JP4484556B2 - Methods and pharmaceutical compositions for the treatment of psoriasis and squamous cell carcinoma - Google Patents

Description

  The present invention treats a disease selected from the group consisting of psoriasis and squamous cell carcinoma by suppressing the expression of squamous cell carcinoma antigen (hereinafter referred to as “SCCA”) in cells. Alternatively, a method for preventing or a pharmaceutical composition is provided.

  SCCA is an antigen extracted from squamous cell carcinoma cells, and has a high blood concentration in squamous cell carcinomas of the cervix, lungs, esophagus, and skin, and is often used for the diagnosis of squamous cell carcinoma (H. Kato et al. Cancer 40: 1621-1628 (1977); N. Mino et al. Cancer 62: 730-734 (1988)). In particular, SCCA blood levels correlate well with the progression stage, malignancy, tumor size, etc. of squamous cell carcinoma, so that not only early detection of cancer but also evaluation of cancer treatment effects and diagnosis of recurrence It is a particularly effective cancer marker.

  SCCA is also known to have increased expression in the upper layers of the psoriatic epidermis (Takeda A. et al., J. Invest. Dermatol. (2002) 118 (1), 147-154). Psoriasis is a skin disease, and there is psoriasis, which is a chronic, recurrent inflammatory keratosis characterized by abnormal proliferation and differentiation of epidermal cells and inflammatory cell infiltration. Psoriasis is thought to develop by adding various environmental factors to a genetic predisposition (Hopso-Havu et al. British Journal of Dermatology (1983) 109, 77-85).

  SCCA is encoded by two genes, SCCA-1 and SCCA-2, arranged in tandem on chromosome 18q21.3. The proteins encoded by them, SCCA-1 and SCCA-2, are both proteins with a molecular weight of about 45,000 and are highly homologous, but the amino acid sequences of the reaction sites are different and are considered to have different functions. (Schick et al. J. Biol. Chem. (1997) 27213, 1849-55). Although it was known that SCCA-1 and SCCA-2 were highly expressed in diseases such as squamous cell carcinoma and psoriasis, it was unclear what function they performed in disease cells.

Cancer 40: 1621-1628 (1977) Cancer 62: 730-734 (1988) J. Invest. Dermatol. (2002) 118 (1), 147-154 British Journal of Dermatology (1983) 109, 77-85 J. Biol. Chem. (1997) 27213, 1849-55

  The present inventor has conducted research aimed at elucidating the physiological mechanism of the epidermis in which SCCA is involved, and surprisingly found that SCCA is an anti-apoptotic factor having an action of suppressing cell apoptosis. .

Briefly, the present inventor examined the skin UV protection mechanism and revealed that UV irradiation on human skin strongly enhances the expression of SCCA in the spinous layer and granule layer. Thus, human SCCA-1 and SCAA-2 genes were introduced into 3T3 cells in which SCCA expression was not observed to establish a stable expression system, and apoptosis of the SCCA stable expression system cells by UV irradiation was examined. It was revealed that apoptosis by UV irradiation was also significantly reduced in the expression system.
In addition, SCCA-1 and SCCA-2 knockdown cell lines were established by RNA interference method in which siRNAs were constantly expressed by pSilencer vectors in HaCat cells that highly express SCCA, and UV irradiation was applied to the cell lines. As a result, it was shown that the apoptosis rate of SCCA knockdown cells was significantly higher than that of the control strain. From the above, the present inventor was able to conclude that SCCA is a protein having an action of suppressing apoptosis.

  In diseases involving abnormal cell proliferation / differentiation such as cancer and psoriasis, cancer cells are expected to escape from cell death by suppressing apoptosis and continue to grow abnormally. Therefore, it is clear that SCCA having anti-apoptotic action suppresses cell death in cells exhibiting high expression of SCCA, resulting in abnormal growth of the cells. Therefore, it is clear that by suppressing the expression of SCCA having an apoptosis-inhibiting action, diseases associated with abnormal cell proliferation such as squamous cell carcinoma and psoriasis can be treated and prevented.

  In view of the above viewpoint, the present invention has an object to provide a method and a pharmaceutical composition for the treatment and prevention of diseases accompanied by abnormal growth of SCCA high-expressing cells, for example, cancer, particularly squamous cell carcinoma, and psoriasis. To do.

