JP4538628B2 - Gene expression detection method - Google Patents

Description

  The present invention relates to a gene expression detection method for analyzing gene expression.

  In situ hybridization and immunostaining are known as methods for detecting gene expression. In situ hybridization is performed to detect mRNA transcribed from the target gene, and immunostaining is performed to detect the protein that is the final product of the target gene. Even if mRNA and protein are derived from the same gene, mRNA and protein often show different distributions due to mRNA instability and post-transcriptional regulation. However, when in situ hybridization and immunostaining are performed independently using different samples, it is difficult to compare expression detection regions at the cellular level. Therefore, it is desirable to be able to perform these methods on the same sample.

In in situ hybridization, a nucleic acid probe labeled with a label is hybridized to the target mRNA. In immunostaining, an antibody against the target protein is bound to the protein, so that the mRNA and the protein. Are detected respectively. Therefore, since these two methods are completely different, in order to perform these methods on the same sample, it is difficult to perform a series of processes for each method at the same time, and it is necessary to perform them sequentially. (For example, see Non-Patent Document 1)
When these methods are sequentially performed on the same sample, the probe is labeled with dicoxygenin (abbreviated as digoxygenin or DIG) in in situ hybridization, and the antibody is labeled with an enzyme such as alkaline phosphatase or HRP in immunostaining. In many cases, both perform a color reaction using enzyme activity to detect a signal in the final stage. However, regardless of which color development reaction is used, once the sample is colored, the penetration of the probe and antibody is inhibited, so the previous procedure is temporarily stopped at the stage of probe hybridization or primary antibody binding. Then, after performing the technique to be performed later, it is usual to perform color development at the final stage at the same time.
Current Topics Microbiol. Immunology 1989, 143, 9-20

  In addition to the color reaction, one treatment often interferes with the detection of the other. In particular, the target protein or primary antibody is degraded by the proteolytic treatment that is performed as a pretreatment by in situ hibrydization, resulting in an immunostaining method. Detection of antigen in

  Therefore, the present invention performs both in situ hybridization and immunostaining on the same sample, and improves detection results when performing simultaneous detection methods for detecting both mRNA and protein. A processing method is provided. In each method and the simultaneous detection method, the processing method of the present invention can be used independently. In the simultaneous detection method, only one of the processing methods of the present invention may be used. It may be used.

  The inventors conducted both in situ hybridization and immunostaining on the same sample to search for proteases suitable for simultaneous detection that detects both mRNA and protein, and simultaneously detected more than 40 types of proteases. As a result of examining the suitability for the detection method, it was found that the detection result was greatly improved by using Thermolysin (EC3.4.24.27). In addition, it has been found that the detection result is greatly improved by searching for a processing step suitable for the simultaneous detection method and applying a cross-linking agent conventionally used in the field of biochemistry. Thus, the present invention has been completed.

  The proteolytic agent for use in the in situ hybridization method according to the present invention contains thermolysin.

  The in situ hybridization method of the present invention uses thermolysin as a proteolytic agent.

  The in situ hybridization method of the present invention comprises a step of immobilizing a sample, a step of subjecting the immobilized sample to proteolysis using thermolysin, and a nucleic acid probe labeled with a label to the mRNA to be detected. A step of hybridizing and a step of detecting the label may be provided. In this in situ hybridization method, the sample may be a tissue section or a whole-mount individual.

  Crosslinkers for use in the immunostaining method according to the present invention include 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride, 4-succinimidyloxycarbonyl-methyl-α- [2-pitidyldithio] toluene, bis -Maleimidohexane, p-azidobenzoyl hydrazide, N-succinimidyl [4-iodoacetyl] aminobenzoate, N- [g-maleimidobutyryloxy] succinimide ester, sulfo-N- [g-maleimidobutyryloxy] succinimide ester, Selected from the group consisting of dimethyl suberimidate dihydrochloride, bis (sulfosuccinimidyl suberate), sulfo-N-hydroxysulfosuccinimide, N-hydroxysulfosuccinimide, and 4- [p-azidosalicylamido] butylamine Is done.

  The immunostaining method of the present invention performs a crosslinking reaction using a crosslinking agent. In this immunostaining method, the cross-linking reaction may be performed between primary antibody administration and secondary antibody administration.

  The immunostaining method of the present invention includes a step of fixing a sample, a step of binding a primary antibody to a protein to be detected with respect to the fixed sample, and a cross-linking agent for the sample to which the primary antibody is bound. A step of performing the cross-linking reaction used, a step of binding a secondary antibody labeled with a label to the primary antibody, and a step of detecting the label to the sample subjected to the cross-linking reaction. Also good. In this immunostaining method, the sample may be a tissue section or a whole-mount individual.

  In any of the above immunostaining methods, a crosslinking reaction using the crosslinking agent may be performed.

