JP4511654B2 - Expression cloning process for discovery, characterization and isolation of genes encoding polypeptides having predetermined properties - Google Patents

Description

[0001]
BACKGROUND OF THE INVENTION
The present invention relates generally to the field of expressed gene technology and expression cloning. More particularly, the present invention identifies nucleic acid sequences that encode a transcribed polypeptide having a predetermined property (eg, cellular location, structure, enzymatic function, or affinity for other molecules). , Characterization and isolation, and production of the corresponding polypeptide.
[0002]
[Prior art]
(General background)
Proteins are the most important biomolecules in organisms; in addition to their role as structural components and catalysts, proteins play an important role in the regulatory process. The regulation of both cell proliferation and metabolic function is controlled and performed primarily by the cooperation of numerous cellular and extracellular proteins. Lehninger, A.M. L. 1975, “Biochemistry”, Worth Publishers Inc. , New York, New York. For example, many types of signaling pathways that affect important physiological responses operate through proteins through protein molecular interactions. Metzler, D.M. E. 1977, “Biochemistry”, Academic Press Inc. , London. Furthermore, gene transcription and regulation of such transcription is dependent and controlled by the interdependence of a number of protein factors. Wainwright, S.W. D. "Control Mechanisms and Protein Synthesis", Columbia University Press, New York and London.
[0003]
The proper function of a multicellular organism does not depend solely on the interaction of biomolecules within the cell, and individual cells must also communicate appropriately. Such intercellular communication and environment-cell interactions are often realized by the action of receptors on the extracellular surface and associated intracellular signaling mechanisms. Poste, G.M. Nicholson, G .; L. , 1976, “The Cell Surface”, Elsevier, Amsterdam. Information is communicated through the cellular environment to regulate gene expression or intracellular protein activity. Secreted proteins in the extracellular environment thereby exert a strong regulatory effect on specific cellular functions.
[0004]
In light of the above summary, a very simplified paradigm of cell function (specific protein properties, including cell localization, structure, affinity for binding partners, or enzymatic activity under physiological conditions) It seems to show the function of the type highly. With regard to specific cellular localization locations, for example, secreted proteins appear to function as intercellular communicators of signals, but membrane-bound receptors with extracellular and intracellular domains probably transmit extracellular signals into the cell. It seems to do. Cytoplasmic proteins can function as intracellular signaling agents and coordinators. Jetter, J. et al. R. Cameron, I .; L. Padilla, I .; L. Padilla, G .; M.M. Zimmerman, A.M. M.M. 1978, “Cell Cycle Regulation”, London. Nuclear proteins appear to be involved in specific aspects of gene regulation. Zawel et al., 1995, Annu. Rev. Biochem. 64: 533-561. Mature proteins found in the Golgi or ER can play a regulatory role in post-translational processing of protein precursors (eg, cleavage or addition of carbohydrates). Hirschberg, 1987, C.I. Annu. Rev. Biochem. 56: 63-87.
[0005]
(Membrane-bound protein)
For many years, the cell function paradigm has motivated numerous drug discovery programs that focused on the identification of specific novel receptors and membrane-bound proteins in each function. Porter, R.A. And O'Connor, M .; , 1970, “Molecular Properties of Drug Receptors, Ciba Foundation Symposium”, J & A Churchill, London. Indeed, many examples force the conclusion that inappropriate functioning of membrane receptors is a significant source of the development of serious metabolic and proliferative diseases such as cancer. For example, a particular form of diabetes mellitus, non-insulin dependent diabetes mellitus (NIDDM), can result from mutations in the insulin receptor. Ullrich et al., 1985, Nature 313: 756-761; Taira et al., 1989, Science 245: 63-66. Furthermore, 30% of all mammalian cancers are associated with the amplification of the receptor tyrosine kinase HER2. Burgman et al., 1986, Cell 45: 649-657; Slamon et al., 1989, Science 244: 707-712. In addition to traditional drug discovery programs that target receptors, ambitiously explored objectives are possible using comparative genomics (eg, allowing determination of gene expression changes in pathological conditions) Membrane-bound receptors have been identified as potential gene therapy targets. Wels et al., 1995, Gene
159: (1): 73-80.
[0006]
(Secreted protein)
While receptors are primarily considered as important potential therapeutic targets, secreted proteins are of particular interest as potential therapeutic agents. Secreted proteins often have signal transduction or hormonal functions and therefore have a high and specific biological activity. Schoen, F.M. J. et al. 1994, “Robbins Pathological Basis of Disease”, W.M. B. Saunders Company, Philadelphia. For example, secreted proteins control physiological responses such as differentiation and proliferation, blood clotting and thrombolysis, somatic cell proliferation and cell death, and immune responses. Schoen, F.M. J. et al. 1994, “Robbins Pathological Basis of Disease”, W.M. B. Saunders Company, Philadelphia.
[0007]
Significant funding and research efforts have been expanded to discover and investigate new secreted proteins that control biological functions. Many of such secreted proteins include cytokines and peptide hormones and are manufactured and used as therapeutic agents. Zavyalov et al., 1997, APMIS 105 (3): 161-186. However, only a few of the thousands of expected secreted proteins are currently used as therapeutic compounds. Many of the secreted proteins that have not been discovered to date in human organisms can be expected to be effective in remediating physiological disorders and thus to be promising candidates for new drugs.
[0008]
In the past, novel cytokine and hormone proteins have been identified by assaying specific cell types for their response to protein fractions or purified proteins. Lauffenburger et al., 1996, Biotechnology and Bioengineering 52 (1): 61-80. Other researchers have cloned novel interferons and interleukins using DNA level sequence similarity. Nabori et al., 1992, Analyt. Biochem. 205 (1): 42-46. In yet another approach, differential display technology was used to compare the expression patterns of stimulated versus unstimulated cells. Nagata et al., 1980, Nature 287: 401-408. All these methods can lead to the identification and isolation of specific secreted polypeptides.
[0009]
Recently, screening methods have been described for identifying cDNAs for encoding novel secreted mammalian proteins in yeast using the invertase gene as a selectable marker. See US Pat. No. 5,536,637 (“637 patent”). The disclosed technology relies on the concept that the mammalian cDNA leader sequence is effective in the export of invertase proteins lacking that leader sequence. This approach results in a partial cDNA, which can then be used to screen a full length cDNA library. The new protein of interest can then be made by standard but laborious techniques including subcloning, transformation of recombinant hosts, expression, development and implementation of purification processes. Furthermore, since the assay described in the 637 patent is performed in yeast, the glycosylation pattern of the isolated product is significantly different from the natural product produced in mammals. This difference is a major obstacle in view of the fact that a very important feature of the secreted protein (which also applies to the extracellular domain of the receptor) is its glycosylation pattern and carbohydrate composition. Rademacher et al., 1988, Annu. Rev. Biochem. 57: 785-838.
[0010]
(Nuclear protein)
In the nucleus, both DNA replication and gene transcription actually take place. Many nucleoproteins are directly involved in these processes as transcription factors, cell cycle regulators, or both. Some nucleoproteins are responsible for the expression of certain metabolic proteins in response to environmental changes. Zawel et al., 1995, Annu. Rev. Biochem. 64: 533-561. Many others are directly involved in the regulation of cell growth. Jetter, J. et al. R. Cameron, I .; L. Padilla, G .; M.M. Zimmerman, A .; M.M. 1978, “Cell Cycle Regulation”, London. The latter class of proteins fall into two general categories: (1) dominant transforming genes, including oncogenes; and (2) tumor suppressor genes and programmed cell death ("apoptosis") A recessive cell proliferation gene comprising a gene encoding the product to be produced.
[0011]
Oncogenes generally encode proteins that are associated with the promotion of cell proliferation. Since cell division is an important part of normal tissue development and continues to play an important role in tissue regeneration, proper regulation of oncogene activity is essential for the survival of the organism. However, improper expression or inappropriate activity control of oncogenes induces uncontrolled cell proliferation and results in the development of serious diseases such as cancer. Weinberg, 1994, CA Cancer J. Clin. 44: 160-170.
[0012]
On the other hand, tumor suppressor genes usually act as a “brake” of cell proliferation and thus counteract the activity of oncogenes. Thus, inactivation of tumor suppressor genes (eg, via mutations or elimination of growth inhibitory effects) can result in loss of growth control and cell proliferative diseases such as cancer can develop. Weinberg, 1994, CA Cancer J. Clin. 44: 160-170.
[0013]
Associated with tumor suppressor genes are genes whose products are associated with the control of apoptosis, rather than the regulation of cell growth, and these affect cell survival in the body. In normal cells, the monitoring system is believed to ensure that the growth regulatory mechanism is intact; if an abnormality is detected, the monitoring system switches on the suicide program that reaches its highest in apoptosis.
[0014]
Several genes involved in the apoptotic process have been described. See, for example, Collins and Lopez Rivas, 1993, TIBS 18: 307-308; Martin et al., 1994, TIBS 19: 26-30. Cells that are resistant to apoptosis have advantages over normal cells and tend to proliferate and occupy tissue over their normal counterparts. As a result, inactivation of genes involved in apoptosis can result in tumor progression and is actually an important step in tumor formation.
[0015]
Thus, nucleoprotein identification deals with two regions of interest. First, oncogenes are likely to be useful targets for the development of highly specific drugs for the treatment of cancer. Secondly, tumor suppressors and proteins that induce apoptosis may be useful as agents for the treatment of cancer.
[0016]
(Other cell localization locations)
Many of the remaining cellular localization locations are also associated with specific functions. For example, most metabolic enzymes are located in mitochondria. Lehninger, A.M. L. 1975, “Biochemistry”, Worth Publishers Inc. , New York. Thus, mitochondrial proteins may reveal targets for the treatment of metabolic diseases. The Golgi apparatus and ER are associated with post-translational processing of proteins; such processes are useful targets for the treatment of diseases associated with protein folding and glycosylation. Rademacher et al., 1988, Ann. Rev. Biochem. 57: 785-838.
[0017]
(Enzyme activity)
Specific enzyme activity can be an indicator of protein function. For example, kinases are frequently involved in signal transduction processes.
[0018]
(Construction)
Protein also indicates the function of the protein. In fact, proteins of similar structure often share certain functional properties. Thus, by identifying a protein having a structure that is related to the structure of a known protein having a particular function of interest, additional proteins having such functions can be identified.
[0019]
In general, a method is desired that allows pre-classification of proteins according to properties of interest (eg, location in cells, affinity for binding partners, enzyme activity, structure, etc.). Such methods make it possible to generate libraries of secreted proteins such as cytokines, membrane-bound proteins such as receptors, nucleoproteins such as transcription factors, mitochondrial proteins such as respiratory proteins, etc. . Furthermore, it is desirable to screen, isolate, and produce any product in mammalian cells in order to achieve an appropriate glycosylation pattern. Finally, the most preferred method further allows the identification and isolation of the protein of interest itself, rather than a partial DNA sequence.
[0020]
The present invention addresses this need. The present invention provides for the generation of an expression library that encodes polypeptides of predetermined characteristics, including but not limited to cell localization location, structure, enzymatic function, or affinity with other molecules. Methods and expression systems are provided. The methods and expression systems of the present invention allow the identification and isolation of nucleic acids encoding a novel protein of interest. The methods and expression systems further provide a powerful system for identifying receptor / ligand relationships that have not been elucidated so far. Since the provided method can be used in a wide variety of host cell systems, including mammalian systems, this method provides an expression product with an appropriate carbohydrate composition.
[0021]
(Summary of the Invention)
The present invention provides the following:
1. A method for identifying a recombinant nucleic acid encoding an exogenous protein having a desired property, comprising the following steps: a. Providing a composition comprising a plurality of eukaryotic host cells, wherein each host cell has an expression system comprising different members, each member comprising an exogenous protein operably linked to a regulatory element. Comprising a recombinant nucleic acid encoding; b. Culturing the eukaryotic host cell under conditions in which the exogenous protein is expressed but expression of the eukaryotic host cell is suppressed; and c. Identifying a member comprising a recombinant nucleic acid encoding an exogenous protein having the property of interest.
[0022]
2. Item 2. The method according to Item 1, wherein the characteristic is a predetermined cell localization position.
[0023]
3. Item 3. The method according to Item 2, wherein the predetermined cell localization position is an extracellular space.
[0024]
4). Item 3. The method according to Item 2, wherein the predetermined cell localization position is a cell membrane.
[0025]
5). Item 3. The method according to Item 2, wherein the predetermined cell localization position is selected from the group consisting of nucleus, lysosome, mitochondrion, endoplasmic reticulum, Golgi apparatus, peroxisome, endosome, and cytoplasm.
[0026]
6). Item 2. The method according to Item 1, wherein the property is binding affinity for a binding partner.
[0027]
7). Item 2. The method according to Item 1, wherein the property is enzyme activity.
[0028]
8). Item 2. The method according to Item 1, wherein the property is a structural property.
[0029]
9. Item 2. The method according to Item 1, wherein the exogenous protein is labeled, but expression of the endogenous protein is suppressed.
[0030]
10. Item 10. The method according to Item 9, wherein the exogenous protein is labeled with a marker selected from the group consisting of a radioactive marker and a spectroscopically detectable marker.
[0031]
11. Item 11. The method according to Item 10, wherein the radioactive marker is selected from the group consisting of a radioactive amino acid and a radioactive sugar.
[0032]
12 Item 2. The method of Item 1, wherein each of said members is expressed in a separate eukaryotic host cell.
[0033]
13. Item 10. The method according to Item 9, wherein the control element is derived from a virus.
[0034]
14 Item 14. The method according to Item 13, wherein the virus suppresses expression of an endogenous protein.
[0035]
15. Item 14. The method according to Item 13, wherein the virus is an alphavirus.
[0036]
16. Item 16. The method according to Item 15, wherein the alphavirus is selected from the group consisting of Sindbis virus, Semliki Forest virus, and Venezuelan equine encephalomyelitis virus.
[0037]
17. Item 14. The method according to Item 13, wherein the expression system further directs production of virus particles.
[0038]
18. Item 18. The method according to Item 17, further comprising the step of separating the virus particles from the exogenous protein.
[0039]
19. Item 19. The method according to Item 18, wherein the virus particle is separated from the exogenous protein via filtration, chromatography, or precipitation.
[0040]
20. Item 15. The method according to Item 14, wherein the control element lacks at least one function necessary for the growth of the virus.
[0041]
21. Item 21. The method according to Item 20, wherein the function necessary for the growth of the virus is provided through a helper function.
[0042]
22. Item 22. The method according to Item 21, wherein the helper function is provided by a virus packaging cell line or a helper virus particle.
[0043]
23. Item 2. The method according to Item 1, wherein the control element is derived from a virus capable of directing the expression of the nucleic acid encoding an exogenous protein, but suppressing the expression of the endogenous protein.
[0044]
24. Item 24. The method according to Item 23, wherein the expression of the endogenous protein is suppressed by inhibition of transcription or translation of a nucleic acid encoding the endogenous protein.
[0045]
25. The control element promotes transcription of the recombinant nucleic acid encoding the exogenous protein in the presence of an inhibitor of cellular RNA polymerase II, wherein in step b, the eukaryotic host cell is transformed into cellular RNA. Item 2. The method according to Item 1, wherein the cells are cultured in the presence of an effective amount of an inhibitor of polymerase II.
[0046]
26. 26. The method of paragraph 25, wherein the inhibitor is selected from the group consisting of actinomycin D, aflatoxin B1, and amatoxin.
[0047]
27. Item 18. The method according to Item 17, wherein the virus particles produce a solubilized viral protein, wherein production of the solubilized viral protein is reduced.
[0048]
28. Item 28. The method according to Item 27, wherein the production of the solubilized protein of the virus is reduced by the use of a protease inhibitor.
[0049]
29. Item 28. The method according to Item 27, wherein the production of the solubilized protein of the virus is reduced by the use of a mutant virus strain.
[0050]
30. 30. The method of paragraph 29, wherein the mutant virus strain is selected from the group consisting of temperature sensitive Sindbis mutants ts20, ts10, and ts23.
[0051]
31. Item 28. The method according to Item 27, wherein the production of the solubilized protein of the virus is reduced by the use of a cell line deficient in cleavage of the protein of the virus.
[0052]
32. Item 32. The method according to Item 31, wherein the cell line lacks cleavage of protein PE2 into E2 and E3.
[0053]
33. Item 2. The method according to Item 1, wherein the nucleic acid encoding an exogenous protein is derived from a nucleic acid library containing a plurality of different nucleic acids encoding a polypeptide.
[0054]
34. The method of paragraph 1, wherein the plurality of members are screened using physical separation of the eukaryotic host cell, wherein each of the host cells is one individual of the plurality of members. How to own a member.
[0055]
35. 35. The method of paragraph 34, wherein the physical separation is achieved by separation of the eukaryotic host cell in a semi-solid medium.
[0056]
36. The physical separation is achieved by placing eukaryotic host cells in separate compartments, wherein each compartment comprises a host cell carrying the same expression system as the plurality of expression systems. 34. The method according to 34.
[0057]
37. Item 2. The method according to Item 1, wherein the expression system is capable of autonomous replication.
[0058]
38. A method for identifying a recombinant nucleic acid encoding an exogenous protein having a desired property, comprising the following steps: a. Providing a composition comprising a plurality of eukaryotic host cells, wherein each host cell has an expression system comprising different members, each member comprising an exogenous protein operably linked to a regulatory element. Comprising a recombinant virus having a recombinant nucleic acid encoding; b. Culturing the eukaryotic host cell under conditions in which the exogenous protein is expressed; and c. Identifying a member comprising a recombinant nucleic acid encoding an exogenous protein having the property of interest.
[0059]
39. The method according to Item 38, wherein the characteristic is a predetermined cell localization position.
[0060]
40. Item 40. The method according to Item 39, wherein the predetermined cell localization position is an extracellular space.
[0061]
41. Item 40. The method according to Item 39, wherein the predetermined cell localization position is a cell membrane.
[0062]
42. 40. The method of paragraph 39, wherein the predetermined cell localization location is selected from the group consisting of nucleus, lysosome, mitochondrion, endoplasmic reticulum, Golgi apparatus, peroxisome, endosome, and cytoplasm.
[0063]
43. 40. The method of paragraph 38, wherein the property is binding affinity for a binding partner.
[0064]
44. Item 39. The method according to Item 38, wherein the property is enzyme activity.
[0065]
45. Item 39. The method according to Item 38, wherein the property is a structural property.
[0066]
46. 40. The method of paragraph 38, wherein the eukaryotic host cell is cultured under conditions in which the exogenous protein is expressed but expression of the endogenous protein of the eukaryotic host cell is suppressed.
[0067]
47. The method according to Item 38, wherein the exogenous protein is labeled, but the expression of the endogenous protein is suppressed.
[0068]
48. 48. The method of paragraph 47, wherein the exogenous protein is labeled with a marker selected from the group consisting of a radioactive marker and a spectroscopically detectable marker.
[0069]
49. 49. The method of paragraph 48, wherein the radioactive marker is selected from the group consisting of a radioactive amino acid and a radioactive sugar.
[0070]
50. 40. The method of paragraph 38, wherein each of said members is expressed in a separate eukaryotic host cell.
[0071]
51. Item 39. The method according to Item 38, wherein the virus suppresses the expression of an endogenous protein.
[0072]
52. Item 39. The method according to Item 38, wherein the virus is an alphavirus.
[0073]
53. 53. The method of paragraph 52, wherein the alphavirus is selected from the group consisting of Sindbis virus, Semliki Forest virus, and Venezuelan equine encephalomyelitis virus.
[0074]
54. 40. The method of paragraph 38, wherein the virus is further directed to the production of viral particles.
[0075]
55. 55. The method of paragraph 54, further comprising separating the viral particles from the exogenous protein.
[0076]
56. 56. The method of paragraph 55, wherein the viral particles are separated from the exogenous protein via filtration, chromatography, or precipitation.
[0077]
57. Item 52. The method according to Item 51, wherein the virus lacks at least one function required for propagation of the virus.
[0078]
58. 58. The method according to Item 57, wherein the function necessary for the propagation of the virus is provided via a helper function.
[0079]
59. 59. The method of paragraph 58, wherein the helper function is provided by a viral packaging cell line or a helper virus particle.
[0080]
60. 39. The method of paragraph 38, wherein the virus can direct the expression of the nucleic acid encoding an exogenous protein, but the expression of the endogenous protein is suppressed.
[0081]
61. Item 61. The method according to Item 60, wherein expression of the endogenous protein is suppressed by inhibition of transcription or translation of a nucleic acid encoding the endogenous protein.
[0082]
62. 55. The method of paragraph 54, wherein the viral particle produces a solubilized viral protein, wherein production of the solubilized viral protein is reduced.
[0083]
63. Item 63. The method according to Item 62, wherein the production of the solubilized protein of the virus is reduced by the use of a protease inhibitor.
[0084]
64. Item 63. The method according to Item 62, wherein the production of the solubilized protein of the virus is reduced by the use of a mutant virus strain.
[0085]
65. 65. The method of paragraph 64, wherein the mutant virus strain is selected from the group consisting of temperature sensitive Sindbis mutations ts20, ts10, and ts23.
[0086]
66. Item 63. The method according to Item 62, wherein the production of the solubilized protein of the virus is reduced by the use of a cell line deficient in cleavage of the protein of the virus.
[0087]
67. 70. The method of paragraph 66, wherein the cell line lacks cleavage of protein PE2 into E2 and E3.
[0088]
68. 39. The method of paragraph 38, wherein the nucleic acid encoding an exogenous protein is derived from a nucleic acid library containing a plurality of different nucleic acids encoding a polypeptide.
[0089]
69. 40. The method of paragraph 38, wherein the plurality of members are screened using physical separation of the eukaryotic host cell, wherein each of the host cells is one individual of the plurality of members. How to own a member.
[0090]
70. 70. The method of paragraph 69, wherein the physical separation is achieved by separation of the eukaryotic host cell in a semi-solid medium.
[0091]
71. The physical separation is achieved by placing eukaryotic host cells in separate compartments, wherein each compartment comprises a host cell carrying the same expression system as the plurality of expression systems. 69. The method according to 69.
[0092]
72. Item 39. The method according to Item 38, wherein the recombinant virus is capable of self-replication.
[0093]
73. A method for generating a gene expression library encoding a protein having a predetermined property of interest, comprising the following steps: a. Providing a composition comprising a plurality of eukaryotic host cells, wherein each host cell has an expression system comprising different members, each member comprising an exogenous protein operably linked to a regulatory element. Comprising a recombinant nucleic acid encoding; b. Culturing the eukaryotic host cell under conditions in which the exogenous protein is expressed but expression of the eukaryotic host cell is suppressed; and c. Identifying a member comprising a recombinant nucleic acid encoding an exogenous protein having the property of interest.