In a first aspect, the present invention provides a method for treating and / or preventing a disease selected from the group consisting of psoriasis and squamous cell carcinoma by suppressing the expression of squamous cell carcinoma associated antigen (SCCA) in cells. provide. Preferably, suppression of SCCA expression in cells is performed by RNA interference of a gene encoding SCCA. In a more preferred embodiment, the RNA interference comprises a sense oligonucleotide strand comprising an oligonucleotide of SEQ ID NO: 1 or a variant thereof and an antisense oligonucleotide strand comprising an oligonucleotide of SEQ ID NO: 2 or a variant thereof. Use single-stranded RNA. Here, the oligonucleotide variant of SEQ ID NO: 1 has a sequence that hybridizes under highly stringent conditions to nucleotide numbers 46 to 66 of the gene encoding SCCA, and the oligonucleotide of SEQ ID NO: 2 Nucleotide variants have sequences that hybridize under highly stringent conditions to the complementary strand of nucleotide numbers 46-66 of the gene encoding SCCA.

In another aspect, the present invention provides a pharmaceutical composition for treating and / or preventing a disease selected from the group consisting of psoriasis and squamous cell carcinoma by suppressing the expression of SCCA in cells. Preferably, the pharmaceutical composition contains double stranded RNA providing a short RNA that interferes with the RNA encoding the gene encoding SCCA. In a more preferred embodiment, the pharmaceutical composition comprises a sense oligonucleotide chain comprising the oligonucleotide of SEQ ID NO: 1 or a variant thereof and an antisense oligonucleotide chain comprising the oligonucleotide of SEQ ID NO: 2 or a variant thereof. Contains double-stranded RNA. Here, the oligonucleotide variant of SEQ ID NO: 1 has a sequence that hybridizes under highly stringent conditions to nucleotide numbers 46 to 66 of the gene encoding SCCA, and the oligonucleotide of SEQ ID NO: 2 Nucleotide variants have sequences that hybridize under highly stringent conditions to the complementary strand of nucleotide numbers 46-66 of the gene encoding SCCA.

  In a preferred embodiment, the double-stranded RNA is in the form contained in a vector, such as a pSilencer vector.

The present invention further provides a method for preparing cells in which the expression of SCCA is suppressed. Preferably, suppression of SCCA expression is performed by RNA interference of a gene encoding SCCA. In a more preferred embodiment, the RNA interference comprises a sense oligonucleotide strand comprising an oligonucleotide of SEQ ID NO: 1 or a variant thereof and an antisense oligonucleotide strand comprising an oligonucleotide of SEQ ID NO: 2 or a variant thereof. Use single-stranded RNA. Here, the oligonucleotide variant of SEQ ID NO: 1 has a sequence that hybridizes under highly stringent conditions to nucleotide numbers 46 to 66 of the gene encoding SCCA, and the oligonucleotide of SEQ ID NO: 2 Nucleotide variants have sequences that hybridize under highly stringent conditions to the complementary strand of nucleotide numbers 46-66 of the gene encoding SCCA. The present invention further provides a cell in which the expression of SCCA is suppressed by the above method and a mammal containing such a cell.

  The present invention provides a method and a pharmaceutical composition for the treatment and prevention of a disease selected from the group consisting of squamous cell carcinoma and psoriasis.

  The present inventor has clarified that SCCA is a protein having an action of suppressing apoptosis. Therefore, it is clear that by suppressing the expression of SCCA, diseases associated with abnormal proliferation / differentiation of cells expressing squamous cell carcinoma antigen such as cancer and psoriasis can be treated / prevented. Examples of squamous cell carcinoma include squamous cell carcinoma in organs such as cervix, lung, esophagus, maxilla and skin.

  SCCA is a protein having a molecular weight of about 45,000, which is present in squamous cell carcinoma cells and psoriatic epidermis as described above. The amino acid sequences of SCCA-1 and SCCA-2 and the nucleic acid sequences encoding them are described in Takeda A et al. J. Invest. Dermatol. 118, 147-154 (2002) (supra).

  Suppression of cellular SCCA expression can be achieved by various genetic techniques such as RNA interference, antisense RNA / DNA methods, peptides and RNA / DNA aptamers, site-specific deletion, homologous recombination, dominant negative alleles, Although it can be achieved by various techniques such as an intrabody, RNA interference is particularly preferred.

