JP4654432B2 - Inhibitors of activation of StretchActivated channel - Google Patents

Description

  The present invention relates to a peptide that suppresses activation of a mechanosensitive (Stretch Activated; SA) channel, an SA channel activation inhibitor containing the peptide or DNA encoding the peptide as an active ingredient, and a treatment for cardiovascular disease. The present invention relates to a drug, a method for determining cardiovascular disease targeting the peptide, and a method for screening an SA channel activation inhibitor.

  Every cell shows various responses to various mechanical stimuli (tension, pressure, shear stress, etc.), but the mechanism is not well understood. The biggest reason is that the molecular entity and the principle of operation of the receptor (sensor) for mechanical stimulation are unknown. Stretch activated (SA) channel is a general term for ion channels activated by cell membrane extension, and is a new type of ion channel discovered in 1984 (see Non-Patent Document 1, for example). It is expected to form a third group after sex channels and receptor channels. However, since it has both a wide range of ion selectivity and stimuli (some respond to potential and ligand stimulation), it is unlikely that it will constitute a family at the gene level. Other than this, there are SI (Stretch Inactivated) channels that are inactivated by membrane extension, PS (Pressure Sensitive) channels that respond only to stimuli in which the membrane is recessed, or those that are activated by shear stress, and these are also MS ( It is called mechano-sensitive channel or MG (Mechano-gated) channel.

  Among these channels, the higher-order structure is currently known only in bacterial MscL (closed structure) (for example, see Non-Patent Document 2) and MscS channel (open structure) (for example, see Non-Patent Document 3). However, detailed studies of mechanogating mechanisms using point mutants and patch clamp methods or molecular dynamics are ongoing. Bacterial MS channels do not lose their stretch sensitivity even when reconstituted on lipid bilayers, and are thought to open by directly feeling the membrane tension that increases with membrane stretch. (For example, refer nonpatent literature 4) (FIG. 1). On the other hand, as eukaryotic MS channels, many channels belonging to the MEC / DEG family or TRP family, including the Mid1 channel derived from yeast (see, for example, Non-Patent Document 5), have been reported as MS channel candidates. For example, the membrane-penetrating ion channel belonging to the MEC / DEG family related to mechanoreception of nematodes (for example, see Non-Patent Document 6), the relationship between BNC1 (Brain Sodium Channel 1) and skin hair follicle receptors (for example, Non-patent document 7), NOPMC (no mechanreceptor potential C) belonging to TRP channel family and Drosophila mechanosensory hair (for example, refer to non-patent document 8), or VR-OAC (vanilloid receptor-related osmotically activated) The relationship between an osmotic pressure-sensitive channel called “channel” and mechano-reception in the skin and the hearing instrument has been pointed out (see, for example, Non-Patent Document 9). Most recently, Dm CG5842 (a member of TRPV) in the Drosophila auditory organ (see, for example, Non-Patent Document 10), TRPV2 in the mouse myocardium (see, for example, Non-Patent Document 11), and a mouse pain sensation device (high threshold value). There are an increasing number of reports pointing out the close association between the TRPV subfamily and MS channels, such as the association between mechanoreceptors and TRPV4 (see, for example, Non-Patent Document 12).

 However, according to the reported electrophysiological data and personal information, it seems that the ectopic expression efficiency of these channels is not good, and it is not yet in a situation that can withstand detailed electrophysiological analysis. As often pointed out so far, the expression of these channels in the membrane and the exertion of functions may require the cooperation of cell membrane-backed scaffolds and scaffold-related proteins (for example, see Non-Patent Documents 13 and 14). . In fact, there is a report that the functional expression level of TRPV4 in CHO cells is markedly increased by the microfilament-associated protein MAP7 (see, for example, Non-Patent Document 15). Compared with these, 2P (pore) domain K channel (TREK / TRAAK family) (see, for example, Non-Patent Document 16) expressed in various organs of higher organisms, myocardium and vascular smooth muscle recently cloned by the present inventors. The bigKca channel type SAKCA expressed in (see, for example, Patent Document 1 and Non-Patent Documents 17 and 18) has a high expression efficiency and shows a stable stretch sensitivity, so it can be definitely said that it is an MS channel.

