen K, and Arnold FH. 1993, Proc. Natl. Acad. Sci. USA, 90: 5618-5622 See also Stemmer, WP 1994, Nature, 370: 389-391 and Stemmer WP, 1994, Proc. Natl. Acad. Sci. USA 91: 10747-10751 for DNA shuffling.

  Whether or not a recombinant protein produced by a nucleic acid having a mutation has a target function (ie, sugar phosphorylation activity) is determined by expressing the mutant nucleic acid in a transformant and determining the sugar phosphorylation activity of the resulting recombinant protein. As described above, it can be confirmed by measuring by a method known in the art.

  Furthermore, a nucleic acid that hybridizes under stringent conditions with a sequence complementary to all or part of the nucleic acid consisting of the above base sequence and encodes a protein having sugar phosphorylation activity is also used in the present invention. Can do. Stringent conditions refer to conditions in which specific hybrids are formed and non-specific hybrids are not formed. For example, it refers to conditions under which DNA having high homology (homology is 60% or more, preferably 80% or more) hybridizes. Such hybridization conditions are known in the art and are described, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989.

  The recombinant vector used in the present invention can be obtained by ligating (inserting) the nucleic acid into an appropriate vector. The vector used in the present invention is not particularly limited as long as it can replicate in the host. For example, bacteriophage, plasmid, cosmid, phagemid and the like can be mentioned, which may be linear or circular.

  Plasmid DNA includes actinomycete-derived plasmids (eg, pK4, pRK401, pRF31, etc.), E. coli-derived plasmids (eg, pET, pBR322, pBR325, pUC118, pUC119, pUC18, etc.), Bacillus subtilis-derived plasmids (eg, pUB110, pTP5). Etc.), yeast-derived plasmids (eg, YEp13, YEp24, YCp50, etc.) and the like, and phage DNAs include λ phage (λgt10, λgt11, λZAP, etc.).

  In order to insert a nucleic acid into a vector, first, a method in which the purified nucleic acid is cleaved with an appropriate restriction enzyme, inserted into a restriction enzyme site or a multicloning site of an appropriate vector, and linked to the vector is employed.

  The nucleic acid needs to be incorporated into a vector so that the protein of interest is expressed. Therefore, in addition to a promoter and a nucleic acid, a cis element such as an enhancer, a splicing signal, a poly A addition signal, a selection marker, a ribosome binding sequence (SD sequence) and the like can be linked to the vector used in the present invention, if desired. .

  In the present invention, a transformant transformed with the above recombinant vector can be used. The transformant can be obtained by introducing the above recombinant vector into a host so that the target protein can be expressed. Here, the host is not particularly limited, and for example, Bifidobacterium genus such as Bifidobacterium longum, Escherichia genus such as Escherichia coli, Bacillus subtilis (Bacillus subtilis) Bacteria such as Bacillus, Pseudomonas putida, etc., yeasts such as Saccharomyces cerevisiae, Schizosaccharomyces pombe, other animal cells or insect cells .

  When a bacterium such as Escherichia coli is used as a host, it is preferable that the recombinant vector is capable of autonomous replication in the bacterium and at the same time is composed of a promoter, a ribosome binding sequence, the nucleic acid, and a transcription termination sequence. Moreover, the gene which controls a promoter may be contained. Any promoter can be used as long as it can be expressed in a host such as Escherichia coli. The method for introducing a recombinant vector into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. For example, a method using calcium ions (Cohen, S.N. et al .: Proc. Natl. Acad. Sci., USA, 69: 2110-2114 (1972)), electroporation method and the like can be mentioned.

  When yeast is used as a host, the promoter is not particularly limited as long as it can be expressed in yeast. The method for introducing a recombinant vector into yeast is not particularly limited as long as it is a method for introducing DNA into yeast. For example, electroporation (Becker, DM et al., Methods. Enzymol. 194, 182-287 (1990) ), Spheroplast method (Hinnen, A. et al., Proc. Natl. Acad. Sci., USA, 75,1929-1933 (1978)), lithium acetate method (Itoh, HJ Bacteriol., 153,163-168 ( 1983)).