[0094]
74. Item 74. The method according to Item 73, wherein the nucleic acid encoding an exogenous protein is derived from a nucleic acid library including a plurality of nucleic acids encoding different polypeptides.
[0095]
75. 74. A gene expression library comprising a plurality of expression systems encoding proteins localized at predetermined cell localization positions, which is generated by the method according to Item 73.
[0096]
76. Item 76. The expression library according to Item 75, wherein the protein is a secreted protein.
[0097]
77. Item 76. The expression library according to Item 75, wherein the protein is a cell membrane-bound receptor.
[0098]
78. The expression library according to Item 75, wherein the cell localization position is selected from the group consisting of nucleus, lysosome, and mitochondria.
[0099]
79. 74. A library of exogenous proteins generated using the method according to Item 73.
[0100]
80. A nucleic acid library comprising a population of eukaryotic expression systems having a plurality of different members, each member comprising a recombinant nucleic acid encoding an exogenous protein operably linked to a control element, wherein the control A nucleic acid library, wherein an element directs the expression of the exogenous protein, but the expression of the endogenous protein in the eukaryotic host cell is suppressed.
[0101]
81. A method for generating a gene expression library encoding a protein having a predetermined property of interest, comprising the following steps: a. Providing a composition comprising a plurality of eukaryotic host cells, wherein each host cell has an expression system comprising different members, each member comprising an exogenous protein operably linked to a regulatory element. Comprising a recombinant virus having a recombinant nucleic acid encoding; b. Culturing the eukaryotic host cell under conditions in which the exogenous protein is expressed; and c. Identifying a member comprising a recombinant nucleic acid encoding an exogenous protein having the property of interest.
[0102]
82. 84. The method according to Item 81, wherein the nucleic acid encoding an exogenous protein is derived from a nucleic acid library containing a plurality of nucleic acids encoding different polypeptides.
[0103]
83. 82. A gene expression library comprising a plurality of expression systems encoding proteins that are localized at predetermined cell localization positions, and is generated by the method according to Item 81.
[0104]
84. 84. An expression library according to Item 83, wherein the protein is a secreted protein.
[0105]
85. 84. An expression library according to Item 83, wherein the protein is a cell membrane-bound receptor.
[0106]
86. 84. The expression library according to Item 83, wherein the cell localization position is selected from the group consisting of a nucleus, a lysosome, and a mitochondria.
[0107]
87. 84. A library of exogenous proteins generated using the method according to Item 81.
[0108]
88. A nucleic acid library comprising a population of eukaryotic expression systems having a plurality of different members, each member comprising a recombinant virus having a recombinant nucleic acid encoding an exogenous protein operably linked to a control element; Nucleic acid library.
[0109]
The present invention relates generally to the field of expressed gene technology and expression cloning. More particularly, the present invention includes predetermined properties, including but not limited to cellular localization, structure, enzyme function, and affinity with other molecules, and production of corresponding polypeptides. ) Identification, characterization and isolation of transcribed nucleic acid sequences encoding polypeptides having
[0110]
More particularly, the present invention relates to a method for identifying a nucleic acid encoding a protein having a predetermined property of interest. Such properties may include specific cellular localization locations, structures, enzyme functions, or affinity with other molecules. In one embodiment of the invention, a plurality of eukaryotic host cells are provided, wherein each host cell contains a recombinant nucleic acid encoding an exogenous protein, each member operably linked to a control element. Having an expression system comprising different members. In the second step, the eukaryotic host cell is cultured under conditions in which the exogenous protein is expressed while suppressing the expression of the endogenous protein in the eukaryotic host cell. In this time frame, the exogenous protein can be labeled as required or processed in a manner that allows discrimination from unprocessed exogenous protein. Finally, the expression system member (s) encoding the exogenous protein (s) having the desired properties are identified.
[0111]
In another aspect of the invention, a method for identifying a recombinant nucleic acid encoding an exogenous protein having a property of interest is achieved by providing a plurality of eukaryotic host cells, wherein each host The cell has an expression system that includes different members, and each member includes a recombinant virus having a recombinant nucleic acid encoding an exogenous protein operably linked to a regulatory element. The eukaryotic host cell is cultured to express an exogenous protein and to identify an expression system that expresses a recombinant nucleic acid encoding the exogenous protein having the desired properties. If necessary, the expression system can express exogenous proteins while suppressing endogenous protein production in eukaryotic host cells. Although any kind of recombinant eukaryotic virus can be used, a particularly advantageous virus is an alphavirus. Furthermore, exogenous proteins can be preferentially labeled or distinguished from endogenous proteins. The recombinant virus may be capable of directing and replicating the production of viral particles, or the recombinant virus may lack functions necessary for growth.
[0112]
The present invention also includes a method for generating a gene expression library encoding a protein having a predetermined property of interest. In one aspect, such a method provides a plurality of eukaryotic host cells, each host cell having an expression system that includes a different member, each member operably linked to a control element. A recombinant nucleic acid encoding an exogenous protein, wherein the eukaryotic host cell is expressed under conditions for expressing the exogenous protein while suppressing expression of the endogenous protein of the eukaryotic host cell. Culturing as well as identifying a member that expresses a recombinant nucleic acid encoding an exogenous protein having the desired properties. In another aspect, the method provides a plurality of eukaryotic host cells, each host cell having an expression system that includes a different member, each member operably linked to a control element. A recombinant virus having a recombinant nucleic acid encoding an exogenous protein, a step of culturing the eukaryotic host cell to express the exogenous protein, and an exogenous protein having the desired properties Identifying a member that expresses the recombinant nucleic acid. The invention further encompasses libraries of proteins identified using such methods. Further, the present invention provides a eukaryotic organism comprising a plurality of members, each having a recombinant nucleic acid encoding an exogenous protein, operatively linked to a control element for expression in a eukaryotic host cell. A nucleic acid library having a population of expression systems. In one embodiment, the control element directs the expression of the exogenous protein while suppressing the expression of the endogenous protein in the eukaryotic host cell. In yet another embodiment, the control element is derived from a eukaryotic virus.
[0113]
(IV. Definition)
The terms used herein are generally as typically used in the art. The following terms, as used herein, are intended to have the following general meaning:
[0114]
The term “cellular localization location” refers to localization defined in the context of a cell, including the extracellular space and any defined intracellular compartment (including the nucleus, mitochondria, lysosome, Endoplasmic reticulum (ER), Golgi, cytoplasm, cell membrane, endocytotic or exocytotic vesicle, cytoskeleton, peroxisomes, and the like). In bacterial or plant cells, cell localization locations can further include cell walls and chloroplasts.
[0115]
The term “control element” refers to a nucleic acid component capable of directing the expression of a nucleic acid encoding an operably linked polypeptide. In general, a “control element” includes regulatory sequences required for transcription and / or translation of genetic information. The control element further includes a component that facilitates selective expression of the operably linked nucleic acid under the specified conditions or environment while suppressing the expression of the endogenous host protein. If desired, the “control element” can further include a component that facilitates packaging of the operably linked nucleic acids.
[0116]
The term “exogenous protein” refers to a protein encoded by a recombinant nucleic acid. When an “exogenous protein” is expressed in a cell, it is encoded by a recombinant nucleic acid introduced into the cell or its ancestors. In the expression system of the present invention, the nucleic acid encoding the exogenous protein is operably linked to a control element. In some circumstances, the exogenous protein can be the same protein that is endogenously produced by the cell.
[0117]
The term “virus” refers to an entity capable of introducing genetic information into a cell. Genetic information can be introduced in the form of RNA, DNA, or derivatives thereof. The cell can be eukaryotic or prokaryotic.
[0118]
DETAILED DESCRIPTION OF THE INVENTION
(V. Detailed Description of the Invention)
(A. General overview of the present invention)
The present invention relates to a transcribed nucleic acid encoding a polypeptide having a predetermined property, including but not limited to a cellular localization location, structure, enzyme function, or affinity with other molecules. The present invention relates to methods and expression systems that allow for the rapid identification, characterization and isolation of sequences. The present invention relates to a unique exogenous protein of interest present in the system and all other “common” proteins, including endogenous cellular proteins and recombinant proteins that are permanent parts of the expression system. Based in part on the surprising discovery we have made of materials and compositions that allow identification. In general, the methods of the present invention use eukaryotic host cell systems. In this system, an expression system has been introduced for any further features according to the invention. Preferably, the expression system used has unique characteristics that allow the introduction of only one expression system per eukaryotic cell. Such a system has the advantage of allowing rapid one-step cloning of individual expressed sequences.
[0119]
The system described in more detail below has a number of advantages. First, the system of the present invention is an expression cloning system that makes it possible to direct the cloning of full-length cDNAs in one step. Secondly, this facilitates the rapid expression of the protein of interest without further cumbersome work like subcloning and production cell line establishment. Third, since the product can be expressed in mammalian cells, this system can be correctly folded, glycosylated and yield active substances. Fourth, this system allows for the rapid purification of materials without the obvious knowledge of protein properties. Fifth, this allows labeling of substances that facilitates rapid identification of the site of binding in any situation (including animals). Finally, this system directly provides a vector useful for gene transfer into cultured cells, tissues, or animals.
[0120]
In one aspect, the present invention discloses a method that allows the identification and isolation of new and known proteins having a predetermined property (eg, cellular location). More specifically, within a plurality of expression systems that encode unique exogenous proteins that are expressed in a suitable host cell system, the disclosed methods are those that encode the exogenous proteins located in the cell compartment of interest. Allows the expression system to be identified and isolated. This method, in one of its aspects, is a unique feature of the expression system used that allows high expression of the exogenous protein while suppressing the synthesis of the endogenous protein for a specific time frame. based on. During this time frame, if expressed exogenous proteins are treated with a particular detected method (eg, radiolabel), they can be easily identified within the selected cell fraction. Alternatively, all proteins expressed prior to a time frame in which synthesis of endogenous protein is suppressed can be processed in a manner that can be identified; in this case, such treatment while inhibiting endogenous protein expression. The exogenous protein that is expressed later can be identified by not exhibiting the characteristics resulting from the treatment.
[0121]
In one aspect, the methods of the invention can be used to identify and isolate individual expression systems that encode secreted proteins. During the time frame in which expression of the host cell system's endogenous protein is suppressed, the exogenous protein is labeled, for example, by incubation with radioactive amino acids. Subsequently, all secreted proteins are separated from the host cell containing the individual expression system. This separation is performed in a manner that allows the secreted protein fraction to be correlated with the host cell / expression system from which it is derived. For example, host cells containing individual expression systems can be grown in semi-solid medium (eg, soft agar at a concentration that allows physical separation of individual clones or colonies). If the secreted protein is separated from the cells, for example by a vertical diffusion process in a nitrocellulose filter (this can be achieved by placing the filter on top of a semi-solid medium), the secreted protein is Bind to the filter in a pattern that accurately reflects the physical distribution pattern of the host cells. Thus, these host cell / expression systems containing exogenous secreted proteins can be easily identified by the presence of a label in the fraction of secreted proteins.
[0122]
Similarly, this method can be applied to identify and isolate membrane associated proteins, nuclear proteins, mitochondrial proteins, lysosomal proteins, Golgi apparatus proteins, ER proteins, etc., as described in more detail herein. Briefly, the above principles can be applied with modifications to identify and isolate exogenous proteins localized at any other predetermined cellular location of interest. In addition, the methods and expression systems of the invention can be applied to identify and isolate nucleic acids encoding exogenous proteins having specific enzyme activity, binding affinity for binding partners, or structures of interest.
[0123]
In a second general aspect, the present invention provides a method that allows expression cloning of an exogenous protein encoding a given binding molecule and substrate (ligand) available. For example, to identify an unknown secreted ligand for a known receptor, the receptor protein is immobilized on a filter (eg, nitrocellulose) in a manner that saturates the protein (ie, no longer binds any protein molecule). Can do. Multiple expression systems prepared using expressed nucleic acids from sources known to express receptor ligands, which can be determined using standard methods, are provided. Expression systems can also be introduced into suitable host cells in a manner that can be physically separated in a identifiable manner, such as by growing the cells in an individual expression system, eg, in a semi-solid medium. And expressed. Similarly, as described for the identification of expression systems containing secreted proteins, exogenous proteins are labeled within a time frame during which expression of the endogenous protein is suppressed. Subsequently, the secreted protein is transferred to a nitrocellulose filter saturated with receptor protein. Since all binding sites on the filter are saturated with protein (see above), only ligands bound to the receptor can adhere to the filter. The exogenous protein corresponding to the ligand of the receptor can be identified due to its label and correlated with the expression system derived therefrom. Thus, when a receptor for a given ligand is cloned and binding of this labeled ligand to the host cell is detected, the labeled ligand is subjected to a host cell containing multiple expression systems, and the host cell Binding of this labeled ligand to is detected. Individual expression systems that produce ligand binding can be isolated.
[0124]
One advantage provided by the expression system provided by the present invention is that the expression system can be introduced and expressed in a wide variety of host cells. Thus, expression cloning of receptors and ligands can be performed in certain host cell systems that are the same as or related to those derived from receptors and ligands. This is a valuable feature, especially in light of the significance of glycosylation patterns that are known to be species dependent and can affect receptor ligand binding.
[0125]
(B. Process for identification and isolation of proteins with predetermined properties)
1. Expression system
One important component for the methods provided by the present invention is an expression vector having a number of features. To practice the methods of the present invention, one or more unique expression systems are generated and introduced into eukaryotic host cells, whereby each cell generally contains a unique type of expression system. Bring a collective. However, it is understood that this population of host cells can include several cells having the same expression system.
[0126]
In general, the expression systems provided by the present invention are nucleic acid molecules that contain two important elements. First, it contains a control element; second, it contains a heterologous nucleic acid that encodes a recombinant protein termed “exogenous protein”, which is operably linked to the control element. .
[0127]
(Control element)
In the most basic form, control elements include components that facilitate transcription and translation of exogenous proteins. Preferably, the control element is also or comprises a component that promotes the selective expression of the expressed protein while suppressing the expression of the endogenous protein in the host under certain circumstances. The control element may further comprise additional components as detailed below.
[0128]
Control elements useful in the practice of the present invention can be derived from a number of sources. Typically, the control element is derived from a virus. Various viral regulatory elements have been described that can direct expression in eukaryotic cells. Particularly preferred regulatory elements may further promote nucleic acid expression in eukaryotic cells while inhibiting endogenous protein expression under certain circumstances. Both such viral control elements have been described and those not yet discovered are within the scope of the present invention.
[0129]
Viruses of the RNA virus group are preferred vectors for the present invention. The most preferred viruses of the group of alphaviruses are used as viral vectors. Because they have the ability to block host protein synthesis itself. Examples of suitable alphaviruses are Sindbis virus, Semliki Forest virus, or Venezuelan equine encephalitis virus. Various alphavirus-derived control elements have been described. In particular, Liljeström and Garoff, 1991, Biotechnology 9: 356-361; Hahn et al., 1992, Proc. Natl. Acad. Sci. USA 89: 2679-2683; Bredenbeek, 1993, J. MoI. Virol. 67: 6439-6446.
[0130]
Alphaviruses are positive strand RNA viruses of the Togaviridae family. Strauss et al., 1994, Microbiological Reviews, pages 491-562. Alphaviruses can function in a wide range of host cells, which are mammals, birds, amphibians, reptiles, and insects. The genome of the alphavirus contains elements that can direct the expression of the protein encoded by the nucleic acid of the genomic virus.
[0131]
Expression of the protein encoded by the alphavirus genome is independent of the expression of the protein encoded by the host cell genome. Transcription of cellular genes can be stopped without apparently affecting the expression of the virus-encoded nucleic acid. Furthermore, it has been found that expression of alphavirus viral genomes in cells results in inhibition of translation of cellular messenger RNA molecules. Frolov et al., 1994, J. MoI. Virol. 68: 1721-1727. This feature of protein expression in alphavirus-mediated cells is particularly useful in the practice of the present invention.
[0132]
Recombinant nucleic acid can be inserted into a site in the genome downstream of a second subgenomic promoter or another genetic element, which can lead to the expression of exogenous nucleic acids, eg, multiple double subgenomic vectors of the alphavirus group Is provided. Hahn et al., PNAS, 89: 2679-2683. For example, it is well known that the internal ribosome entry site is functional in the Sindbis virus background. RNA molecules that contain a viral internal ribosome entry site upstream of a resistance gene (eg, a neomycin resistance gene) in the cytoplasm are sufficient to survive selection using G418. Thus, the viral internal ribosome entry site is sufficient for translation. Also, many sites in the genome are functional for the expression of exogenous nucleic acids. A Sindbis virus vector containing a second subgenomic promoter / expression cassette upstream or downstream of the structural gene has been engineered. Frolov et al., 1996, PNAS, 93: 11371-11377. Furthermore, for increased cloning capacity and enhanced vector safety, structural proteins can be supplied by helper functions provided by either packaging cell lines or helper virus particles. Bredenbeek et al., 1993, J. MoI. Virol. 6433-6446. Removing structural proteins from the replicon increases the cloning capacity of the vector used, which is advantageous for the cloning of large secreted and glycoproteins. See below. As pointed out with these examples, many modifications of the gene arrangement are possible within the scope of the present invention.
[0133]
Although alphavirus regulatory elements are most preferred, a number of other viral regulatory elements can be used that meet the criteria of synthesis that can result in protein synthesis under viral control when host cell protein synthesis stops. In accordance with the present invention, various methods can be applied to separate viral protein synthesis from host cell protein synthesis. For example, all eukaryotic genes that encode proteins are transcribed by RNA polymerase II. Thus, if control elements that do not use RNA polymerase II for transcription are used, host protein synthesis can be selectively inhibited using RNA polymerase II inhibitors; inhibition of transcription also results in inhibition of translation. Lead.
[0134]
A variety of other RNA polymerase II specific inhibitors have been described and are useful for the practice of this embodiment of the invention. Those skilled in the art will readily understand which RNA polymerase II specific inhibitors should be used. For example, antibiotics have been demonstrated as useful for such inhibition. Such antibiotics are, for example, actinomycin D, aflatoxin B1, amatoxin, which are useful for the practice of this embodiment of the invention.
[0135]
In another embodiment of the invention, the control element can be derived from a prokaryotic cell. In that case, the expression system also includes a gene encoding a bacterial RNA polymerase. Host transcription can then also be selectively inhibited using RNA polymerase II inhibitors such as actinomycin D, aflatoxin B1, amatoxin. Those skilled in the art will readily understand which control elements to use in the practice of the present invention.
[0136]
In yet another embodiment of the invention, control elements derived from eukaryotic systems can be used in the expression system of the invention. For example, a promoter or enhancer element specific for RNA polymerase I or III can be used as a control element. This makes the expression of the nucleic acid encoding the exogenous protein dependent on RNA polymerase I or III, but not on RNA polymerase II. It has been demonstrated that genes encoding proteins in eukaryotic host cells are transcribed by RNA polymerase II, and only RNA polymerase II is thought to be responsible for such transcription in the art. Thus, in the practice of this embodiment, RNA polymerase II-dependent, for example, by adding an RNA polymerase II-specific inhibitor and thus inhibiting the expression of the endogenous protein without such effects on the expression of the exogenous protein. It can inhibit sexual transcription.
[0137]
(Nucleic acid encoding exogenous protein)
As indicated above, the expression system of the present invention includes, in addition to the regulatory element, a recombinant nucleic acid encoding an exogenous protein that is operably linked to the regulatory element. The recombinant nucleic acid can be derived from any source (ie, any organism, tissue or cell type, disease state, etc.). In one embodiment of the invention, multiple different nucleic acids are inserted into multiple expression systems, resulting in multiple expression systems, each encoding a unique exogenous protein. Alternatively, a single known or unknown nucleic acid of interest encoding one particular exogenous protein to be characterized can be inserted into the expression system.
[0138]
In one embodiment of the invention, the nucleic acid component encoding the exogenous protein can be derived from a nucleic acid library. This embodiment is particularly preferred when aiming at identifying and isolating nucleic acids encoding exogenous proteins of interest and having predetermined properties. The library can be obtained from the tissue or cell type of interest. This library can be a cDNA library, genomic library, RNA library, heterologous RNA library or any other containing transcribed nucleic acid from any type of organism, tissue, or cell type known to those skilled in the art. Can be any kind of library. In preferred embodiments, the library is derived from a mammalian source, and in the most preferred embodiment forms a human source, but is also derived from reptiles, amphibians, birds, insects, plants, fungi, bacterial cells, etc. Can do. In some examples, the recombinant nucleic acid is derived from a subtractive library, eg, a library containing cDNA that is differentially expressed in a disease state when compared to the corresponding healthy tissue. A nucleic acid library typically includes a number of different nucleic acid species, each species having a different nucleic acid sequence when compared to other species in the library. The number, or complexity, of nucleic acid species in the library can vary widely depending on the number of parameters. For example, in the case of a cDNA library, the complexity of the library depends on the complexity of the RNA pool used to generate the cDNA library. Suitable nucleic acid libraries can be generated using standard methods, particularly Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition. , Cold Spring Harbor (1989). Alternatively, suitable libraries can be obtained from a number of commercial sources, including but not limited to Clontech, Palo Alto, California; and Stratagene, La Jolla, California.
[0139]
If necessary, a gene library is obtained from E. coli. E. coli, phage, yeast, etc.
[0140]
Alternatively, the nucleic acid encoding the exogenous protein can be derived from mRNA isolated from the tissue or cell type of interest. In this case, the mRNA is reverse transcribed into cDNA. Many methods are known for the preparation of cDNA, starting with cellular mRNA or preferably mRNA. Most preferably directed cDNAs are generated that can be inserted into a viral vector such that the clone has an insert in the sense direction. For example, Stratagene provides several kits for the generation of directed cDNAs (λZAP cDNA kit). In addition, standard protocols for the generation of cDNA are available, and in particular, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition. , Cold Spring Harbor (1989).
[0141]
In another embodiment of the invention, the nucleic acid encoding the exogenous protein is the specific and specific nucleic acid of interest. The expression system thus generated is particularly useful for characterizing the particular nucleic acid or protein of interest. This is because it conveniently allows the protein encoded by the nucleic acid molecule to determine where it is located in the cell, thereby revealing important information about the function of this protein to those skilled in the art. .