Excessive stretch stimulation to the heart causes various responses such as increased automatic ability, induction of arrhythmia / fibrillation, increased ANP, BNP secretion, or hypertrophy. Many studies have been conducted on cardiac hypertrophy, and it has been said that ERK activation downstream of PKC and Ca ²⁺ influx are involved. Recently, however, AT1 receptor is independent of angiotensin II. It has been shown that the body is activated by mechanical stimulation, and ERK activation occurs downstream thereof (see, for example, Non-Patent Document 19). But the essential mechanoreceptor is still a mystery. On the other hand, Hansen et al. Reported an interesting result on the relationship between SA channel and stretch-induced arrhythmia (see, for example, Non-Patent Document 20). They prepared a model that can reproducibly induce stretch-dependent arrhythmia using a canine isolated ventricle, and showed that the arrhythmia is almost completely suppressed by gadolinium (Gd ³⁺ ), a blocker of the SA channel. From these results, they argue that the mechanism of arrhythmia (which can be explained by depolarization by SA channel activation) and suppression by Gd ³⁺ can be explained uniformly by the cation-selective SA channel. Certainly, a 120 pS cation-selective SA channel has been reported in cardiomyocytes (see, for example, Non-Patent Document 21). However, since several types of potassium-selective and anion-selective SA channels have been found in the myocardium afterwards (see, for example, Non-Patent Documents 22 to 24), it is necessary to carefully consider whether or not this is simply divisible. It is. In addition, as described later, it has been reported that a recently discovered MS channel blocker GsMTx-4 derived from sputum has an inhibitory effect on stretch-induced atrial fibrillation (for example, see Non-Patent Document 25). The heart is loaded with shear stress and transmural pressure in addition to the extension stimulus, but research on its effects has not progressed. As described above, Iwata et al. (For example, see Non-Patent Document 11) have reported the expression of TRPV2 that seems to work as an MS channel in mouse myocardium. This is an issue for the future. Alongside myocardium, the best studied is the relationship between vascular endothelial cells and mechanical stress. Endothelial cells have been reported to have a cation-selective SA channel (about 35 pS) activity (see, for example, Non-Patent Document 26), and an increase in intracellular Ca ²⁺ concentration due to activation of this channel has been confirmed ( For example, refer nonpatent literature 27). There is a report that periodic stretching of blood vessels by pulsation activates this channel and contributes to remodeling of cell morphology and enhancement of adhesion (for example, see Non-Patent Documents 28 and 29). A similar SA channel is also expressed in vascular smooth muscle and seems to contribute to stretch-induced contraction. The elucidation of the molecular entity of SA channels in vascular endothelial cells is a mystery that many researchers have been waiting for. Moreover, although the K channel which responds to shear stress has been reported long ago (for example, refer nonpatent literature 30), there is no remarkable progress after that.

It has long been pointed out that mechano-electric-feedback is important for the function of the heart because it is the organ that repeatedly contracts and relaxes most actively in the body. However, nothing is known about the essential mechanical sensor. Therefore, the most probable MS channel screening as a mechanical sensor was performed using cultured cardiomyocytes isolated from chicken embryos (see, for example, Non-Patent Document 22). After that, we re-screened using the same specimen and identified five types of MS channels, one cation channel and four types of K channel, and the K channel with the highest conductance with the highest observation frequency was calcium. It was found to match a dependent BigK (BK) channel. In addition to Ca ²⁺ dependence and voltage dependence, which are the characteristics of BK channel (intracellular), this channel has both extension dependence and intracellular ATP dependence, so it was initially named SAKca and ATP channel (for example, And non-patent document 23). This is a report of the first BK channel in the myocardium. Since it is known that the BK channel is a protein encoded by a gene called siol (see, for example, Non-Patent Document 31), the present inventors prepared from chicken embryo cardiomyocytes using degenerate primers for the BK channel. Based on the obtained library, gene cloning of SAKca and ATP channels was attempted. As a result, a specific sequence called STREX (Stress-Axis-Regulated-Exon) (for example, see Non-patent Document 32) having very high homology with a known BK channel and consisting of 59 amino acid residues at the C-terminal is inserted. Was successfully identified as SAKCA (FIG. 2a). The stress here is not a mechanical stress but a physiological / psychological stress, and it is known that a BK channel having this insertion sequence is up-regulated when such stress is applied ( For example, refer nonpatent literature 33). When this gene was transiently expressed in CHO cells, a SABKca channel having a conductance of 280 pS (140 mM K) similar to that of cardiomyocytes was observed with good reproducibility. Moreover, when an antibody against the STREX sequence was prepared and immunohistology was performed, strong expression was observed in the myocardium and vascular smooth muscle.