  The simultaneous detection method of the present invention is a simultaneous detection method for detecting both mRNA and protein by performing both in situ hybridization method and immunostaining method on the same sample, and using thermolysin as a proteolytic agent. It is characterized by.

  The simultaneous detection method of the present invention is a simultaneous detection method for detecting both mRNA and protein by performing both in situ hybridization method and immunostaining method on the same sample. A proteolytic treatment using thermolysine on the prepared sample, a step of hybridizing the nucleic acid probe labeled with the first label to the mRNA to be detected, and the hybridized sample A step of binding a primary antibody to a protein to be detected, a step of binding a secondary antibody labeled with a second label to the primary antibody, and a step of detecting the first and second labels And may be provided.

  The simultaneous detection method of the present invention is a simultaneous detection method for detecting both mRNA and protein by performing both in situ hybridization method and immunostaining method on the same sample. The reaction may be performed.

  The simultaneous detection method of the present invention is a simultaneous detection method for detecting both mRNA and protein by performing both in situ hybridization method and immunostaining method on the same sample, the step of fixing the sample, A step of binding a primary antibody to a protein to be detected with respect to a fixed sample, a step of performing a cross-linking reaction using a cross-linking agent with respect to a sample to which the primary antibody is bound, and the cross-linked sample, A step of proteolytic treatment, a step of hybridizing a nucleic acid probe labeled with a first label to the mRNA to be detected, on the sample subjected to the proteolytic treatment, and the proteolytic treatment The sample may include a step of binding a secondary antibody labeled with a second label to the primary antibody, and a step of detecting the first and second labels.

  In the above simultaneous detection method, proteolytic treatment may be performed using thermolysin. Moreover, you may perform the crosslinking reaction using the said crosslinking agent.

  The automatic in situ hybridization apparatus and the automatic immunostaining apparatus of the present invention automatically perform any of the above in situ hybridization methods and any of the above immunostaining methods. Moreover, the automatic simultaneous detection apparatus of the present invention automatically performs any of the simultaneous detection methods described above.

  The kit for in situ hybridization of the present invention contains thermolysin as a proteolytic agent. The kit for immunostaining of this invention contains a crosslinking agent. Further, the crosslinking agent may be any of the above crosslinking agents.

  According to the treatment method of the present invention, the detection result in the in situ hybridization method or immunostaining method is improved. In particular, both in situ hybridization and immunostaining can be performed on the same sample, and the detection result can be improved when performing simultaneous detection that detects both mRNA and protein.

  Hereinafter, embodiments of the present invention completed based on the above knowledge will be described in detail with reference to examples. Unless otherwise stated in the embodiments and examples, J. Sambrook & DWRussell (Ed.), Molecular Cloning: a laboratory manual (3rd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York ( 2001); FM Ausubel, R. Brent, RE Kingston, DD Moore, JG Seidman, JA Smith, K. Struhl (Ed.), Current Protocols in Molecular Biology, John Wiley & Sons Ltd. The described method, or a modified or modified method thereof is used. In addition, when using commercially available reagent kits and measuring devices, unless otherwise explained, protocols attached to them are used.

  The objects, features, advantages, and ideas of the present invention will be apparent to those skilled in the art from the description of the present specification, and those skilled in the art can easily reproduce the present invention from the description of the present specification. it can. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention, and are shown for illustration or explanation. It is not limited. It will be apparent to those skilled in the art that various modifications and variations can be made based on the description of the present specification within the spirit and scope of the present invention disclosed herein.

  In particular, the in situ hybridization method and the immunostaining method used in the present invention are very widely used among those skilled in the art, and those skilled in the art routinely perform even if there is no particular explanation. It goes without saying that processing can be applied. In addition, various improvement methods have been found according to each researcher's experience, and the present invention can be applied to all such methods, and the present invention is limited by methods other than the features of the present invention. There is no.

== Sample ==
The sample to which the present invention is applied may be of any origin, and representative biological species include plants, nematodes, Drosophila, squirts, Xenopus, chickens, quail, pigs, mice, rats, humans, etc. It is not limited to.
The sample may be a part or all of these organisms. For example, a tissue or organ may be taken out and used as a sample, or an embryo may be used as a sample. Moreover, what cultured the cell and the structure | tissue may be used.
The origin of the sample is not particularly limited with respect to the developmental stage of these species. For example, in the case of animals, eggs (egg), embryos (embryo), fetuses, adults ( adult) or the like.

== Fixing of sample / Sample preparation ==
First, the sample is fixed. As a fixing method, the sample may be directly immersed in a fixing solution, or reflux fixed.
The fixing solution may be anything, for example, glutaraldehyde, formaldehyde aqueous solution, formalin or a mixed solution thereof is used, and 4% formaldehyde aqueous solution is most often used.
In the case of tissue, the sample may be a section or a whole-mount. In the case of a section, any of a frozen section, a paraffin section, a plastic section using a resin or the like as an embedding agent may be used. In the case of cultured cells, the cells may be cultured on a slide glass and the slide glass may be used as a sample, or the cells cultured on a culture dish may be used as they are.