[0142]
The nucleic acid of interest can be DNA or RNA. Whether the nucleic acid is available as DNA or RNA, it can easily be used in a control element as part of the expression system of the present invention. Once a person skilled in the art selects a control element that is useful for the method of the invention, only routine experimentation using the nucleic acid of interest with this control element is required.
[0143]
For example, if the nucleic acid of interest is available in the form of RNA and the control element of choice is available in the form of DNA, the nucleic acid of interest is converted to DNA using a routine reverse transcription assay. obtain. Control elements can also be replaced with RNA by use of routine transcription assays. After either conversion, the resulting two DNA or RNA molecules can be ligated together using a routine DNA ligase assay or RNA ligase assay. Finally, the resulting expression system comprising the nucleic acid of interest and the combined control elements can then be used in the present invention. Similar to the above example, if the nucleic acid of interest is available in the form of DNA and the control element is in the form of RNA, any routine transformation method can be applied followed by appropriate routine A ligase method can be applied. One skilled in the art will readily know which procedure of transcription, reverse transcription or ligation will be performed next to practice the present invention.
[0144]
Alternatively, the nucleic acid of interest can be any kind of DNA. This includes, but is not limited to, complementary DNA ("cDNA"), genomic DNA, cDNA engineered to include additional nucleic acid molecules, or any other species of DNA. Any species of DNA can be used in the methods of the invention. Any species of DNA can be ligated to the control element molecule by using routine ligation assays. The expression of genomic DNA is well within the scope of the present invention. Because the use of eukaryotic cell types facilitates the necessary processing of heterologous RNA molecules generated through transcription of genomic DNA and produces messenger RNA that is useful for cellular protein synthesis.
[0145]
If the nucleic acid encoding the exogenous protein is from a cDNA library or RNA or any other source, it can be incorporated into the expression system using standard procedures. Such incorporation can be facilitated, for example, by DNA or RNA ligation procedures to connect library nucleic acid molecules with regulatory element molecules.
[0146]
In addition, different methods of assembling cDNA or RNA and viral vectors are available. Standard ligation of nucleic acids as DNA is the preferred method for performing the assembly process. Of course, other methods are also suitable (eg, RNA molecules can be ligated using a T4 RNA ligase enzyme). Many standard methods are available and are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition. , Cold Spring Harbor (1989).
[0147]
(Viral growth)
When using virus-derived control elements in the practice of the present invention, it may be necessary to propagate the virus in order to have an expression system available for future experimental methods. Virus propagation requires the availability of specific molecular components that facilitate the assembly of virus particles. In the case of proteins, some molecular components must typically be encoded by nucleic acids of the viral genome, depending on the particular virus. However, this does not allow an unlimited number of nucleic acid molecules to be added to the viral genome while maintaining the ability of the resulting derivative of the viral genome to be packaged into a viral particle.
[0148]
Therefore, when attempting to maximize the size of the nucleic acid of interest that can be integrated into the viral genome for characterization in the methods of the invention, deleting the nucleic acid molecule found in the wild-type viral genomic genome of that genome is necessary. However, such a deletion makes it impossible for the resulting expression system to propagate the virus from which the control element is derived.
[0149]
However, this problem can be overcome by the use of helper functions that provide the components required for virus propagation. In one embodiment of the invention, such helper functions can be provided by the use of helper nucleic acids. The helper nucleic acid can be a defective helper RNA as used, for example, for alphavirus-based expression systems to facilitate alphavirus growth.
[0150]
In another embodiment of the invention, such helper functions can be provided through a packaging cell line. A packaging cell line encodes in its genome the components necessary for viral propagation normally encoded by the viral genome, but is deleted for purposes of cloning utility. Therefore, these components are expressed in the cell line used in the method of the invention and facilitate viral growth.
[0151]
The production of such packaging cell lines is well within the knowledge of one skilled in the art by using routine experimentation. For example, depending on the virus selected for the practice of the present invention, the exact same nucleotide sequence deleted from the viral genome can be obtained, facilitating high level expression of the nucleic acid in the selected cell line. It can be linked to a control element known to do and the resulting nucleic acid can be transfected into a cell line. Examples of such vectors are provided below. Specifically, the vector 987BBneo (SEQ ID NO: 2) can be transfected into BHK21 cells by the Ca-phosphate method and 200 mg / l G418 can be subsequently selected according to known methods. For example, this can be further facilitated by the use of standard screening procedures for the establishment of cell lines with new properties, such as screening for the presence of markers that provide resistance to specific toxins. . Such markers (eg, neomycin resistance genes that confer resistance to neomycin selection in cells) include nucleic acid molecules that encode components required for viral growth and regulatory elements that are specific for the selected cell line. It can be included in an expression system.
[0152]
2. Introduction of expression system into host cells
An expression system, or a plurality of unique expression systems, typically including a library insert encoding an exogenous protein, is introduced into a suitable eukaryotic host cell. In this manner, a plurality of eukaryotic host cells can be provided, where each host cell has an expression system comprising a different member. Of course, in this population there may be multiple host cells containing the same member. Host cells can be from any type of organism, depending on the suitability of the expression system. Preferably, the host cell is the same or associated with a cellular source of recombinant nucleic acid encoding an exogenous protein, which in a preferred embodiment is a mammal.
[0153]
Introduction of expression systems into eukaryotic host cells can be performed using a number of different well-known procedures. CaPo _Four Transfection using polyethyleneimine, lipofection, electroporation is a small number of available techniques for introducing nucleic acids into animal cells. An RNA molecule containing a viral endogenous ribosome entry site upstream of a resistance gene in the cytoplasm (eg, a neomycin resistance gene) is sufficient to survive selection at G418. Therefore, the viral endogenous ribosome entry site is sufficient for translation. The advantages of alphaviruses have been reported in their wide host range (infection of mammals, insects, birds, amphibians, and reptile cells from a variety of different tissues) and different degrees of transformation. Cells containing exogenous viral nucleic acid can be used to generate viral particles that can be collected from the supernatant or by cell lysis. Alternatively, cells containing exogenous nucleic acid can be used to induce plaque formation in feeder cultures.
[0154]
3. Screening process for the identification and isolation of exogenous proteins with predetermined properties
In order to facilitate screening for individual exogenous proteins, physical separation of different viral clones is possible and viral particles and / or viral proteins can be isolated from the exogenous novel secreted protein or glycoprotein of interest. A cell culture is provided that allows physical separation.
[0155]
In accordance with the present invention, detection of clones that secrete novel radiolabeled proteins or glycoproteins can be performed in a variety of ways. Physical separation of viral clones can be achieved, for example, by plaque formation in a semi-solid medium consisting of normal culture medium containing agarose or carboxymethylcellulose (similar to phage screening). Alternatively, single virus particles (isolated by limited dilution) or plaque purified clones can be seeded, for example, in 96 well plates containing animal cells. The addition of a single cell to the feeder layer of a 96 well plate infects a single clone of cells. Other methods of physical isolation of viral clones can be performed without exceeding the scope of the present invention.
[0156]
(Blocking of residual host protein synthesis)
If selective labeling of virally encoded exogenous protein is desired, host cell protein synthesis must be silent. In accordance with the present invention, several methods can be used to inhibit cellular protein synthesis. Since viruses completely block cellular protein synthesis (see above), this problem is addressed by using the alphavirus family of viruses. Alternatively, if other viruses are used, depending on the control elements used (see above), host cell specific RNA polymerase II transcription and translation can be as actinomycin D, aflatoxin B1, amatoxin Can be specifically suppressed by the addition of various drugs. Even when all cells are not subject to viral replication, the rest of the cells can be stopped transcription / translation with this material. Condrey et al., 1988, J. Am. Virol, 62: 2629-2635.
[0157]
(Labeling process)
In a preferred embodiment of the present invention, the exogenous protein expressed by the expression system is in a time frame period (in this period, the expression of the endogenous protein is suppressed, but the exogenous protein is expressed). Can be made distinguishable from the endogenous protein of the host cell system. For example, a pulse of radiolabeled amino acid of appropriate length and intensity can be applied so that sufficient radioprotein can be recovered from the clone for detection. This system can vary in at least three dimensions (ie (1) pulse length, (2) pulse intensity, and (3) plaque site).
[0158]
At an appropriate time after infection, sufficient cells will produce viral replication and express viral encoded proteins and RNA polymerase II transcription and / or translational repression will be complete. Added to the culture. Of course, many different combinations are suitable, such as pulse-chase time, different plaque sizes, isotope selection, autoradiographic aspects (phosphoimagers for X-ray film), etc. Examples of suitable combinations of labeling time, isotope, concentration, etc. are given in the examples. The application of radioactive amino acids can be performed as a pulse with a subsequent chase period. Other schemes are appropriate (eg, continuous incorporation of radioactive amino acids). Under certain conditions where the protein can be precipitated and therefore removed, the monomeric amino acids do not precipitate. Suitable isotopes are any 20 natural amino acids, ³⁵ S, ^Three H, ¹⁴ C. Alternatively, the endogenous protein can be processed in such a way that it can be distinguished from the newly synthesized exogenous protein. The treatment of the present invention includes 1) removal of sialic acid residues from the cell surface with sialidase. New membrane proteins being synthesized from exogenous expression systems exhibit sialic acid residues on the cell surface that allow detection, and 2) proteolytic digestion of endogenous proteins (eg, on the cell surface). Other methods are possible and within the scope of the present invention.
[0159]
(Soluble virus protein)
When using expression systems for viral-derived control elements, including viral proteins, one may encounter problems with soluble viral proteins that are expressed when exogenous proteins are expressed. This problem can be of varying degrees. For example, when using screening methods based on semi-solid media (eg, soft agar plates), such soluble viral proteins can bind to membranes designed to bind exogenous proteins.
[0160]
In one embodiment of the invention, such soluble viral proteins are screened for the desired exogenous protein by using a filter that can bind or stop the flow of such soluble viral proteins. Blocked from interfering. In another embodiment, antibodies specific for soluble viral proteins are attached to such filter paper so that the soluble viral proteins bind. Various filter papers have been described that are useful for binding or stopping the flow of soluble viral proteins. One skilled in the art will readily know which filter should be used for the practice of the present invention. It is also well within the knowledge of those skilled in the art to attach to such a filter an antibody that is specific for soluble viral proteins. In another embodiment of the invention, the antibody is cross-linked with semi-solid medium (eg, NuFix Agarose, FMC Bioproducts Rockland USA, which prevents interference between the screen and viral proteins).
[0161]
In another embodiment of the invention, the production of soluble viral protein is reduced by the use of serum-containing media. Any amount of reduction is desired, preferably to a level that allows detection of the secreted protein of interest in the viral protein background. Yet another way to reduce the production of soluble viral proteins is by the use of protease inhibitors or inhibitors. An example of the use of a protease inhibitor to reduce the amount of soluble viral protein is illustrated below as a practical example. Any one or more protease inhibitors may be used and are well known to those skilled in the art.
[0162]
In another embodiment of the invention, the production of soluble viral proteins is reduced by the use of an expression system that includes mutant virus-based control elements. Various mutant virus strains useful for this embodiment of the invention have been described.
[0163]
One skilled in the art readily knows which mutant virus strain should be used for this embodiment. For example, mutant virus strains of the genus Alphavirus have been described as useful for the practice of this embodiment of the invention. Mutant Sindbis virus strains that are useful for the practice of this embodiment of the invention have, for example, ts20, ts10, and ts23 genotypes (Lindquist et al., 1986, Virology, 151: 10-20; Arias et al., 1983). J. Mol. Biol., 168: 87-102; Carleton and Brown, 1996, J. Virol., 70: 952-959). Such temperature sensitive virus mutants are defective in the cleavage of PE2 (ts20) and defective in the folding of E1 (ts10; ts23). As a result, viral proteins do not reach the cell surface at non-permissive temperatures. Soluble protein leakage is reduced by the use of these variants.
[0164]
In another embodiment of the invention, production of soluble viral proteins is reduced using cell lines that lack proteolysis of the viral proteins in the methods of the invention. Various cell lines have been described that lack proteolysis of viral proteins. Watson et al., 1991, J, Virol. 65: 2332-2339.
[0165]
One skilled in the art readily knows which cell lines are cell lines that lack proteolysis of the viral protein. Cell lines that are useful for practice in this embodiment of the invention lack the proteolytic cleavage of the viral protein used in the methods of the invention. For example, when using alphaviruses in the practice of the present invention, the described cell lines that lack the cleavage of viral proteins PE2 to E2 and E3 may be useful.
[0166]
More specific screening processes of the present invention are illustrated below.
[0167]
(Compartment screening)
For one embodiment of the present invention, host cells containing unique expression systems encoding exogenous proteins can be screened by placing them in a separate compartment. For example, individual cells are physically picked up and placed in a separate compartment, eg, one well in a 96 well plate. Of course, if desired, multiple cells can be placed in compartments or wells to facilitate screening of cells in the group. Alternatively, viral particles are diluted to 1 pfu per compartment to induce monoclones.
[0168]
(Semi-solid medium screening)
In another embodiment of the invention, the cells used in the methods of the invention can be isolated by growing them in soft agar. For example, cells can be transfected with expression system nucleic acids and then developed on plates in semi-solid medium (ie, soft agar). This soft or semi-solid medium can consist of a normal growth medium containing, for example, agarose or carboxymethylcellulose. Alternatively, confluent layers of cells are infected with viral (eg, alphavirus) plaques with a MOI that allows growth to a size of 1-3 mm. Three hours after infection, the virus solution is removed and replaced with semi-solid medium. This semi-solid medium inhibits the spread of virus particles and allows plaque formation. Other methods of maintaining cells in semi-solid media known to those skilled in the art are also within the scope of the present invention.
[0169]
Once plated on soft agar or semi-solid media, host cells can be screened. This makes it possible to reduce the lateral diffusion of the substance on the plate, thus reducing the cross-contamination of various cells or viruses including expression systems that express different exogenous proteins. Furthermore, this experimental setting allows the influx of proteins secreted by the cells (eg extracellular proteins encoded by the nucleic acid of interest) from the cells into a filter that can bind such proteins. Filters that are useful for protein binding are, for example, nitrocellulose filters and PVDF or nylon membranes.
[0170]
Once the exogenous proteins are bound to the filter, they can be screened by different methods known to those skilled in the art. In one embodiment of the invention, exogenous proteins are selectively labeled to determine their position on the filter (see above). For example, by exposing the filter to the film, the film will have a dark spot where it will be juxtaposed to the spot of the filter bound labeled exogenous protein once developed. When using normal displays, one skilled in the art can correlate each spot on the film to an area on the soft agar plate. Thus, cells expressing exogenous proteins that occur in spots on the film can be located. Thus, specific expression systems comprising nucleic acids encoding exogenous proteins that are secreted and occur in spots on the film can also be located.
[0171]
In another embodiment of the invention, filters with exogenous proteins bound may be screened by exposing the filter to a ligand. For example, one method selected may be to expose a filter with bound exogenous protein to a labeled lectin, thereby screening for secreted glycoproteins. Alternatively, for example, the filter can be screened with antibodies specific for a particular post-translational modification (such as a sugar moiety). In addition, antibodies specific for the particular protein of interest can be used.
[0172]
In addition, this system facilitates easy separation of viral particles from exogenous proteins. Separation can be achieved, for example, by the use of different filter papers (ie, those that bind to the virus particles or stop the flow of virus particles, but do not bind to exogenous proteins, nor do they stop the flow). This additional filter paper can be placed under a filter that binds the exogenous protein. Therefore, the virus particles do not reach the filter paper that binds the exogenous protein.
[0173]
The filter can be made more effective, for example, by attaching an antibody against the soluble viral protein to a filter that binds the soluble viral protein but not the exogenous protein.
[0174]
(Detection and isolation of secreted proteins)
In a preferred embodiment of the invention, the sample is prepared for detection of secreted radioactive protein and detection of radioactivity versus background.
[0175]
Depending on the method of physical separation of the selected clones, different modes of detection of secreted or glycoproteins can be applied. For example, if a single clone is inoculated into a microtiter plate, precipitation of secreted radioactive protein or glycoprotein in the supernatant can be performed using, for example, the TCA method (Ma et al., 1994, Cancer). Chemother. Pharmacol.38 (4): 391-394). If physical separation of the clones was achieved using a semi-solid growth medium, then the membrane that captured the secreted radioactive protein or glycoprotein is washed and prepared for autoradiography. Many different commercially available membranes or filters are useful as tracer membranes. Proteins captured at the membrane need to be bound so that clones secreting radioactive protein can be detected. Several different washing procedures can be applied to link the precipitated protein to the membrane and remove unincorporated radioactive amino acids. Several methods are suitable for autoradiography, including exposure to X-ray film with and without sensitizers and phosphorescence imaging.
[0176]
(Ligand selection)
In another embodiment of the invention, cells containing expression systems that express different exogenous proteins can be separated by ligand recognition. For example, in the case of screening for nucleic acids of interest that encode receptor molecules on cell membranes, ligands that can recognize such receptors can be used to screen for cells that express such receptors. This screening can be performed, for example, by attaching a ligand to the solid support and exposing cells expressing the protein of interest to the ligand on the solid support. By binding cells that express the membrane receptor molecule of interest, cells that express such receptors can be separated from cells that do not express such receptors.
[0177]
In one embodiment of the invention, the ligand can be a protein. In another embodiment, the ligand can be an antibody. In yet another embodiment, the ligand can be a lectin. In a further embodiment, the ligand can be a non-protein. The choice of ligand depends on the protein selected for it. Numerous ligands have been described that can bind proteins based on peptide backbones, post-translational modifications, or other criteria. Those skilled in the art will readily know which ligands are useful for the practice of this embodiment of the invention.
[0178]
In another embodiment of the invention, the ligand is bound to a solid support. Various solid supports useful for the practice of this embodiment have been described. For example, the ligand can be bound to a plate to which cells expressing exogenous protein are added. Once placed on the plate to which the ligand is bound, the cell binds to the ligand if the cell expresses a membrane protein that recognizes the ligand. Cells bound to the ligand will therefore remain on the plate when a wash solution is added to remove cells that do not bind the ligand. In this way, cells expressing membrane receptors that bind the ligand are removed from cells that do not. Consequently, this is a quick and simple method for identifying membrane receptors and the nucleic acids that encode them. Since membrane receptors are major targets for drug development, this embodiment of the invention is very useful for pharmaceutical research and drug discovery.
[0179]
(Membrane protein selection)
In another embodiment of the invention, cells expressing an exogenous protein based on an exogenous protein that is a membrane protein having an extracellular domain may be selected. For example, exogenous protein can be expressed in the cell, while expression of endogenous protein is inhibited, or using an expression system, the manipulation inhibits expression of endogenous protein (see above). thing).
[0180]
This setup can be used, for example, to protease treat cells after inhibition of endogenous protein expression has occurred (but exogenous protein expression still continues). After extracellular proteinaceous protrusions (ie, cell membrane receptors, etc.) are removed from the cell surface, the expression of exogenous proteins can replenish such protrusions. However, such recruitment occurs only when the exogenous protein expressed in a particular cell is a membrane receptor molecule.
[0181]
Therefore, in this process, only cells that contain an expression system that encodes a membrane receptor molecule have an extracellular proteinaceous overhang. Such overhangs are used to bind cells to any structure that binds to the protein, whether such binding is specific or non-specific with respect to the structure of the binding protein. Can be done. Cells that bind to such protein binding structures can then be further analyzed, for example, with respect to the sequence of the nucleic acid encoding the exogenous protein. Various structures for binding proteins have been described and are well known to those skilled in the art. For example, nitrocellulose, PVDF or nylon filters can be used in this embodiment as protein binding structures. Other structures that bind to proteins known to those skilled in the art are also within the scope of the present invention.
[0182]
(Membrane glycoprotein screening)
In one embodiment of the invention, cell membrane glycoproteins are identified using the methods of the invention. In order to facilitate the identification of cell membrane glycoproteins, various methods have been described that are useful in practicing this embodiment of the invention. For example, the chemical reactivity of cell surface sugar residues may be altered, thereby facilitating specific recognition and identification of such sugar residues. One useful method for such modification of chemical reactivity is, for example, the introduction of reactive ketone groups into cell surface oligosaccharides. Mahal et al., 1997, Science 276: 1125-1128. In this method, a new chemically reactive group is introduced into a cell surface glycoprotein. When this method is applied under conditions such that the exogenous protein is expressed in the method of the invention, while the expression of the endogenous protein is inhibited, the exogenous protein preferably incorporates a reactive group, thereby exogenous. Facilitates protein recognition. Other methods known to those skilled in the art are useful in the practice of this embodiment of the invention and are also within the scope of the invention.
[0183]
In another embodiment of the invention, membrane glycoproteins are identified using the methods of the invention through selective glycosylation of such membrane glycoproteins. Various methods for selectively glycosylating membrane proteins are known and within the scope of the present invention. For example, all sialic acid residues on the cell surface can first be removed by the use of an enzyme that exhibits sialidase activity. After such removal, the method of the present invention is used to express exogenous protein in the cell, while endogenous protein expression is inhibited. Thereby, the exogenous protein is preferably transported to the cell surface in a sialylated form, facilitating its improved identification.
[0184]
(Screening for proteins localized in other cellular fractions of interest)
In one embodiment, the present invention provides a general approach that can be used to identify expression systems that include nucleic acids encoding exogenous proteins that are localized to any cell location of interest. A host cell with an expression system that contains a unique nucleic acid encoding an exogenous protein is provided in a manner that allows physical separation of each host cell, including the individual expression system. Preferably, the expression system includes a viral control element. Most preferably, the host cell / expression system allows viral particles comprising the expression system to be released from the host cell.
[0185]
For example, host cells can be plated on semi-solid media. Initially, a filter capable of binding virus particles is placed on a semi-solid medium under conditions and at times that allow virus particles to be captured on the filter. Those skilled in the art will readily know what filters may be useful in the production of this embodiment of the invention. For example, the filter can be a nitrocellulose filter. The first filter with virus particles associated with the filter is processed in a manner that facilitates recovery of infectious virus particles containing the expression system. Subsequently, the host cells in the semi-solid medium are exposed to a composition that allows for the labeling of the expressed exogenous protein and the expression of the endogenous protein is inhibited. For example, exogenous proteins can be labeled with radioactive amino acids, while endogenous protein expression is suppressed. In the next step, the host cells in the semi-solid medium are those that allow recovery of the desired intracellular fraction / intracellular compartment and / or allow recovery of the desired intracellular fraction / intracellular compartment. Prepare the conditions to do. The person skilled in the art knows, under consideration, what conditions are appropriate depending on the intracellular compartment / fraction. In the next step, a second filter is placed on the semi-solid medium that has bound to it, for example, an antibody against a specific structure contained within the intracellular fraction of interest. It is important that the filter is saturated (ie does not allow any further molecules to bind to its surface). The second filter is placed under conditions and for such time to allow the cell compartment of interest to adhere. For example, if the cell component of interest is in the nucleus, antibodies against nuclear membrane surface proteins are attached to the filter. In another compartment, a corresponding method is used. Thus, the second filter constitutes a “replica” of the first filter, where the first filter attaches a recoverable expression system to it, while the second filter is derived from the cell component of interest. Attach proteins. These individual clones of host cells contain an expression system that includes a nucleic acid encoding an exogenous protein located within the intracellular fraction / intracellular component of interest and can be identified through the presence of the label. In addition, cellular components can be physically separated using classical methods well known in the art (eg, differential centrifugation).