  The BK channel generally consists of an α subunit that has all the basic characteristics of the channel and a β subunit that modifies its gating properties, and we have cloned the former. From the results of co-expression of both subunits, almost all properties of the natural SAKca channel could be reproduced with only the α subunit. Here, the result of only the α subunit is introduced (for example, see Non-Patent Document 17). So far, stretch stimulation-dependent BK channels have been reported in several cells and tissues. In many cases, the BK channel seems to be indirectly activated by the increase in calcium accompanying the activation of the calcium permeable SA channel coexisting in the patch membrane (see, for example, Non-Patent Document 34). There is also a report that extension is directly activated (see, for example, Non-Patent Document 35). On the other hand, BK channels and their splicing variants (including STREX insertion) have been cloned from many species and cells (see, for example, Non-Patent Document 36), but there is no report regarding the relationship between stretch sensitivity and molecular structure. .

  As described above, the present inventors newly cloned a gene of calcium-dependent potassium permeable mechanoreceptor (SAKCA) channel protein that activates against cell membrane stretch stimulation in Patent Document 1 described above, An SA channel protein consisting of 1172 amino acids (see FIG. 1) was obtained, and it was revealed that this SAKCA channel contains a STREX sequence and that the STREX sequence is important for stretch sensitivity.

JP 2000-97060 A J. Physiol. 352, 685-701 (1984) Science 282, 2220-2226 (1998) Science 298, 1582-1587 (2002) Biophys. J. 86, 2113-2120 (2004) Science 285, 882-886 (1999) Nature 349, 588-593 (1991) Nature 407, 1007-1011 (2000) Science 287, 2229-2234 (2000) Cell 103, 525-535 (2000) Nature 424, 81-84 (2003) J Cell Biol. 2003, 9; 161 (5): 957-67 THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 25, Issue of June 20, pp. 22664-22668 (2003) Biophys J. 59, 722-728 (1991) Proc Natl Acad Sci USA. 93, 6577-6582 (1996) THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 51, Issue of December 19, pp. 51448-51453 (2003) Curr. Opin. Cell Biol. 13, 422-428 (2001) J Membr Biol, 196: 185-200 (2003) Biophys. J. 86, A2825 (2004) Nat Cell Biol. 2004 Jun; 6 (6): 499-506 Circulation 81, 1094-1105 (1990) Biosci. Rep., 8: 407-414 (1988) Am. J. Physiol. 264 (3 Pt 2): H960-72 Am. J. Physiol.276, H 1827-38 (1999) J. Physiol., 456: 285-302 (1992) Nature 409, 35-36 (2001) Nature 325, 811-813 (1987) Am. J. Physiol. 264: C1037-C1044 (1993) Am. J. Physiol. 43: H1532-H1538 (1998) Biochem. Biophys. Res. Com. 239: 372-376 (1997) Nature 331: 168-170 (1998) Science 261, 221-224 (1993) J. Biol. Chem. 272, 11710-11717 (1997) Science 280, 443-446 (1998) Am. J. Physiol.257, F347-F452 (1989) Am. J. Hypertens. 7, 82-89 (1994) J. Neuron 19, 1061-1075 (1997)

  An object of the present invention is to provide a peptide that suppresses SA channel activation, an SA channel activation inhibitor comprising the peptide or DNA encoding the peptide as an active ingredient, a therapeutic agent for cardiovascular disease, the peptide The object is to provide a method for determining a targeted cardiovascular disease and a screening method for an SA channel activation inhibitor.