  The RNA interference method is a method comprising a strand containing a sense oligonucleotide of about 21 to 23 base pairs complementary to a part of mRNA encoding a part of a target gene and 21 to 23 base pairs homologous to a part of the mRNA. This is a method for suppressing the expression of a target gene by introducing a double-stranded RNA composed of a strand containing a certain amount of antisense oligonucleotide into a cell. This method is based on the interference properties of double-stranded RNA derived from the coding region of the gene, and has proven to have excellent utility in nematode genetic studies (Fire et al., Nature (1998) 391: 806-811), and can be used to produce a loss-of-function phenotype in Drosophila and mammals.

In this method, a sequence complementary to a suitable target region of the SCCA gene, preferably a region having a nucleotide length of about 18 to 23 (sense oligonucleotide) and a nucleotide length of about 18 to 23 complementary to the sense sequence. A double-stranded RNA (dsRNA) composed of a single sequence (antisense oligonucleotide) is synthesized in vitro. Preferably, the double-stranded RNA is a sense oligonucleotide containing a sequence complementary to the sequence of nucleotide positions 46 to 66 of the SCCA gene (ACATGAACTT GGTGTTGGCT T: SEQ ID NO: 1), and the sequence of nucleotide positions 46 to 66 described above. And an antisense oligonucleotide containing a homologous sequence (AAGCCAACAC CAAGTTCATGT; SEQ ID NO: 2 ). The total length of the sense and antisense oligonucleotides is not particularly limited, and is, for example, about 25 to 100 nucleotides, preferably 40 to 80 nucleotides, more preferably about 50 to 70 nucleotides.

The sense oligonucleotide may be an oligonucleotide comprising a variant of the oligonucleotide of SEQ ID NO: 1. This mutant preferably has a sequence that hybridizes under highly stringent conditions to nucleotide positions 46 to 66 of the gene encoding SCCA. The antisense oligonucleotide may be an oligonucleotide containing a variant of the oligonucleotide of SEQ ID NO: 2 . This mutant preferably has a sequence that hybridizes under highly stringent conditions to the complementary strands of nucleotide numbers 46 to 66 of the gene encoding SCCA. Here, highly stringent hybridization conditions refer to conditions including, for example, a sodium concentration of about 10 to 40 mM, preferably about 20 mM, and a temperature of about 50 to 70 ° C., preferably about 60 to 65 ° C.

The obtained double-stranded RNA may be introduced directly into the target cell, or the dsRNA may be introduced into the target cell in advance after ligation to a vector having elements necessary for transcription such as a promoter and terminator. Various vectors well known to those skilled in the art can be used as the vector, but the pSilencer vector (Ambion) is preferred. By introducing a vector containing the above double-stranded RNA into a cell, the sense strand of SEQ ID NO: 1 (or a variant thereof) and the antisense strand of SEQ ID NO: 2 (or a variant thereof) are transcribed in the cell And a short hairpin RNA (shRNA) connecting the sense strand and the antisense strand. The shRNA is then cleaved to a short RNA (short interfering RNA) of about 21 to 23 base pairs by intracellular nucleases and dicers, forming a complex RISC and causing RNA interference that cleaves SCCA mRNA. As a result, the expression of SCCA by the introduced cells is suppressed.

  Preferably, in the present invention, genes that suppress the expression of SCCA, such as the above double-stranded RNA and other genes that suppress the expression of SCCA, such as antisense DNA or RNA, aptamer RNA or DNA (hereinafter simply referred to as “ SCCA expression-suppressing gene ") is used as an active ingredient of a pharmaceutical composition for suppressing SCCA expression and consequently preventing or treating psoriasis or squamous cell carcinoma. The SCCA expression-suppressing gene may be administered directly by injection, or may be administered to the affected area by a method of administering a vector or plasmid incorporating the gene.

  Examples of the vector include an adenovirus vector, an adeno-associated virus vector, a herpes virus vector, a vaccinia virus vector, a retrovirus vector, and the like. By using these virus vectors, an SCCA expression suppressing gene can be efficiently administered. . In addition, a method of introducing an SCCA expression-suppressing gene into a phospholipid vesicle such as a liposome and administering the liposome can also be employed. Since the liposome is a closed vesicle containing a biodegradable material, the gene is held in the aqueous layer or lipid bilayer inside the liposome by mixing the liposome and the gene (liposome-gene complex). Next, when the complex is cultured with cells, the gene in the complex is taken into the cells (lipofection method). Then, the obtained cells may be administered by the following administration method.

  As for the administration form of the pharmaceutical composition, in addition to systemic administration such as normal intravenous and intraarterial administration, local administration can be performed to each tissue where tumors and psoriasis are present. Furthermore, administration forms combined with catheter techniques, surgical operations and the like can also be employed. The dosage of the pharmaceutical composition of the present invention varies depending on age, sex, symptom, administration route, administration frequency, dosage form, and will be appropriately determined by a doctor or the like.