[0186]
(Identification of unknown ligands of known receptors)
In one embodiment, the present invention allows the identification of an unknown secreted ligand of a known receptor of interest. Host cells containing expression systems containing unique recombinant nucleic acids encoding exogenous proteins are cultured in a manner that they are physically separable. For example, for this purpose, host cells can be cultured in semi-solid medium. The cells are incubated with a composition that allows labeling of the expressed exogenous protein while inhibiting expression of the endogenous protein. Filters coated with the receptor protein of interest are such that all binding sites are saturated (either by the receptor protein or any other neutral protein) and all secreted proteins can migrate to the filter. And on a semi-solid medium at time. Since all protein binding sites on the filter are saturated, only the secreted protein bound to the receptor of interest adheres to the filter. These exogenous proteins can be identified by their label. Since the filter represents a replica (ie, a mirror image of the original plate), colonies containing expression systems containing nucleic acids encoding ligands of the receptor of interest can be easily identified.
[0187]
(Identification of unknown receptors for known ligands)
In one embodiment, the present invention allows the identification of unknown receptors for known ligands. Host cells containing expression systems containing unique recombinant nucleic acids encoding exogenous proteins are cultured in a way that they are physically separable. For example, a confluent layer of cells can be infected with a low MOI of an infecting virus having multiple expression systems. Following infection, the cells are incubated at 34 ° C. in a semi-solid medium (eg, low melting point agarose) having a melting point around 37 ° C. After a sufficiently large plaque is produced, the filter is placed on the surface (top) for a time sufficient to capture virus particles that serve as replicas of the plate. Subsequently, the agarose is dissolved by heating the plate to 39 ° C. After agarose removal and washing, the cells are incubated with the selected labeled ligand. After washing the cells, ligand binding can be detected by autoradiography. Viral particles containing the desired expression system (and nucleic acid) can then be recovered from the replica filter.
[0188]
(4. Recovery of virus particles containing the exogenous protein of interest)
In the next step, these viral particles from the sample or areas where increased radioactivity was observed are identified and recovered. Identification of the location of the plaque in which the well or the exogenous protein of interest was detected can be traced back using the developed film and the virus particles can be recovered. In this regard, recombinant viral particles containing the nucleic acid sequence that results in the expression of the protein of interest are collected. According to the present invention, the particles can be applied, for example, to one of the procedures described below.
[0189]
C. Application of identified expression systems that encode proteins of a given property
A pool of expression systems selected using the screening methods described above that have a predetermined property, such as cell localization location, structure, enzymatic function, or affinity for other molecules, is used for further screening procedures. obtain. Alternatively, individual expression systems can be picked randomly and subjected to characterization and functional analysis. See below.
[0190]
(Further screening round to avoid contamination)
Individual clones can be picked up and the procedures of steps 3 and 4 can be repeated to plaque purify the clones and avoid contamination.
[0191]
(Passaging of virus particles to increase the number of virus particles)
Viral particles that have been isolated and optionally amplified by passage can be applied to one of the following procedures. Numerous useful applications for viral particles containing exogenous nucleic acids encoding secreted or glycoproteins are apparent, some of which are described below. The invention is therefore not limited to the applications described above.
[0192]
(Infection of cell cultures that induce the production of novel secreted proteins or glycoproteins, either in labeled or unlabeled form)
Isolated virus particles can be used on a large scale, for example, by infecting substrate cell lines grown in vessels such as T-flasks, spinner flasks, roller bottles, bioreactors, perfusion reactors, etc. Secreted or glycoproteins can be produced. Depending on the nature of the gene construct selected above, production occurs under slightly different conditions. When one method of vector is packaged in a packaging cell line, the particles induce only one round of infection (thus the MOI should be greater than 1). Also, a wide range of host cell lines can be used for the production of novel secreted proteins or glycoproteins. Labeling of the new secreted protein or glycoprotein can be accomplished by the addition of radioactive amino acids as described above. This provides the advantage that product formation can be easily monitored by SDS polyacrylamide gel electrophoresis and subsequent autoradiography. In this way, unknown products can be easily detected for optimization of production parameters.
[0193]
(Application of the so-produced supernatant to a protein purification or isolation method by its radiolabel and detection of a novel secreted protein or glycoprotein)
Novel secreted proteins or glycoproteins can be easily purified from the supernatant of the above steps using standard protein purification techniques. The unique possibility of labeling secreted proteins during production (see above) greatly simplifies the purification process. The eluate from the chromatography column or the like can be collected automatically using a sample collector. Samples containing novel secreted proteins can be easily identified by detection of radioactivity. Enriched and purified material can be obtained in this way. Unlabeled material can be obtained by application of identical chromatographic conditions to unlabeled cell culture supernatant.
[0194]
D. Characterization and functional analysis of individual identified proteins
Several procedures known in the art can be utilized for further characterization and functional analysis of individual identified exogenous proteins.
[0195]
1. Sequencing of nucleic acids encoding exogenous proteins
In one embodiment, the identification and sequencing of exogenous nucleic acids in recovered viral particles can be studied by sequencing by standard methods. A detailed description of suitable protocols can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor (1989).
[0196]
Sequence comparison with known polynucleotide sequences in the database can provide an indication of the function of the identified and isolated exogenous protein.
[0197]
2. Analysis of expression patterns of identified exogenous proteins
In one embodiment, the cDNA of the identified exogenous protein or fragment thereof is used as a probe to detect the expression of the mRNA. For example, sections of tissue samples can be prepared and examined by in situ hybridization using an appropriate labeled probe. Alternatively, mRNA extracts can be prepared and analyzed in Northern blot analysis. Alternatively, synthetic oligonucleotides designed according to the identified protein cDNA sequences can be generated and used as hybridization probes. A detailed description of suitable protocols can be found, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor (1989).
[0198]
In one embodiment, the level of gene expression is assayed by detection and measurement of its transcription. For example, RNA from a particular cell type or tissue that is known or that is thought to over- or under-express its gene (e.g., cancerous tissue) may be hybridized as described herein or Isolated and tested by utilizing PCR technology. Isolated cells can be derived from cell cultures, patients, or experimental animals. Such an analysis may show both quantitative and qualitative aspects of the expression pattern of the gene encoding the identified exogenous protein, including activation or inactivation of the gene expression.
[0199]
Hybridization probes for Northern blot, Southern blot, and in situ hybridization are: ³² P, ³⁵ S, and ^Three Can be labeled by various reporter groups, including radionuclides such as H (for in situ hybridization) or enzymatic labels such as alkaline phosphatase coupled to the probe via an avidin / biotin coupling system . Labeled hybridization probes can be prepared by any method known in the art for the synthesis of DNA and RNA molecules. The following V1. H. See section. Further uses for nucleic acid hybridization probes include their use as primers for polymerase chain reaction (PCR). PCR is described in detail in US Pat. Nos. 4,965,188, 4,683,195, and 4,800,195.
[0200]
The DNA can be used in biological sample hybridization or amplification assays to detect abnormalities, including genetic structures, including point mutations, insertions, deletions, and chromosomal rearrangements. Such assays include, but are not limited to, Southern analysis, single chain polymorphism analysis (SSCP) and PCR analysis.
[0201]
Diagnostic methods for detection of specific mutations in genes encoding identified exogenous proteins include, for example, sets obtained from samples (eg, from patient samples, or from other suitable cell sources). One or more labeled nucleic acid reagents, including recombinant DNA molecules, cloned genes or degenerate variants thereof, recombinant DNA molecules, cloned genes or degenerate variants thereof, and genes of these reagents Contacting and incubating under conditions favorable for specific annealing to their complementary sequences within. Preferably, the length of these nucleic acid reagents is at least 15-30 nucleotides. After incubation, all unannealed nucleic acids are removed from the nucleic acid molecule hybrid. The presence of hybridized nucleic acid is then detected, if present. By using such a detection system, nucleic acids from the cell type or tissue of interest can be immobilized, for example, on a solid support such as a membrane or on a plastic surface such as on a microtiter plate or polystyrene beads. . In this case, the labeled nucleic acid reagent that is not annealed is easily removed after incubation. Detection of the remaining, annealed, labeled gene nucleic acid reagent is accomplished by the use of standard techniques well known in the art. The sequence annealed by the nucleic acid reagent is compared to the annealing pattern predicted from the normal gene sequence to determine if a genetic mutation is present.
[0202]
Other methods for the detection of nucleic acid molecules specific for the gene in patient samples or in other suitable cell sources are for example PCR (Mullis, KB, 1987, US Pat. No. 4,683, U.S. Pat. The experimental embodiment described in No. 202, see supra) may be included, followed by detection of the amplified molecule using techniques well known to those skilled in the art. If the mutation is intended to be measured, the resulting amplified sequence is expected if the amplified nucleic acid contains only a normal copy of the gene to determine whether the gene mutation is present It can be compared with a sequence.
[0203]
3. Detection of exogenous proteins identified using antibodies
Antibodies directed against the identified exogenous protein of interest, or a conserved variant or peptide fragment thereof, can also be used to gain further insight into expression patterns in vivo. Antibodies can also be used to detect abnormalities in the expression level of a gene, or abnormalities in the structure and / or temporal, tissue, cellular, or subcellular location of the gene product, and for example, It can act in vivo or in vitro, as in biopsy tissue.
[0204]
The analysis can be performed in any tissue or cell type or in a test animal, still in vivo, using a labeled antibody. Alternatively, the tissue or cell type to be analyzed is a tissue or cell type that is known (or suspected) to abnormally express the identified exogenous protein of interest, such as cancer tissue, for example. May be included.
[0205]
Protein isolation methods used herein are described, for example, in Harlow and Lane (Harlow, E. and Lane, D., 1988, “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, Cold Spring Harbour, New York). Isolated cells can be from cell cultures, laboratory animals, or patients.
[0206]
For example, antibodies, or fragments of antibodies useful in the present invention, can be used to quantitatively or qualitatively detect the presence of an identified exogenous protein of interest, or a conserved variant or peptide fragment thereof. obtain. This can be achieved, for example, by immunofluorescence techniques using fluorescently labeled antibodies (see below in this section) combined with light microscopy, flow cytometry, or fluorometric detection.
[0207]
Antibodies (or fragments thereof), or fused or conjugated proteins useful in the present invention may further be used for in situ detection of the identified exogenous protein of interest, or conserved variants or peptide fragments thereof. Alternatively, for catalytic subunit binding (in the case of labeled catalytic subunit fusion proteins), it can be used histologically, such as immunofluorescence, immunoelectron microscopy, or non-immunoassay.
[0208]
In situ detection can be accomplished by removing a histological specimen from a patient and applying a labeled antibody or fusion protein of the invention thereto. The antibody (or fragment) or fusion protein is preferably applied by overlaying the labeled antibody (or fragment) onto the biological sample. By using such a procedure, it is possible to determine not only the presence of the identified exogenous protein of interest, or conserved variants or peptide fragments, but also the distribution in the tested tissue. Using the present invention, one skilled in the art will readily understand that any of a wide variety of histological methods (eg, staining procedures) can be modified to achieve such in situ detection.
[0209]
Immunoassays and non-immunoassays for the identified exogenous proteins of interest, or conserved variants or peptide fragments thereof, are typically collected from samples (eg, biological fluids, tissue extracts, freshly collected) Cells, or cell lysates incubated in cell culture) in the presence of detectably labeled antibodies that can identify the identified exogenous protein of interest, or a conserved variant or peptide fragment thereof. And detecting bound antibody by any of a number of techniques well known in the art.
[0210]
The biological sample can be subjected to contact with a solid support or carrier (eg, nitrocellulose, or other solid support that can immobilize cells, cell particles, or soluble proteins) and can be immobilized. The support can then be washed with a suitable buffer and subsequently treated with a detectably labeled antibody or fusion protein. The solid support can then be washed a second time with buffer to remove unbound antibody or fusion protein. The amount of bound label on the solid support is then detected by conventional means.
[0211]
By “solid support or carrier” is intended any support capable of binding an antigen or antibody. Well known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylase, natural and modified cellulose, polyacrylamide, gabbro, and magnetite. The nature of the carrier can be either somewhat soluble or insoluble for the purposes of the present invention. The support material can have virtually any possible structural configuration so long as the bound molecule can bind to the antigen or antibody. Thus, the support configuration can be spherical (eg, in a bead), cylindrical (eg, in the inner surface of a test tube), or the outer surface of a rod. Alternatively, the surface can be flat, such as a sheet, test strip, and the like. Preferred supports include polystyrene beads. One skilled in the art knows many other suitable carriers for antibody or antigen binding, or can readily obtain the same.
[0212]
The binding activity of a given lot of antibody or fusion protein is determined by well-known methods. One skilled in the art can readily determine operational and optimal assay conditions.
[0213]
For antibodies, one of the ways in which antibodies can be detectably labeled is by linking the same to an enzyme and using it in an enzyme immunoassay (EIA) (Voller, 1978, Diagnostic Horizons 2: 1-7, Microbiological Associates Quarterly Publication, Walkersville, MD); Voller et al., 1978, J. Biol. Clin. Pathol. 31: 507-520; Butler, 1981, Meth. Enzymol. 73: 482-523; Maggio, E .; (Eds.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, FL; Ishikawa et al. (Eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo). The enzyme bound to the antibody reacts with an appropriate substrate (preferably a chromogenic substrate) in a manner that produces a chemical moiety that can be detected, for example, by a spectrophotometer, a fluorimeter, or by visual means. To do. Enzymes that can be used to detectably label antibodies include malate dehydrogenase, staphylococcal nuclease, Δ-5-steroid isomerase, yeast alcohol dehydrogenase, α-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, Examples include, but are not limited to, alkaline phosphatase, asparaginase, glucose oxidase, β-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase, and acetylcholinesterase. Detection can be accomplished by a colorimetric method using a chromogenic substrate for the enzyme. Detection can also be achieved by visual comparison of the extent of substrate enzymatic reaction in comparison to a similarly prepared standard.
[0214]
Detection can also be achieved using any of a variety of other immunoassays. For example, by radioactively labeling an antibody or antibody fragment, the identified exogenous protein of interest can be detected by use of a radioimmunoassay (RIA) (eg, Weintraub, B., Principles). of Radioimmunoassays, Seventh Training Course on Radioligand Assay Technologies, The Endocrine Society, March, 1986). The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
[0215]
It is also possible to label the antibody with a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the appropriate wavelength, its presence can then be detected due to fluorescence. The most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthalaldehyde, and fluorescamine.
[0216]
Antibodies are also ¹⁵² It can be detectably labeled using a fluorescent metal such as Eu or other lanthanum series. These metals can be attached to the antibody using metal chelates such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0217]
The antibody can also be detectably labeled by coupling the antibody to a chemiluminescent compound. The presence of the chemiluminescent tagged antibody is then determined by detecting the presence of luminescence that occurs during the course of the chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, thermomatic acridinium ester, imidazole, acridinium salt, and oxalate ester.
[0218]
Similarly, bioluminescent compounds can be used to label the antibodies of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems where catalytic proteins increase the effectiveness of chemiluminescent reactions. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for labeling purposes are luciferin, luciferase, and aequorin.
[0219]
(Animal tissue or cell infection)
Viral particles obtained by the above procedure can be used as gene transfer vectors for delivery of a gene of interest to a tissue or animal. This approach is useful for studying the properties of the protein of interest, or can be used, for example, for the production of antibodies against the new protein as a result of its expression in the host.
[0220]
E. Use of proteins with predetermined properties
Nucleic acids that have been identified, characterized, and isolated using the methods and expression systems of the invention, and more importantly, the proteins encoded thereby, can be useful for a number of applications. First, they are often useful for research applications and laboratory use, for example, the discovery and isolation of new growth factors, cytokines, or hormones can be performed in cells that have not previously been cultured. Can be easily propagated. Discovery and isolation of membrane receptors, cytoplasmic proteins, and nucleoproteins are useful to gain further insights in important cellular signaling and regulatory processes. The discovery and isolation of organelle proteins can provide further insight into metabolism, anabolism, and processing functions.
[0221]
However, some genes and gene products identified and isolated according to the present invention can be used directly as therapeutic agents, or alternatively as therapeutic targets.
[0222]
1. Use as a therapeutic agent
Proteins identified and isolated using the expression systems of the present invention, particularly secreted proteins, can be useful as therapeutic agents. In fact, a number of already known secreted proteins (including cytokines and peptide hormones) have been produced and used as therapeutic agents. Many serious diseases are caused by the lack or insufficient amount of certain secreted proteins that act as intercellular communicators, for example, in response to environmental changes or other physiological needs. A well-known example is diabetes most often caused by a deficiency in the production of the peptide hormone insulin. Many other examples are known. Many new secreted proteins not covered by the present invention with respect to the fact that only a small percentage of all secreted proteins have been identified, isolated, and characterized to date Expected to be useful as therapeutic compounds for the treatment of diseases including, but not limited to, growth, metabolic signals, or certain other possibilities that the cell cannot properly communicate with obtain.
[0223]
Furthermore, proteins derived from other cellular localization locations may be useful for therapeutic agents. For example, many proteins expressed in the nucleus include apoptosis-inducing proteins or tumor suppressors and tend to be used as agents for treatment (eg, cancer).
[0224]
One skilled in the art can use the methods and expression systems of the invention to determine which identified proteins can be useful as therapeutic targets. For example, in vivo assays using inhibitory antibodies or antisense strategies can be used to elucidate protein function. In addition, purified forms of proteins can be used for cellular assays and tests in animal disease models to determine their value as therapeutic compounds.
[0225]
2. Use as therapeutic target
Another important aspect of the present invention is to provide proteins that serve as specific therapeutic targets for therapeutic pathological disorders. When many diseases related to the inappropriate function of secreted proteins or the amount of secreted protein generated can be treated by the administration of the respective protein (or its equivalent), this situation is often the case for proteins located in cells Is different. Defects in hormone or cytokine production can often be treated by administration to restore a physiological response. In contrast, many other cellular functions, particularly in the cell membrane and nucleus, are associated with serious diseases (including cancer and other proliferative disorders, as well as various metabolic diseases) when their functions are disproportionate. It is known to contain a large number of proteins that can be causal. For example, breast cancer is thought to be caused by overexpression of cell surface receptors (ie, receptor tyrosine kinase HER2) in 30% of all cases. Slamon, 1989, supra. It is believed that this type of breast cancer can be treated by administration of a HER2 inhibitor to the appropriate target site. As an example of a metabolic disease, type II diabetes (non-insulin dependent diabetes mellitus, NIDDM) can be caused by aberrantly expressed or defective insulin receptors. Taira. 1989, supra. Type II diabetes can be treated with therapeutic compounds that inhibit the receptor and activate molecules downstream of the insulin receptor signaling pathway. Alternatively, type II diabetes can be treated with a compound that can activate a defective insulin receptor.
[0226]
For many diseases, both those associated with inappropriate cell proliferation and those associated with metabolic defects, the biological cause has not yet been identified, but the inappropriate function or amount of cellular protein It is thought to be caused by. The proteins identified by the methods of the invention are useful for the development of targeted therapeutic approaches (including drug development and gene therapy) or as diagnostics / reagents.
[0227]
When a protein identified by the methods of the invention is used as a therapeutic target, the protein can be subjected to appropriate assays for compound identification and isolation by modulating its activity.
[0228]
F. Generation and use of antibodies directed against proteins identified by the methods of the invention
Various procedures known in the art can be used for the production of antibodies against epitopes of recombinantly produced proteins identified and isolated using the methods of the invention. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and fragments produced by Fab expression libraries.
[0229]
In one embodiment of the invention, such antibodies are used as a tool for the study of the expression pattern, generation, function, and other characteristics of the proteins identified by the methods of the invention. For example, cells or tissue sections can be exposed to antibodies and can characterize the expression specificity and amount of identified proteins of the invention. Various types of antibodies (including monoclonal, polyclonal, and single chain antibodies) can be used for experiments such as determining the cell and tissue specific expression patterns of identified proteins. A number of techniques are well established that allow the detection of antibodies that bind to proteins expressed in cells or tissue sections.
[0230]
In addition, labeled antibodies (eg, radiolabeled antibodies) can be used in vivo to determine the expression pattern and generation of identified proteins. See above. For example, a labeled antibody can be injected into the specimen and its binding site can be monitored to determine the cell and / or tissue type where the identified protein is located. Since the protein of interest originally identified and isolated is certainly a product of a different species than the test animal, the use of polyclonal antibodies is preferred. Thus, for example, if the identified protein used to generate the antibody is human and the test specimen is not human, polyclonal antibodies are preferred, with exceptions.
[0231]
In addition, antibodies can be used to analyze the physiological function of proteins identified using the methods and expression systems of the invention. For example, inhibitory antibodies (ie, antibodies that bind to a particular functional epitope of the identified protein of interest) can be identified rationally or empirically and injected into test cells or experimental animals. Effects on cells, specific tissues, or physiological functions can be identified to elucidate the biological role of the identified protein and its potential environment in abnormal or pathological conditions. Once biological functions and roles in disease development have been identified, the development and design of targeted treatment strategies can begin. One such strategy is the identification and isolation of compounds that conveniently modulate the function of the target protein, as described in more detail below.
[0232]
In other embodiments, the antibody is useful, for example, as a diagnostic or therapeutic agent. As therapeutic agents, neutralizing antibodies (ie, antibodies that compete for binding with a ligand, substrate, or adapter molecule, or antibodies that interfere with this protein when the protein of the invention is used as a therapeutic target) are particularly preferred purposes. It is.
[0233]
For use as a diagnostic agent, monoclonal antibodies that bind to the identified protein are radioactively labeled, allowing detection of location and distribution in the body after injection. Radioactively tagged antibodies can be used as non-invasive diagnostic tools for in vivo imaging of the presence of tumors and metastases associated with expression of the identified proteins of the invention.