  Since the STREX sequence is rich in cysteine, there is a possibility of specific binding between STREX centered on the ERA sequence and the unknown protein X, and the binding with the unknown protein X is essential for realizing the SA activity. The hypothesis is considered. In other words, SAKCA needs to feel the extension of the membrane in some way, but from the previous secondary structure prediction, STREX, which is the responsible site, is exposed to the cytoplasm side and seems to interact directly with the cell membrane. Nor. Thus, when SAKCA and an excess of STREX-GFP fusion protein were co-expressed in CHO cells, the localization of STREX-GFP in the cell membrane was confirmed first, and the possibility that the STREX partner was a membrane-associated protein. More importantly, over-expression of STREX-GFP significantly inhibited the SA activity of SAKCA. That is, it was considered that the excessive STREX introduced competed with STREX of SAKCA to inhibit the binding of unknown protein X and SAKCA-STREX. Furthermore, 7-amino acid peptides of various sequences centering on ALA at position 672 in the STREX sequence were synthesized, and the influence on the SAKCA channel from the cytoplasm side was examined. As a result, only the LERAFPL sequence (SEQ ID NO: 1) containing ERA was SA activity. I found that I strongly suppressed.

  The next challenge is the identification of the mysterious mediator protein X. The present inventors thought that this protein could be purified using the inhibitory specificity of the LERAFPL sequence, and prepared an affinity column on which various peptides containing this sequence were immobilized, and applied it to the lysate of cardiomyocytes. As a result, a protein having a molecular weight of about 50 kDa that specifically binds to the LERAFPL sequence column could be purified. When the peptide sequence was determined with a mass spectrometer, it was found that the hypothetical protein X is a peptide elongation factor EF1-α which is one of ubiquitous proteins, and the present invention has been completed.

  That is, the present invention comprises (1) a peptide consisting of an amino acid sequence represented by LERAFPL and suppressing activation of a mechanosensitive (Stretch Activated) channel, (2) the peptide according to (1) above, a marker protein and / or The present invention relates to a fusion peptide in which a peptide tag is bound, (3) a mechanosensitive (Stretch Activated) channel activation inhibitor comprising as an active ingredient a peptide comprising an amino acid sequence represented by LERAFPL or a DNA encoding the peptide.

The present invention further relates to ( 4 ) a mechanosensitive (Stretch Activated) channel characterized in that a test substance is contacted with a peptide comprising the amino acid sequence shown in LERAFPL in vitro and the degree of binding is measured and evaluated. The present invention relates to a screening method for an activation inhibitor.

  According to the present invention, a peptide that suppresses SA channel activation, an SA channel activation inhibitor comprising the peptide or DNA encoding the peptide as an active ingredient, a therapeutic agent for cardiovascular disease, and the peptide target And a screening method for an SA channel activation inhibitor.

  The peptide that suppresses the activation of the SA channel of the present invention is not particularly limited as long as it is a peptide consisting of the amino acid sequence (SEQ ID NO: 1) shown in LERAFPL, and can be prepared by such peptide chemical synthesis. For example, the peptide of the present invention can be synthesized according to chemical synthesis methods such as Fmoc method (fluorenylmethyloxycarbonyl method), tBoc method (t-butyloxycarbonyl method), and various commercially available peptide synthesizers. It is also possible to synthesize the peptide of the present invention.

  The fusion peptide of the present invention may be any peptide as long as the peptide of the present invention is bound to the marker protein and / or peptide tag. The marker protein is not particularly limited as long as it is a conventionally known marker protein. Specific examples include an enzyme such as alkaline phosphatase and HRP, an Fc region of an antibody, and a fluorescent substance such as GFP. As peptide tags, known peptide tags such as epitope tags such as HA, FLAG, and Myc, and affinity tags such as GST, maltose-binding protein, biotinylated peptide, oligohistidine, etc. It can be illustrated. Such a fusion peptide can be prepared by a conventional method. Purification of the peptide of the present invention utilizing the affinity between Ni-NTA and His tag, detection of the peptide of the present invention, and quantification of an antibody against the peptide of the present invention It is also useful as a research reagent in this field.

