JP4742272B2 - Non-human animal in which the function of GsdmA gene is suppressed and the function of canceration-related gene is promoted or suppressed - Google Patents

Description

  The present invention relates to a non-human animal and animal cell in which the function of the GsdmA gene is suppressed and the function of a canceration-related gene is promoted or suppressed, and a method for screening a compound that complements the phenotype of the non-human animal or the animal cell. .

Analysis using a mutant mouse is a very powerful analysis method in understanding gene functions, development, human diseases such as cancer. Recently the present inventors have found that the growth and differentiation of epithelial cells, focusing on such hair formation and regeneration, and analyzed using mutant mice such Rim3, Re ^den, Re. Re is a spontaneously mutated mouse found by Crew and Auerbach in 1939, and exhibits a curled wrinkle and hair phenotype (Non-Patent Documents 1 and 2). Recombinant-induced mutation-3 (Rim3) and Re ^den are spontaneously mutated mice found in 1983 and 1968 in B10.BR (R228) and B10.129 congenic strains, respectively. , Epithelial hyperproliferation, hyperkeratinization and hair loss (Non-Patent Documents 1, 3, 4). From the results of linkage analysis, Rim3 and Re ^den are considered to be alleles of Re (Non-patent Document 4). These mutations are located on mouse chromosome 11 and in humans correspond to a closely related region of cancer called 17q12 amplicon on chromosome 17.

  Chromosome instability is well studied in human carcinogenesis. For example, partial deletion or amplification of chromosomes and translocation are phenomena that are remarkably observed in cancer cells. These genome rearrangements are caused by DNA double strand break down, and as a result, are thought to lead to amplification of oncogenes and deletion of tumor suppressor genes (Non-Patent Document 5).

  Amplification of human chromosome 17 long arm, 17q12 amplicon, is often observed in breast cancer, stomach cancer, ovarian cancer, bladder cancer, and uterine cancer. The proto-oncogene erbB2 is located in this region, and it has been reported that the number of copies per genome is amplified with canceration, and is overexpressed in about 20% of breast cancer and gastric cancer ( Non-Patent Documents 6 and 7). In the process of structural analysis of 17q12 amplicon, the present inventors have confirmed that the region where CAB1 / MLN64, CAB2, ERBB2, and GRB7 are located in this region is generally or mainly amplified in canceration. I found it. In addition, it was reported that gasdermin (renamed as mouse gasdermin A-1) was present in a region homologous to human 17q12 amplicon in mice (Non-patent Document 8).

Prior art document information related to the invention of the application is shown below.
Lyon MF, Rostan S. and Brown SDM Genetic Variants and Strains of the Laboratory Mouse.3rd edition (Oxford Univ. Press, Oxford, 1996) Crew, FAE and Auerbach, C. (1939) Rex: a dominant autosomal monogenic coat texture character in the mouse.J. Genet. 38, 341-344. Snell, GD, and Bunker, HP (1968) Mouse News Lett. 39. 28. Sato, H., Koide, T., Masuya, H., Wakana, S., Sagai, T., Umezawa, A., Ishiguro, S., Tama, M., and Shiroishi, T. (1998) A new mutation Rim3 resembling Re (den) is mapped close to retinoic acid receptor alpha (Rara) gene on mouse chromosome 11.Mamm Genome.; 9 (1), 20-25. Coquelle, A., Pipiras, E., Toledo, F., Buttin, G., and Debatisse, M. (1997). Expression of fragile sites triggers intrachromosomal mammalian gene amplification and sets boundaries to early amplicons.Cell 89, 215- 225. van de Vijver, M., van de Bersselaar, R., Devilee, P., Cornelisse, C., Peterse, J, and Nusse, R. (1987). Amplification of the neu (c-erbB-2) oncogene in human mammary tumors is relatively frequent and is often accompanied by amplification of the linked c-erbA oncogene. Mol. Cell. Biol. 7, 2019-2023. Yokota, J., Yamamoto, T., Miyajima, N., Toyoshima, K., Nomura, N., Sakamoto, H., Yoshida, T., Terada, M., and Sugimura, T. (1988). Genetic alterations of the c-erbB-2 oncogene occur frequently in tubular adenocarcinoma of the stomach and are often accompanied by amplification of the v-erbA homologue.Oncogene 2, 283-287. Saeki, N., Kuwahara, Y., Sasaki, H., Satoh H., and Shiroishi, T. Gasdermin (Gsdm) localizing to mouse chromosome 11 is predominantly expressed in upper gastrointestinal tract but significantly suppressed in human gastric cancer cells. Genome., 11 (9): 718-724, 2000.

  The inventors of the present invention have found that the causative gene of Recombinant-induced mutation 3 (Rim3) found in the National Institute of Genetics / Mammalian Genetic Laboratory is a GasderminA cluster (hereinafter referred to as GsdmA) that exists as a cluster on mouse chromosome 11. It was clarified that it is GasderminA-3 (hereinafter referred to as GsdmA3), which is one gene in the cluster (PCT / JP03 / 02345). Rim3 is a dominant spontaneous mutant mouse exhibiting a phenotype of epithelial cell proliferation abnormality, differentiation abnormality, hyperkeratosis, and hair loss. Considering that the causative gene of this mutant mouse is GsdmA3, it is speculated that the function of GsdmA3 is deeply involved in cell proliferation / differentiation and hair formation in the epithelium. On the other hand, the human homologous gene of the mouse GsdmA cluster is a human GasderminA (hereinafter referred to as GSDMA) gene present on human chromosome 17. The mouse GsdmA cluster is composed of three genes, GsdmA1 (GasderminA-1), GsdmA2 (GasderminA-2), and GsdmA3, whereas in humans, only the GSDMA gene is present on chromosome 17. The region of GsdmA cluster on mouse chromosome 11 and the region of human chromosome 17 GSDMA are very well conserved. In particular, this region where GSDMA of human chromosome 17 is present is called 17q12 amplicon, and it is known that genome amplification is observed in skin cancer, esophageal cancer, stomach cancer, breast cancer, etc. It is thought to be related.

  The present inventors have clarified that the human GSDMA gene has the ability to suppress cancer in gastric cancer and esophageal cancer. On the other hand, the tumor suppressive ability of the mouse GsdmA cluster gene was unknown (PCT / JP03 / 02345).

  Gli-2 and ΔLef-1 transgenic mice are a transgenic mouse that expresses the Gli-2 gene under the control of the keratin 14 promoter, and a gene in which the N-terminal region of the Lef-1 protein is deleted under the control of the keratin 14 promoter. It is a transgenic mouse expressing (ΔLef-1). A very interesting point in these two types of skin cancer model animals is their carcinogenic sites. Gli-2, ΔLef-1 transgenic mice develop skin cancers in the ears, limbs, tail, eye edges, etc. (Grachtchouk et al., Nat Genet, 24, 216-217, 2000 .; Niemann et al. , Development, 129, 95-109, 2002.). These positions are all regions with little body hair. From this, the present inventors speculated that in these transgenic animals, GsdmA3 or GsdmA1 may suppress the occurrence of cancer in the region where hair is present.

  The present invention has been made based on the above considerations, and an object of the present invention is to create a non-human animal in which the function of the GsdmA gene indicating a cancer phenotype is suppressed, and to provide the non-human animal and its use There is.

The present inventors introduced a knockout allele of Trp53 (p53), which is known as a tumor suppressor gene, into Rim3 having a mutation in GsdmA3, and GsdmA-3 ^Rim3 / +; Trp53 ⁻ / + individuals (hereinafter referred to as Rim3 heterozygous p53 knockout heterozygous individuals) were prepared. As a result, multiple squamous cell carcinomas of the skin occurred spontaneously from 7 months after birth, and similar squamous cell carcinomas were observed in over 80% of individuals at 12 months of age. Furthermore, the cancer cells were found to metastasize to lymph nodes, and the present invention was completed.