[0234]
Immunotoxins that target cytotoxic factors to specific sites in the body can also be designed. For example, high affinity monoclonal antibodies can be covalently linked to bacterial or plant toxins (eg, diphtheria toxin, abrin, or ricin). A general method for preparing antibody / hybrid molecules may involve the use of thiol cross-linking reagents such as SPDP that attack primary amino groups in the antibody and attach the toxin to the antibody by disulfide exchange. Hybrid antibodies can be used to specifically remove cells that express the proteins identified by the methods of the invention.
[0235]
For the production of antibodies, various host animals (including but not limited to rabbits, mice, rats, etc.) are immunized by injecting the identified protein of interest. Various adjuvants (Freund's adjuvant (complete and incomplete), inorganic gels such as aluminum hydroxide, surface active substances (eg lysolecithin, pluronic polymer, polyanion, peptide, oil emulsion, keyhole limpet hemocyanin, dinitrophenol) , And potentially useful human adjuvants, such as but not limited to BCG (bacille Calmette-Guerin) and Corynebacterium parvum, to enhance immunological responses, depending on the host species Can be used.
[0236]
Monoclonal antibodies against the proteins of the invention can be prepared using any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include the hybridoma technology originally described by Kohler and Milstein, 1975, Nature 256: 495-497, the human B cell hybridoma technology (Kosbor et al., 1983, Immunology Today 4:72; Cote et al., 1983, Proc. Natl. Acad.Sci.U.S.A. 80: 2026-2030), and EBV-hybridoma technology (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). However, it is not limited to these. In addition, technology developed for the production of “chimeric antibodies” (Morrison) by splicing genes from mouse antibody differentiation of appropriate antigen specificity with genes from human antibody molecules of appropriate biological activity. 1984, Proc. Natl. Acad. Sci. U.S.A. 81: 6851-6855; Neuberger et al., 1984, Nature 312: 604-608; Takeda et al., 1985, Nature 314: 452-454). Can be done. Alternatively, techniques described for the production of single chain antibodies (US Pat. No. 4,946,778) can be adapted to produce single chain antibodies specific for the proteins of the invention.
[0237]
Antibody fragments that contain specific binding sites for cell proliferation genes can be generated by known techniques. For example, such fragments include F (ab ′) that can be produced by pepsin digestion of antibody molecules. ₂ Fragment, and F (ab ′) ₂ Fab fragments that can be generated by reducing the disulfide bonds of the fragments are included, but are not limited to these. Alternatively, Fab expression libraries can be constructed that allow the rapid and easy identification of monoclonal Fab fragments with the desired specificity of the proteins of the invention (Huse et al., 1989, Science 246: 1275-1281).
[0238]
G. Use of identified nucleic acids encoding target proteins of interest for antisense approaches and ribozyme development
The development and use of antisense DNA or RNA molecules or oligonucleotides or oligoribonucleotide sequences containing ribozymes that function to inhibit the translation of cell growth gene mRNA can serve either of two purposes. First, such an approach can be used to study the function of novel proteins identified using the methods of the present invention. Second, these approaches can serve as actual therapeutic methods once the function of the protein and its involvement in pathological conditions are established. For example, antisense DNA or RNA molecules act to directly block translation of a targeted gene by binding to the targeted mRNA and then preventing protein translation.
[0239]
Ribozymes are enzymatic RNA molecules that can catalyze the specific cleavage of RNA. The mechanism of ribozyme action appears to involve site-specific hybridization of the ribozyme molecule to the complementary sequence of the target RNA, followed by endonucleolytic cleavage. In one embodiment of the present invention, ribozyme molecules are engineered to specifically catalyze endonucleolytic cleavage of mRNA of genes identified using the methods of the present invention.
[0240]
A suitable target site for ribozyme activity is about 15-25 amino acids corresponding to the region of the target molecule that first scans the target molecule for potential ribozyme cleavage motifs and second contains the identified cleavage recognition site. Identified by evaluating structural features. Furthermore, the suitability of candidate targets can also be assessed by testing accessibility to hybridization with complementary oligonucleotides using a ribonuclease protection assay. Bordonaro et al., 1994, Biotechniques 16: 428-430.
[0241]
The labeled hybridization probes antisense DNA and RNA oligonucleotides and ribozymes of the present invention are prepared by any known method in the art for the synthesis of DNA and RNA molecules. For example, oligonucleotides can be chemically synthesized using commercially available DNA or RNA synthesizers, such as equipment sold by Applied Biosystems. Alternatively, RNA molecules can be generated by in vitro and in vivo transcription of DNA sequences encoding antisense RNA molecules. Such DNA sequences can be incorporated into a wide variety of vectors including suitable RNA polymerase promoters such as T3, T7, or SP6 polymerase promoters. Alternatively, antisense cDNA constructs that synthesize antisense RNA can be stably introduced into cell lines, either constitutively or inducibly.
[0242]
Various modifications to DNA and RNA molecules can be introduced as a means of increasing intracellular stability and half-life. For example, flanking sequences of ribonucleotides or deoxyribonucleotides can be added to the 5 ′ and / or 3 ′ ends of the molecule, or phosphorothioate or 2′O-methyl rather than phosphodiester linkage is used in the oligonucleotide backbone. Can be done. Xu et al., 1996, Nucleic Acid Res. 24: 1602-1607.
[0243]
H. Generation of compounds that target identified, isolated, and characterized proteins
1. Compound identification
For identification and isolation of compounds that alter, inhibit or enhance the function of the identified and characterized proteins of the present invention, appropriate cell lines expressing the identified proteins can be utilized. . Alternatively, proteins identified by the process of the invention can be isolated and used for in vitro or in vivo assays for the identification and isolation of compounds that specifically interfere with their activity. In general, the type of assay utilized will depend largely on the nature and functional characteristics of the identified protein used as the target (hereinafter “target protein”). For example, if the target protein is a growth factor receptor, a cellular assay in which the effect of the compound on growth is measured can be utilized. If the target protein is a secreted protein, an assay that includes the effect of the isolated secreted protein on an appropriate system (eg, a receptor system that allows the function of the secreted protein to be measured) Can be used. If the target protein is a transcription factor, a cell line that allows one to assay the effect of the compound on the expression of genes controlled by the transcription factor may be utilized. If the target protein is an apoptosis regulator, cell lines in which cell death (or survival) is driven by the responsive target protein can be utilized and the effects of the compounds can be assayed.
[0244]
More particularly, cells in a suitable assay system that expresses the target protein can be exposed to a chemical compound or compound library to identify compounds having the desired modulatory effect. Alternatively, the target protein can be expressed in a suitable expression system designed to allow high-throughput testing of compounds from any source and bind to the target protein or measurable inhibition Isolated as necessary to identify molecules with effects.
[0245]
Nucleotide sequences encoding target proteins identified and isolated using the methods of the invention can be used to produce corresponding purified proteins using well-known methods of recombinant DNA technology. . Many publications teaching methods for expression of genes after they have been isolated include Gene Expression Technology, Methods and Enzymology. Vol. 185, edited by Goeddel, Academic Press, San Diego, California (1990).
[0246]
The protein of the present invention selected as the target protein can be expressed in a variety of host cells, either prokaryotic or eukaryotic. In many cases, the host is eukaryotic, more preferably the host is a mammal. The host cell can be derived from either the same species as the naturally occurring (ie, endogenous) species that encodes the protein identified using the methods of the invention, or from a different species. In cell expression systems other than the expression system originally used for the original identification and isolation of proteins according to their cell location (see above), target proteins selected by recombinant DNA technology Advantages to produce include the development of optimized assay systems for the identification of regulatory compounds. In general, the expression systems of the present invention have the advantage that they readily provide a system for the production of large quantities of recombinant proteins. However, under certain circumstances understood by those skilled in the art, alternative expression systems may in some cases utilize highly enriched sources of proteins for purification, and simplified purification procedures. It can prove to be advantageous to obtain the possibility. Methods for recombinant production of proteins are generally very well established in the art and can be found, among others, in Sambrook et al. (Supra).
[0247]
In an embodiment of the present invention, cells transformed with an expression vector encoding the identified protein of the present invention are subjected to conditions that favor expression of the gene sequence and recovery of the recombinantly produced protein from cell culture. Incubated in The target protein of interest produced by the recombinant cell can be secreted or contained within the cell, depending on the nature of the gene and the particular gene construct used. In general, it is more convenient to prepare recombinant proteins in secreted form. The purification process depends on the nature of the production and the particular protein produced. Purification methodologies are well known in the art; one skilled in the art will understand how to optimize the purification conditions. General protocols for how to optimize purification conditions for a particular protein can be found, inter alia, in Scopes: Protein Purification: Principles and Practice, 1982, Springer-Verlag New York, Heidelberg, Berlin.
[0248]
In addition to recombinant production, peptide fragments can be produced by direct peptide synthesis using solid phase techniques. Stewart et al., Solid-Phase Peptide Synthesis (1969), W.M. H. Freeman Co. San Francisco, and Merrifield, 1963, J. Am. Am. Chem. Soc. 85: 2149-2154.
[0249]
In vitro polypeptide synthesis can be performed using manual techniques or by automation. Automated synthesis can be accomplished, for example, using Applied Biosystems 431A Peptides Synthesizer (Foster City, California) according to the instructions provided in the manufacturer's instructions.
[0250]
In one embodiment of the invention, an antibody, peptide, organic molecule that acts as an agonist or antagonist of cell proliferation gene activity using a target protein that expresses the target protein and / or a cell line that expresses the target protein, or Screen for other ligands. For example, antibodies that can interfere with activity (eg, enzymatic activity of a target protein) or its interaction with a ligand, adapter molecule, or substrate are used to inhibit the function of the target protein. Where amplification of the function of the target protein is desired, for example, antibodies that mimic the ligand, adapter molecule, or substrate of the corresponding signaling pathway can be developed. Obviously, antibodies that alter the activity, function, or specificity of the target protein can be purified if desired.
[0251]
Alternatively, screening a peptide library or organic compound with a recombinantly expressed target protein or cell line that expresses the target protein functions by inhibiting, amplifying, or modifying its biological activity. It may be useful for identifying molecules for use.
[0252]
Synthetic compounds, natural products, and other sources of potentially biologically active substances can be screened by a number of methods. The ability of a test compound to inhibit, enhance, or modulate the function of a target protein can be determined using an appropriate assay that measures the function of the target protein. For example, a response (eg, an activity such as enzyme activity, or the ability of a target protein to bind to a ligand, adapter molecule, or substrate) can be determined in an in vitro assay. Cellular assays can be developed to monitor the effects on modulation of second messenger production, changes in intracellular metabolism, or cell proliferation. These assays can be performed using conventional techniques developed for these purposes. Finally, the ability of a test compound to inhibit, enhance or modulate the function of the target protein is measured in vivo in an appropriate animal model. For example, mouse models are used to monitor the ability of compounds to inhibit solid tumor development, or the effect of reducing solid tumor size.
[0253]
In one embodiment of the invention, a random peptide library consisting of all possible combinations of amino acids bound to a solid support is used to identify peptides that can interfere with the function of the target protein. For example, peptides can be identified for binding of a given target protein to a ligand binding site, adapter molecule binding site, or substrate binding site, or other functional domain (eg, an enzyme domain) of the target protein. Thus, screening of peptide libraries can yield compounds that have therapeutic value because they interfere with their activity.
[0254]
Identification of molecules that can bind to the target protein can be accomplished by screening peptide libraries with recombinant soluble target proteins. Methods for expression and purification of the selected target protein can be used to express the recombinant full-length protein or fragment thereof, depending on the functional domain of interest.
[0255]
In order to identify and isolate a peptide / solid support that interacts with the target protein to form a complex, it is necessary to label or “tag” the target protein molecule or fragment thereof. For example, the target protein may be conjugated to an enzyme such as alkaline phosphatase or horseradish peroxidase or to other reagents such as fluorescent labels that may include fluorescein isothiocyanate (FITC), phycoerythin (PE), or rhodamine. Binding of any given label to the target protein can be done by using routine techniques in the art.
[0256]
In addition to using soluble protein molecules or fragments thereof, in another embodiment, peptides that bind to the target protein can be identified using intact cells. The use of intact cells is preferred when the target protein contains a cell surface receptor that requires the lipid domain of the cell membrane to be functional. A method for generating a cell line that expresses a target protein identified using the methods and expression systems of the present invention. The cells used in this technique can be either live cells or immobilized cells. The cells are incubated with a random peptide library and bind to specific peptides in the library. The complex thus formed between the target cell and the associated solid support / peptide can be isolated by standard methods known in the art, including differential centrifugation.
[0257]
If the target protein is a membrane-bound receptor, or a receptor that requires the lipid domain of the cell membrane to be functional, an alternative to whole cell assays is to bind the receptor molecule to a liposome to which a label or “tag” can bind. To rebuild.
[0258]
In another embodiment, the cell line expressing the selected target protein, or isolated target protein or fragment thereof, inhibits, enhances, or enhances the activity of the target protein (signaling, if applicable), or Used to screen for modulating molecules. Such molecules can include small organic or inorganic compounds, or other molecules that affect the activity of the target protein or promote or prevent complex formation with its ligand, adapter molecule, or substrate. . Synthetic compounds, natural products, and other sources of potentially biologically active substances can be screened by a number of methods commonly known to those skilled in the art.
[0259]
For example, the ability of a test molecule to interfere with the function of a selected target protein can be measured using standard biochemical techniques. Alternatively, activation or suppression of the catalytic activity of other proteins, phosphorylation, dephosphorylation, or other modifications, activation or regulation of second messenger production, changes in intracellular ion levels, binding or dissociation of signaling molecules, Alternatively, cellular responses such as metastasis, or transcription or translation of specific genes can also be monitored. These assays can be performed in the screening process by using conventional techniques developed for these purposes.
[0260]
Furthermore, the effect on the function of the target protein can affect various cellular processes via signal transduction pathways. Cellular processes under the control of its signaling pathway include normal cell function, proliferation, differentiation, maintenance of cell shape, adhesion, and normal or potentially harmful processes (eg, unregulated cells Proliferation, deficiency of contact inhibition, and blocking differentiation or cell death). Qualitative or quantitative observation and measurement of any described cellular process by techniques known in the art can be advantageously used as a scoring means for signal transduction in the course of screening.
[0261]
A variety of techniques for screening, identification, and evaluation of compounds that interact with selected target proteins of the present invention may be utilized. The compound can affect various cellular processes under the control of the target protein.
[0262]
For example, the target protein or functional derivative thereof is incubated with the compound in pure or semi-pure form, in a membrane preparation, or in all living or immobilized cells. Subsequently, under appropriate conditions, the effect of the compound on the target protein function, for example, measuring its activity or its signal transduction and comparing it to the activity of the target protein incubated under the same conditions without the compound Is closely examined to determine whether the compound stimulates or inhibits the activity of the target protein.
[0263]
In addition to the use of whole cells expressing the selected target protein for compound screening, the present invention also includes a method of using a soluble or immobilized target protein. For example, molecules that can bind to a target protein can be identified within a biological or chemical preparation. For example, a target protein or a functional fragment thereof (eg, a fragment containing a specific domain of interest) is immobilized on a solid phase matrix, followed by chemical or biological preparations where the immobilized target protein and compound are Is contacted for a time sufficient to bind. Any unbound material is then washed away from the solid phase matrix and the presence of the compound bound to the solid phase is detected, thereby identifying the compound. Appropriate means are then used to elute the bound compound.
[0264]
2. Source of candidate test compounds
Test compounds used for assays to identify modulators of target protein activity are available from any commercial source (Aldrich (1001 West St. Paul Ave., Milwaukee, WI 53233), Sigma Chemical (P .O. Box 14508, St. Louis, MO 63178), Fluka Chemie AG (Industriestrasse25, CH-9471 Buchs, Switzerland (Fluka Chemical Corp.980 South 2nd Street, Ronkonkoma, NY 11779)), Eastman Chemical Company, Fine Chemicals ( P. O Box 431, Kingsport, TN 3766 ), Boehringer Mannheim GmbH (Sandhofer Strasse116, D-68298 Mannheim), Takasago (4Volvo Drive, Rockleigh, NJ 07647), SST Corporation (635 Brighton Road, Clifton, NJ 07012), Ferro (111 West Irene Road, Zachary, LA 70791 ), Riedel-deHaenAktiensellschaft (PO Box D-30918, Seelze, Germany), PPG Industries Inc., Fine Chemicals (One PPG Place, 34th Floor, 72th Pitb, Pittsbur Obtained from; Furthermore, microorganism, products of any kind of natural comprising an extract of fungal or plant, can be screened using assays cascade of the present invention.
[0265]
3. Indication for the use of a compound to modulate the activity of a target protein of the invention according to its predetermined properties
Depending on the nature and function of the target protein, the compounds identified by the above exemplified assays and methods can be modulators of cell proliferation or modulators of specific metabolic functions. Thus, the compounds produced by the processes and assays of the present invention are useful for the treatment of diseases associated with abnormal, uncontrolled or inappropriate cell proliferation (including excessive or decreased proliferation). is there. Alternatively, the compounds may be useful for the treatment of diseases associated with abnormal metabolic function.
[0266]
Many disease states involve excessive or reduced cell proliferation. In general, many of these diseases can be treated with DNA sequences or small molecules that affect cell proliferation. In some cases, the goal is to stimulate proliferation; in other cases, it is to prevent or inhibit cell proliferation. Lists of diseases involving cell proliferation directly include cancer, psoriasis, inflammatory diseases (eg rheumatoid arthritis), restenosis, immunological activation or suppression (tissue injection), neurodegeneration, or neuronal expansion, And viral infections.
[0267]
Many diseases include abnormal metabolic functions, including but not limited to diabetes mellitus, fibrosis, cystic fibrosis. Furthermore, pathological conditions are associated with both abnormal cell proliferation and metabolic defects.
[0268]
Accordingly, a pharmaceutical composition comprising a therapeutically effective amount of a compound identified by the above method is a disease (glioma, melanoma, Kaposi's sarcoma, uncontrolled or inappropriate cell growth driven) Cancers such as psoriasis, hemangiomas, and ovarian cancer, breast cancer, lung cancer, pancreatic cancer, prostate cancer, colon cancer, and epidermoid cancer, rheumatoid arthritis, restenosis, immunological activation or suppression (tissue rejection) ), Including neurodegeneration or expansion of nerve cells); as well as diseases associated with metabolic failure (including but not limited to diabetes mellitus, fibrosis, cystic fibrosis).
[0269]
I. Formulation / Route of Administration
The present invention provides two forms of therapeutic compositions. First, the present invention provides a medicament that is similar to a naturally occurring functional polypeptide or peptide, or a functional fragment or derivative thereof. Such medicaments are, for example, proteins that are secreted in their natural form; such proteins can be identified directly using the expression system of the invention. This type of medicament includes, but is not limited to, cytokines, hormones, growth factors, and the like. Second, the present invention provides therapeutic compounds that modulate the function of the target protein identified using the methods and expression systems of the present invention. Typically, these types of compounds are small organic molecules, but they also include peptide compounds and antibodies. Those skilled in the art will appreciate that the following methods of administration, formulation, and treatment need to be tailored depending on the compound selected and the type of disease to be treated.
[0270]
The identified therapeutic compound can be administered to a human patient alone or in a pharmaceutical composition. In the composition they are mixed with a suitable carrier or excipient in a therapeutically effective dose to treat or reduce various disorders. A therapeutically effective dose refers to the amount of a compound sufficient to produce, for example, a reduction or increase in cell proliferation, or a reduction in symptoms determined in remodeling metabolic function. Techniques for the formulation and administration of the compounds of this application are described in “Remington's Pharmaceuticals Sciences”, Mack Publishing Co. , Easton, PA, can be found in the latest edition.
[0271]
1. Route of administration
Suitable routes of administration include, for example, oral, rectal, transmucosal, or enteral administration; intramuscular, subcutaneous, intramedullary injection, and intrathecal, direct intraventricular, intravascular, intraperitoneal, intranasal, Or parenteral delivery including intraocular injection is included.
[0272]
Alternatively, the compounds of the invention are administered locally rather than systemically, for example, by direct injection of the compound into a solid tumor, often in a depot, or in a sustained release formulation. obtain.
[0273]
Further, for example, drugs can be administered via targeted drug delivery systems in liposomes coated with tumor-specific antibodies. Liposomes are targeted to and taken up selectively by the tumor.
[0274]
2. Composition / Formulation
The pharmaceutical compositions of the present invention may be prepared by conventional mixing, dissolving, granulating, dragee-making, levulating, emulsifying, encapsulating, entrapping, or lyophilizing. It can be manufactured by means of a process.
[0275]
Accordingly, a pharmaceutical composition for use according to the invention comprises excipients and adjuvants, which facilitate the processing of the active therapeutic compound into a pharmaceutically usable preparation 1 It can be formulated in a conventional manner using one or more physiologically acceptable carriers. Proper formulation is dependent upon the route of administration chosen.
[0276]
For injection, the agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
[0277]
For oral administration, the therapeutic compound can be readily formulated by combining the active therapeutic compound with pharmaceutically acceptable carriers well known in the art. Such carriers are formulated for oral intake by the patient to be treated, such as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc., of the therapeutic compounds of the invention. Is possible. Pharmaceutical preparations for oral use are, as a solid excipient, if desired, after addition of suitable adjuvants to obtain tablets or dragee cores, optionally milling the resulting mixture, It can then be obtained by processing a mixture of granules. Suitable excipients include fillers such as sugar (including lactose, sucrose, mannitol, or sorbitol); for example, corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, hydroxypropylmethylcellulose Cellulose preparations such as sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrating agents can be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
[0278]
Dragee cores are provided with suitable coatings. For this purpose, a concentrated sugar solution can be used, which if necessary includes gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol and / or titanium dioxide, lacquer solution, As well as suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings to identify or characterize different combinations of active therapeutic compound doses.
[0279]
Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Push-fit capsules may contain active ingredients mixed with fillers such as lactose, binders such as starch, and / or lubricants such as talc or magnesium stearate, and optionally stabilizers. In soft capsules, the active therapeutic compound can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers can be added. All formulations for oral administration should be in dosages suitable for such administration.
[0280]
For buccal administration, the composition may take the form of tablets or troches formulated in a conventional manner.