== In situ hybridization method ==
First, as a pretreatment, a fixed section or a whole-mount sample is appropriately treated such as deparaffinization or rehydration. Thereafter, proteolytic treatment is performed to expose the mRNA by decomposing the protein that binds to the mRNA so that the probe can be easily accessed. In the present invention, thermolysin is used as a proteolytic agent used for proteolytic treatment. The treatment time for the proteolytic treatment is preferably 5 to 30 minutes, and the treatment temperature is preferably 37 to 50 ° C., but is not limited to these numerical values. In practice, several conditions including the concentration are tried in advance, It is preferable to optimize. In this proteolytic treatment, in addition to thermolysin, other proteolytic enzymes such as proteinase K and trypsin may be mixed and used. Thereafter, a series of pretreatments such as quenching with glycine and acetylation with acetic anhydride may optionally be performed.

  After sample pretreatment, prehybridization and hybridization are performed. Prehybridization is performed at 37 ° C. for 30 to 60 minutes, for example, in a solution containing SSC and Forimamide. The concentration of each reagent is preferably 0.1 to 2 × SSC and 1 to 50% Forimamide, but is not particularly limited to these conditions. Hybridization is performed overnight at 37 ° C. in a solution containing, for example, SSC, SDS, and Formamaide. The concentration of each reagent is preferably 0.1-2 × SSC, 0.05-1% SDS, 1-50% Formamaide, but is not particularly limited to these conditions. The probe used for hybridization may be labeled with a label such as a radioisotope or biotin, but is most often labeled with digoxigenin. The probe may be an oligonucleotide, single-stranded DNA, double-stranded DNA, or RNA. The probe may be synthesized by chemical synthesis, using a primer extension using a DNA-dependent DNA polymerase, an in vitro transcription system using a DNA-dependent RNA polymerase, or using PCR. Also good.

  After hybridization, the sample is washed and a detection reaction suitable for each label is performed. For example, a probe labeled with a radioisotope is developed using an emulsion. When the label is biotin or digoxigenin, detection is performed by using an anti-biotin antibody or anti-digoxigenin antibody to which an enzyme such as HRP, alkaline phosphatase, or β-GAL is bound, and using a substrate for the enzyme to develop a color. In the detection process using this antibody, the signal can be amplified by various methods such as the ABC method.

== Immunostaining method ==
First, as a pretreatment, a fixed section or whole mount sample is appropriately treated, such as a deparaffinization treatment or a rehydration treatment, and then treated with a primary antibody against a protein to be detected. As the primary antibody, one bound to HRP or alkaline phosphatase may be used. The treatment conditions are preferably 4 to 37 ° C. and 1 hour to several days, but the reaction conditions are not limited thereto.

After the primary antibody reaction, the sample is washed with PBS or the like, and a crosslinking reaction is performed using a crosslinking agent. As a crosslinking agent, EDC (0.1 to 10 mg / mL 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride in 0.1 M female (2- (N-morpholino) ethanesulfonic acid monohydrate solution; 1 -Ethy-3- (3-Dimethylaminopropyl) carbdiimide Hydrochloride in 0.1M MES (2- (N-Morpholino) ethanesulfonic acid monohydrate)), SMPT (0.01-5 mM 4-succinimidyloxycarbonyl-methyl-α- [2 -Pitidyldithio] toluene in PBS; 4-Succinimidyloxycarbonyl-methl-α- [2-pyridyldithio] toluene in PBS), BMH (0.5-20 mM bis-maleimidohexane in PBS; Bis-Maleimidohexane in PBS), ABH (0.1- 10 mM p-azidobenzoyl hydrazide in PBS; p-Azidobenzoyl hydrazide in PBS), SIAB (0.1-10 mM N-succinimidyl [4-iodoacetyl] aminobenzoate in PBS; N-Succinimidyl [4-iodoacetyl] aminobenzoate in PBS) , GMBS (0.1-10 mM N- [g-male Midobutyryloxy] succinimide ester in PBS; N- [g-Maleimidobutyryloxy] succinimide ester in PBS), Sulfo-GMBS (0.1-10 mM sulfo-N- [g-maleimidobutyryloxy] succinimide ester in PBS; sulfo -N- [g-Maleimidobutyryloxy] succinimide ester in PBS), DMS (1-50 mM dimethyl suberimidate · 2 HCl in PBS; Dimethyl Suberimidate · 2 HCl in PBS), BS ³ (1-50 mM bis (sulfosk) Sulfo-NS (sulfo-N-hydroxysulfosuccinimide) or NHS (N-hydroxysulfosuccinimide), such as Bis (sulfosuccinimidyl suberate) in PBS) ), ASBA (0.1-10 mM 4- [p-azidosalicylamido] butylamine in PBS; 4- [p-Azidosalicylamido] butylamine) in PBS) be able to. The reaction may be incubated at room temperature for 1-2 hours, but is not limited to this condition.