That is, the present invention provides the following [1] to [16].
[1] A non-human animal in which the function of a GsdmA gene is suppressed and the function of a canceration-related gene is promoted or suppressed.
[2] The canceration-related gene is at least one gene selected from the group consisting of Trp53 gene, Rb gene, Ras gene, Cyclin-D gene, Cdk gene, TNF-α gene, and TGF-β gene. [1] The non-human animal according to [1].
[3] The non-human animal according to [1] or [2], which is a model animal for cancer.
[4] A mouse in which the function of at least one gene selected from the group consisting of the GsdmA1 gene, the GsdmA2 gene and the GsdmA3 gene is suppressed, and the function of a canceration-related gene is promoted or suppressed.
[5] The canceration-related gene is at least one gene selected from the group consisting of Trp53 gene, Rb gene, Ras gene, Cyclin-D gene, Cdk gene, TNF-α gene, and TGF-β gene. [4] The mouse according to [4].
[6] A mouse in which the functions of the GsdmA3 gene and the Trp53 gene are suppressed.
[7] The mouse according to any one of [4] to [6], which is a cancer model animal.
[8] The mouse according to [7], wherein the cancer is skin cancer.
[9] An animal cell in which the function of a GsdmA gene is suppressed and the function of a canceration-related gene is promoted or suppressed.
[10] A mouse cell in which the function of at least one gene selected from the group consisting of the GsdmA1 gene, the GsdmA2 gene and the GsdmA3 gene is suppressed, and the function of a canceration-related gene is promoted or suppressed.
[11] The canceration-related gene is at least one gene selected from the group consisting of Trp53 gene, Rb gene, Ras gene, Cyclin-D gene, Cdk gene, TNF-α gene, and TGF-β gene. [9] The cell according to [10].
[12] A mouse cell in which the functions of the GsdmA3 gene and the Trp53 gene are suppressed.
[13] A cell established from the non-human animal according to [1] or [2] or the mouse according to any of [4] to [6].
[14] The phenotype of the non-human animal according to [1] or [2] or the mouse according to any of [4] to [6], comprising the following steps (a) to (c): Complementary compound screening method.
(A) a step of administering to the non-human animal according to [1] or [2] or the mouse according to any of [4] to [6] (b) a step of measuring the phenotype of the non-human animal ( c) a step of selecting a compound that complements the phenotype as compared with the case where no test compound is administered [15] including the following steps (a) to (c): [9] to [13] A method for screening a compound that complements the phenotype of an animal cell according to any one of the above.
(A) a step of bringing the test compound into contact with the animal cell according to any one of [9] to [13] (b) a step of measuring the phenotype of the cell (c) And [16] an antibody that binds to the protein according to any one of the following (a) to (e):
(A) a protein encoded by DNA comprising the base sequence described in any one of SEQ ID NOs: 1, 3, 5, and 7 (b) an amino acid sequence described in any one of SEQ ID NOs: 2, 4, 6, and 8 A protein (c) consisting of the amino acid sequence of SEQ ID NO: 2, 4, 6, or 8, wherein one or more amino acids are substituted, deleted, inserted, and / or added to the naturally occurring amino acid sequence. A protein that is functionally equivalent to a protein consisting of the amino acid sequence set forth in any one of SEQ ID NOs: 2, 4, 6, and 8 (d) in any of SEQ ID NOs: 1, 3, 5, and 7 A protein encoded by a naturally derived DNA that hybridizes under stringent conditions with a DNA comprising the described base sequence, wherein the amino acid sequence according to any one of SEQ ID NOs: 2, 4, 6, 8 Ranaru functionally equivalent to a protein (e) (a) ~ (d) partial protein of the protein of any one of

It is a photograph which shows the expression of the GSDMA gene in a skin cancer cell line. As a result of examining the expression of GSDMA gene in normal skin tissue and skin cancer tissue by RT-PCR, the expression of GSDMA gene was completely lost in cancer cell lines. It is a schematic diagram of the production method of Rim3 hetero-p53 knockout hetero mice. Rim3 hetero individual (GsdmA3 ^Rim3 / +) and terrorism individuals to p53 knockout (Trp53 ^- / +) by multiplying the, carried out terrorism to Rim3 hetero · p53 knockout, Rim3 hetero, terrorism to p53 knockout, the production of normal mouse individual It was. Rim3 Teromausu to hetero · p53 knockout; ^- is a graph showing the development of skin cancer in ^{(GsdmA3 Rim3 / + Trp53 / +} ). In Rim3 heterozygous p53 knockout hetero mice, skin cancer spontaneously developed from 6 months of age. At 12 months of age, multiple skin cancers were observed in more than 80% (17/21) of Rim3 heterozygous p53 knockout hetero mice. In other genotypes of mice, skin cancer was observed only in Rim3 hetero (GsdmA3 ^Rim3 / +; Trp53 + / +), but the rate was as low as 10% (2/19). N on the right side of the graph indicates the number of individuals of each genotype mouse used in the experiment. It is a photograph showing skin cancer in Rim3 hetero-p53 knockout hetero mice. A: Image of Rim3 hetero-p53 knockout heteromouse that developed skin cancer. The white line in the figure indicates the section plane at B. B: Overall view of skin cancer section. C: Enlarged view of C region in B (non-cancerous part). D: Enlarged view of the D region in B (cancerous part). Rim3 heterozygous p53 knockout heteromouse skin cancer showed typical squamous cell carcinoma. E: Skin cancer cells in Rim3 hetero-p53 knockout hetero mice metastasized to regional lymph nodes, causing epithelial structure and hyperkeratosis within the lymph nodes. It is a photograph which shows the specificity of an anti- GsdmA / GSDMA polyclonal antibody. The antigen specificity of the anti-GsdmA / GSDMA polyclonal antibody was verified by Western blotting. As a result, in a normal skin sample, a single band was detected in the vicinity of the expected molecular weight of 50 kDalton of GsdmA / GSDMA, indicating the antigen specificity of the anti-GsdmA / GSDMA polyclonal antibody. A indicates a molecular weight marker, and B indicates a normal skin sample. It is a photograph showing disappearance of GsdmA protein in Rim3 hetero-p53 knockout heteromouse skin cancer. A is a non-cancerous part, C is a hematoxylin / eosin stained image of a cancerous part. B and D are stained images with the GsdmA antibody of adjacent sections of A and C, respectively. In non-cancerous B, localization of GsdmA (1/3) protein is observed from spinous cells, whereas in typical squamous cell carcinoma cells (* area in FIGS. C and D), GsdmA ( 1/3) Protein disappeared. It is a photograph which shows the expression of GSDMA protein in human skin and skin cancer. The GSDMA protein is expressed in normal skin (A) as well as normal hair follicles (B) like the mouse GsdmA protein. Further, in human squamous cell carcinoma cells (C) and basal cell carcinoma cells (D), the expression of GSDMA protein was lost as in Rim3 hetero-p53 knockout hetero skin cancer cells.

  In the present invention, the function of the GsdmA gene is suppressed, and the function of the canceration-related gene (cancer suppressor gene other than the oncogene and GsdmA gene) is promoted or suppressed, that is, the function of the GsdmA gene is suppressed. A non-human animal in which the function of an oncogene is promoted or a non-human animal in which the function of a GsdmA gene is suppressed and the function of a cancer suppressor gene is suppressed is provided.

  The GsdmA gene in the non-human animal of the present invention is as follows: 1) If the non-human animal is a mouse, at least one gene selected from the group consisting of GsdmA1 gene, GsdmA2 gene, GsdmA3 gene, and mutants thereof; ) If the non-human animal is a non-human animal other than a mouse, a homologue of the GsdmA1 gene, GsdmA2 gene, GsdmA3 gene, or GSDMA gene can be exemplified, and if there are multiple GsdmA genes such as a mouse, Examples include at least one gene selected from the group consisting of genes.

  Examples of the biological function of GsdmA1, GsdmA2, GsdmA3, or GSDMA include a function of suppressing abnormal cell growth or differentiation, a function of inducing apoptosis, a function of suppressing epithelial hyperproliferation, hyperkeratinization, and hair loss. The biochemical functions of GsdmA1, GsdmA2, GsdmA3, or GSDMA include binding between gas dermin families, phosphorylation of GsdmA cluster by growth differentiation control proteins, modification of sugar chains, protein transport to the nucleus, cell membrane Localization, extracellular secretion and the like.

In the non-human animal of the present invention, the function of one or more canceration-related genes may be promoted or suppressed.
The canceration-related genes of the present invention include those known to those skilled in the art. For example, the oncogene is Ras (Harvey rat sarcoma virus oncogene 1 (Hras1): h-ras) (mouse: NM_008284). , Human: NM_005343), Cyclin-D (cyclin D1 (Ccnd1)) (mouse: NM_007631, human: BC000076), Cdk (cyclin-dependent kinase 2: Cdk2) (mouse: BC005654, human: BC003065), as a tumor suppressor gene Trp53, Rb (retinoblastoma 1 (Rb1): Retinoblastoma) (mouse: NM_009029, human: NM_000321), TNF-α (tumor necrosis factor) (mouse: NM_013693, human: NM_000594), TGF-β (transforming growth factor, beta 1) (mouse: BC013738, human: NM_000660), preferably Trp53.

  Moreover, as the canceration-related gene in the non-human animal of the present invention, 1) if the non-human animal is a mouse, for example, mouse Trp53 gene, mouse Rb gene, mouse Ras gene, mouse Cyclin-D gene, mouse Cdk gene , Mouse TNF-α gene, mouse TGF-β gene, and at least one gene selected from the group consisting of these mutants. 2) If the non-human animal is a non-human animal other than a mouse, for example, mouse Trp53 Genes such as genes (others include mouse Rb gene, mouse Ras gene, mouse Cyclin-D gene, mouse Cdk gene, mouse TNF-α gene, mouse TGF-β gene, human Trp53 gene, human Rb gene, human Ras gene And at least one gene selected from the group consisting of homologues of human Cyclin-D gene, human Cdk gene, human TNF-α gene, human TGF-β gene).

  The biological functions of mouse Trp53 or human Trp53 include its ability to suppress cancer (DNA repair, cell cycle, etc.) activated in response to various stresses such as DNA damage, telomere shortening, abnormal growth signals, and active oxygen. Stop, induction of apoptosis, etc.). The biochemical functions of mouse Trp53 or human Trp53 include binding to DNA, binding to other cancer-related genes, and the like.

  Biological functions of mouse Rb or human Rb include cell cycle control, apoptosis control, transcriptional regulation, and biochemical functions include binding to DNA and binding to E2F protein.

  Biological functions of mouse Ras or human Ras include cell cycle control, and biochemical functions include binding to GTP and GTPase activity.

  Biological functions of mouse Cyclin-D or human Cyclin-D include cell cycle control, and biochemical functions include binding to Cdk4 and Cdk6 and phosphorylation of Rb protein.

  Biological functions of mouse Cdk or human Cdk include cell cycle control, and biochemical functions include binding to Cyclin-E and phosphorylation of Rb protein.

  Biological functions of mouse TNF-α or human TNF-α include cell growth control, apoptosis induction, and biochemical functions include binding to a TNF receptor.

  Biological functions of mouse TGF-β or human TGF-β include cell growth control, apoptosis induction, and biochemical functions include binding to TGF-β receptor.