[0281]
For administration by inhalation, therapeutic compounds for use according to the present invention are suitable propellants (eg, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas). Is conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or nebulizer. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver the measured amount. For example, gelatin capsules and cartridges may be formulated for use in an inhaler or insufflator, which includes a powder mixture of the therapeutic compound and a suitable powder base such as lactose or starch.
[0282]
The therapeutic compound may be formulated for parenteral administration by injection, for example by bolus injection or continuous infusion. Formulations for injection may be present in unit dosage form, eg, in ampoules or multiple dose containers, with additional preservatives. The composition may take such forms as suspensions, solutions, or emulsions in oils and aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.
[0283]
Pharmaceutical formulations for parenteral administration include aqueous solutions of the active therapeutic compound in water-soluble form. In addition, suspensions of the active compounds can be prepared as appropriate oil injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. If desired, the suspension may also contain suitable stabilizers or agents that increase the solubility of the therapeutic compound, allowing the preparation of highly concentrated solutions.
[0284]
Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle (eg, sterile pyrogen-free water) before use.
[0285]
The therapeutic compounds can also be formulated in rectal compositions such as suppositories or retention enemas, eg, containing conventional suppository bases such as cocoa butter or other glycerides.
[0286]
In addition to the previously described formulations, the therapeutic compound can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, therapeutic compounds can be combined with suitable polymeric or hydrophobic materials (eg, as an emulsion in an acceptable oil) or ion exchange resin, or sparingly soluble derivatives (eg, conserving soluble salts). ).
[0287]
A pharmaceutical carrier for the hydrophobic therapeutic compounds of the invention is a cosolvent system comprising benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
[0288]
The co-solvent system can be a VPD co-solvent system. VPD was a solution of 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant polysorbate 80, and 65% w / v polyethylene glycol 300, made up to absolute volume with absolute ethanol. The VPD co-solvent system (VPD: 5W) consists of VPD diluted 1: 1 with 5% dextrose in aqueous solution. This co-solvent system dissolves hydrophobic therapeutic compounds well and itself produces low toxicity upon systemic administration. Naturally, the proportion of a co-solvent system can vary considerably without destroying its solubility and toxicity characteristics. In addition, the identity of the co-solvent component can vary: for example, other low toxicity nonpolar surfactants can be used in place of polysorbate 80; the fraction size of polyethylene glycol can vary; A compatible polymer can be replaced with polyethylene glycol (eg, polyvinylpyrrolidone); as well as other sugars or polysaccharides can be replaced with dextrose.
[0289]
Alternatively, other delivery systems for hydrophobic pharmaceutical therapeutic compounds can be used. Liposomes and emulsions are well known as examples of delivery vehicles or carriers for hydrophobic drugs. Although usually toxic, certain organic solvents such as dimethyl sulfoxide can also be used.
[0290]
In addition, the therapeutic compound can be delivered using a sustained release system such as a semi-permeable matrix of solid hydrophobic polymer containing the therapeutic agent. Various sustained-release materials have been established and are well known by those skilled in the art. Sustained release capsules can release therapeutic compounds over several weeks up to 100 days, depending on their chemical nature.
[0291]
Depending on the chemical nature and biological stability of the therapeutic agent, additional strategies for protein stability can be used.
[0292]
The pharmaceutical composition may also include a suitable solid or gel phase carrier or excipient. Examples of such carriers or excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars, starch-cellulose derivatives, gelatin, and polymers such as polyethylene glycol.
[0293]
Many therapeutic compounds of the invention can be provided as salts with pharmaceutically compatible counterions. Pharmaceutically compatible salts can be formed with many acids, including but not limited to hydrochloric acid, sulfuric acid, acetic acid, lactic acid, tartaric acid, malic acid, succinic acid, and the like. Salts tend to be more soluble between aqueous solvents that are the corresponding free base forms or in other protic solvents.
[0294]
3. Effective dosage
Pharmaceutical compositions suitable for use in the present invention include compositions wherein the active ingredient is included in an amount effective to achieve its intended purpose. More particularly, a therapeutically effective amount means an amount effective to prevent the onset of the subject being treated or to alleviate existing symptoms. The determination of an effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
[0295]
For any therapeutic compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. For example, the dosage is formulated in an animal model and is determined in cell culture. ₅₀ A range of circulating concentrations (ie, concentrations of test therapeutic compounds that achieve half-maximal inhibition or activation of cell proliferative activity, or restoration of metabolic function). Such information can be used to more accurately determine useful doses in humans.
[0296]
A therapeutically effective dose refers to that amount of therapeutic compound that results in amelioration of symptoms or prolonged survival in a patient. Toxicity and therapeutic effects of such therapeutic compounds are demonstrated in cell cultures or experimental animals, for example LD ₅₀ (Lethal dose up to 50% of the population) and ED ₅₀ It can be determined by standard pharmaceutical procedures for determining (a therapeutically effective dose in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and LD ₅₀ And ED ₅₀ As a ratio between. Therapeutic compounds that exhibit high therapeutic indices are preferred.
[0297]
Data obtained from these cell culture assays and animal studies can be used to formulate a dosage range for use in humans. The dosage of such therapeutic compounds is preferably ED with little or no toxicity. ₅₀ Is within the range of circulating concentration. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration, and dosage can be chosen by the individual physician in view of the patient's condition. (See, eg, Fingl et al., 1975, “The Pharmaceutical Basis of Therapeutics”, Chapter 1, page 1.)
[0298]
Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety sufficient to maintain the kinase modulating effects, or minimal effective concentration (MEC). The MEC will vary for each therapeutic compound but can be estimated from in vitro data; for example, the concentration required to achieve 50-90% inhibition of the kinase using the assays described herein . The dosage required to achieve MEC depends on the individual characteristics and route of administration. However, plasma concentrations can be determined using HPLC assays or bioassays.
[0299]
Dosage intervals can also be determined using the MEC value. The therapeutic compound should be administered using a regimen that maintains plasma levels above the MEC for between 10-90%, preferably 30-90%, and most preferably 50-90% of the time. In cases of local administration and selective uptake, the effective local concentration of the drug may not contribute to plasma concentration.
[0300]
The amount of composition administered will, of course, depend on the subject being treated, the weight of the subject, the severity of the affliction, the manner of administration, and the judgment of the physician prescribing the drug.
[0301]
4). Packaging
The composition may be present in a pack or dispenser device that may contain one or more unit dosage forms containing the active ingredients, if desired. The pack can include, for example, a metal or plastic foil (eg, a blister pack). The pack or dispenser device can be accompanied by instructions for administration. A composition comprising the therapeutic compound of the invention formulated in a compatible pharmaceutical carrier can be prepared, placed in a suitable container and labeled for treatment of the indicated condition. Appropriate conditions indicated on the label may include inhibition or activation of cell proliferation, restoration of metabolic function, treatment of tumors, treatment of arthritis, and the like.
[0302]
The following examples for the generation and use of the selection system of the present invention allow those skilled in the art to have a clearer understanding and implementation of the present invention. However, the invention is not limited in scope by the exemplary embodiments intended only as an illustration of a single aspect of the invention, and methods that are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the above claims.
[0303]
VI. Example
A. Materials and methods
The following are the experimental procedures and materials used in the examples shown below.
[0304]
(Construction of cDNA library into SinRep5 vector)
Total mRNA of any tissue or cell line is isolated using the QuickPrep (MicromRNA purification kit (Pharmacia, Pharmacia Biotech Europe GmbH, Duebendorf, Switzerland) according to the supplier's recommendations. First-strand synthesis is performed in the presence of 5-methyl-cytosine using a Straagene AG, Basel, Switzerland) ZAP cDNA synthesis kit to protect the internal StuI restriction site, followed by a second digestion with RNaseH. The strand is synthesized using DNA polymerase I to produce a 3 ′ overhang that can be recessed by T4 DNA polymerase (3 ′ exonuclease activity). Finally, it is ligated into the pSinRep5 vector (see Invitrogen, NV Leek, Netherlands; see FIG. 5 and Bredenbeek et al., 1993, J. Virol. 11: 6439-6446), followed by digestion with StuI. Linearize the plasmid for in vitro transcription.
[0305]
Construction of a cDNA library in a TE vector (see FIG. 6 and Frolov et al., 1996, PNAS 93: 11371-11377; the complete sequence of pTE5′2J is given in SEQ ID NO: 1) essentially consists of pSinRep5 Do as described for. The only exception is the use of 5-methyl-adenosine during second strand synthesis to protect the internal XbaI restriction site and the resulting DNA fragment into the pTE plasmid pTE SEAP via XbaI / StuI or ApaI. To clone.
[0306]
The plasmids used in this study are detailed in Table 1.
[0307]
Table I
Description of the DNA construct:
pSinRep5 construct:
pSinRep5: Invitrogen Sindbis
From the expression system European Headquarters: Invitrogen, NV Leek, Netherlands
Bredenbeek et al., November 1993, J. Am. Virology 67: 6439-6446.
[0308]
SP6 promoter: 9933-9951
Nonstructural genes: 60-7598
Subgenomic promoter: 7580-7603
Start of transfer: 7598
Multiple cloning sites: 7647-7689
Poly A tail: 7997-8033
Amp resistance gene: 8227-9085
ColE1 origin: 9232-9861.
[0309]
pSinRep5 EPO: pSinRep5 digested with XbaI / SphI was ligated with the synthetic EPO sequence of EPO (XbaI / SphI). See the attached sequence 1 for the sequence of EPO.
[0310]
pSinRep5 SEAP: pSinRep5 digested with XbaI / StuI and ligated with the NheI / ClaI fragment of pSEAP2Basic, Clontech Laboratories, Inc. , Palo Alto, USA. pSinRep5 lacZ: derived from Invitrogen Sindbis expression system.
[0311]
pTE construct:
pTE5'2J: A general description of the related vector pTE3'2J is described below: Hahn et al., 1992, Proc. Natl. Acad. Sci. USA 89: 2679-2683. Frolov et al., 1996, Proc. Natl. Acad. Sci. USA 93: 11371-11377. The detailed sequence of TE5′2J is shown in SEQ ID NO: 1.
[0312]
pTE5′2J EPO: pTE was digested with XbaI / ApaI and ligated with the XbaI / ApaIEPO fragment derived from pSinRep5.
[0313]
pTE5'2J SEAP: pTE was digested with ApaI and the ends were treated with Klenow enzyme prior to digestion with XbaI. The vector was ligated with the NheI / ClaI fragment from pSEAP 2Basic (Clontech Laboratories, Inc., Palo Alto USA).
[0314]
pTE5'2J CAT: pTE5'2J was digested with XbaI and the ends were filled with Klenow enzyme according to standard procedures. The CAT PCR fragment shown in the attached sequence 3 was blunt-ended and ligated into the vector TE5′2J.
[0315]
Helper construct:
DHEB: Bredenbeek et al., 1993, J. MoI. Virology 67: 6439-6446.
[0316]
987BBneo: (SEQ ID NO: 2).
[0317]
(In vitro transcription of Sindbis cDNA library)
Linearized vector DNA (pSinRep5 or pTE linearized by NotI digestion; helper DNA DH-EB linearized by EcoRI digestion (Bredenbeek et al., 1993, J. Virol. 11: 6439-6446)) was prepared using QiaQuick PCR. RNase was removed by purification through a purification column (QIAGEN AG, Basel, Switzerland) and eluted with DEPC-H2O. Subsequent in vitro transcription was performed using the SP6 in vitro transcription kit (Invitroscript CAP Kit, Invitrogen BV, NV Leek, The Netherlands) according to the manufacturer's recommendations. The resulting 5 ′ capped mRNA was analyzed on reducing and non-reducing agarose gels.
[0318]
(Generation of Sindbis virus particles)
2-5 μg of in vitro transcribed mRNA was electroporated to BHK21 cells (ATCC accession number CCL10), or (for TE construct), according to Invitrogen manual (Invitroscript CAP Kit, Invitrogen BV, NV Leek, The Netherlands) Electroporated (for PSinRep5 and helper DH-EB). The 5 'capped mRNA of pSinRep5 encodes a viral nonstructural protein that induces the viral replication process. A co-electroporated helper mRNA (DH-EB) delivered viral structural proteins. 5% CO in TurbodomaHP-1 medium containing 1% FCS ₂ After incubation for 18 hours at 37 ° C., cell supernatants were harvested and the amount of infectious virus particles released was determined by plaque assay.
[0319]
(Plaque assay)
A dilution series of harvested viral particles (see above) was used in 1 ml of Turbodoma HP-1 (1:10) in 90% confluent BHK21 cells in a 6-well plate. ^Four , 1: 5 × 10 ^Four 1:10 ^Five , 1: 5 × 10 ^Five 1:10 ⁶ , 1: 5 × 10 ⁶ ) After 2 hours incubation at 37 ° C., in the case of temperature sensitive mutants from complementation groups C, D, and E, the plates were incubated at a permissive temperature of 30 ° C. (Lindquist et al., 1986, Virology 151: 10-20; Arias et al., J. Mol. Biol. 168: 87-102; Carleton and Brown, 1996, J. Virol. 70: 952-959). The medium was replaced with 2 ml of warm 0.8% agarose (Carl Roth GmbH, Karlsruhe, Germany) in 2 ml of Turbodoma HP-1 medium (Dr. F. Messi, Cell Culture Technologies, Zurich, CH). After 2 days incubation at an acceptable temperature, plaques of 1 to 4 mm diameter were formed. Plaques were counted and the corresponding number of plaque forming units (“pfu”) per ml was calculated.
[0320]
(Agarose blot assay (ABA))
A 90% confluent BHK21 cell layer in a 60 mm dish was incubated with HP-1 medium containing approximately 800-1000 plaque forming units for 2 hours at a permissive temperature. The supernatant was replaced by overlaying the cells with a 1.5 mm layer of warm 0.8% agarose at 41 ° C. in 1 × HP-1 and the cells were incubated at permissive temperature for 2 hours. Secreted proteins from infected cells ³⁵ Detection was by S Met / Cys labeling. For this purpose, the medium is 20 μCi. ³⁵ Before adding S Met / Cys (Hartmann Analytical GmbH, Braunschweig, Germany), it was replaced with 2 ml RPMI 1640 (Met / Cys deficient medium) for 30 minutes.
[0321]
Viral protein release was inhibited by adding a cocktail of protease inhibitors and / or cross-linked antibodies to the Sindbis virus glycoprotein described in the Examples. The temperature sensitive Sindbis mutant was changed to 40 ° C. for 2 hours prior to labeling to inhibit virus particle release. Before washing the cells and agarose layer twice with 1 ml RPMI 1640 (Met / Cys deficient medium), 20 μCi ³⁵ S Met / Cys was applied for 2 hours at 37 ° C. Later, a pre-moistened nitrocellulose membrane was placed on top of the agarose for 4-20 hours. Membranes were removed and washed with a buffer containing 0.1% Triton X100 (Sigma, St. Louis, USA) as described in the examples and exposed to X-ray film (Hyperfilm bmax, Amersham, Sweden) after drying. . Black spots on the developed X-ray film showed Sindbis virus particles containing cDNA for secreted protein.
[0322]
(Amplification of selected viral particles)
Positive plaques were identified by an X-ray film overlay with an agarose overlay. Corresponding plaques were harvested with a 10 μl chip and eluted overnight at 4 ° C. in 200 μl PBS. After pelleting the agarose, 60% confluent BHK21 cells in a 12-well plate were infected with 0.5 ml of Turbodoma HP-1 with the eluted virus for 2 hours at the permissive temperature and then the medium Was replaced with 1 ml of Turbodoma HP-1 medium. After incubation for 20 hours at permissive temperature, the cell supernatant is collected and a 1:20 dilution in 2 ml of Turbodoma HP-1 is incubated for 2 hours in a T25 flask containing 60% confluent BHK 21 cells. The medium was then replaced with 10 ml of HP-1 medium. After 20 hours of incubation, the resulting supernatant is approximately 10 ^Four -10 ⁶ pfu / ml (total about 10 per T25 supernatant) ^Five -10 ⁷ corresponding to pfu).
[0323]
(Sequencing of selected Sindbis virus particles)
Viral RNA was isolated using a viral RNA isolation kit (High Pure Viral RNA Kit, Boehringer Mannheim, Mannheim, Germany), and RT-PCR was performed according to manufacturer's recommendations, Gibco (Gibco / BRL, Life Techno Tech). , Basel, Switzerland) using Superscript one-step RT-PCR. The 3 ′ primer for RT-PCR is oligo GCGCGGGCCCT ₂₀ (Specific for poly A tail) or oligo GCGCGGGCCCCGCTGCGGTGGCATTAGCACC (specific for the Sindbis virus 3 'CIS sequence); The RT-PCR product was digested with the restriction enzymes Bsp120I and EcoRI, gel purified and ligated to pBluescript (digested with EcoRI and Bsp120I) and finally the oligo at the multiple cloning site “about 40 of Sequencing was performed using “forward and reverse primers”.
[0324]
(Immunofluorescence microscopy of Sindbis virus-infected cells)
60% confluent BHK 21 cells in a 6-well plate were treated with 2 at a permissive temperature at 0.1 moi in 1 ml HP-1 medium containing Sindbis virus particles containing a heterologous cDNA encoding a membrane protein (receptor). Infected for hours. Twenty hours after infection, cells were dissociated using cell dissociation solution (Sigma-Aldrich, Steinheim, Germany) and washed twice at 4 ° C. in 1% BSA HBSS. The resuspended cells were then incubated for 15 minutes on ice with a ligand-flag fusion protein at a concentration between 100 ng / ml and 1 μg / ml and 5 μg / ml of monoclonal antibody M2. Cells were washed twice and then incubated for 30 minutes at 4 ° C. with 10 μg / ml FITC-conjugated secondary antibody in 1% BSA HBSS. After two washing steps with 1% BSA HBSS, the cells were analyzed using immunofluorescence microscopy (Leica DMIL, Leica, Heerburg, Switzerland) or the cells were analyzed using a FACS sorter. And classified.
[0325]
(Cloning of ts2, ts20 and double mutation ts2,20 in DH-EB)
Mutations ts2, ts20, and combinations of these two mutations were inserted into DH-EB by PCR using the following oligonucleotides (Bredenbeek et al., 1993, J. Virology 6439-6446):
Primer:
Oligo AatII GCACTTAAGTTGGAGGCGCAC
Oligo BssHII GGCACTCACGCGCGCGCTTTACAGGC
Oligo HpaI. 1 GCAAT GTtAAc aGGTCTGTATCTAATTGG
Oligo HpaI. 2 CGACCt gTTaAC ATTGCTCACCACCAGGG
Oligo PvuI. 1 GACAGCGGT CGatCG ATCATGGGAACTC
Oligo PvuI. 2 GAGTTATCCATGAT CGatCG ACCGCTTGTC.
[0326]
The restriction sites used for analysis are underlined and the mutated nucleotides are shown in lower case and bold. PCR reactions were performed in the following combinations.
[0327]
PCR 1: oligo AatII-oligo HpaI. 1 (about ts20)
PCR2: Oligo BssHII-oligo HpaI. 2 (about ts20)
PCR3: Oligo AatII-oligo PvuI. 1 (about ts2)
PCR4: Oligo BssHII-Oligo Pvu. I. 2 (for ts2).
[0328]
100 pmol of each oligo and 5 ng template DNA were transferred to 4 units of Taq or Pwo polymerase, 0.1 μM dNTP and 1.5 mM MgSO. _Four Used in a 100 μl reaction mixture. Polymerase was added directly before starting the PCR reaction (starting point 95 ° C.). The temperature cycle is as follows: 95 ° C., 1.5 minutes, followed by 5 cycles of 95 ° C. (30 seconds), 54 ° C. (30 seconds), 72 ° C. (120 seconds), and subsequently 95 ° C. ( 30 cycles), 64 ° C (30 seconds), 72 ° C (120 seconds), 25 cycles.
[0329]
Four PCR (PCR1-4) fragments were purified using the Qia spin PCR kit (QIAGEN, Inc., Chatsworth, CA 91311, USA) and finally 10 units of DraIII and HpaI in an appropriate buffer, Digested with HpaI and BssHII, DraIII and PvuI, or BssHII and PvuI, respectively. This digestion was performed at 37 ° C. for 6 hours, and the DNA fragment was then gel purified (gene-clean; Bio 101 Inc., Vista, CA 92083, USA). Purified PCR fragments 1 and 2 and fragments 3 and 4 were finally ligated to DraIII / BssHII digested and gel purified pDH-EB (Bredenbeek et al., J. Virology November 1993, 6439). ~ 6446). The exact sequence of the resulting vector was checked by restriction enzyme digestion and confirmed by DNA sequencing using the following primers:
Oligo sequence ts2: TTCCAAGCCATCAGAGGGG
Oligo sequence ts20: AGATTAGCACCTCAGGACCG.
[0330]
The correct vectors DH-EB ts2 and DH-EB ts20 were digested with 10 units of Bsp68I and EcoRI in appropriate buffer for 4 hours at 37 ° C. The 4.5 kb DNA fragment of pDH-EB ts2 and the 3.4 kb fragment of pDH-EB ts20 were gel purified (as described above) and ligated to create DH-EB ts2,20. The exact sequence of the resulting vector was confirmed by restriction enzyme digestion and confirmed by DNA sequencing using primer oligo sequence ts2 and oligo sequence ts20 (above).
[0331]
(Production of mg amount of secreted protein)
A batch of BHK 21 cells was infected with a viral supernatant containing the protein of interest. Subsequent purification yielded several milligrams of pure protein.
[0332]
B. Example 1: Compartment screening and identification of nucleic acid-encoded proteins using a predetermined localization
Confluent cultures of BHK cells were infected with viral particles containing two expression systems with two different nucleic acids (pSinRep5 EPO and pSinRep5 lacZ, both packaged with the helper construct DHBB). One culture was not infected as a negative control (Vial 1, lane 1 in FIG. 1A). 24 hours after infection, cells were starved for 30 minutes in starvation medium lacking methionine and cysteine. Pulse stimulation of 10 μCi 35S Met / Cys was added and replaced with fresh medium after 30 minutes. Cells and cell supernatants were collected after 2 hours of incubation. Cells were resuspended in Laemmli buffer and boiled for 10 minutes. 500 μl of supernatant was added to 600 μl methanol and 200 μl chloroform. The top layer was discarded and the precipitated protein was pelleted by the addition of 800 μl methanol. Both precipitated supernatant protein and cell pellet were resuspended in 25 μl Laemmli buffer and the protein was separated on a 15% SDS polyacrylamide gel. After drying, the gel was exposed to X-ray film overnight. The labeled protein found in the supernatant was electrophoresed on the gel shown in FIG. 1A; FIG. 1B was labeled in the cell pellet corresponding to the supernatant in lanes 1 and 2 of FIG. 1A. Indicates protein.