  After the cross-linking reaction, the sample is washed with PBS or the like and treated with a secondary antibody to which an enzyme such as HRP, alkaline phosphatase, or β-Gal (β-galactosidase) is bound. When a primary antibody bound to HRP or alkaline phosphatase is used, the secondary antibody treatment can be omitted.

  Finally, a signal is detected by adding a substrate of an enzyme bound to the antibody and developing a color. Representative substrates include diaminobenzidine solution (DAB Tris Tablets, MUTO PURE CHEMICALS) for HRP, NBT (Nitrotetrazolium Blue Choride) and BCIP (5-Bromo-4-Chloro) for alkaline phosphatase. -3-indolyl-phosphate disodium salt) and β-Gal include X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) solution.

  In addition to the method described here, the signal can be amplified by various methods such as the ABC method.

== Simultaneous detection method I ==
When both the in situ hybridization method and immunostaining method are performed on the same sample and both mRNA and protein are detected, there are three possible methods depending on the order of adding the hybridization probe and the primary antibody for immunostaining. .

  First, a method for adding a hybridization probe and an immunostaining primary antibody to the same solution and reacting with a sample will be described. According to this method, since the hybridization and the primary antibody reaction can be performed simultaneously, the time required for all the processes is shortened.

  First, the sample to be detected is subjected to pretreatment suitable for the sample, such as deparaffinization treatment, rehydration treatment, proteolysis treatment, quenching, and acetylation using acetic anhydride. Since this pretreatment is the same as the in situ hybridization method described above, details are omitted.

  Next, hybridization and primary antibody reaction are performed in one solution containing, for example, SSC and SDS. The concentration of each reagent is preferably 0.1 to 0.5 × SSC, 0.01 to 0.05% SDS, but is not particularly limited to these conditions. Since an antibody reaction is also carried out, the SDS concentration in this solution is preferably low, and it is preferable not to contain Formamaide. Furthermore, this solution contains a probe and a primary antibody labeled with a label for hybridization (first label) of 1 to 20 μg / mL. Incubate samples in Solution A at 37-50 ° C. overnight. The method for preparing the hybridization probe is the same as the in situ hybridization method described above, but it is preferable to label with biotin or digoxigenin.

  After washing the sample, a solution containing an enzyme-bound antibody that specifically binds to the first label bound to the probe and a secondary antibody bound to the enzyme (second label) for the primary antibody is prepared. The sample is incubated therein at 4 to 37 ° C. for 1 hour to several days, but the reaction conditions are not particularly limited. In addition, in order to be able to detect mRNA and protein separately, the enzymes bound to each of the antibody against the probe and the secondary antibody are different types of enzymes. In addition, the antibody reaction with these two types of antibodies may not be performed in the same solution, but may be sequentially performed sequentially.

  After the antibody reaction, a substrate for each enzyme is added to cause color development. This color development reaction may be performed in the same solution, but may be performed sequentially and continuously.

== Simultaneous detection method II ==
Next, a method of reacting a primary probe for immunostaining with a sample after reacting the probe for hybridization with the sample will be described.

The sample pretreatment is the same as in the simultaneous detection method I.
After pretreatment, prehybridization and hybridization are performed. Prehybridization is performed in a solution containing, for example, SSC and Formamide at 37 ° C. for 30 to 60 minutes. The concentration of each reagent is preferably 0.1 to 2 × SSC and 1 to 50% Formamide, but is not particularly limited to these conditions. Hybridization is performed overnight at 37 ° C. in a solution containing, for example, SSC, SDS, and Formamide. The concentration of each reagent is preferably 0.1 to 2 × SSC, 0.05 to 1% SDS, 1 to 50% Formamide, but is not particularly limited to these conditions. The solution for hybridization contains 1 to 20 μg / mL of hybridization probe labeled with the first label. The method for producing the probe is the same as the in situ hybridization method described above, but it is preferable to label with biotin or digoxigenin.

  After washing the sample, an enzyme-linked antibody that specifically binds to the label bound to the probe and a solution containing the primary antibody are prepared, and the sample is sampled in this solution at 4 to 37 ° C. for 1 hour to several days. The reaction conditions are not particularly limited. In addition, the antibody reaction with these two types of antibodies may not be performed in the same solution, but may be sequentially performed sequentially.

  Next, a solution containing a secondary antibody to which the enzyme (second label) is bound to the primary antibody is prepared, and the sample is incubated in this solution at 4 to 37 ° C. for 1 hour to several days. The reaction conditions are not particularly limited. The enzyme bound to the secondary antibody is different from the enzyme bound to the antibody that specifically binds to the label bound to the probe.