  The “non-human animal” in the present invention means a vertebrate or invertebrate that does not include humans. Examples of the non-human animal in the present invention include non-human mammals, birds, insects and the like, and more preferably non-human mammals such as rodents such as mice and rats, monkeys, pigs, Examples include cattle.

  The non-human animal of the present invention is useful as a model animal for cancer. Examples of cancer include skin cancer, laryngeal cancer, tongue cancer, esophageal cancer, stomach cancer, breast cancer, colon cancer, ovarian cancer, bladder cancer, uterine cancer, pancreatic cancer, kidney cancer, lung cancer, melanoma, leukemia, etc. It is not limited to.

  For example, a mouse in which the function of the GsdmA3 gene expressed in the skin is suppressed develops skin cancer. Specifically, mice in which the functions of the GsdmA3 gene and Trp53 gene are suppressed frequently spontaneously develop skin cancer frequently and metastasize to lymph nodes (Example 2). In addition, the GsdmA1 gene is expressed in the skin, esophagus, and frontal stomach (these are all squamous epithelium). Therefore, it is considered that mice in which the functions of the GsdmA1 gene and the Trp53 gene are suppressed develop cancer in the skin, the esophagus, and the front stomach. In addition, the GsdmA2 gene is expressed in the glandular epithelium of the stomach. Therefore, it is considered that mice in which the functions of the GsdmA2 gene and the Trp53 gene are suppressed develop gastric cancer. Moreover, it is thought that the mouse | mouth in which the function of the several gene and Trp53 gene among GsdmA1, GsdmA2, and GsdmA3 is suppressed develops the said various cancer.

  The present invention also provides an animal cell in which the function of a GsdmA gene is suppressed and the function of a canceration-related gene is promoted or suppressed, that is, an animal cell in which the function of a GsdmA gene is suppressed and the function of an oncogene is promoted. Or an animal cell in which the function of the GsdmA gene is suppressed and the function of the tumor suppressor gene is suppressed. Such cells are useful as cancer model cells.

  As GsdmA in the animal cell of the present invention, 1) if the animal cell is a human cell, at least one gene selected from the group consisting of a GSDMA gene and a mutant of the gene, and 2) whether the animal cell is a mouse cell For example, GsdmA1 gene, GsdmA2 gene, GsdmA3 gene, and at least one gene selected from the group consisting of these mutants. 3) If the animal cell is a cell other than human or mouse, GsdmA1 gene, GsdmA2 gene, GsdmA3 A gene or a homologue of the GSDMA gene can be exemplified. When a plurality of GsdmA genes are present as in a mouse, at least one gene selected from the group consisting of the plurality of genes can be exemplified.

In the animal cell of the present invention, the function of one or more canceration-related genes may be promoted or suppressed.
As the canceration-related gene in the animal cell of the present invention, 1) If the animal cell is a human cell, human Trp53 gene, human Rb gene, human Ras gene, human Cyclin-D gene, human Cdk gene, human TNF-α A gene, a human TGF-β gene, and at least one gene selected from the group consisting of these mutants. 2) If the animal cell is a mouse cell, for example, mouse Trp53 gene, mouse Rb gene, mouse Ras gene, Mouse Cyclin-D gene, mouse Cdk gene, mouse TNF-α gene, mouse TGF-β gene, and at least one gene selected from the group consisting of these variants, 3) cells other than human or mouse cells Then, for example, a gene such as mouse Trp53 gene (in addition to mouse Rb gene, mouse Ras gene, mouse Cyclin-D gene, mouse Cdk gene, mouse TNF-α gene, Mouse TGF-β gene, human Trp53 gene, human Rb gene, human Ras gene, human Cyclin-D gene, human Cdk gene, human TNF-α gene, human TGF-β gene) at least selected from the group consisting of homologs One gene can be exemplified.

  The present invention also provides a method for suppressing the function of the GsdmA gene in a non-human animal or animal cell and promoting the function of the oncogene, or a method for suppressing the function of the GsdmA gene and suppressing the function of the cancer suppressor gene. provide. Cancer is thought to develop when mutations accumulate in many canceration-related genes. Therefore, non-human animals or animal cells can be cancerized by suppressing the function of GsdmA gene and promoting or suppressing the function of canceration-related genes.

  In the present invention, the base sequences of DNAs encoding GsdmA1, GsdmA2, GsdmA3, GSDMA, mouse Trp53 and human Trp53 are represented by SEQ ID NOs: 1, 3, 5, 7, 9 and 11, respectively, and the proteins encoded by the DNA Are shown in SEQ ID NOs: 2, 4, 6, 8, 10, and 12, respectively.

Further, GsdmA1, GsdmA2, GsdmA3, GSDMA, mouse Trp53, mutants, variants, and homologues of human Trp53 are shown in the following (a) or (b).
(A) a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12. And a protein functionally equivalent to the protein consisting of the amino acid sequence of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12 (b) SEQ ID NOs: 1, 3, 5, 7, 9 , 11 is a protein encoded by DNA that hybridizes under stringent conditions with DNA comprising the base sequence of any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12 A protein functionally equivalent to the protein consisting of the amino acid sequence described in

  Here, “functionally equivalent” means that the target protein has a biological function (biological role, biological property) equivalent to GsdmA1, GsdmA2, GsdmA3, GSDMA, mouse Trp53, or human Trp53, It refers to having a biochemical function (biochemical activity).

  In the present specification, mouse Rb gene, mouse Ras gene, mouse Cyclin-D gene, mouse Cdk gene, mouse TNF-α gene, mouse TGF-β gene, human Rb gene, human Ras gene, human Cyclin-D gene, The human Cdk gene, human TNF-α gene, human TGF-β gene variants, variants, and homologues are also defined in the same manner as described above.

  Other methods well known to those skilled in the art for preparing DNA encoding a naturally occurring protein functionally equivalent to a protein include hybridization techniques (Sambrook, J et al., Molecular Cloning 2nd ed., 9.47). -9.58, Cold Spring Harbor Lab. Press, 1989). That is, in those skilled in the art, GsdmA1, GsdmA2, GsdmA3, GSDMA, mouse Trp53, mouse Rb, mouse Ras, mouse Cyclin-D, mouse Cdk, mouse TNF-α, mouse TGF-β, human Trp53, human Rb, human Ras , Using DNA sequence encoding human Cyclin-D, human Cdk, human TNF-α, human TGF-β (hereinafter referred to as GsdmA1 etc.) or a part thereof, to isolate DNA having high homology with this This is a well-known technique.

  The present invention includes a DNA that hybridizes with a DNA encoding GsdmA1 or the like under stringent conditions and encodes a naturally derived protein that is functionally equivalent to GsdmA1 or the like.

  Those skilled in the art can appropriately select hybridization conditions for isolating a DNA encoding a naturally derived protein that is functionally equivalent to GsdmA1 or the like. Examples of hybridization conditions include low stringency conditions. Low stringent conditions are, for example, conditions of 42 ° C., 5 × SSC, and 0.1% SDS, and preferably 50 ° C., 5 × SSC, and 0.1% SDS in washing after hybridization. More preferable hybridization conditions include highly stringent conditions. High stringent conditions are, for example, conditions of 65 ° C., 0.1 × SSC and 0.1% SDS. Under these conditions, it can be expected that DNA having high homology can be efficiently obtained as the temperature is increased. However, a plurality of factors such as temperature and salt concentration can be considered as factors affecting the stringency of hybridization, and those skilled in the art can realize the same stringency by appropriately selecting these factors. .

  In addition, a gene amplification method using a primer synthesized based on the sequence information of DNA encoding GsdmA1 etc., for example, a polymerase chain reaction (PCR) method is used to obtain a naturally occurring protein functionally equivalent to GsdmA1 etc. It is also possible to isolate the encoding DNA.

  Naturally derived proteins functionally equivalent to GsdmA1 and the like encoded by DNA isolated by these hybridization techniques and gene amplification techniques usually have high homology in amino acid sequence with GsdmA1 and the like. The protein of the present invention includes naturally derived proteins that are functionally equivalent to GsdmA1 and the like and have high homology with the amino acid sequence of the protein. High homology generally refers to at least 50% identity, preferably 75% identity, more preferably 85% identity, more preferably 95% identity at the amino acid level. At the base level, it usually refers to at least 50% identity, preferably 75% identity, more preferably 85% identity, more preferably 95% identity.

  The identity of amino acid sequences and base sequences can be determined by the algorithm BLAST (Proc. Natl. Acad. Sci. USA 90: 5873-5877, 1993) by Karlin and Altschul. Based on this algorithm, programs called BLASTN and BLASTX have been developed (Altschul et al. J. Mol. Biol. 215: 403-410, 1990). When a base sequence is analyzed by BLASTN based on BLAST, parameters are set, for example, score = 100 and wordlength = 12. When an amino acid sequence is analyzed by BLASTX based on BLAST, parameters are set to score = 50 and wordlength = 3, for example. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific techniques for these analysis methods are known (http://www.ncbi.nlm.nih.gov.).

  In addition, naturally occurring proteins that are composed of amino acid sequences in which one or more amino acids are mutated in the amino acid sequence such as GsdmA1 and are functionally equivalent to the protein are also included in the protein of the present invention. Such amino acid mutations can also occur in nature. The number of amino acids to be mutated is usually within 30 amino acids, preferably within 15 amino acids, more preferably within 5 amino acids (for example, within 3 amino acids), and even more preferably within 2 amino acids.

  The amino acid residue to be mutated is preferably mutated to another amino acid in which the properties of the amino acid side chain are conserved. For example, amino acid side chain properties include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl group-containing side chains (S, T, Y), sulfur atom-containing side chains Amino acids having amino acids (C, M), amino acids having carboxylic acid and amide-containing side chains (D, N, E, Q), amino acids having base-containing side chains (R, K, H), aromatic-containing side chains The amino acids (H, F, Y, W) that can be used can be listed (the parentheses indicate the single letter of the amino acid).