  When using animal cells as a host, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells, rat GH3, PC12 or NG108-15 cells, or human FL, HEK293, HeLa or Jurkat cells Etc. are used. As the promoter, SRα promoter, SV40 promoter, LTR promoter, β-actin promoter and the like may be used, and human cytomegalovirus early gene promoter and the like may be used. Examples of methods for introducing a recombinant vector into animal cells include an electroporation method, a calcium phosphate method, and a lipofection method. When insect cells are used as hosts, Sf9 cells, Sf21 cells and the like are used. As a method for introducing a recombinant vector into insect cells, for example, calcium phosphate method, lipofection method, electroporation method and the like are used.

  Since the transformant obtained as described above produces a protein having sugar phosphorylation activity, it can be used for the production of such a protein or itself for sugar phosphorylation.

  The protein that can be used in the present invention can be obtained by culturing the transformant and collecting it from the culture. “Culture” means any of culture supernatant, cultured cells, cultured cells, or disrupted cells or cells. The method of culturing the transformant is performed according to a usual method used for culturing a host.

  A medium for culturing transformants obtained using microorganisms such as Escherichia coli and yeast as a host contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the microorganisms, and efficiently cultures the transformants. As long as the medium can be used, either a natural medium or a synthetic medium may be used. Examples of the carbon source include carbohydrates such as glucose, fructose, sucrose, and starch, organic acids such as acetic acid and propionic acid, and alcohols such as ethanol and propanol. Examples of the nitrogen source include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor, and the like. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.

The culture is usually performed at 36 to 37 ° C. for 10 to 48 hours, preferably for 1 day under aerobic conditions such as shaking culture or aeration and agitation culture.
Examples of a medium for culturing a transformant obtained using animal cells as a host include generally used RPMI 1640 medium, DMEM medium, or a medium obtained by adding fetal calf serum or the like to these mediums. The culture is usually performed at 37 ° C. for 40 to 48 hours in the presence of 5% CO ₂ .

  When the target protein is produced in the cells or cells after culturing, the protein is collected by crushing the cells or cells by performing ultrasonic treatment, repeated freeze-thawing, homogenizer treatment, and the like. When the protein is produced outside the cells or cells, the culture solution is used as it is, or the cells or cells are removed by centrifugation or the like. Thereafter, by using general biochemical methods used for protein isolation and purification, such as ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc. alone or in appropriate combination, From the above, the protein of the present invention can be isolated and purified.

  In the sugar phosphorylating agent and the sugar phosphorylation method according to the present invention, any of the above-described proteins, nucleic acids, recombinant vectors, and transformants can be used. Further, for example, one kind of protein may be used alone, or a plurality of kinds of proteins may be used, and the same applies to nucleic acids, recombinant vectors, and transformants.

  The form of the sugar phosphorylating agent according to the present invention is not particularly limited, and the protein, nucleic acid or recombinant vector is used as it is or as a solution by dissolving or suspending them in an appropriate solvent, or these are powdered. Alternatively, it can be prepared as a tablet, and further can be prepared as a lyophilized product. The transformant may be a transformant isolated from a culture, the culture itself, a culture dilution, a disrupted culture, or a culture supernatant.

  Examples of the sugar that is phosphorylated by the sugar phosphorylating agent and the sugar phosphorylation method according to the present invention include hexose (hexose sugar) such as D- and L-galactose, D-glucose, D-mannose, and D-talose. Hexosamine (compound 9 in which the hydroxyl group of hexose is substituted with an amino group, such as D-glucosamine, D-galactosamine and D-mannosamine, and their N-acetyl forms (N acetylglucosamine, N acetylgalactosamine, N acetyl manno); Hexosylamine (a compound in which the hemiacetal hydroxyl group of hexose is substituted with an amino group), deoxyhexose, such as 2-deoxyglucose, etc. In addition, sugar derivatives and analogs exemplified above, and these It is also possible to phosphorylate a mixture of sugars .

  Sugar phosphorylation can be performed by reacting sugar with ATP (or GTP or ITP) in the presence of the sugar phosphorylating agent described above. By sugar phosphorylation reaction, sugar is converted into α-sugar monophosphate.

  The amount of sugar phosphorylating agent to be used, reaction time, reaction conditions, etc. can be obtained in consideration of the type of sugar phosphorylating agent to be used, the amount of sugar as a substrate, the amount of ATP, etc. Can be determined. The concentration of the phosphorylated saccharide is not particularly limited, but is 0.01 mM or more and 4M or less, preferably 1 mM or more and 3M or less. The amount of ATP is not particularly limited, but is 2 equivalents or less, preferably 1.2 equivalents or less of the sugar to be phosphorylated.