[0333]
Identification of the nucleic acid encoding the secreted protein is possible by detection of a band on X-ray film (FIG. 1A), which is labeled in the supernatant encoded by an exogenous expression system. The result is unique to proteins. Lane 1 of FIG. 1A shows that uninfected cells (without exogenous expression systems) secrete some unidentified proteins. The corresponding cell pellet is shown in FIG. 1B, where many proteins are labeled and multiple bands are visualized. Empty lane 2 in FIG. 1A shows the presence of an expression system containing nucleic acid encoding intracellular protein in vial 2. Thus, lane 2 in FIG. 1B confirms this finding by the presence of a unique band resulting from a single labeled protein from the cell pellet. Repress all expression of other endogenous proteins (compared to lane 1), unique labeling, and vial 2 nucleic acid to intracellular protein (this protein is actually lacZ is an intracellular protein) It was possible to unambiguously identify as a nucleic acid encoding (confirming published findings). The strong band resulting from a single radioactive protein in the supernatant in lane 6 of FIG. 1A indicates the presence of an expression system comprising a nucleic acid encoding the secreted protein. Vial 6 (lane 6 in FIGS. 1A and 1B) was infected with the pSinRep5 EPO construct. This finding confirms that EPO is a secreted protein. Endogenous protein expression was again suppressed, allowing unique labeling and unambiguous identification of the nucleic acid in vial 6 as the nucleic acid encoding the secreted protein. Lanes 3-5 show labeled secreted proteins from a mixture of the two expression systems. Increasing the ratio of the EPO expression system by 10%, 50%, and 90% results in more unique labeled proteins in the supernatant. These results indicate that compartment screening can identify nucleic acids encoding proteins at predetermined cellular localization locations.
[0334]
C. Example 2: Separation of labeled virus particles from secreted proteins for semi-solid medium screening
For optimization of the identification of expression systems encoding secreted proteins in semi-solid media, the following are preferred: a) suppress endogenous protein synthesis; and b) labeled viral particles and other labeled Prevent soluble viral proteins from screening interferences. A layer of confluent BHK21 cells in a 35 mm dish was infected with double subgenomic infectious virus particles pTEC5'2JCAT or pTE5'2JEPO at 5 MOI. As a negative control, uninfected BHK 21 cells were used. 14 hours after infection, the medium was removed and the cells were 10 μCi per dish. ³⁵ Layered with 4 mm 0.8% agarose in RPMI 1640 medium containing SMet / Cys. After gelation, the culture was overlaid with 1 ml of Cys / Met-free RPMI and the medium was collected after 2, 4, and 8 hours. Proteins were precipitated and separated on a 15% SDS gel. The gel was exposed to X-ray film overnight. It could be shown that endogenous protein synthesis was again inhibited and labeling was specific (Figure 2: Comparison of lanes 1-3 and lanes 4-9). In addition, viral particle spread was also inhibited. This is because the characteristic pattern of the three structural viral proteins (capsid, E1, and E2) could not be detected (lanes 4-9).
[0335]
There was a labeled protein of about 60 kD size in both supernatants of the virally infected culture (lanes 4-9). It was speculated that this protein is a viral protein and can be produced by proteolytic cleavage of one of the Sindbis virus glycoproteins. In the case of pTE5′2JEPO, an additional protein with the size of EPO was detected after 8 hours (lane 9), indicating the main feasibility of semi-solid medium screening. This experiment shows that labeled viral particles can be separated from secreted proteins by limited diffusion in 0.8% agarose. However, the release of soluble viral proteins occurs without further treatment. Such release is not preferred. This is because its release can interfere with phenotypic screening. Example 3 describes a method for inhibiting the release of unwanted viral proteins.
[0336]
D. Example 3: Inhibition of viral soluble protein release
A layer of confluent BHK cells was infected with double subgenomic pTE5′2JCAT virus particles at 5 MOI. 14 hours after infection, the medium was removed and the cells were 10 μCi per dish. ³⁵ 4 mm 0.8% agarose in RPMI 1640 medium containing cocktail solutions of SMet / Cys and various amounts of Mini Protean protease inhibitors (concentrated 7 times as described in Boehringer Mannheim, Rotkreuz, Switzerland) Layered. 100 μl, 20 μl, 10 μl, 5 μl, and 1 μl were used (lanes 1-5 in FIG. 3). After gelation, the culture was overlaid with 1 ml of RPMI without Cys / Met and the medium was collected after 4 hours. Proteins were precipitated and separated on a 15% SDS gel. The gel was exposed to X-ray film overnight. The results (shown in FIG. 3) showed that viral protein release was inhibited by the addition of protease inhibitors. At concentrations above 20 μl / ml (lanes 1 and 2), it inhibits the release of soluble protein, which neither diffuses virus particles nor viral proteins through the agarose layer, and endogenous or viral proteins Showed no interference with screening.
[0337]
(E. Example 4: Identification of a nucleic acid encoding a protein having a predetermined enzymatic activity in a mixture of nucleic acids in a semi-solid medium screening)
An expression system comprising a nucleic acid encoding a protein having phosphatase activity was identified in a mixture of the two expression systems. pSinRep5 lacZ and pSinRep5 SEAP were individually packaged with helper DHEB to produce infectious particles. The two expression systems were mixed at a 10: 1 ratio (pSinRep5 lacZ: pSinRep5 SEAP). A layer of confluent BHK 21 cells in a 35 mm dish was infected with this mixture of expression systems or with the pSinRep5 lacZ expression system alone. Two hours after infection, the medium was removed and the cells were overlaid with 1.5 ml of 0.8% agarose 1 × HP-1 medium.
[0338]
Two days later, the nitrocellulose filter was placed on top of the agarose for 4 hours. The filter is removed, washed in PBS, and placed in a solution of 100 mM TrisHCl, 100 mM NaCl, 370 mg / nitro blue tetrazolium, and 250 mg / l 5-bromo-4-chloro-3-indolyl phosphate (all Sigma). Alkaline phosphatase activity was detected.
[0339]
In a sample containing 10% pSinRep5 SEAP expression system, two spatially distinct regions with alkaline phosphatase activity could be detected (FIG. 5). In screening, two corresponding plaques resulting in enzymatic conversion of the substrate and a negative control from the negative staining area were isolated. Cell cultures were then fixed in 0.5% glutaraldehyde in PBS and lacZ activity was stained with X-Gal as described in the instructions “Sindbis expression system” (Invitrogen, San Diego, USA). Detected cells (not shown). About 20-30 plaques stained blue in this cell culture show the distribution of the original expression system.
[0340]
Positive alkaline phosphatase plaques and virus from negative controls were eluted by shaking overnight at 4 ° C. in PBS. PBS was added to a culture of fresh confluent BHK cells in a 35 mm dish and SEAP activity was confirmed 2 days after infection by the following assay. 500 μl of 2 × SEAP buffer (2 mM L-homoarginine, 0.2 M diethanolamine, 0.1 mM MgCl ₂ +100 μl of substrate solution (120 mM nitrophenyl phosphate in water) was mixed with 400 μl of cell culture supernatant heat inactivated (10 min, 60 ° C.). SEAP activity was represented by a color change from purple to yellow in samples from the positive area of the culture, whereas the negative control produced no color change. This example shows that an expression system comprising a nucleic acid encoding a protein having a predetermined enzymatic activity can be isolated from a mixture of expression systems in a semi-solid medium screening.
[0341]
(F. Example 5: Stable amplification of expression system)
Positive virus particles from Example 4 (including nucleic acids encoding SEAP) were amplified over three passages. 1% of the supernatant from the 35 mm dish of Example 4 was added to 80% confluent T25 (25 cm with BHK 21). ² ) Used to infect a cell culture flash. Supernatants were removed 24 hours after infection and assayed for SEAP activity. SEAP activity in the supernatant was demonstrated by a quick color change in the sample. The particles are thus passaged a total of 4 times, so that 10 ⁸ The expression system was amplified within 5 days according to the above factors. This result indicates that this expression system is rapidly and efficiently amplified to produce large amounts of the protein of interest. In addition, this process provides a substantial amount of expression system and utility in any other mammalian system that will benefit further study of protein function.
[0342]
(G: Example 6: Identification of nucleic acids encoding secreted proteins in a mixture of nucleic acids in semi-solid medium screening)
An expression system comprising a nucleic acid encoding a secreted protein with phosphatase activity was identified in a mixture of the two expression systems. pSinRep5′LacZ and pSinRep5 ′ SEAP were individually packaged with the helper DHEB to generate infectious particles. 90% confluent BHK 21 cell layer (Easy Grip, Falcon 3004, Becton Dickinson and Company, England) in a 60 mm dish with about 780 plaque forming units (“pfu”) pSinRep5 LacZ and 20 pfu of SEP5 ) And 1 ml of 1 × HP-1 medium and incubated at 37 ° C. for 2 hours. After removing the medium, the cells were overlaid with 3 ml of HP-1 medium at 41 ° C. 0.8% agarose (Carl Roth GmbH, Karlsruhe, Germany) and then 5% CO 2. ₂ Incubated for 2 days at 37 ° C.
[0343]
Agarose was overlaid with 1 ml of 1 × RPMI 1640 Met / Cys for 10 minutes and then replaced with 1 ml of fresh 1 × RPMI 1640 Met / Cys. After 30 minutes of starvation, the medium was washed with 0.8 ml of 1 × RPMI 1640 Met / Cys− + 20 μCi. ³⁵ Substitution with S Met / Cys. After 4 hours of labeling, the agarose overlay was washed 3 times for 10 minutes with 1 ml of 1 × HP-1 and then 54 mm pre-moistened nitrocellulose filter (0.45 μm membrane, BA85, Schleicher & Schuell, Germany). ) Was applied for 16-18 hours.
[0344]
Diffusion blotting was allowed to proceed for 18 hours and then SEAP activity was measured by AP staining (10 ml 100 mM TrisHCl, 100 mM NaCl, 370 mg nitroblue tetrazolium and 250 mg / l 5-bromo-4chloro-3indolyl phosphate (all Sigma)) (FIG. 7). AP color development was stopped by removal of AP staining solution and subsequent washing steps (3 times with TBS containing 0.1% Triton X-100). The nitrocellulose was then dried and exposed to X-ray film (Hyperfilm βmax, Amersham, Sweden) for at least 24 hours and then developed using an AGFA Curix 60 (Schenk, Winterthur, Switzerland) machine (FIG. 7).
[0345]
The coordinates of the radioactive spot were determined and the equivalent area was taken from the agarose layer using a 10 μl tip. Eluted virus (as described above) was passaged in 60% confluent BHK 21 12 well plates. The presence of the SEAP encoding gene in the eluted virus insert was determined by spotting 4 μl of supernatant on a nitrocellulose membrane and AP staining as described above.
[0346]
The coincidence of the spot on the secreted alkaline phosphatase-stained filter with the spot on the X-ray film can clearly identify the nucleic acid encoding the secreted protein in a mixture of nucleic acids using semi-solid media screening It shows that.
[0347]
(H. Example 7: Identification of nucleic acids encoding secreted proteins in a Sindbis virus library representing a cDNA library in semi-solid medium screening)
A directed cDNA library derived from ECV 304 cells (ATCC CRL-1998, human endothelial cell line) containing a Not I site at the 3 ′ end and 5 ′ blunt end, StuI, Bsp 120L digested pSinRep5 vector And connect to 10 ⁷ The first clone of E. coli. Obtained after transformation of E. coli DH10b. After preparation of plasmid DNA and linearization with Not I, the library was transcribed in vitro as described above and packaged with helper DHEB to produce infectious particles. 90% confluent BHK21 cell layer in a 60 mm dish (Easy Grip, Falcon 3004, Becton Dickinson and Company, England) at 37 ° C. with 1 ml of 1 × HP-1 medium containing approximately 800 pfu of pSinRep5 ECV 304 library. Incubated for 2 hours. After removal of the medium, the cells were overlaid with 3 ml of HP-1 medium at 41 ° C. warm 0.8% agarose (Carl Roth GmbH, Karlsruhe, Germany) and then 5% CO 2. ₂ Incubated for 2 days at 37 ° C.
[0348]
Agarose was overlaid for 10 minutes with 1 ml of 1 × RPMI 1640 Met- / Cys- replaced with 1 ml of fresh 1 × RPMI 1640 Met- / Cys-. After 30 minutes of starvation, the medium was washed with 20 μCi ³⁵ Replacement with 0.8 ml of 1 × RPMI 1640 Met / Cys containing S Met / Cys. After 4 hours of labeling, the agarose overlay was washed 3 times with 1 ml of 1 × HP-1 for 10 minutes and then a 54 mm pre-moistened nitrocellulose filter (0.45 μm membrane, BA85, Schleicher & Schuell, Germany) was applied.
[0349]
Diffusion blotting was allowed to proceed for 18 hours at 37 ° C., then the nitrocellulose was washed 3 times for 10 minutes with TBS containing 0.1% Triton X-100, then the membrane was dried and X-ray film (Hyperfilm βmax, Amersham, Sweden) was exposed for at least 24 hours followed by color development with AGFA Curix 60 (Schenk, Winterthur, Switzerland) machine.
[0350]
The coordinates of the radioactive spot were determined and an equal area was picked from the agarose layer using a 10 μl tip. Virus was eluted as previously described and passaged to 60% confluent BHK21 cells in 12 well plates. After reamplification of viral particles in 60% confluent BHK21 cells in 6-well plates, viral RNA was isolated using a “high purity viral RNA kit” (Boehringer Mannheim, Mannheim, Germany). RT-PCR was performed using the Superscript single step RT-PCR kit from the manufacturer (Gibco / BRL, Life Technologies AG, Basel, Switzerland) and the primers described above. The RT-PCR product was digested with restriction enzymes Bsp120I and EcoRI, gel purified, ligated into pBluescript (digested with EcoRI and Bsp120I), and oligo “−40 forward and reverse primers” at the multiple cloning site. Was finally sequenced using.
[0351]
I. Example 8: Identification of a nucleic acid encoding a secreted protein in a nucleic acid mixture in a semi-solid medium screen using a Sindbis ts mutant
(Recombinant SEAP Sindbis virus stock)
EcoRI linearized DH-EB helper constructs (DH-EB, DH-EB ts2, DH-EB ts20, DH-EB ts2,20) and NotI linearized pSinRep 5 SEAP and pSinRep5 LacZ DNA (QiaQuick PCR purification column) QIAGEN AG, Basel, Switzerland) and DEPC-H ₂ Elution with O was made so as not to contain RNase. SP6 in vitro transcription was performed according to the manufacturer Invitrogen (Invitroscript CAP Kit, Invitrogen BV, NV Leek, The Netherlands). 5 μg of SinRep 5 ′ SEAP and 5 μg of helper transcript were simultaneously electroporated into BHK21 cells according to Invitrogen (Invitroscript CAP Kit, Invitrogen BV, NV Leek, The Netherlands). The supernatant was removed 30 hours after electroporation (30 ° C., 5% CO 2 ₂ And assayed for SEAP activity. 4 μl of supernatant was spotted on a nitrocellulose membrane (Schleicher & Schuell) and SEAP activity was detected by AP staining as described above (FIG. 8).
[0352]
(First passage of ts mutant)
Recombinant virus stock was passaged into 60% confluent 6-well plates with BHK21 cells. 100 μl of each stock + 900 μl of HP-1 was added to BHK cells for 2 hours at 30 ° C., and then the viral supernatant was replaced with 2 ml HP-1. Cells were incubated for 24 hours at either a permissive temperature of 30 ° C. or a non-permissive temperature of 37 ° C., after which the supernatant was assayed for SEAP activity (as described above) (FIG. 8).
[0353]
(Plaque assay for ts mutant)
Dilution series of collected virus particles (see above) were performed in 1 ml Turbodoma HP-1 in 90% confluent BHK21 cells in a 60 mm tissue culture dish (Easy Grip, Falcon 3004, Becton Dickinson and Company, England). (1:10 ^Four , 1: 5 × 10 ^Four 1:10 ^Five , 1: 5 × 10 ^Five 1:10 ⁶ , 1: 5 × 10 ⁶ ). Cells were infected for 2 hours at 30 ° C. with virus diluted in a diluted series of collected virus particles (see above). The supernatant was then replaced with 0.8% agarose in HP-1 and 5% CO 2 for 2 days at 37 ° C. or 30 ° C. ₂ Incubated in. The plaques were then counted.
[0354]
(Agarose blot assay using a mixture of pSinRep SEAP and pSinRep LacZ)
Expression systems containing nucleic acids encoding secreted proteins were identified in a mixture of two expression systems. pSinRep5′LacZ and pSinRep5′SEAP were individually packaged with the ts mutant helper DHEB (see Table 1) to obtain infectious particles. A 90% confluent BHK21 cell layer in a 60 mm dish (Easy Grip, Falcon 3004, Becton Dickinson and Company, England) was pSinRep 5 LacZ / DHEB ts with approximately 780 plaque forming units (“pfu” and 20 pfu). Incubation was performed at 30 ° C. for 2 hours with 1 ml of 1 × HP-1 medium containing SEAP (secreted alkaline phosphatase) / DHEB ts. After removal of the medium, the cells were overlaid with 3 ml of 0.8% agarose (Carl Roth GmbH, Karlsruhe, Germany) at 41 ° C. in HP-1 medium, then 5% CO 2. ₂ Incubated for 2 days at 30 ° C.
[0355]
After 2 hours pre-starvation, the cells were treated with 5% CO2. ₂ Shifted to 40 ° C. In agarose, 1 ml of 1 × RPMI 1640 Met ^- / Cys ^- For 10 minutes, and then add 1 ml of RPMI medium to 1 ml of fresh 1 × RPMI 1640 Met. ^- / Cys ^- The medium was replaced. After 30 minutes of starvation at 40 ° C., the medium was washed with 20 μCi of ³⁵ 0.8 ml of 1 × RPMI 1640 Met containing S Met / Cys ^- / Cys ^- Replaced with. After labeling for 4 hours at 40 ° C., the agarose top layer was washed 3 times for 10 minutes with 1 ml of 1 × HP-1 and then 54 mm pre-moistened nitrocellulose filter (0.45 μm membrane, BA85, Schleicher & Schuell, Germany) was applied.
[0356]
Diffusion blotting was allowed to proceed for 18 hours at 40 ° C., after which SEAP activity was measured by AP staining (10 ml 100 mM Tris-HCl, 100 mM NaCl, 370 mg nitroblue-tetrazolium, and 250 mg / l 5-bromo-4-chloro- Detection with 3-indolyl phosphate (all Sigma)) gave a purple spot (FIG. 8). AP staining was stopped by removal of AP solution and subsequent washing steps (3 times with TBS containing 0.1% Triton X100). Nitrocellulose was dried and exposed to X-ray film (Hyperfilm bmax, Amersham, Sweden) for at least 24 hours before being developed in an AGFA Curix 60 (Schenk, Winterthur, Switzerland) apparatus.
[0357]
The coordinates of the radioactive spot were determined and an equal area was picked from the agarose layer using a 10 μl pipette tip.
[0358]
(J. Example 9: Identification of nucleic acids encoding secreted proteins in nucleic acid mixtures in semi-solid media library screening using ts mutants)
The pSinRep5 ′ cDNA library ECV 304 was packaged with the mutant helper DHEB to obtain infectious particles. A 90% confluent BHK21 cell layer in a 60 mm dish (Easy Grip, Falcon 3004, Becton Dickinson and Company, England) was used with 1 ml of 1 × HP-1 medium containing about 800 pfu of pSinRep 5 cDNA library ECV 304. And incubated at 30 ° C. for 2 hours. After removal of the medium, the cells were overlaid with 3 ml of 0.8% agarose (Carl Roth GmbH, Karlsruhe, Germany) in HP-1 medium, then 5% CO2. ₂ Incubated for 2 days at 30 ° C.
[0359]
After 2 hours pre-starvation, the cells were treated with 5% CO2. ₂ Shifted to 40 ° C. In agarose, 1 ml of 1 × RPMI 1640 Met ^- / Cys ^- For 10 minutes, then 1 ml of fresh 1 × RPMI 1640 Met ^- / Cys ^- The medium was replaced. After 30 minutes of starvation, the medium was washed with 0.8 ml of 1 × RPMI 1640Met. ^- / Cys ^- + 20μCi ³⁵ Substitution with S Met / Cys. After 4 hours of labeling, the agarose top layer was washed 3 times for 10 minutes with 1 ml of 1 × HP-1, then 54 mm pre-moistened nitrocellulose filter (0.45 μm membrane, BA85, Schleicher & Schuell, Germany) was applied for 16-18 hours.
[0360]
Diffusion blotting is allowed to proceed for 18 hours, after which the nitrocellulose is dried and exposed to X-ray film (Hyperfilm βmax, Amersham, Sweden) for at least 24 hours before being developed with an AGFA Curix 60 (Schenk, Winterthur, Switzerland) apparatus. did. The coordinates of the radioactive spot were determined and an equal area was picked from the agarose layer using a 10 μl pipette tip.
[0361]
K. Example 10: Expression cloning using Sindbis virus: Cloning of receptors for known ligands by FACS single cell sorting
A 60% confluent BHK21 culture in a T150 flask was infected in 1 × HP-1 medium with a moi of 0.1 at 37 ° C. for 2 hours. pSinRep5 hIL 13 Ra (human interleukin 13 receptor, subunit α; cloned into pSinRep5 digested with pBA2-hIL13Ra digested with XbaI and PvuII with hIL13Ra.XbaI and StuI) / DHEB and pSinRep 5E LacZD Different dilutions (1: 0/1: 100/1: 100,000) were used with a total moi of 0.1. The medium was then replaced with fresh 1 × HP-1 medium and the cells were replaced with 5% CO2. ₂ Incubated for 20 hours at 37 ° C.
[0362]
The cells were then resuspended in 5 ml of cell dissociation solution (Sigma-Aldrich, Steinheim, Germany) followed by two additional washing steps in HBSS containing 1% BSA. 1 ml 1% BSA in HBSS, 1 μg / ml IL13flag (by IBR GmbH, Waengi, Switzerland) and 5 μg / ml mAb M2 (by IBR GmbH, Waengi, Switzerland) were incubated with the cells at 4 ° C. for 15 minutes. Cells were washed twice with 1.5 ml 1% BSA / HBSS and incubated with 1 ml 1% BSA and 10 μg / ml FITC-conjugated secondary antibody for 30 minutes at 4 ° C. Cells were washed twice with 1% BSA in HBSS at 4 ° C. and 3 × 10 3 in HBSS. ⁶ Resuspended at a concentration of / ml. Single cell sorting into 96 well plates was performed for cells with FITC fluorescence intensity above background (see FIG. 9).