  It is already known that proteins having amino acid sequences modified by deletion, addition and / or substitution with other amino acids of one or more amino acid residues to a certain amino acid sequence maintain their biological activity. (Mark, DF et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, MJ & Smith, M. Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al., Science 224, 1431-1433, Dalbadie-McFarland, G. et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).

  In the present invention, functional suppression of the GsdmA gene and the tumor suppressor gene includes both complete suppression and partial suppression. In addition, suppression of gene function includes suppression of the function of one or both of a gene pair.

  Suppression of gene function can be performed by suppressing gene expression and introducing a mutation into the gene. There is no restriction on the type, number, site, etc. of the mutation. Examples of the types of mutation include addition, deletion (which may be complete deletion or partial deletion), substitution or insertion mutation. Further, the mutation may be a mutation that occurs in nature or a mutation introduced artificially (for example, a mutation caused by mutagen treatment or a mutation introduced by a gene modification technique).

  As a preferred embodiment of the non-human animal of the present invention, a non-human animal having a mutation in one of the GsdmA gene and Trp53 gene pair (hereinafter referred to as mutant GsdmA hetero-mutant Trp 53 hetero-non-human animal), GsdmA gene Non-human animals that have mutations in one of the gene pairs and mutations in both Trp53 gene pairs (hereinafter referred to as mutant GsdmA hetero / mutant Trp53 homo-non-human animals), both GsdmA gene pairs A non-human animal (hereinafter referred to as a mutant GsdmA homo-mutant Trp53 hetero-non-human animal) having a mutation in one of the Trp53 gene pair and both the GsdmA gene and Trp53 gene pair. Non-human animals having mutations (hereinafter referred to as mutant GsdmA homo / mutant Trp53 homo non-human animals).

Mutant GsdmA hetero / mutant Trp53 hetero non-human animal, mutant GsdmA hetero / mutant Trp 53 homo non-human animal, mutant GsdmA homo / mutant Trp 53 hetero non-human animal, mutant GsdmA hetero / mutant Trp 53 homo non-human animal Examples of non-human animals include Rim3 heterozygous / Trp53 knockout heterozygous mouse, Rim3 heterozygous / Trp53 knockout homozygous mouse (GsdmA-3 ^Rim3 / +; Trp53 ⁻ / −), Rim3 homozygous / Trp53 knockout heterozygous mouse (GsdmA-3 ^Rim3 / ^Rim3 ; Trp53 ⁻ / +), Rim3 homo / Trp53 knockout homo mouse (GsdmA-3 ^Rim3 / ^Rim3 ; Trp53 ⁻ / −), but not limited thereto.

Mutant GsdmA hetero / mutant Trp53 hetero non-human animal, Mutant GsdmA hetero / mutant Trp 53 homo non-human animal, Mutant GsdmA homo / mutant Trp 53 hetero non-human animal, Mutant GsdmA homo / mutant Trp 53 homo non-human animal An animal can be obtained by mating the following (i) to (iv) and mating individuals obtained by this mating.
(I) Mutant GsdmA hetero-non-human animal and mutant Trp53 hetero-non-human animal (ii) Mutant GsdmA hetero-non-human animal and mutant Trp53 homo-non-human animal (iii) Mutant GsdmA homo-non-human animal and mutant Trp53 Heterogeneous non-human animal (iv) mutant GsdmA homo-non-human animal and mutant Trp53 homo-non-human animal Further, in the present invention, non-human animals having naturally occurring mutations and non-humans having artificially introduced mutations The mating of animals, the mating of non-human animals having a naturally occurring mutation, and the mating of non-human animals having an artificially introduced mutation can be appropriately selected.

  Function suppression of a specific gene can be performed by a method known to those skilled in the art. For example, a method using a gene modification technique (including an enzyme that promotes recombination of a target gene site, for example, a conditional gene modification technique by introducing Cre in Cre-lox), a method using an antisense DNA, a ribozyme Examples include a method using a DNA to be encoded or a method using RNAi technology.

  For example, a non-human animal in which the function of a gene is suppressed can be produced as follows. First, a genomic DNA fragment containing a target gene is cloned, and based on this, a vector for homologous recombination for modifying an endogenous target gene is constructed. The homologous recombination vector includes a nucleic acid sequence in which at least a part of the target gene or its expression control region is deleted / mutated, a nucleic acid sequence in which nucleotides or polynucleotides are inserted into the target gene or its expression control region, and a target gene Alternatively, the deletion / mutation site and insertion site are not limited as long as the expression control region includes a nucleic acid sequence in which another gene is inserted, but the nucleic acid sequence loses the activity of the target gene.

  Examples of the inserted gene include a neomycin resistance gene, a thymidine kinase gene, a diphtheria toxin gene, and the like. A combination of these is also conceivable. The basic skeleton of the vector for homologous recombination is not particularly limited, and for example, pKO Scrambler Series (Lexicon) can be used.

  By introducing the constructed vector for homologous recombination into a non-human animal cell (for example, embryonic stem cell (ES cell)) that can be differentiated into an individual, and performing homologous recombination with an endogenous target gene, Modified non-human animal cells are produced. In order to prepare the cell in which the expression of one side of the gene pair is suppressed, it can be obtained, for example, by a method of selecting a cell with neomycin. The vector for homologous recombination can be introduced into cells by methods known to those skilled in the art. Specifically, an electroporation method and the like can be exemplified.

  When ES cells are used as animal cells that can be differentiated into individuals in the present invention, for example, chimeric embryos are produced by injecting the cells into blastocysts and transplanted into the uterus of animals that have been pseudopregnant To give birth. In order to be able to select a chimeric animal having a tissue derived from a genetically modified ES cell, it is more preferable that the external characteristics (for example, hair color) of the produced individual are the tissue and scutellum derived from the genetically modified ES cell. Blastocysts are selected to be different from the cyst-derived tissue.

  In addition, whether or not a chimeric animal has a reproductive tissue derived from a genetically modified ES cell is generally determined by mating between the chimeric non-human animal and a homologous non-human animal of an appropriate strain. Other methods include, for example, a method of detecting the presence or absence of an inserted gene by performing a PCR reaction using DNA extracted from the tail or ear of the chimeric non-human animal as a template, or the Southern hybridization method. It is also possible to use.

  Whether or not the pup obtained by mating the chimeric animal with the same species of the same species is a heterozygous genetically modified non-human animal can be determined by, for example, PCR using DNA extracted from the genetically modified animal as a template. Or by Southern hybridization. In addition, homozygous genetically modified non-human animals can be produced by crossing heterozygous genetically modified non-human animals. Whether or not the offspring obtained by mating is a non-human animal having a desired genotype also follows the above determination method.

  The production of the genetically modified non-human animal of the present invention is not limited to the above method. For example, an animal can be produced according to a technique for producing a somatic cell cloned animal. Specifically, animal cells can be produced using somatic cells other than ES cells (for example, skin cells) according to the same method as that for ES cells. Furthermore, a non-human animal can be produced from the non-human animal cell by applying a somatic cell clone production technique.

  The production of a non-human animal in which the function of a gene is suppressed can also be performed by using a DNA encoding an RNA complementary to the transcription product of the gene of the present invention. Examples of such DNA include antisense DNA.

  There are several factors as described below for the action of an antisense nucleic acid to suppress the expression of a target gene. That is, transcription initiation inhibition by triplex formation, transcription inhibition by hybridization with a site where an open loop structure is locally created by RNA polymerase, transcription inhibition by hybridization with RNA that is undergoing synthesis, intron and exon Of splicing by hybrid formation at the junction with the protein, suppression of splicing by hybridization with the spliceosome formation site, suppression of transition from the nucleus to the cytoplasm by hybridization with mRNA, hybridization with capping sites and poly (A) addition sites Splicing suppression by formation, translation initiation suppression by hybridization with the translation initiation factor binding site, translation suppression by hybridization with the ribosome binding site near the initiation codon, peptization by hybridization with the mRNA translation region and polysome binding site For example, inhibition of gene chain elongation is prevented, and hybridization between nucleic acid and protein interaction sites is performed. They inhibit the expression of target genes by inhibiting transcription, splicing, or translation processes.

  The antisense sequence used in the present invention may suppress the expression of the target gene by any of the actions described above. In one embodiment, if an antisense sequence complementary to the untranslated region near the 5 ′ end of the mRNA of the gene is designed, it will be effective for inhibiting translation of the gene. However, sequences complementary to the coding region or the 3 ′ untranslated region can also be used. As described above, a DNA containing an antisense sequence of a non-translated region as well as a translated region of a gene is also included in the antisense DNA used in the present invention. The antisense DNA to be used is linked downstream of a suitable promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side. The DNA thus prepared can be transformed into a desired cell by a known method. The sequence of the antisense DNA is preferably a sequence complementary to the endogenous gene or a part thereof possessed by the cell to be transformed, but may be not completely complementary as long as the gene expression can be effectively inhibited. Good. The transcribed RNA preferably has a complementarity of 90% or more, most preferably 95% or more, to the transcription product of the target gene. In order to effectively inhibit the expression of a target gene using an antisense sequence, the length of the antisense DNA is at least 15 bases or more, preferably 100 bases or more, more preferably 500 bases or more. is there. Usually, the length of the antisense DNA used is shorter than 5 kb, preferably shorter than 2.5 kb.