  After the antibody reaction, a substrate for each enzyme is added to cause color development. This color development reaction may be performed in the same solution, but may be performed sequentially and continuously.

== Simultaneous detection method III ==
Next, a method of reacting a primary probe for immunostaining with a sample and then reacting a hybridization probe with the sample will be described.

  First, a deparaffinization process, a rehydration process, etc. are performed with respect to the sample used as a detection target. After washing the sample, the primary antibody reaction is performed. Since the method so far is the same as the said immuno-staining method, detailed description is abbreviate | omitted here.

Thereafter, the sample is washed again and then a crosslinking reaction is performed. The purpose of this cross-linking reaction is to give the sample resistance to the subsequent proteolytic treatment. As described later, by performing this reaction, at least 10 ² times, 10 ⁵ times or more enzyme resistance is obtained by a crosslinking agent.

  Thereafter, a proteolytic treatment is performed, and as an option, quenching using glycine, acetylation using acetic anhydride, or the like may be performed. For this proteolytic treatment, a proteolytic enzyme such as thermolysin, proteinase K, trypsin, papain or the like may be used, or a mixture of two or more thereof may be used. The treatment time for the proteolytic treatment is preferably 5 to 30 minutes, and the treatment temperature is preferably 37 to 50 ° C., but is not limited to these numerical values. In practice, several conditions including the concentration are tried in advance, It is preferable to optimize.

  After pretreatment of in situ hybridization, prehybridization and hybridization are performed. Details follow the description of the in situ hybridization method.

  The antibody reaction and detection reaction after hybridization are in accordance with those described in the method of simultaneous detection method I.

== Automatic in situ hybridization device, automatic immunostaining device, automatic simultaneous detection device ==
Currently, automatic in situ hybridization devices and automatic immunostaining devices are being developed, and are available as fairly stable devices. These devices can be easily subjected to the proteolytic treatment and the crosslinking reaction of the present invention. For example, the specification may be such that thermolysin is used instead of conventional proteinaseK. In addition, it is easy for those skilled in the art to perform both in situ hybridization and immunostaining with one apparatus, and an automatic simultaneous detection apparatus can be produced by applying the simultaneous detection method of the present invention. Can do.

== In situ hybridization kit, immunostaining kit ==
When in situ hybridization, immunostaining, or simultaneous detection, the necessary reagents for each kit are made into kits, so the labor of reagent adjustment can be greatly reduced, and stable use of stable reagents The result can be obtained.

  The kit for in situ hybridization of the present invention contains thermolysin as a proteolytic agent. This kit includes, for example, immobilization reagents, probe synthesis reagents, quenching glycine, acetylation acetic anhydride, prehybridization solutions, hybridization solutions, various detection antibodies, detection enzyme substrates, Various buffers may be included.

  Moreover, the kit for immunostaining of this invention contains the crosslinking agent used for crosslinking reaction. It may be any of the above crosslinking agents or a mixture thereof. Further, a plurality of single crosslinking agents may be contained. In addition, the kit may contain, for example, a fixing reagent, a primary antibody, a secondary antibody, a detection enzyme substrate, various buffers, and the like.

  Hereinafter, examples in which expression of mRNA or protein is detected using the in situ hybridization method or histochemical method of the present invention will be described in detail. Reagents not specifically described are manufactured by SIGMA-ALDRICH. In addition, the reaction was performed at room temperature unless otherwise specified.

<Effectiveness of Example 1 ... Thermolysin>
In this example, the expression of β-tubulin was detected by in situ hybridization in the brain and spinal cord tissues of adult pigs (Landraces) and fetuses. At that time, in the proteolytic treatment, 2 mg / mL and 2 μg / mL thermolysine were used and compared with the results obtained using proteinase K or trypsin. Hereinafter, the experimental procedure will be described in order.

{Production of probe}
The porcine β-tubulin gene cDNA was used as a template, and the 3′-UTR region was amplified by PCR using primers TGAGACCGTCCCGCGCAAG (SEQ ID NO: 1) and ACACATGCGTTTTATTAGGATA (SEQ ID NO: 2). The amplified fragment is subcloned into the transcription vector pGEM-T Easy (Promega) having SP6 promoter and T7 promoter, and the base sequence and the direction in which the fragment is inserted into the vector are confirmed. A plasmid having the correct base sequence and direction is obtained. Selected.