  The SA channel activation inhibitor of the present invention is not particularly limited as long as it comprises a peptide consisting of the amino acid sequence shown in LERAFPL or a DNA encoding the peptide as an active ingredient. The base sequence CTTGAGAGAGCCCTTCCACTTT shown by can be specifically illustrated. SAKCA is expressed in the presence of smooth muscle cells such as vascular smooth muscle, bronchial smooth muscle, and visceral smooth muscle in addition to the myocardium, and is also expressed in the kidney. Thus, the activity of the SA channel of the present invention. The anti-oxidation agent may be used as a preventive / therapeutic agent for respiratory diseases and visceral diseases in addition to cardiovascular diseases.

  The prophylactic / therapeutic agent for cardiovascular disease of the present invention is not particularly limited as long as it comprises a peptide consisting of the amino acid sequence shown in LERAFPL or a DNA encoding the peptide as an active ingredient. Arrhythmia, hypertension, cardiomyopathy, arteriosclerosis, myocardial infarction and the like. When the peptide that suppresses activation of the SA channel of the present invention is used as an active ingredient as a prophylactic / therapeutic agent for cardiovascular disease of the present invention, a method for introducing it into cells such as the heart is non-shared with macromolecules. Non-cytotoxic reagents such as Chariot (manufactured by Active Motif) that can form conjugates, change the structure of macromolecules such as proteins, and deliver macromolecules such as proteins into cells can be used . In addition, when a DNA encoding a peptide that suppresses activation of the SA channel of the present invention is used as an active ingredient as a prophylactic / therapeutic agent for cardiovascular disease of the present invention, the DNA is integrated into an appropriate expression vector, The vector of the present invention is expressed in cells by introducing such vectors into cells by electroporation, ultrasound, gene gun, hydrodynamics injection, or by gene delivery using gene carrier molecules such as dendritic polylysine. Can be made. When preparing a preparation, a solvent such as physiological saline alcohol, a solubilizing agent such as polyethylene glycol and propylene glycol, a suspending agent such as stearyltriethanolamine, sodium lauryl sulfate, and lecithin, glycerin, D-mannitol and the like. Buffering agents such as tonicity agents, phosphates, acetates and citrates can be blended.

The method for determining a circulatory disease of the present invention is not particularly limited as long as it is a method targeting a peptide portion consisting of the amino acid sequence shown in LERAFPL, and specifically, LERAFPL in the human STREX sequence (see FIG. 2). When the nucleotide sequence of the corresponding part is examined and the amino acid sequence encoded by the nucleotide sequence is different from LERAFPL, for example, mutations such as LERTFPL (SEQ ID NO: 3), LGRAFPL (SEQ ID NO: 4), LAPEFRL (SEQ ID NO: 5) are observed. In this case, the stretch sensitivity is low, and the possibility of cardiovascular diseases such as arrhythmia and hypotension is high.

  As a screening method for the SA channel activation inhibitor of the present invention, any method can be used in which a peptide comprising the amino acid sequence shown in LERAFPL is brought into contact with a test substance in vitro, and the degree of binding is measured and evaluated. The method of contacting the peptide of the present invention with a test substance and measuring and evaluating the degree of binding is not particularly limited, and the test substance is contacted and bound to LERAFPL bound to an NHS-activated HiTrap column. In addition to the method using affinity chromatography, a two-hybrid method, a phage display method and the like can be specifically mentioned. Substances such as proteins obtained by this screening method bind to the amino acid sequence part shown in LERAFPL in the STREX sequence of the SA channel and prevent the amino acid sequence part shown in LERAFPL in the STREX sequence from binding to EF-1. Therefore, it is possible to suppress the activation of SA channel. Therefore, it can be expected as a prophylactic / therapeutic agent for cardiovascular diseases such as arrhythmia, hypertension, cardiomyopathy, arteriosclerosis and myocardial infarction.

  EXAMPLES Hereinafter, although an Example demonstrates this invention more concretely, the technical scope of this invention is not limited to these illustrations.