  Another embodiment of RNA complementary to the transcription product of the gene of the present invention is dsRNA complementary to the transcription product of the gene of the present invention. RNAi is a phenomenon in which, when a double-stranded RNA (hereinafter referred to as dsRNA) having the same or similar sequence as a target gene sequence is introduced into a cell, the expression of the introduced foreign gene and target endogenous gene are both suppressed. When dsRNA of about 40 to several hundred base pairs is introduced into a cell, a RNaseIII-like nuclease called Dicer with a helicase domain is present in the presence of ATP, and dsRNA is about 21 to 23 base pairs from the 3 ′ end. Cut out and produce siRNA (short interference RNA). A protein specific to this siRNA binds to form a nuclease complex (RISC: RNA-induced silencing complex). This complex recognizes and binds to the same sequence as siRNA, and cleaves the mRNA of the target gene at the center of siRNA by RNaseIII-like enzyme activity. In addition to this pathway, the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RsRP) to synthesize dsRNA. There is also a possibility that this dsRNA becomes Dicer's substrate again to generate new siRNA and amplify the action.

  The RNA of the present invention can be expressed from an antisense coding DNA that encodes an antisense RNA to any region of the target gene mRNA and a sense code DNA that encodes a sense RNA of any region of the target gene mRNA. . Moreover, dsRNA can also be produced from these antisense RNA and sense RNA.

  When the dsRNA expression system of the present invention is retained in a vector or the like, the antisense RNA and sense RNA are expressed from the same vector, and the antisense RNA and sense RNA are expressed from different vectors, respectively. There is. For example, antisense RNA and sense RNA can be expressed from the same vector as an antisense RNA in which a promoter capable of expressing a short RNA such as polIII is linked upstream of the antisense code DNA and the sense code DNA. It can be constructed by constructing an expression cassette and a sense RNA expression cassette, respectively, and inserting these cassettes into the vector in the same direction or in the opposite direction. It is also possible to construct an expression system in which the antisense code DNA and the sense code DNA are arranged in opposite directions so as to face each other on different strands. In this configuration, one double-stranded DNA (siRNA-encoding DNA) in which an antisense RNA coding strand and a sense RNA coding strand are paired is provided, and antisense RNA and sense RNA from each strand are provided on both sides thereof. A promoter is provided oppositely so that it can be expressed. In this case, in order to avoid adding extra sequences downstream of the sense RNA and antisense RNA, a terminator is added to the 3 ′ end of each strand (antisense RNA coding strand, sense RNA coding strand). It is preferable to provide. As this terminator, a sequence in which four or more A (adenine) bases are continued can be used. Moreover, in this palindromic style expression system, it is preferable that the types of the two promoters are different.

  In addition, as a configuration for expressing antisense RNA and sense RNA from different vectors, for example, antisense coding DNA and an antisense in which a promoter capable of expressing a short RNA such as polIII is linked upstream of sense coding DNA. An RNA expression cassette and a sense RNA expression cassette can be constructed, and these cassettes can be held in different vectors.

In the RNAi of the present invention, siRNA may be used as dsRNA. “SiRNA” means a double-stranded RNA consisting of short strands that are not toxic in cells, for example, 15 to 49 base pairs, preferably 15 to 35 base pairs, and more preferably 21 Can be ~ 30 base pairs. Alternatively, the siRNA to be expressed is transcribed and the length of the final double-stranded RNA portion is, for example, 15 to 49 base pairs, preferably 15 to 35 base pairs, more preferably 21 to 30 base pairs. be able to.
The DNA used for RNAi need not be completely identical to the target gene, but has at least 70% or more, preferably 80% or more, more preferably 90% or more, most preferably 95% or more sequence homology. .

  The part of the double-stranded RNA in which the RNAs in dsRNA are paired is not limited to a perfect pair, but mismatch (corresponding base is not complementary), bulge (no base corresponding to one strand) ) Or the like may include an unpaired portion. In the present invention, both bulges and mismatches may be included in the double-stranded RNA region where RNAs in dsRNA pair with each other.

  Inhibition of the expression of the gene of the present invention can also be carried out using DNA encoding a ribozyme. A ribozyme refers to an RNA molecule having catalytic activity. Some ribozymes have a variety of activities. Among them, research on ribozymes as enzymes that cleave RNA has made it possible to design ribozymes for site-specific cleavage of RNA. Some ribozymes have a group I intron type and a size of 400 nucleotides or more like M1RNA contained in RNaseP, but some have an active domain of about 40 nucleotides called hammerhead type or hairpin type.

  For example, the self-cleaving domain of hammerhead ribozyme cleaves on the 3 ′ side of C15 of G13U14C15, but it is important for U14 to form a base pair with A at position 9, and the base at position 15 is In addition to C, it is shown that it can also be cut by A or U. If the ribozyme substrate binding site is designed to be complementary to the RNA sequence near the target site, it is possible to create a restriction enzyme-like RNA-cleaving ribozyme that recognizes the UC, UU, or UA sequence in the target RNA. It is. For example, there are a plurality of sites that can be targets in the coding region of the enzyme of the present invention that is an inhibition target.

  Hairpin ribozymes are also useful for the purposes of the present invention. Hairpin ribozymes are found, for example, in the minus strand of tobacco ring spot virus satellite RNA (J. M. Buzayan Nature 323: 349, 1986). This ribozyme has also been shown to be designed to cause target-specific RNA cleavage.

  A ribozyme designed to cleave the target is linked to a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence so that it is transcribed in plant cells. However, at that time, if an extra sequence is added to the 5 ′ end or 3 ′ end of the transcribed RNA, the ribozyme activity may be lost. In such a case, in order to accurately cut out only the ribozyme part from the RNA containing the transcribed ribozyme, another trimming ribozyme that acts in cis for trimming is placed on the 5 'side or 3' side of the ribozyme part. (K. Taira et al. (1990) Protein Eng. 3: 733, AMDzianottand JJ Bujarski (1989) Proc. Natl. Acad. Sci. USA. 86: 4823, CAGrosshansand RTCech (1991) Nucleic Acids Res. 19: 3875, K. Taira et al. (1991) Nucleic Acids Res. 19: 5125). In addition, such structural units can be arranged in tandem so that multiple sites in the target gene can be cleaved, thereby further enhancing the effect (N. Yuyama et al. Biochem. Biophys. Res. Commun. 186: 1271,1992). Such a ribozyme can be used to specifically cleave the transcription product of the target gene in the present invention, thereby suppressing the expression of the gene.

  In the present invention, a non-human animal in which the functions of the GsdmA gene and the tumor suppressor gene are suppressed is introduced by introducing the above-described DNA that suppresses gene expression into a desired non-human animal using a transgenic technique. You can also

  Methods for producing transgenic animals are known. For example, transgenic animals can be obtained by the method described in Proc. Natl. Acad. Sci. USA 77: 7380-7384 (1980). Specifically, the DNA that suppresses gene expression is introduced into an totipotent cell of an animal, and this cell is generated into an individual. By selecting individuals from which the transgene has been incorporated into somatic cells and germ cells, the desired transgenic animals can be produced. Examples of totipotent cells into which genes are introduced include fertilized eggs and early embryos, and cultured cells such as ES cells having multipotency. Those skilled in the art can appropriately modify the above method to produce a transgenic animal in which the expression of a desired gene is modified.

  The DNA that suppresses gene expression is generally a recombinant gene construct (expression vector) linked to a promoter that can be expressed in the cells of an animal into which the DNA is to be introduced. The recombinant gene construct of the present invention can be constructed by inserting and cloning the above-described DNA that suppresses gene expression and a promoter upstream thereof into a vector that can be cloned using an appropriate host. .

  The promoter that can be used in the present invention is not particularly limited as long as it is a promoter that can be expressed in animal cells. For example, promoters derived from mammalian cells, cytomegalovirus, retrovirus, polyomavirus, adenovirus, A viral promoter such as simian virus 40 (SV40) can be mentioned. For example, when the SV40 promoter is used, the above construct can be prepared according to the method of Mulligan et al. (Nature (1990) 277, 108).

  The vector that can be used in the present invention may be any vector that can induce the expression of the transgene over a wide range in the animal body, and an expression vector known to those skilled in the art can be used.

  A recombinant gene construct excised from the vector with an appropriate restriction enzyme is sufficiently purified and used to produce a transgenic animal. Usually, a transgenic animal is produced by introducing the construct into an unfertilized egg, a fertilized egg, a sperm and a germ cell containing a progenitor cell thereof. As the cells into which the construct is introduced, those at the stage of embryogenesis in the development of non-human mammals, more specifically, at the stage of single cells or fertilized egg cells, usually those before the 8-cell stage are used. Known methods for introducing the construct include calcium phosphate method, electroporation method, lipofection method, aggregation method, microinjection method, particle gun method, DEAE-dextran method and the like. Furthermore, it is also possible to produce a transgenic animal by fusing the thus obtained transformed cells with the above-mentioned germ cells.

  In the case of a mouse, for example, by mating a normal male mouse with a female mouse administered with an ovulation inducer, a fertilized egg capable of introducing a construct can be collected. In mouse fertilized eggs, the construct is generally introduced by microinjection into the male pronucleus. The cells into which the construct has been introduced are cultured outside the body, and then the cells that appear to have been successfully introduced are transplanted into the surrogate mother's fallopian tube to produce a transgenic chimeric animal. The surrogate mother is usually a female that has been mated with a male whose vagina has been cut into a pseudopregnant state.

  The born transgenic chimeric animal is mated with a normal animal for the birth of the F1 animal after confirming that the DNA that suppresses the gene expression is incorporated. In general, multiple copies of foreign DNA introduced as a construct are integrated in series in the same part of the genome. In general, the higher the number of integrated copies, the greater the expression of the gene, and a clearer phenotype can be expected. The incorporation of DNA that suppresses the above gene expression in the somatic cell genome can be confirmed by PCR using primers specific for the construct or Southern blotting using a specific probe.