  Furthermore, in order to perform the sugar phosphorylation reaction more efficiently, an additional component may be used in the sugar phosphorylation agent and the sugar phosphorylation reaction according to the present invention. Such additional components include, but are not limited to magnesium and / or cobalt. The amount of such additional components can be easily determined by those skilled in the art. For example, the magnesium concentration is preferably 0.001 mM to 1 M, more preferably 0.01 mM to 10 mM, and still more preferably 0.1 mM to 5 mM.

  As described above, by reacting sugar and ATP in the presence of the sugar phosphorylating agent according to the present invention, sugar can be efficiently phosphorylated to produce α-sugar monophosphate.

  Since α-sugar monophosphate can be used for improving the taste or as a calcium retention agent, it is preferably blended in a food additive or a pharmaceutical additive. Therefore, it is possible to produce a food additive or pharmaceutical additive containing α-sugar monophosphate by formulating the α-sugar monophosphate produced as described above as an additive. . Formulation can be easily performed according to a formulation method known in the art, together with additives, preservatives, excipients and the like known in the art. Further, α-sugar monophosphate can be used as a starting material for enzymatic synthesis of various oligosaccharides.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.

Based on the genome information of Bifidobacterium longum (function unidentified gene BL1642), the following forward primer and reverse primer respectively adjacent to the target ORF were prepared:
Forward primer: GTGGTGCCGGACCACTTCATCACC (SEQ ID NO: 3)
Reverse primer: GAAGAGGGCGAAGATTTGGTTGCGGGTCCA (SEQ ID NO: 4).

  The above primers were used in combination, and the Bifidobacterium longum JCM 1217 strain genomic DNA prepared using Instagene (manufactured by Bio-Rad) was used as a template and amplified by PCR reaction. As a result, a clear band of about 1790 bp was obtained.

  When the obtained band was cloned and analyzed by a DNA sequencer, the DNA base sequence shown in SEQ ID NO: 1 was obtained. When this DNA base sequence was translated into amino acids, a 1080 bp open reading frame (ORF) (SEQ ID NO: 2) homologous to the gene derived from Bifidobacterium longum was observed.

Next, in order to confirm the activity of the proteins encoded by these ORFs, a gene expression system using E. coli was constructed. Specifically, using the primers (see below) prepared at the 5 ′ and 3 ′ ends of the ORF, the full length of the ORF was amplified by PCR using the genomic DNA of Bifidobacterium longum JCM 1217 as a template:
Forward primer: AACGGACCCCATATGACCGAAAGCAATGAAGTTTTATTC (SEQ ID NO: 5)
Reverse primer: GCTGACCTCGAGCCTGGCAGCCTCCATGATGTCGGCTAC (SEQ ID NO: 6).

  The PCR product was digested with restriction enzymes NcoI and XhoI, and then ligated to a commercially available gene expression plasmid pET (manufactured by Novagen) similarly treated using a DNA ligation kit (manufactured by Takara Shuzo Co., Ltd.). Furthermore, according to the method described in Sambrook, J., Fritsch, EF and Maniatis, T. "Molecular Cloning, A Laboratory Manual 2nd Edition" 1.74 Vo1.1 (1989) using these plasmids. Was transformed.

  Using the transformant obtained as described above, expression of the gene and production of a recombinant protein were performed according to a conventional method. The obtained recombinant protein was purified by column chromatography using Ni-NTA agarose (Qiagen) to obtain a purified enzyme preparation.

  Using the purified enzyme preparation obtained in Example 1, N-acetylhexosamine kinase activity was confirmed by the method shown below.

  A standard reaction solution consisting of 0.1 M Tris buffer (pH 8.5), 1 mM N acetylglucosamine, 1 mM ATP, 1 mM magnesium chloride and an appropriately diluted enzyme solution is reacted at 30 ° C. for 30 minutes and then heated at 100 ° C. for 30 minutes. Then, the reaction was stopped, and the produced α-N acetylglucosamine monophosphate was separated by an anion exchange column, and then measured using a pulsed amperometry detector (manufactured by Dionex).