  When plasmid DNA is directly administered intravenously, it is difficult to express the gene because the DNA is immediately degraded by DNase in the blood. Therefore, when plasmid DNA is used, it is preferable to employ a plasmid direct injection method. Since this method is easier to purify the vector than the method using a viral vector, it can be prepared in a large amount in a short time, and there are no restrictions on the size of the transgene and the concentration at the time of injection. It has various advantages (Verma IM et al., Nature 389: 239-242, 1997).

  In the direct DNA injection method, the purified plasmid DNA may be dissolved in physiological saline or the like and directly injected into the muscle. As a result, the plasmid DNA is taken into cells around the injection site, the expression of the gene incorporated into the eukaryotic expression unit on the plasmid occurs, and the gene product is produced. Intramuscular injection is currently the mainstream of direct DNA injection, but intratumor (Yang JP et al., Gene. Ther. 3: 542-548, 1996), intradermal (Hengge UR et al., J Clin. Invest. 97: 2911-2916, 1996; Choate KA et al., Hum. Gene. Ther. 8: 1659-1665, 1997).

  As for plasmid DNA to be injected intramuscularly, for example, 1 μg to 1 mg, preferably 25 μg to 100 μg of DNA is dissolved in 50 μl of physiological saline and injected. Thereby, the maximum value of expression can be obtained after 4 to 7 days.

  Confirmation of suppression of the expression of SCCA can be performed, for example, by directly measuring the amount of SCCA in the cell. Preferably, it is determined by extracting RNA from the cells and measuring the amount of mRNA encoding SCCA. Extraction of mRNA and measurement of the amount thereof are also well known in the art. For example, RNA is quantified by quantitative polymerase chain reaction (PCR). In addition, SCCA measurement uses an antibody specific for SCCA, and is well-known in the art, for example, immunostaining using a fluorescent substance, dye, enzyme, etc., Western blotting, immunoassay, eg ELISA It can be carried out by various methods such as RIA method. In addition to the above, the expression level of SCCA can also be measured by measuring the known biological activity of SCCA. In addition, the expression of SCCA can be determined through in situ hybridization and measurement of its biological activity.

  The cells in which the expression of SCCA is suppressed according to the present invention may preferably be epidermal cells such as granule cells, spinous cells and the like. In addition to humans, mammals having such cells include non-human mammals such as mice, rats, hamsters, guinea pigs, rabbits, dogs, cats, horses, cows, sheep, pigs, goats, and monkeys. It's okay. The animals and cells according to the present invention can also be used as model animals and cells used for elucidation of the UV protection mechanism of the epidermis, research and development, and screening of drugs for preventing or suppressing skin damage caused by UV. .

  Hereinafter, the present invention will be described more specifically with specific examples. In addition, this invention is not limited by this.

Immunohistochemical examination According to the AMeX procedure (Sato Y. et al. Am. J. Pathol., 125, 431-435 (1986)), the epidermal biopsy was fixed in cold acetone and then embedded in paraffin . Sections were deparaffinized with xylene and washed with acetone and then PBS. Next, non-specific binding sites of the sections were blocked with 10% normal rabbit serum (Histofine, Tokyo, Japan).
Epidermal sections were anti-SCCA-1 monoclonal antibody (Santa Cruz Biotechnology, CA, USA) (diluted 1: 500), anti-SCCA-2 monoclonal antibody (Santa Cruz Biotechnology, CA, USA) (diluted 1: 500) Or incubated with each of the anti-SCCA polyclonal antibodies (purified as described in Takeda A. et al. J. Invest. Dermatol. 118, 147-154 (2002)). After washing with PBS, the sections were counterstained with hematoxylin and observed with a DAKO Envision System (DAKO Corp., CA, USA).

  FIG. 1 shows an epidermis specimen as an epidermis derived from a non-exposed region of the upper arm (human 24 years), buttocks (human 46 years), thigh (human 75 years), and an exposed region of the cheek (human 20). The results are obtained by microscopic observation using an anti-SCCA polyclonal antibody that binds to both SCCA-1 and SCCA-2 as antibodies. From FIG. 1, it can be seen that SCCA is remarkably enhanced in the upper epidermis of the exposed part compared to the non-exposed part. However, no enhanced SCCA expression was observed in the basal layer even at the exposed site.