  Among F1 animals born as a result of this mating, those that have foreign genes (DNA that suppresses the above gene expression) in somatic cells (heterozygotes) are transgenic animals that can transmit foreign genes to germ cells. is there. A homozygote that is an F2 animal can be obtained by selecting an F1 animal that has a foreign gene in a somatic cell and using these as parents.

  In the present invention, a non-human animal in which the function of an oncogene is promoted can be produced by introducing a DNA encoding an oncogene into a desired non-human animal using a transgenic technique. . By mating the prepared non-human animal with a non-human animal in which the function of the GsdmA gene is suppressed, a non-human animal in which the function of the GsdmA gene is suppressed and the function of the oncogene is promoted can be produced. .

  Further, in the present invention, by using a transgenic technique, by introducing DNA encoding an oncogene into a non-human animal in which the function of the GsdmA gene is suppressed, the function of the GsdmA gene is suppressed, and the oncogene It is also possible to produce a non-human animal in which the function of is promoted.

  The present invention also provides an animal cell in which the function of a GsdmA gene is suppressed and the function of a canceration-related gene is promoted or suppressed (an animal cell in which the function of a GsdmA gene is suppressed and the function of an oncogene is promoted, or Animal cells in which the function of the GsdmA gene is suppressed and the function of the tumor suppressor gene is suppressed. The biological species from which the animal cell of the present invention is derived is not particularly limited, and is a cell derived from various biological species including humans. Examples of animal cells of the present invention include, but are not limited to, somatic cells, fertilized eggs, ES cells, and cells established from the non-human animals of the present invention. As a method for establishing the cell line derived from the non-human animal, a known method can be used. For example, in rodents, it is possible to use the method of primary culture of fetal cells (Neochemistry Laboratory, Vol. 18, pp. 125-129, Tokyo Chemistry Doujin, and mouse embryo operation manual, pp. 262- 264 pages, Modern Publishing).

The present invention provides a method of screening for compounds that complement the phenotype of the non-human animal of the present invention.
There is no restriction | limiting in particular as "test sample" in the method of this invention, For example, single compounds, such as a natural compound, an organic compound, an inorganic compound, protein, a peptide, an antibody, a compound library, a gene library, an antibody Examples include library expression products, cell extracts, cell culture supernatants, fermented microorganism products, marine organism extracts, plant extracts, prokaryotic cell extracts, eukaryotic single cell extracts or animal cell extracts. . The test sample can be appropriately labeled as necessary. Examples of the label include a radiolabel and a fluorescent label.

  The first aspect of the screening method of the present invention relates to screening for compounds that complement the phenotype of the non-human animal of the present invention. In the first embodiment, first, a test compound is administered to the non-human animal of the present invention. Administration of the test compound to the non-human animal of the present invention can be performed, for example, orally or parenterally, but is not limited thereto. When the test compound is a protein, for example, a viral vector having a gene encoding the protein can be constructed, and the gene can be introduced into the non-human animal of the present invention using its infectivity. It is. In the first embodiment, it is then determined whether or not the test compound complements the phenotype of the non-human animal. Then, a compound that complements the phenotype of the non-human animal is selected as compared to the case where the test compound is not administered.

  Non-human animal phenotypes include cancer (eg skin cancer, laryngeal cancer, tongue cancer, esophageal cancer, stomach cancer, breast cancer, colon cancer, ovarian cancer, bladder cancer, uterine cancer, pancreatic cancer, kidney cancer, lung cancer, melanoma. Onset, progression, metastasis, etc., especially skin cancer onset, progression, metastasis, etc. Further, the complementation of the phenotype of a non-human animal includes suppression of cancer onset, progression, metastasis, and the like.

  The second aspect of the screening method in the present invention relates to screening for compounds that complement the phenotype of animal cells of the present invention. In the second embodiment, first, a test compound is contacted with the animal cell of the present invention.

  In the present invention, “contact” can be carried out, for example, by adding a test sample to a cell culture solution. When the test sample is a protein, for example, a vector containing DNA encoding the protein can be introduced into the cell.

Next, it is determined whether or not the test compound complements the phenotype of the animal cell. Then, a compound that complements the phenotype of the animal cell is selected as compared with the case where the test compound is not administered.
Examples of the phenotype of the cell of the present invention include proliferation abnormality, differentiation abnormality, adhesion abnormality, and mobility enhancement. In addition, complementation of cell phenotype includes suppression of proliferation abnormality, differentiation abnormality, adhesion abnormality, enhancement of mobility and the like.

  The present invention also provides an antibody that binds to GsdmA1, GsdmA2, GsdmA3, GSDMA, or mutants, variants, homologs (hereinafter referred to as GsdmA1, GsdmA2, GsdmA3, or GSDMA) of these proteins, or fragments thereof. provide. The antibody of the present invention can be used for the detection of the protein in cancer screening, cancer research, and the like. The type of the antibody is not particularly limited, and for example, both a monoclonal antibody and a polyclonal antibody can be used. The antibody can be prepared by methods known to those skilled in the art. For example, a polyclonal antibody can be obtained as follows. GsdmA1, GsdmA2, GsdmA3, GSDMA or the like, a recombinant protein expressed in a microorganism such as Escherichia coli as a fusion protein of these with GST, or a partial fragment thereof is immunized to a small animal such as a rabbit to obtain serum. This is prepared by, for example, purification using ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, GsdmA1, GsdmA2, GsdmA3, GSDMA, etc., an affinity column coupled with a synthetic peptide, or the like. In the case of a monoclonal antibody, for example, GsdmA1, GsdmA2, GsdmA3 or GSDMA or a partial fragment thereof is immunized to a small animal such as a mouse, the spleen is removed from the mouse, and this is ground to separate cells, Cells and mouse myeloma cells are fused with a reagent such as polyethylene glycol, and a clone that produces an antibody that binds to GsdmA1, GsdmA2, GsdmA3 or GSDMA is selected from the resulting fused cells (hybridoma). . Subsequently, the obtained hybridoma is transplanted into the abdominal cavity of the mouse, and ascites is collected from the mouse, and the obtained monoclonal antibody is obtained by, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, GsdmA1, GsdmA2 It can be prepared by purifying with an affinity column coupled with a synthetic peptide such as GsdmA3 or GSDMA.

The fragment of the protein is a fragment described in the Examples, or a C-terminal region such as GsdmA1, GsdmA2, GsdmA3, or GSDMA. Examples of such a region include amino acids 343 to 451 of GsdmA3, Examples include, but are not limited to, amino acids 334 to 442 of GsdmA1, amino acids 352 to 460 of GsdmA2, and amino acids 333 to 441 of GSDMA.
In addition, all prior art documents cited in the present specification are incorporated herein by reference.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.
Materials and Methods Experimental animal (mouse)
C57BL / 6J and C57BL / 10J were purchased from Jackson Laboratory. The mutant mouse, Rim3, was independently organized at the National Institute of Genetics, and the p53 (Trp53) knockout mouse was provided by Dr. Shinichi Aizawa (currently RIKEN, Research Center for Developmental Sciences). These mouse strains were reared and managed at the National Institute of Genetics, Center for Biological Biology, and animals bred at the Center for Biological Biology were used for experiments. Animal experiments were approved by the National Institute of Genetics / Animal Experimentation Committee and conducted according to the guidelines.

2. Rim3 heterozygous p53 knockout heteromouse
Rim3 terrorism individuals to hetero · p53 knockout ^{(GsdmA3 Rim3 / +; Trp53 -} / +) to the production of, Rim3 hetero individual (GsdmA3 ^Rim3 / +) and p53 knockout to terrorism individuals (Trp53 ^- / +) to natural mating Obtained. Genotypes children obtained by the combination of the parent lines, Rim3 hetero individuals in addition to hetero individuals to Rim3 hetero · p53 knockout ^{(GsdmA3 Rim3 / +; Trp53 +} / +), p53 knockout hetero individuals ^{(GsdmA3 + / +; Trp53 -} / +), Normal individuals (GsdmA3 + / +; Trp53 + / +). All these offspring were bred under the same conditions (light / dark conditions, temperature, humidity, feed, drinking water, flooring, etc.), and the rate of skin cancer onset was observed over time.

3. Cell lines and cell cultures
Four types of skin cancer cell lines: HSC1 (squamous cell carcinoma of the skin), HSC4 (squamous cell carcinoma of the tongue), HSC5 (squamous cell carcinoma of the skin), and A431 (epithelioid cancer of the vulva) are human science promotion foundation human science research resources Purchased from a bank. HSC1 is DMEM supplemented with 20% fetal calf serum and penicillin-streptomycin, HSC4 is MEM supplemented with 10% fetal calf serum, and penicillin-streptomycin, HSC5 is 10% fetal calf serum, and penicillin- Iscove's modified DMEM supplemented with streptomycin, A431 was cultured in 10% fetal calf serum and DMEM supplemented with penicillin-streptomycin.