(Interaction between STREX and membrane-associated components)
STREX has been suggested to interact with other molecules due to its nature of being rich in cysteine and proline (Saito et al., 1997), thus the STREX sequence interacts directly or indirectly with membrane association components, It is not unnatural to assume the possibility of sensing the strength in the membrane. Considering that the above-mentioned interaction is necessary for this stretch sensitivity, when STREX having an ERA sequence becomes excessive, the binding partner is occupied, and as a result, the binding of the STREX partner in SAK _Ca C with the STREX partner becomes difficult. Blocked (FIG. 3A, schematic). In order to demonstrate this hypothesis, we over-expressed the avian STREX (including ERA) -EGFP fusion protein in SAK _Ca- expressing CHO cells. As shown in FIG. 3A, GFP signal was detected in the membrane, suggesting that STREX-GFP was localized in the cytoplasmic membrane. More interestingly, the stretch sensitivity of SAK _Ca C was remarkably suppressed, suggesting that the interaction with the STREX sequence and several membrane-associated proteins is important for the stretch sensitivity of SAK _Ca C. (FIG. 3B). This is because when the STRAF fragment of the LERAFPL peptide is applied to the excised inside-out patch, the extension sensitivity of SAK _Ca C is remarkably suppressed. This is supported by the observation that sensitivity was not suppressed (FIGS. 4A and B).

(Isolation of STREX-binding protein and identification using mass spectrometer)
Since it is suggested that STREX and an unknown component associate with each other for stretch sensitivity, the present inventors performed in vitro binding analysis using STREX peptide and avian heart extract. According to the manufacturer's manual, STREX peptides (LERAFPL, LERTFPL, LGRAFPL, LAPEFRL; 1 mg each) were cross-linked to NHS activated HiTrap columns (1 ml) (Amersham Biosciences). Avian embryonic heart (12 days after birth (12D)) at 4 ° C. in lysis buffer (pH 7.40) containing 1% NP40, 25 mM Tris, proteinase inhibitor (complete, Mini, Protease inhibitor cocktail tablets, manufactured by Roche) Was then homogenized and then centrifuged at 15000 × g, 4 ° C. for 20 minutes. The supernatant (1 mg of protein) was applied to the column, and the bound protein was eluted using a solution (pH 3.0) containing 1% NP40, 100 mM glycine.

  The eluted protein was immediately separated by SDS-PAGE, subjected to silver staining or Coomassie blue staining, and subjected to analysis by a mass spectrometer and in-gel proteolysis. As a result of the SDS-PAGE experiment, bands having clear molecular weights (42 kDa and 50 kDa) were observed only in the bird STREX, but not in the mouse, rabbit and mixed STREX (FIG. 5A, left panel). The stained protein band in the gel was cut with a clean laser blade, the protein in the gel was reduced with 10 mM DTT and modified with 100 mM iodoacetamide in 10 mM ammonium bicarbonate. Gel pieces were treated with 50% acetonitrile in 10 mM ammonium bicarbonate to remove protein staining and the gel pieces were dried. The dried gel pieces were rehydrated with 10 mM ammonium bicarbonate containing 300 ng trypsin (Promega). The gel pieces were incubated overnight at 37 ° C., and the resulting peptides were collected using 60% acetonitrile containing 0.1% trifluoroacetic acid.

  The trypsin peptide was dissolved and analyzed on an LCQ ion trap (IT) mass spectrometer (ThermoFinnigan) equipped with an electrospray ionization (ESI) source and a MAGIC 2002 liquid chromatography system (Michrom BioResources). Using the mass spectrometry data, a protein database was searched using a mascot search engine. That is, a protein that associates with avian STREX (LERAFPL) was analyzed by combining a mass spectrometry approach and a sequence database search method. The signal in the spectrum was comparable to the tryptic peptide produced from the protein by trypsin digestion in the gel. Using the measured peptide mass, a sequence database (Mascot search engines) was searched for proteins that yielded a similar tryptic peptide mass map. The 42 kDa protein was identified as actin and the 50 kDa protein was identified as EF-1α. As a result of immunoblotting using an anti-EF-1α antibody, it was further confirmed that the 50 kDa purified protein was EF-1 (FIG. 5A, right figure).