  Using a restriction enzyme, insert the inserted fragment into the plasmid (1 mg) cleaved on the opposite side of the SP6 promoter or T7 promoter, 3.5 mM Dig-UTP, 6.5 mM UTP, 10 mM ATP , CTP, GTP, in vitro transcription buffer (40 mM Tris pH 8.0, 10 mM NaCl, 2 mM spermidine, 0.1 U Rnase inhibitor), 5-10 u of SP6 or T7 RNA polymerase (Roche) at 37 ° C For 2 hours. The reaction was stopped by adding EDTA to a final concentration of 0.2 M, RNA was ethanol precipitated, dissolved in an appropriate amount of water, the concentration was measured, and the length and purity were checked by agarose electrophoresis. Thus, a Digoxigenin-labeled antisense cRNA probe and a Digoxigenin-labeled sense cRNA probe for the porcine β-tubulin gene were prepared.

{Experimental procedure}
1) The adult pig (Landrace breed) brain was fixed by perfusion using a 4% formaldehyde aqueous solution, and paraffin sections were prepared using a silane-coated slide glass (MUTO PURE CHEMICALS).
2) Paraffin sections were warmed at 60 ° C. for 30 minutes.
3) The mixture was stirred twice with xylene for 10 minutes to perform a deparaffinization operation.
4) Rehydration was performed 3 times for 5 minutes with 100% ethanol, followed by 90% ethanol, 80% ethanol, 70% ethanol and 50% ethanol for 5 minutes each.
5) Wash once with PBS for 10 minutes.
6) Proteolytic treatment with 20μg / ml trypsin, 1μg / ml proteinase K (WAKO 163-18131) or 400μg / ml thermolysin (protease type X, P-1512, Sigma-Aldrich) for 15 minutes at 37 ° C went.
7) After washing with PBS at room temperature for 10 minutes, it was quenched by immersion in 2 mg / mL glycine aqueous solution for 10 minutes.
8) After washing twice with PBS for 3 minutes, acetylation was performed by immersing in 0.1 M triethanolamine buffer pH 8.0 (hereinafter, 0.1 M TEA) with 0.25% acetic anhydride for 15 minutes.
9) Washed with 0.1 M TEA for 15 minutes.
10) After soaking in 4 × SSC for 10 minutes, the solution was changed and soaked once for another 5 minutes.
11) The reaction was performed at 37 ° C. for 30 minutes in Pre-Hybridization buffer (2 × SSC, 50% Formamide).
12) Digoxigenin labeled cRNA probe in Hybridization buffer (2 x SSC, 1% SDS, 1 mg / mL BSA, 10% Dextran, 1 mg / mL salmon sperm DNA, 1 mg / mL tRNA, 50% Formamaide) Hybridization was performed overnight at 37 ° C. at a concentration of mL.
13) Washed with Pre-Hybridization buffer at 37 ° C. for 20 minutes.
14) Washed in 0.2 × SSC at 37 ° C. for 20 minutes.
15) It was washed by immersing it in NTE buffer (0.5 M NaCl, 10 mM Tris-HCl pH 8.0 and 1 mM EDTA) at 37 ° C. for 5 minutes.
16) It was soaked in a 20 μg / mL RNase A solution at 37 ° C. for 30 minutes.
17) Washed with NTE buffer at 37 ° C. for 5 minutes.
18) Washed 3 times at 42 ° C. for 20 minutes in 0.1 × SSC.
19) After washing with PBS, blocking was performed with 5% Normal Goat Serum (Invitrogen).
20) A mixed solution of 250-fold diluted alkaline phosphatase-labeled anti-digoxigenin antibody (Roche) was dropped on the specimen and incubated for 60 minutes.
21) Washed 3 times with PBS for 5 minutes.
22) It was immersed in an NTM buffer (100 mM NaCl, 100 mM Tris-HCl pH 9.5, 50 mM MgCl ₂ ) for 5 minutes.
23) Color development was performed in a mixed solution of 450 μg / mL NBT (Nitrotetrazolium Blue Choride) and 175 μg / mL BCIP (5-Bromo-4-Chloro-3-indolyl-phosphate disodium salt) as a chromogenic substrate for alkaline phosphatase.
24) While observing under a microscope, color development was stopped by washing with PBS at an appropriate time.
25) The sample slide after stopping the reaction was washed with water and then sealed with a water-soluble mounting medium.

{result}
The results are shown in FIG.
When proteolytic treatment was performed with thermolysine, a signal with higher contrast was obtained compared to trypsin and proteinase K.

<Embodiment 2 ... Effectiveness of crosslinking reaction>
In this example, expression of β-tubulin was detected by immunostaining in the brains of adult pigs (Landraces). At that time, in order to confirm the effect of the cross-linking reaction, the cross-linking reaction was performed after the primary antibody reaction, and then the proteolytic treatment using proteinase K at several concentrations was performed before the secondary antibody reaction. Hereinafter, the experimental procedure will be described in order. In addition, an experiment was simultaneously performed on a sample not subjected to proteinase K treatment as a positive control and a sample not crosslinked as a negative control.