4). RT-PCR analysis (RT-PCR)
Preparation of total RNA from skin cancer cultured cells was performed using ISOGEN (Nippon Gene) according to the procedure recommended by the supplier. Human normal skin total RNA was purchased from Invitrogen. Total RNA obtained from each cultured skin cancer cell was treated with a DNA-degrading enzyme at 37 ° C. for 30 minutes to remove genomic DNA in the sample. The procedure for synthesizing cDNA from total RNA is as follows. Total RNA of cultured skin cancer cells and human normal skin total RNA, 7.5 μg of 10 mM dNTP (10 mM dATP, 10 mM dCTP, 10 mM dGTP, 10 mM dTTP) 3 μl, Oligo (dT) _12-18 primer 1500 ng, and RNA degradation The final volume was 39 μl with distilled water subjected to enzyme removal treatment. This solution was treated at 65 ° C. for 5 minutes and then rapidly cooled in ice. In a solution that has been sufficiently cooled to ice temperature, 12 μl of 5x First strand buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl ₂ ), 3 μl of 100 mM DTT, 3 μl of RNA Inhibitor, reverse transcriptase (SuperScript III Reverse Transcriptase: 3 μl of Invitrogen) was added and reacted at 55 ° C. for 50 minutes. After completion of the reaction, the mixture was further incubated at 70 ° C. for 15 minutes to remove the enzyme activity of reverse transcriptase, and this final reaction product was used as a cDNA sample of each skin cancer cultured cell used for PCR and human normal skin total RNA.

  Confirmation of GSDMA expression in each cultured skin cancer cell and human normal skin sample was performed by PCR. The primers used were a set of (GSDMAF: ATGACCATGTTTGAAAATGTC (SEQ ID NO: 13)) and (GSDMAR: TTAGGAGGCCTTGGTAAGCTG (SEQ ID NO: 14)). The reaction conditions are: DNA denaturation reaction at 94 ° C for 30 seconds, annealing reaction at 57 ° C for 30 seconds, extension reaction at 72 ° C for 1 minute 30 seconds, reaction cycle of 35 cycles, and the machine used was DNA amplification from Biometra Device. After completion of the reaction, the PCR sample was electrophoresed on a 1% agarose gel, and the GSDMA expression in each sample was evaluated.

5. Production of anti-GsdmA / GSDMA antibody (antibody production)
The anti-GsdmA / GSDMA antibody comprises peptides in regions corresponding to the 37th to 12th amino acids (CLVLRKRKSTLF (SEQ ID NO: 15)) of the GsdmA1 protein and the 248th to 14th amino acids (QMISEEPEEEKLIG (SEQ ID NO: 16)) of the GsdmA3 protein. Synthesized and made by immunizing chickens. The antibody titer was measured by ELISA. When the obtained antibodies were verified for their antigen specificity by Western blotting, it was confirmed that these antibodies specifically recognize all of mouse GsdmA1, GsdmA2, GsdmA3 and human GSDMA.

6). Immunohistochemistry (immunostaining)
Skin samples of Rim3 hetero-p53 knockout hetero mice that spontaneously developed skin cancer were fixed with 4% formaldehyde solution for 12 to 16 hours after collection. The skin tissue was embedded in paraffin and sliced to a thickness of 5 μm. Normal human skin as well as cutaneous squamous cell carcinoma paraffin sections were purchased from BIOCHAIN and used for experiments. The deparaffinized sample was subjected to microwave treatment in 10 mM citrate buffer for 5 minutes or 0.05% Trypsin treatment at 37 ° C. for 5 minutes as an antigen activation treatment. Further, in order to suppress the endogenous peroxidase activity, the treatment was performed with 0.3% H ₂ O ₂ / MtOH for 30 minutes at room temperature. Anti-GsdmA / GSDMA (diluted 50 times) was used as the primary antibody, and peroxidase-labeled donkey anti-chicken IgY polyclonal antibody (diluted 500 times, Jacson ImmunoReseach) was used as the secondary antibody. For visualization, 3 ′ 3-diaminobenzidine tetrahydrochloride (Wako Pure Chemical Industries) was used. The specimen after antibody staining was observed using an upright light microscope (OLYMPUS BX51) with a glass cover.

[Example 1] Disappearance of GSDMA in skin cancer Human homologous gene of mouse GsdmA cluster: GSDMA has been shown to have its expression disappeared in gastric cancer and esophageal cancer, and to have cancer suppressing ability. However, it has not been clarified whether it has similar expression pattern and function in the skin.

  Therefore, as a first step to clarify the function of human GSDMA gene in skin, we analyzed changes in GSDMA gene expression in normal skin and skin cancer. GSDMA gene expression using normal skin and 4 types of skin cancer cell lines: HSC1 (skin squamous cell carcinoma), HSC4 (squamous cell carcinoma of the tongue), HSC5 (skin squamous cell carcinoma), and A431 (vulvar epidermoid carcinoma) As a result of RT-PCR analysis, it was revealed that GSDMA gene expression was lost in all cancer cell lines even though GSDMA gene expression was observed in normal human skin. (Figure 1). This is similar to the expression pattern of the GSDMA gene in stomach and gastric cancer, and suggests that the GSDMA gene may also have a tumor suppressor function in skin.

[Example 2] Rim3 heterozygous p53 knockout heterozygote spontaneously develops skin cancer GsdmA1 and GsdmA3 are expressed in the skin among the GsdmA cluster genes (present on mouse chromosome 11) in mice. The causative gene of the epithelial morphogenesis mutant mouse Rim3 is GsdmA3. Considering the Rim3 phenotype, the function of the GsdmA3 gene is expected to be deeply involved in cell proliferation and differentiation. Considering these things and the disappearance of GSDMA gene expression in human skin cancer, the present inventors hypothesized that GsdmA3 may have a cancer suppressive ability in mouse skin. In order to confirm this hypothesis, the present inventors introduced a knockout allele of p53 (Trp53) known as a tumor suppressor gene into Rim3, an epithelial morphological mutant mouse Rim3 that is a causative gene of GsdmA3. A knockout heterozygous individual (GsdmA3 ^Rim3 / +; Trp53 ⁻ / +) was prepared, and the incidence of skin cancer in the animal individual was verified. FIG. 2 shows a schematic diagram of the hooking used in the experiment. Rim3 hetero individuals (GsdmA3 ^Rim3 / +) and p53 knockout hetero individuals (Trp53 ^- / +) hetero individuals to Rim3 hetero · p53 knockout by mating, Rim3 hetero individuals, p53 knockout hetero individuals, normal individuals, the theoretical value Obtained in street proportions. All these genotype individuals were bred under the same conditions and without contact with carcinogens, and observed over time. If skin cancer develops in these animals, it can be said that the cause is spontaneous onset only by genotype. As a result of time-lapse observation, no skin cancer was observed until 6 months after birth in all genotypes. Skin cancer was observed only in Rim3 heterozygous p53 knockout individuals at the age of 7 months. In double heterozygous individuals, the incidence increases with aging: 38% (8/21) at 8 months, 62% (13/21) at 10 months, 81% (17/21) at 12 months ) Individuals developed skin cancer (FIG. 3). Interestingly, multiple skin cancers occurred in each individual, and the onset sites were concentrated in the head and neck as in human skin cancer (Table 1). Rim3 heterozygous individuals other than p53 knockout heterozygous individuals: In Rim3 heterozygous individuals, p53 knockout heterozygous individuals, and normal individuals, only Rim3 heterozygous individuals developed skin cancer at 11 months of age. The incidence was very low at about 10% even at 12 months of age.

Table 1 shows the incidence of spontaneous skin cancer in hybrid mice obtained from crossing Rim3 / + mice with Trp53 ⁻ / + mice.

[Example 3] Histochemical Observation of Rim3 Hetero / p53 Knockout Heteromouse Skin Cancer In order to examine skin cancer in Rim3 hetero / p53 knockout heterozygous individuals in more detail, tissue sections were prepared. FIG. 4A shows an overview of skin cancer that has developed in a Rim3 hetero / p53 knockout hetero individual, and FIG. 4B is a section image of the individual's cancer. The white line in FIG. 4A corresponds to the cut surface in FIG. 4B. Skin cancer in Rim3 hetero-p53 knockout heterozygous individuals had many keratinized regions and were keratoacanthoma-like (FIG. 4B). Further, pathological examination of the cancer tissue region revealed that this skin cancer was a typical squamous cell carcinoma (FIG. 4D). At the same time, cell overgrowth was observed in the non-cancerous region adjacent to the cancer (FIG. 4C). What is most interesting in histochemical observation is the findings in the lymph nodes of Rim3 heterozygous / p53 knockout heterozygous individuals. Examination of regional lymph nodes of Rim3 heterozygous heterozygous p53 knockout heterozygote revealed that an epithelial structure was formed in the lymph nodes, and an excessive keratinization image was observed (FIG. 4E). ). This means that skin cancer cells generated in Rim3 hetero / p53 knockout heterozygous metastasis to regional lymph nodes and formed skin-like structures in the lymph nodes.

[Example 4] Loss of GsdmA / GSDMA protein in skin cancer Expression of GSDMA gene was lost in cultured human skin cancer cells. However, this result is only an experimental result of a cultured cell system (in vitro). Therefore, as a starting point for examining whether or not the expression of GSDMA in the cancerous part in humans and individual animals (in vivo) has disappeared, the present inventors have produced a GsdmA / GSDMA antibody. The inventors succeeded in producing an anti-GsdmA / GSDMA polyclonal antibody by preparing a synthetic peptide against GsdmA / GSDMA and immunizing chickens. The specificity of the anti-GsdmA / GSDMA polyclonal antibody by Western blot is shown in FIG. The GsdmA / GSDMA polyclonal antibody prepared this time surely recognizes GsdmA / GSDMA (mouse GsdmA1-A3 and human GSDMA protein).