As a result, recombinant N-acetylhexosamine kinase was confirmed to produce α-N-acetylglucosamine monophosphate when N-acetylglucosamine and ATP were used as substrates, and the cloned gene was confirmed to be the N-acetylhexosamine kinase gene. . At this time, the Km value was 0.12 mM, and the k0 value was 1.85 sec ⁻¹ .

  Regarding the N-acetylhexosamine kinase activity of the isolated protein, the optimum pH is 8.5 (FIG. 1), the pH stability is from pH 5 to 9.5 after treatment at 30 ° C. for 30 minutes (FIG. 2), The optimum reaction temperature is 40 ° C. (FIG. 3), and the temperature stability is 30 ° C. after 30 minutes treatment (FIG. 4). Further, magnesium ions are required for the catalytic reaction, and cobalt ions are 20% active. Moreover, when the activity with respect to ATP as a donor substrate is 100%, GTP and ITP have 44% and 32% activity.

  Furthermore, as an acceptor-side substrate, when the activity with respect to N acetylglucosamine is 100%, 60, 15, 3 for N acetylgalactosamine, N acetylmannosamine, talose, mannose, 2 deoxyglucose, glucose and galactose, respectively. 1.5, 0.5, 0.1, and 0.01%, and the production of α-sugar monophosphate of each substrate was confirmed.

  From the above results, a protein having sugar phosphorylation activity showing a wide range of sugar substrate specificities was found. Further, in Bifidobacterium longum JCM 1217 strain, it was confirmed that a protein-coding region was present between the 541th and 1620th positions in the base sequence represented by SEQ ID NO: 1.

  According to the present invention, a sugar phosphorylating agent and a sugar phosphorylation method are provided. Proteins and the like used in the present invention efficiently catalyze the phosphorylation reaction of sugars and have a low sugar substrate specificity, and therefore can phosphorylate all kinds of sugars. Such sugar phosphorylating agents and sugar phosphorylation methods are useful for efficiently producing various α-sugar monophosphates useful in the fields of food processing and pharmaceutical industry, for example.

It is a graph which shows the optimal pH of an enzyme. It is a graph which shows the pH stability of an enzyme. It is a graph which shows the optimal temperature of an enzyme. It is a graph which shows the temperature stability of an enzyme.

  SEQ ID NOs: 3-6: Synthetic oligonucleotides

Claims (6)

A sugar phosphorylating agent comprising at least one of the following (a) to ( d ) , wherein the sugar is glucose, mannose, talose, N-acetylglucosamine, N-acetylgalactosamine, or N-acetylmannosamine And the sugar phosphorylating agent, which is at least one selected from the group consisting of 2-deoxyglucose .
(A) a protein comprising the amino acid sequence shown in SEQ ID NO: 2, or an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added in the amino acid sequence shown in SEQ ID NO: 2, and a sugar Protein having phosphorylation activity (b) Nucleic acid encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 2, or one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2 are substituted, deleted, inserted or added A nucleic acid encoding a protein having a sugar phosphorylation activity ( c ) and a recombinant vector comprising the nucleic acid of (b) above ( d ) transformed with the recombinant vector of ( c ) above Transformant The sugar phosphorylating agent according to claim 1 , wherein the sugar phosphorylation activity is N acetylhexosamine kinase activity. The sugar phosphorylating agent according to claim 1 or 2 , wherein the protein (a) or the nucleic acid (b) is derived from Bifidobacterium longum. Furthermore, the sugar phosphorylating agent of any one of Claims 1-3 containing ATP and / or magnesium. It consists of glucose, mannose, talose, N-acetylglucosamine, N-acetylgalactosamine, N-acetylmannosamine, and 2-deoxyglucose in the presence of the sugar phosphorylating agent according to any one of claims 1 to 4. A method for producing α-sugar monophosphate, comprising reacting at least one sugar selected from the group with ATP to produce α-sugar monophosphate. It consists of glucose, mannose, talose, N-acetylglucosamine, N-acetylgalactosamine, N-acetylmannosamine, and 2-deoxyglucose in the presence of the sugar phosphorylating agent according to any one of claims 1 to 4. A food additive or pharmaceutical additive containing α-sugar monophosphate, characterized in that at least one sugar selected from the group is reacted with ATP to formulate the produced α-sugar monophosphate. Manufacturing method.

Images