{Experimental procedure}
1) The brains of adult pigs (Landraces) were fixed by perfusion using 4% paraformaldehyde, and paraffin sections were prepared using a silane-coated slide glass (MUTO PURE CHEMICALS).
2) Paraffin sections were warmed at 60 ° C. for 30 minutes.
3) The mixture was stirred twice with xylene for 10 minutes to perform a deparaffinization operation.
4) Rehydration was performed 3 times for 5 minutes with 100% ethanol, followed by 90% ethanol, 80% ethanol, 70% ethanol and 50% ethanol for 5 minutes each. Here, in order to block endogenous peroxidase, it was immersed in methanol containing 0.3% hydrogen peroxide for 30 minutes.
5) Washed once with PBS for 10 minutes.
6) Anti-β-Tubulin class II antibody (NOVOCASTRA) as the primary antibody was diluted 100 times with PBS and incubated at room temperature for 60 minutes.
7) Wash 3 times with PBS for 5 minutes.
8) 1.25 mg / mL EDC or 10 mM SMPT (PIERCE Biotechnology) was added dropwise, followed by incubation at room temperature for 1-2 hours.
9) Washed 3 times with PBS for 5 minutes (when using EDC, washed once with 0.1 M MES for 5 minutes before washing with PBS).
10) Protease treatment was carried out by incubation with proteinase K (WAKO 163-18131) at concentrations of 0.5 pg / mL, 10 fg / mL and 10 ^-2 fg / mL for 10 minutes at 37 ° C.
11) After washing with PBS, blocking was performed with 5% Normal Goat Serum (Invitroge) for 60 minutes.
12) A mixed solution obtained by diluting a secondary antibody (HRP-labeled anti-mouse IgG polyclonal antibody) 100-fold with PBS was dropped onto the specimen and incubated for 60 minutes.
13) Washed 3 times with PBS for 5 minutes.
14) Diaminobenzidine (DAB Tris Tablets, MUTO PURE CHEMICALS) was used as the HRP color-developing substrate, and color development was performed in an aqueous solution (0.3 mg / ml).
15) While observing under a microscope, color development was stopped by washing with PBS at an appropriate time.
16) After stopping the reaction, the sample slide was washed with water and sealed with a water-soluble mounting medium.

{result}
The results are shown in FIG.
In the case of a non-crosslinked sample, no signal was detected when treated with 10 ^-2 fg / mL proteinase K. However, when EDC was used as a crosslinking agent, the sample was treated with 1 pg / mL proteinase K. A signal was also observed. When SMTP was used as a cross-linking agent, a clear signal was observed up to a proteinase K concentration of 10 fg / mL. Thus, using EDC, proteinase K resistance of at least 10 ⁵ times, proteinase K resistant With SMTP has increased at least 10 ³ times.
Similarly, Table 1 shows the results of examining how many times the enzyme resistance is increased by using various combinations of cross-linking agents and proteolytic enzymes. Thus, in all crosslinking agent used, the proteolytic enzyme resistance increased by at least 10 ² times, depending on the crosslinking agent was increased by at least 10 ⁵ times.

<Example 3 ... Example of simultaneous detection method>
In this embodiment, an embodiment of the simultaneous detection method will be described in detail. The probe was produced in the same manner as in Example 1.