  Using this antibody, we examined skin cancer that developed in Rim3 hetero-p53 knockout heterozygous individuals, and in non-cancerous epithelial tissues, the presence of GsdmA protein was confirmed from the spinous cell layer to the granular layer and the transparent layer. (FIGS. 6A and 6B), it was revealed that the GsdmA protein disappeared in a typical squamous cell carcinoma cell region (* marks in FIGS. 6C and 6D). Similarly, GSDMA protein was detected in normal human skin and squamous cell carcinoma. In normal human skin, GSDMA protein was not expressed in the basement membrane cell layer as in normal mouse skin, but was expressed from the spinous cell layer to the granular layer and the transparent layer (FIG. 7A). In addition, the expression of GSDMA protein in human hair follicles was similar to that in mice (FIG. 7B). In human skin cancer, it was found that the expression of GSDMA protein was lost in both squamous cell carcinoma and basal cell carcinoma (FIGS. 7C and 7D). From the above results, it was clarified that GsdmA / GSDMA protein disappears with canceration not only in cultured cancer cell lines but also in human and mouse individuals.

  The present inventors have developed a new skin cancer model animal that induces skin cancer spontaneously by introducing p53 (Trp53) knockout allele into an epithelial morphogenesis mutant mouse Rim3 in which a mutation is present in GsdmA3. . Rim3 heterozygous p53 knockout heterozygous individuals develop squamous cell carcinoma around 7 months of age, and the rate is over 80% at 12 months of age. The site of skin cancer onset is concentrated in the head and neck where human skin cancer is frequently observed, and the occurrence of multiple cancers per individual is observed. Furthermore, the cancer cells were surprisingly confirmed to metastasize to regional lymph nodes.

  The high incidence of skin cancer and the development of multiple cancers per individual is very useful in analyzing the onset mechanism of skin cancer. It is also noteworthy that skin cancer is induced spontaneously without chemical induction. Rim3 heterozygous p53 knockout individuals develop skin cancer with aging due to their genotype alone.

Example 5
The incidence of skin cancer with Rim3 alone was very low, about 10% in this experiment. The cancer also developed alone. Although not shown in the data, the incidence of cancer is very low in Rim3 homozygous individuals as well as in the Rim3 heterozygous individuals tested in this study. No p53 (Trp53) knockout mouse has ever been reported to spontaneously develop skin cancer in both hetero and homo individuals. The fact that skin cancer did not develop in p53 knockout hetero mice in this experiment is consistent with previous reports (skin cancer does not spontaneously develop). The reason why skin cancer develops only when there are mutations in these two genes at the same time is discussed below.

  Oncogene and tumor suppressor gene, which are canceration-related genes, are originally derived from normal genes and often play extremely important roles such as cell growth / differentiation regulation. When a mutation occurs in this canceration-related gene for some reason, abnormal gene hyperfunction (oncogene) or functional decline (tumor suppressor gene) occurs, causing abnormal increase in cell proliferation signal or cell cycle abnormality. As a result, gene repair or the like becomes impossible, mutations accumulate in a plurality of genes, and the cells are thought to eventually become cancerous. In fact, in many cases, mutations accumulate in a plurality of cancer-related genes in cancer.

  Rim3 heterozygous p53 knockout heterozygous individuals are thought to reflect this mechanism of cancer development. Mutation of GsdmA3 or p53 gene alone does not cause skin cancer. This means that when the GsdmA3 gene has a mutation (Rim3 homo / heteroindividual), the occurrence of cancer is suppressed by the p53 gene, while the p53 gene has a mutation (p53 knockout homo / heteroindividual). Is presumed that the GsdmA3 gene suppresses cancer development. Skin cancer develops only when there is a mutation in both genes and with aging. In the first place, in Rim3 heterozygous p53 knockout heterozygous individuals, one allele is normal for both GsdmA3 gene and p53 gene. That is, although it is half of the wild type, it has a normal function. Perhaps half of the normal function during the six months until skin cancer develops, gene repair, etc. cannot be performed normally, and mutations accumulate in many canceration-related genes, leading to the development of skin cancer. It is done.

In Rim3 heterozygous / p53 knockout heterozygous individuals, one allele is normal for both the GsdmA3 gene and the Trp53 gene, so the phenotype is considered to be moderate. Therefore, Rim3 Homo · p53 knockout hetero individuals ^{(GsdmA3 Rim3 / Rim3; Trp53 -} / +), Rim3 hetero · p53 knockout homozygotes ^{(GsdmA3 Rim3 / +; Trp53 -} / -) , rather than Rim3 hetero · p53 knockout hetero individuals Skin cancer develops early, and Rim3 homo / p53 knockout homo individuals (GsdmA3 ^Rim3 / ^Rim3 ; Trp53 ⁻ / ⁻ ) are considered to develop skin cancer earlier.

  One candidate for a mutation accumulation canceration-related gene in skin cancer of Rim3 hetero-p53 knockout hetero individuals is GsdmA1. There is no mutation in the GsdmA1 gene in Rim3 heterozygous / p53 knockout heterozygous individuals. However, the results of immunostaining with anti-GsdmA / GSDMA antibody revealed that both GsdmA1 and GsdmA3 proteins originally expressed in the skin were lost in skin cancer of Rim3 heterozygous p53 knockout individuals. did. The disappearance of not only GsdmA3 but also GsdmA1 without mutation is very interesting. GsdmA1 and GsdmA3 have very high homology, and functional redundancy is considered. At the stage where mutations exist only in GsdmA3 (Rim3 homozygous or heterozygous individuals), it seems that GsdmA1 supplements its function and suppresses canceration. For canceration, both genes GsdmA1 and GsdmA3 must be lost. In addition, there is interest in whether the expression of both GsdmA1 and GsdmA3 is suppressed, and factors involved in the transcriptional regulation of both genes are also considered candidates for mutation-accumulating canceration-related genes in skin cancer.

  In this experiment, the present inventors created a skin cancer spontaneous model animal by introducing a p53 knockout allele into Rim3 having a mutation in GsdmA3 expressed specifically in the skin. GsdmA3 has GsdmA1 and GsdmA2 as paralogs. GsdmA1 is specifically expressed in the squamous epithelium in the skin, esophagus and foregut region, and GsdmA2 is specifically expressed in the gastric gland epithelium. Squamous cell carcinoma model mice (GsdmA1 mutation / p53 mutation) that develop skin cancer, esophageal cancer, etc. by creating transgenic or knock-in mice with mutations introduced into GsdmA1 or GsdmA2 and then introducing p53 knockout alleles A gastric cancer model mouse (GsdmA2 mutation / p53 mutation) that produces cancer in the gastric gland epithelium can be prepared.

  Until now, several types of skin cancer development model animals have been created using gene deletion (knockout) and gene transfer (transgenic) techniques, many of which require chemical induction for the development of skin cancer, Metastasis to lymph nodes has not been reported (Capozza et al., Am J Pathol. 162 (6). 2029-2039. 2003, Ishikawa et al., Mutat Res. 477 (1-2). 41-49. 2001, Nicolas et al., Nat Genet. 33 (3). 416-421. 2003).

P53 knockout homo mice spontaneously develop lymphoma at 3 to 6 months of age, and p53 knockout hetero mice at 10 months of age, but do not develop skin cancer (Donehower et al., Nature. 356, 215-221. 1992.). In addition, the present inventors have found that the spontaneous incidence of skin cancer in Rim3 (GsdmA3 ^Rim3 / + and GsdmA3 ^Rim3 / ^Rim3 ) is extremely low.

In contrast, Teromausu to Rim3 hetero · p53 knockout provided by the present inventors ^{(GsdmA3 Rim3 / +; Trp53 -} / +) in, multiple manner cause skin squamous cell carcinoma spontaneously than seven months old, old At 12 months, more than 80% of individuals had similar squamous cell carcinomas. Surprisingly, squamous cell carcinoma was confirmed to metastasize to regional lymph nodes.

  Rim3 heterozygous p53 knockout heteromouse of the present invention is useful as a model animal for squamous cell carcinoma because "spontaneous" squamous cell carcinoma "spontaneously" with "frequent" and "multiple occurrence" and metastasis to lymph nodes It is also useful for elucidating the occurrence and mechanism of squamous cell carcinoma as well as for the development of new drugs and diagnostics.

Claims (7)

The DNA encoding the protein described in the following (a) or (b) and a transgenic mouse in which the function of the Trp53 gene is suppressed , wherein the suppression of the function of the DNA is performed by introducing a mutation into the DNA. Transgenic mice .
(A) a protein encoded by DNA comprising the base sequence set forth in SEQ ID NO: 5
(B) a protein comprising the amino acid sequence set forth in SEQ ID NO: 6 It is a model animal for cancer, transgenic mice according to claim 1. The transgenic mouse according to claim 2 , wherein the cancer is skin cancer. A DNA encoding the protein described in (a) or (b) below and a transgenic mouse cell in which the function of the Trp53 gene is suppressed , and the suppression of the function of the DNA is performed by introducing a mutation into the DNA. , Transgenic mouse cells .
(A) a protein encoded by DNA comprising the base sequence set forth in SEQ ID NO: 5
(B) a protein comprising the amino acid sequence set forth in SEQ ID NO: 6 A cell established from the transgenic mouse according to claim 1. The screening method of the compound which complements the phenotype of the transgenic mouse of Claim 1 including the process of the following (a)-(c).
(A) a step of administering a test compound to the transgenic mouse according to claim 1 (b) a step of measuring a phenotype of the transgenic mouse (c) as compared with a case where no test compound is administered Selecting a compound that complements the phenotype The screening method of the compound which complements the phenotype of the animal cell of Claim 4 or 5 including the process of the following (a)-(c).
(A) a step of contacting a test compound with the animal cell according to claim 4 or 5; (b) a step of measuring the phenotype of the cell; and (c) a phenotype compared to when the test compound is not contacted. For selecting a compound complementary to