(SiRNA transfection and cell culture)
To investigate the role of EF-1 in SAK _Ca C stretch sensitivity, a short interfering RNA (siRNA) was used to abolish EF-1 expression in cultured avian embryo myocardium. The ability to suppress the mechanosensitivity of siRNA duplexes targeting the coding region of mRNA encoding EF-1 and firefly luciferase as a control was examined. The avian EF-1 siRNA against the EF-1 (Gallus gallus elongation factor 1 alpha) cDNA sequence (accession number: L00677) was designed by B-Bridge International Inc. (San Jose, Calif.) And synthesized by Dharmacon. did. The sequences used in the experiment are as follows: 5′-CCAUGUGUGUGUGAGAGCUU-3 ′ (1226-1244 nucleotides in the ORF). In addition, the position of the target sequence was determined in relation to the first nucleotide of the start codon. A siRNA of a firefly (Photinus pyralis) luciferase gene was used as a control. The siRNA was transfected into cultured avian embryonic cardiomyocytes using siFECTOR (B-Bridge International Inc.).

  In order to clarify that the target protein was actually removed from the embryonic cardiomyocytes, Western blotting was performed using an anti-EF-1α antibody. As shown in FIG. 5B, the expression of the EF-1α protein was significantly reduced when the siRNA duplex for EF-1α was used as compared to the control cells treated with the siRNA duplex for luciferase. Actin expression was not affected by siRNA treatment.

Although the stretch sensitivity of SAK _Ca C in cells treated with siRNA-luciferase was not affected, the stretch sensitivity in cells treated with siRNA-EF-1α was significantly suppressed (FIG. 5C).

From the above results, it is suggested that EF-1α plays an important role in the extension sensitivity of SAK _Ca C.

The deduced amino acid sequence of the SAKCA channel derived from avian heart is shown, and the frame shows the STREX sequence. It is a figure which shows the amino acid sequence of each STREX of a bird, a human, a mouse | mouth, and a rabbit. A black character is a figure which shows a branch. FIG. 5 illustrates the importance of STREX binding to membrane-bound components. (A) Confocal fluorescence image (left) and DIC image (right) of CHO cells co-transfected with SAK _Ca and STREX-GFP. (B) It is a figure which shows the opening possibility of SAK _Ca in the inside-out patch in the presence or absence of STREX-GFP (−40 mmHg, +10 mV, n = 6). (A) Representative channel activity observed in an inside-out patch isolated from SAK _Ca- expressing CHO cells before (left) and after (right) application of 1 mg / ml STREX peptide (LERAFPL: -40 mV). It is a figure which shows the trace of one channel. (B) Opening potential of SAK _Ca before (control) and after application of various 1 mg / ml STREX peptides and mixed peptide sequences is shown (−40 mmHg, +10 mV, n = 6). It is a figure which shows the identification of STREX binding protein. (A) Silver staining (left) of STREX-binding protein of avian embryo heart extract and Western blotting (right) using anti-EF-1α. (B) It is a figure which shows that EF-1 (alpha) lose | disappears by siRNA duplex. As a result of Western blotting, it was shown that EF-1α disappeared efficiently in avian embryonic heart muscle, but actin did not disappear. (C) As a result of EF-1α being eliminated by siRNA duplex, the extension sensitivity of SAK _Ca was lost (−40 mmHg, +10 mV, n = 3).

Claims (4)

  A peptide consisting of an amino acid sequence represented by LERAFPL and inhibiting activation of a Stretch Activated channel.   A fusion peptide comprising the peptide according to claim 1 bound to a marker protein and / or a peptide tag.   A mechanosensitive (Stretch Activated) channel activation inhibitor comprising a peptide comprising the amino acid sequence represented by LERAFPL or a DNA encoding the peptide as an active ingredient.   A screening method for a mechanosensitive (Stretch Activated) channel activation inhibitor, comprising contacting a test substance with a peptide comprising the amino acid sequence shown by LERAFPL in vitro, and measuring and evaluating the degree of binding thereof .