{Experimental procedure}
1) The adult pig (Landrace breed) brain was fixed by perfusion using a 4% formaldehyde aqueous solution, and paraffin sections were prepared using a silane-coated slide glass (MUTO PURE CHEMICALS).
2) Paraffin sections were warmed at 60 ° C. for 30 minutes.
3) The mixture was stirred twice with xylene for 10 minutes to perform a deparaffinization operation.
4) Rehydration was performed 3 times for 5 minutes with 100% ethanol, followed by 90% ethanol, 80% ethanol, 70% ethanol and 50% ethanol for 5 minutes each.
5) Wash once with PBS for 10 minutes.
6) Proteolytic treatment with 20μg / ml trypsin, 1μg / ml proteinase K (WAKO 163-18131) or 400μg / ml thermolysin (protease type X, P-1512, Sigma-Aldrich) for 15 minutes at 37 ° C went.
7) After washing with PBS at room temperature for 10 minutes, it was quenched by immersion in 2 mg / mL glycine aqueous solution for 10 minutes.
8) After washing twice with PBS for 3 minutes, acetylation was performed by immersing in 0.1 M TEA supplemented with 0.25% acetic anhydride for 15 minutes.
9) Washed with 0.1 M TEA for 15 minutes.
10) After soaking in 4 × SSC for 10 minutes, the solution was changed and soaked once for another 5 minutes.
11) The reaction was carried out at 37 ° C. for 30 minutes in Pre-Hybridization buffer (2 × SSC, 50% Formamide).
12) Digoxigenin labeled cRNA probe in Hybridization buffer (2 x SSC, 1% SDS, 1 mg / mL BSA, 10% Dextran, 1 mg / mL salmon sperm DNA, 1 mg / mL tRNA, 50% Formamaide) Hybridization was performed overnight at 37 ° C. at a concentration of mL.
13) Washed with Pre-Hybridization buffer at 37 ° C. for 20 minutes.
14) Washed in 0.2 × SSC at 37 ° C. for 20 minutes.
15) It was washed by immersing it in NTE buffer (0.5 M NaCl, 10 mM Tris-HCl pH 8.0 and 1 mM EDTA) at 37 ° C. for 5 minutes.
16) It was soaked in a 20 μg / mL RNase A solution at 37 ° C. for 30 minutes.
17) Washed with NTE buffer at 37 ° C. for 5 minutes.
18) Washed 3 times at 42 ° C. for 20 minutes in 0.1 × SSC.
19) After washing with PBS, blocking was performed with 5% Normal Goat Serum (Invitrogen).
20) A PBS solution of 250-fold diluted alkaline phosphatase-labeled anti-digoxigenin antibody (Roche) and 100-fold diluted anti-β-Tubulin class II antibody (NOVOCASTRA) was dropped onto the specimen and incubated at room temperature for 60 minutes.
21) Washed 3 times with PBS for 5 minutes.
22) A mixed solution obtained by diluting a secondary antibody (HRP-labeled anti-mouse IgG polyclonal antibody) 100-fold with PBS was dropped onto the specimen and incubated for 60 minutes.
23) Washed 3 times with PBS for 5 minutes.
24) Diaminobenzidine (DAB Tris Tablets, MUTO PURE CHEMICALS) was used as the HRP chromogenic substrate, and color was developed in an aqueous solution (0.3 mg / ml).
25) While observing under a microscope, color development was stopped by washing with PBS at an appropriate time.
26) It was immersed in an NTM buffer (100 mM NaCl, 100 mM Tris-HCl pH 9.5, 50 mM MgCl ₂ ) for 5 minutes.
27) Color development was performed in a mixed solution of 450 μg / mL NBT (Nitrotetrazolium Blue Choride) and 175 μg / mL BCIP (5-Bromo-4-Chloro-3-indolyl-phosphate disodium salt) as a chromogenic substrate for alkaline phosphatase.
28) While observing under a microscope, color development was stopped by washing with PBS at an appropriate time.
29) The sample slide after stopping the reaction was washed with water and then encapsulated with a water-soluble encapsulant.

{result}
The results are shown in FIG. In the photograph on the left, mRNA was detected in purple, protein was detected in brown, and tissue sections were stained in both purple and brown above the dotted line and only purple below the dotted line. Thus, both mRNA and protein were detected above the dotted line, and only mRNA was detected below the dotted line. An enlarged view of both is shown on the right.

  Thus, according to the simultaneous detection method of the present invention, the mRNA and protein distributions of the gene can be easily detected in the same sample, and the tissue localization can be easily compared. Furthermore, their intracellular distribution can also be compared. If there is a difference between these, it is suggested that post-transcriptional regulation acts on the expression of this gene.

  In addition, when the gene expression is made into a database, the mRNA and protein distribution can be displayed with the same image, which leads to a reduction in the cost for constructing the database.

It is a photograph which shows the detection result of mRNA by one Example of the in situ hybridization method of this invention, and has shown the effectiveness as a proteolytic agent of thermolysin. It is a photograph which shows the detection result of the protein by one Example of the immuno-staining method of this invention, and has shown the effectiveness of the crosslinking agent of this invention. It is a simultaneous detection result of mRNA and protein by one Example of the co-staining method of this invention. MRNA and protein are dyed separately on the same sample.

Claims (8)

  A proteolytic agent containing thermolysin for use in in situ hybridization.   An in situ hybridization method characterized by using thermolysin as a proteolytic agent. Fixing the sample;
A process of proteolytic treatment using thermolysine on the fixed sample;
Hybridizing a nucleic acid probe labeled with a label to mRNA to be detected;
Detecting the label;
In situ hybridization method.   The in situ hybridization method according to claim 3, wherein the sample is a tissue section.   The in situ hybridization method according to claim 3, wherein the sample is a whole-mount individual. A simultaneous detection method for detecting both mRNA and protein by performing both in situ hybridization and immunostaining on the same sample,
A simultaneous detection method using thermolysin as a proteolytic agent. A simultaneous detection method for detecting both mRNA and protein by performing both in situ hybridization and immunostaining on the same sample,
Fixing the sample;
A process of proteolytic treatment using thermolysine on the fixed sample;
Hybridizing a nucleic acid probe labeled with a first label to mRNA to be detected;
A step of binding a primary antibody to a protein to be detected with respect to the hybridized sample;
Binding a secondary antibody labeled with a second label to the primary antibody;
Detecting the first and second labels;
A simultaneous detection method comprising:   A kit for in situ hybridization containing thermolysin as a proteolytic agent.