[0363]
FIG. 9 shows that interleukin 13 receptor α is transiently expressed and that single cells expressing the appropriate receptor for the selected ligand can be sorted by FACS analysis.
[0364]
(L. Example 11: Expression cloning using Sindbis virus: Cloning of ligands for known receptors)
Infectious Sindbis virus libraries are generated as described above in dual subgenomic Sindbis virus vectors (pTE) or in pSinRep5 co-packaged with DH-EB helpers. Confluent BHK21 cells in a 150 mm dish are incubated for 2 hours with HP-1 medium containing approximately 5,000 pfu of infectious Sindbis virus library. After removal of the medium, the cells are overlaid with 2 mm 0.8% agarose in 1 × HP-1 medium and incubated at 37 ° C. for 3 days. A nitrocellulose filter is placed on top of the agarose and incubated for at least 3 hours. Remove the membrane and subsequently wash with TBS. After stirring the filter in TBS for 15 minutes, the filter is blocked by incubating in 1% skim milk for 1 hour. After three washing steps in TBS, the filter is incubated for at least 1 hour in TBS containing radiolabeled solubilized receptor. After several washing steps in TBS, the filter is dried and exposed to X-ray film. Dark spots indicate colonies expressing the binding partner of the selected receptor of interest.
[0365]
(M. Example 12: Cloning of cell binding protein with known ligand)
Infectious Sindbis virus libraries are generated as described in the Materials and Methods section (supra) in double subgenomic Sindbis virus vectors (pTE) or in pSinRep5 co-packaged with DH-EB helpers To do. BHK21 cells are grown to confluence on nitrocellulose filters in a 150 mm dish. Cells are incubated for 2 hours with HP-1 medium containing approximately 5,000 pfu. After removal of the medium, the cells are overlaid with 2 mm 0.8% low melting point agarose in 1 × HP-1 medium and incubated at 37 ° C. for 2 days. Following this incubation, a nitrocellulose filter is placed on top of the agarose to capture the virus particles. After 24 hours of incubation, the nitrocellulose filter is removed and placed in a new 150 mm dish, where a fresh culture of BHK cells is placed 1 cm. ² Add to medium containing 10% FCS at a cell density of 400,000 cells per cell. After cell attachment, the culture is again overlaid with 2 mm agarose and incubated at 37 ° C. This culture serves as a stock of virus particles for later isolation. The first plate is heated to 40 ° C. to melt the agarose. After removal of the thawed agarose, the cells are separated by known methods (0.5% glutaraldehyde, 3% paraformaldehyde in PBS, according to the expected location (nucleus, cytoplasmic membrane, etc.) and the nature of the cloned protein. Fix to the membrane with -20 ° C methanol). After several washing steps in TBS, the filter is incubated in TBS containing radioactively labeled ligand. After several washing steps, the filter is dried and exposed to X-ray film. The dark dots indicate colonies that express the binding partner of the selected ligand.
[0366]
(N. Example 13: Discovery and expression of novel membrane proteins)
The Sindbis virus library in pSinRep5 as described in Example 6 is co-electroporated with the DHBB helper to produce the one-way virion described above. After determination of the virus titer, a confluent culture of 987 BB neo cells (Table I and SEQ ID NO: for a description of vectors that can be transfected with BHK21 cells to obtain a 987BB neo cell line after selection in 200 μg / ml G418. 2). After removal of the medium, the cells are overlaid with 2 mm agarose to allow plaque formation. Three days later, Motobu et al. (EC Beuvery et al. (Ed.) “Animal Cell Technologies the Development the 21th century”, pages 811 to 815 (1995) Kluwer Academic Publis-coated polyester as described in Kluwer Academic Publishers). And BHK21 cells at the top of 400,000 cells / cm ² At a cell density of 1,000,000 cells / ml medium. After cell attachment, the same amount of fresh medium is added and the culture is incubated for an additional 12 hours. Remove liquid medium and label medium (10 μCi ³⁵ (S methionine / cysteine). After uptake for 12 hours, the labeling medium is removed and the culture is washed by the addition of 10 ml normal medium. The medium is replaced every 10 minutes for a total of 2 hours. After removal of all liquid medium, the cells are overlaid with a 2 mm layer of medium containing 0.8% agarose and 0.1% trypsin. After agarose gelation, the nitrocellulose membrane is placed on top of the agarose and the culture is further incubated for 1-6 hours. Membrane protein fragments released by proteolysis diffuse to the membrane and are captured on a nitrocellulose filter. By performing autoradiography of the filters, clones encoding membrane proteins are shown.
[0367]
O. Example 14: Discovery and expression of novel organelle-specific proteins
Infectious Sindbis virus libraries are generated as described in Materials and Methods in double subgenomic Sindbis virus vectors (pTE) or in pSinRep5 co-packaged with DH-EB helpers. BHK21 cells are grown to confluence in a 150 mm dish. Cells are incubated for 2 hours with HP-1 medium containing approximately 5,000 pfu. After removal of the medium, the cells are overlaid with 2 mm 0.8% low melting point agarose in 1 × HP-1 medium and incubated at 37 ° C. for 1-2 days. Following this incubation, a nitrocellulose filter is placed on top of the agarose to capture the virus particles. After at least 12 hours of incubation, the nitrocellulose filter is removed and placed in a new 150 mm dish, where a fresh culture of BHK cells is placed 1 cm. ² Add to medium containing 10% FCS at a cell density of 400,000 cells per cell. After cell attachment, the culture is again overlaid with 2 mm agarose and incubated at 37 ° C. This culture serves as a stock of virus particles for later isolation.
[0368]
On the first plate, 40 μCi of methionine and cysteine ³⁵ Overlay a second layer of 0.8% agarose in RPMI 1640 medium containing the S labeling mixture. After 2 hours of labeling, the plate is heated to 40 ° C. to melt the agarose. After removal of the thawed agarose, the cells are lysed by known methods to obtain intact organelles. A nitrocellulose filter blocked with immobilized antibody against the organelle surface protein to be captured is placed on top of the homogenate. After several washing steps, the filter is dried and exposed to X-ray film. By performing autoradiography of the filter, a clone encoding a protein localized in the desired organelle is shown.
[0369]
P. Example 15: Expression cloning with Sindbis virus: Cloning of new receptors for known ligands by FACS single cell sorting
60% confluent BHK21 cells in T150 flasks were infected with 20 pLinRep ECV cDNA library in 20 ml of Turbodoma HP-1 medium at 0.1 moi for 2 hours. The medium was then replaced with 40 ml of fresh 1 × HP-1 medium and the cells were replaced with 5% CO2. ₂ Incubate for 20 hours at 37 ° C.
[0370]
The cells are then resuspended in 5 ml of cell dissociation solution (Sigma-Aldrich, Steinheim, Germany) and washed twice in HBSS containing 1% BSA. Cells were incubated for 15 minutes at 4 ° C. in 1 ml HBSS in the presence of 1% BSA, 1 μg / ml ligand-flag fusion protein, and 5 μg / ml mAb M2, and 1.5 ml 1% BSA / Wash twice with HBSS followed by 30 min incubation at 4 ° C. with 1 ml 1% BSA and 10 μl / ml anti-M2 FITC. Cells were washed twice with 1% BSA in HBSS, followed by 3 × 10 3 in HBSS. ⁶ Resuspend at a concentration of / ml. Single cell sorting into 96 well plates is performed on cells with FITC activity above background.
[0371]
The supernatant of the 96 well plate is used for plaque assay in 6 well plates with 90% confluent BHK21 cells. Plaques are picked using a 10 μl pipette tip and eluted as described above. Eluted virus is passaged to a 60% confluent BHK21 12 well plate in 1 ml Turbodoma HP-1 at permissive temperature. The eluted viral insert is determined by reamplification of viral particles in 2 ml Turbodoma HP-1 medium in 6-well plates containing 60% BHK21 cell layers. Viral RNA was isolated using a “high purity viral RNA kit” (Boehringer Mannheim, Mannheim, Germany) and RT-PCR was performed by the manufacturer (Gibco / BRL, Life Technologies AG, Basel, Switzerland process). Performed using RT-PCR kit and primers previously described. Ligation and sequencing of the RT-PCR product into pBluescript is performed as described above.
[0372]
(Q: Example 16: Expression cloning of ligands for known binding partners)
pSinRep5 ′ EPO and pSinRep 5 LacZ were packaged with helper DHEB to obtain infectious particles. A 90% confluent BHK21 cell layer in a 60 mm dish (Easy Grip, Falcon 3004, Becton Dickinson and Company, England) was added to about 25-30 pfu of pSinRep EPO / DH-EB and about 180-200 pfu pL pS Incubated with 1 ml of 1 × HP-1 medium containing DH-EB at 37 ° C. for 2 hours. After removal of the medium, the cells were overlaid with 3 ml of 0.8% agarose (Carl Roth GmbH, Karlsruhe, Germany) in HP-1 medium warmed to 41 ° C. and the plates were 5% CO 2. ₂ Incubated for 2 days at 37 ° C.
[0373]
A 54 mm pre-moistened nitrocellulose filter (0.45 μm membrane, BA85, Schleicher & Schuell, Germany) was applied for 16 hours, followed by blocking the nitrocellulose with 1% BSA in TBS for 2 hours. Primary antibodies specific for the secreted proteins screened (anti-EPO, polyclonal, Research Diagnostics, Inc., USA) were incubated for 1 hour at a dilution of 1: 3000 in TBS (according to the manufacturer). The membrane was then washed three times with TBS 0.05% Tween, followed by secondary antibody (AP-conjugated anti-rabbit IgG, Jackson ImmunoResearch Laboratories, Inc., USA) in 1: 1 TBS 1% BSA. Incubated with filters at a dilution of 4000. After the membrane was washed with TBS 0.05% Tween, AP staining was performed as described above.
[0374]
Plaques corresponding to AP positive spots (see FIG. 10) were picked from the agarose layer using a 10 μl pipette tip. Virus elution was performed as described. Virus was passaged into 60% confluent BHK21 12 well plates. The eluted virus insert was determined by reamplification of virus particles in a 60% BHK21 6-well plate followed by a dot blot against EPO as described above.
[0375]
FIG. 10 shows that secreted specific ligands for known binding partners (receptors, antibodies) can be successfully cloned and that this system can be used efficiently to screen viruses that represent cDNA libraries. Show you get.
[0376]
All references cited in the text of this specification are hereby incorporated by reference in their entirety.
[Brief description of the drawings]
FIG. 1A shows an experiment in which an expression system comprising either a nucleic acid encoding a secreted protein from a mixture of nucleic acids or a nucleic acid encoding an intracellular protein was identified using compartment screening. 2 is an autoradiogram of labeled protein precipitated from the supernatant of a screened cell culture, as described in more detail in Example 1. FIG. Lanes are as follows: Lane 1 -uninfected BHK21 cells; Lane 2 -Expression system encoding intracellular protein pSinRep5 LacZ; Lane 6 -Expression system encoding secreted protein (EPO) pSinREp5 EPO Lanes 3-5 contain a mixture of the two expression systems in a ratio of 90:10, 50:50, 10:90 (sinRep5 lacZ: SinRep5 EPO) showing increasing amounts of EPO. . The protein mass standard is indicated on the left; the protein molecular weight of EPO is indicated by the arrow.
FIG. 1B is an autoradiogram of labeled proteins corresponding to the cell pellets of lanes 1 and 2 of FIG. 1A, shutting down accumulation of lacZ protein in the cell pellet and endogenous protein production in cells infected with pSinRep5 LacZ ( It is a figure which shows shutdown.
FIG. 2 shows the separation of labeled virus particles from secreted proteins as described in more detail in Example 2. Shutdown of endogenous protein synthesis is evident in lanes 4-6 (infected with TE5′2JCAT) and lanes 7-9 (infected with TE5′2JEPO) compared to lanes 1 to 3 (uninfected BHK21 cells). . Viral particle removal is evidenced by the absence of a characteristic pattern of Sindbis structural proteins (capsids E1 and E2). Lane 9 shows the diffusion of EPO size protein by agarose. In lanes 4 to 9, soluble proteins of viral origin can be seen. This protein is assumed to be released by proteolytic cleavage. Labeled proteins were collected at different time points: 2 hours (lanes 1, 4, 7), 4 hours (lanes 2, 5, 8) and 8 hours (lanes 3, 6, 9). The protein mass standard is shown on the left, the size of the Sindbis virus glycoprotein is indicated by the upper arrow and the molecular weight of EPO is indicated by the lower arrow.
FIG. 3 demonstrates that viral soluble protein release is reduced by protease inhibitors. As shown in Example 3, 10 in a 35 mm dish ⁶ BHK21 cells were infected with TE5′2JCAT. Various concentrations of protease inhibitor reaction mixtures (lanes 1-5, 100, 20, 10, 5, 1 μl per ml) were applied to a 4 mm agarose overlay. The molecular mass standard is shown on the left; the arrow indicates the predicted Sindbis glycoprotein E1 mass.
FIG. 4 shows the identification of an expression system comprising a nucleic acid encoding a protein having a predetermined enzyme activity for semi-solid medium screening. Confluent 35 mm dishes of BHK21 cells were infected with a mixture of 200 pfs SinReplacZ (left blot 1) or 200 pfs SinReplacZ / 20 pfu of SinRep 5 SEAP (right blot 2). Enzyme activity was detected on AP-stained filters. Blot 1 (which contains only the lacZ expression system) is negative in SEAP activity, while Blot 2 shows two distinct regions with SEAP activity (indicated by arrows).
FIG. 5A is a schematic diagram of a pSIN vector used to illustrate the present invention. The sources and constructs of these vectors are listed in Table 1.
FIG. 5B is a schematic diagram of the pSIN vector used to illustrate the present invention. The sources and constructs of these vectors are listed in Table 1.
FIG. 5C is a schematic diagram of the pSIN vector used to illustrate the present invention. The sources and constructs of these vectors are listed in Table 1.
FIG. 5D is a schematic diagram of the pSIN vector used to illustrate the present invention. The sources and constructs of these vectors are listed in Table 1.
FIG. 6A is a schematic diagram of a pTE vector used to illustrate the present invention. The vector shown is pTE5'2J. The sources and constructs of this vector are shown in Table 1.
FIG. 6B is a schematic diagram of a pTE vector used to illustrate the present invention. The vector shown is pTE5′2JCAT. The sources and constructs of this vector are shown in Table 1.
FIG. 6C is a schematic diagram of a pTE vector used to illustrate the present invention. The vector shown is pTE5'2JSEAP. The sources and constructs of this vector are shown in Table 1.
FIG. 6D is a schematic diagram of a pTE vector used to illustrate the present invention. The vector shown is pTE5'2JEPO. The sources and constructs of these vectors are shown in Table 1.
FIG. 7 Panel 7A and Panel 7B show that approximately 20 pfu of pSinRep 5 SEAP and 780 pfu of pSinRep 5 LacZ were mixed in 1 ml of TurbodomaHP-1 and infected with 60 mm dishes with BHK21 cells for 2 hours. It is a photograph shown. An agarose blot assay was performed as described in Example 10. Panel 7A shows AP staining represented by a purple spot (black spot indicates labeled secreted protein) of X-ray film (panel 7B: AP-stained film exposed to X-ray film) developed with blotted SEAP protein. 1 shows a nitrocellulose membrane. The coordinates of the spot with SEAP activity (indicated by arrows x1, x2, x3 in the AP-stained membrane and corresponding to arrows y1, y2, y3 in the developed X-ray film) are labeled secreted protein spots (Compare y1 and x1, y2 and x2, y3 and x3).
FIGS. 8A, 8B and 8C show that pSinRep 5 SEAP mRNA and pDHEBts mutant mRNA were co-electroporated into BHK21 cells. Cell supernatants of electroporated cells were analyzed by spotting 4 μl of supernatant onto nitrocellulose pieces 20 hours after electroporation and AP staining was performed as previously described. All electroporations were positive for SEAP secretion (purple spots on nitrocellulose filters) as shown in panel 8A. The first passage of the ts mutant virus was tested for infectivity at 37 ° C and 30 ° C. Infected cell supernatants were tested for secreted product SEAP by AP staining. The upper row of panel 8B shows the supernatant of cells incubated at 37 ° C, and the lower row of panel 8B shows the supernatant of cells incubated at 30 ° C. The double mutant pSinRep5 SEAP / pDHEBts2,20 produced a small amount of SEAP at 20 hours post infection (see panel B), but the viral particles were amplified and a large amount as shown in panel 8C. Product was detected 48 hours after infection.
FIG. 9A shows that pSinRep 5 hIL13Rα infected BHK21 cells (at a moi of about 0.1) were analyzed by immunofluorescence. Expressed hIL13Rα was detected with IL13-flag, M2 antibody and anti-mouse-FITC. BHK21 infected with pSinRep 5 hIL13α at 0.1 moi, analyzed by FACS and classified.
FIG. 9B shows that pSinRep 5 hIL13Rα infected BHK21 cells (at a moi of about 0.1) were analyzed by immunofluorescence. Expressed hIL13Rα was detected with IL13-flag, M2 antibody and anti-mouse-FITC. Same cells as panel A by immunofluorescence microscope.
FIG. 9C shows that pSinRep 5 hIL13Rα infected BHK21 cells (at about 0.1 moi) were analyzed by immunofluorescence. Expressed hIL13Rα was detected with IL13-flag, M2 antibody and anti-mouse-FITC. PSinRep5 LacZ infected cells as a negative control.
FIG. 9D shows that pSinRep 5 hIL13Rα infected BHK21 cells (at about 0.1 moi) were analyzed by immunofluorescence. Expressed hIL13Rα was detected with IL13-flag, M2 antibody and anti-mouse-FITC. PSinRep 5 hI13Rα virus diluted 1: 100 in pSinRep5 LacZ virus analyzed and sorted by FACS.
FIG. 10 shows that about 20 pfu of pSinRep5 Epo / DHEB was mixed with 200 pfu of pSinRep5 LacZ. The virus supernatant was incubated for 2 hours on 90% confluent BHK21 cells in a 60 mm dish before replacing the virus supernatant with 3 ml of 0.8%, 41 ° C. agarose in 1 × HP-1 medium. Two days later, a nitrocellulose membrane was applied on agarose and the diffusion blot was allowed to proceed for 14 hours. Blotted EPO was detected by immunodetection using anti-EPO antibody (rabbit) and AP-conjugated anti-rabbit antibody. Purple spots d1, d2, d3 (and other black spots) are pSinRep5
Blotted EPO from the underlying viral plaque representing EPO virus.
FIG. 11A shows the polynucleotide sequence of pSinRep 5.
FIG. 11B shows the polynucleotide sequence of pSinRep 5.
FIG. 11C shows the polynucleotide sequence of pSinRep 5.
FIG. 11D shows the polynucleotide sequence of pSinRep 5 EPO.
FIG. 11E shows the polynucleotide sequence of pSinRep 5 EPO.
FIG. 11F shows the polynucleotide sequence of pSinRep 5 EPO.
FIG. 11G shows the polynucleotide sequence of pSinRep 5 hIL13Rα.
FIG. 11H shows the polynucleotide sequence of pSinRep 5 hIL13Rα.
FIG. 11I shows the polynucleotide sequence of pSinRep 5 hIL13Rα.
FIG. 11J shows the polynucleotide sequence of pSinRep 5 hIL13Rα.
FIG. 11K shows the polynucleotide sequence of pDH-EB.
FIG. 11L shows the polynucleotide sequence of pDH-EB.
FIG. 11M shows the polynucleotide sequence of pDH-EB.
FIG. 12A shows the polynucleotide sequence of pTE5′2J.
FIG. 12B shows the polynucleotide sequence of pTE5′2J.
FIG. 12C shows the polynucleotide sequence of pTE5′2J.
FIG. 12D shows the polynucleotide sequence of pTE5′2J.
FIG. 13A shows the polynucleotide sequence of 987 BB neo.
FIG. 13B shows the polynucleotide sequence of 987 BB neo.
FIG. 13C shows the polynucleotide sequence of 987 BB neo.
FIG. 14 shows a polynucleotide sequence of CAT.
FIG. 15 shows the polynucleotide sequence of the XbaI / ApaI fragment of synthetic erythropoietin.

Claims (10)

A method for identifying a recombinant nucleic acid encoding an exogenous protein having a desired property, comprising the following steps:
(A) providing a composition comprising a plurality of eukaryotic host cells comprising the steps of:
(I) wherein each host cell has an expression system comprising different members, each member comprising a recombinant virus having a recombinant nucleic acid encoding an exogenous protein operably linked to a regulatory element, wherein The control element is a subgenomic promoter or viral internal ribosome entry site;
(Ii) wherein the recombinant virus is an alphavirus; and (iii) wherein the recombinant virus is capable of self-replication;
(B) culturing the eukaryotic host cell under conditions in which the exogenous protein is expressed; and (c) identifying a member comprising a recombinant nucleic acid encoding the exogenous protein having the property of interest. Process,
Including the method. The method according to claim 1 , wherein the characteristic is a predetermined cell localization position with respect to a cell membrane .   The method of claim 1, wherein the property is binding affinity for a binding partner.   The method of claim 1, wherein the alphavirus is selected from the group consisting of Sindbis virus, Semliki Forest virus, and Venezuelan equine encephalomyelitis virus.   The method of claim 1, wherein the virus is further directed to the production of virus particles.   2. The method of claim 1, wherein the nucleic acid encoding an exogenous protein is derived from a nucleic acid library containing a plurality of different nucleic acids encoding polypeptides.   2. The method of claim 1, wherein the plurality of members are screened using physical separation of the eukaryotic host cell, wherein each of the host cells is one of the plurality of members. A method of having individual members. A nucleic acid library comprising a population of eukaryotic expression systems having a plurality of different members, each member comprising a recombinant virus having a recombinant nucleic acid encoding an exogenous protein operably linked to a control element;
(I) where the regulatory element is a subgenomic promoter or viral internal ribosome entry site;
(Ii) wherein the recombinant virus is an alphavirus; and (iii) a nucleic acid library wherein the recombinant virus is capable of self-replication.   The method of claim 1, wherein the alphavirus is a Sindbis virus. The nucleic acid library according to claim 8 , wherein the alphavirus is Sindbis virus.

Images