  FIG. 2 shows each of SCCA-1 and SCCA-2 in human epidermis subjected to UV irradiation (transluminator TOREX FL205-E-30 / DMR (Toshiba Medical Supply) and control epidermis not irradiated as epidermal specimens. The anti-SCCA-1 monoclonal antibody and the anti-SCCA-2 monoclonal antibody were used as antibodies, respectively, and from FIG. It was revealed that the expression was enhanced by irradiation, and the enhanced expression was remarkable in the skin spiny layer and the granule layer.

  From the above, it was revealed that when the epidermis is irradiated with UV, the expression of SCCA-1 and SCCA-2 is enhanced in the epidermis, particularly in the spinous layer and the granule layer.

Quantitative PCR Experiment Next, an experiment was conducted to confirm at the gene level that the expression of SCCA-1 and SCCA-2 in the epidermis is enhanced by UV irradiation.
Human keratinocytes were cultured in keratinocyte-SFM medium (GIBCO, Invitrogen) at 37 ° C. in the presence of L-glutamine and epidermal growth factor in an atmosphere of high humidity and 5% CO ₂ . Cells with confluence of 60-70% were irradiated with UVB for 0-48 hours. UVB irradiation was performed using a transluminator TOREX FL205-E-30 / DMR (Toshiba Medical Supply) at an intensity of 50 mJ / cm ² . Control cells were not irradiated with UVB.

  Total RNA was isolated and purified from the cultured cells using Isogen (Nippon Gene) according to the attached instructions. The expression levels of SCCA-1 and SCCA-2 were determined by quantitative real-time polymerase chain reaction (PCR). Briefly, total RNA was converted to cDNA using Superscript II (Invitrogen, Carlsbad, CA). The sample was amplified by performing 40 cycles of 2-step PCR using ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, Calif.). GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal standard.

The primers used are as follows.
SCCA-1:
Forward primer
5'-GTGCTATCTGGAGTCCT-3 '(SEQ ID NO: 3)
Reverse primer
5'-CTGTTGTTGCCAGCAA-3 '(SEQ ID NO: 4)
Taq Man probe
5'-CATCACCTACTTCAACT-3 '(SEQ ID NO: 5)

SCCA-2:
Forward primer
5'-CTCTGCTTCCTCTAGGAACACAG-3 '(SEQ ID NO: 6)
Reverse primer
5'-TGTTGGCGATCTTCAGCTCA-3 '(SEQ ID NO: 7)
Taq Man probe
5'-AGTTCCAGATCACATCGAGTT-3 '(SEQ ID NO: 8)

GAPDH:
Forward primer
5'-GAAGGTGAAGGTCGGAGTC-3 '(SEQ ID NO: 9)
Reverse primer
5'-GAAGATGGTGATGGGATTTC-3 '(SEQ ID NO: 10)
Taq Man probe
5'-AGGCTGAGAACGGGAAGCTTGT-3 '(SEQ ID NO: 11)

  A reporter dye (6-carboxy-fluorescein) was attached to the 5 'end of the Taq Man probe sequence and a quencher dye (6-carboxy-tetramethyl-rhodamine) was incorporated at its 3' end.

  FIG. 3 shows the results of the influence of UVB irradiation on the expression of SCCA in cultured human keratinocytes. It was revealed that both SCCA-1 and SCCA-2 are enhanced in expression by UV irradiation. Therefore, it was revealed that the expression of SCCA-1 and SCCA-2 in the epidermal cells was enhanced at the gene level by UV irradiation.

Examination of the Role of SCCA in UV Irradiation As described above, it was elucidated that the expression of SCCA-1 and SCCA-2 is enhanced by receiving UV irradiation in epidermal cells. Next, the role of SCCA-1 and SCCA-2 in the epidermal cells subjected to UV irradiation was examined.

Establishment of SCCA-1 and 2 highly expressing cells 3T3 cells (obtained from ATCC) are cells derived from mouse fetuses that do not express SCCA-1 and 2. A gene encoding SCCA-1 or 2 was introduced into the cells as follows.
SCCA-1 and SCCA-2 cDNAs (Takeda A et al. J. Invest. Dermatol. 118, 147-154 (2002)) were double digested with Bam HI and Kpn I. They were subcloned into the pTarget vector and then introduced into 3T3 cells using Lipofectamine Plus (GIBCO, Invitrogen Corp.). Briefly, 20 μg of cDNA in 675 μl of serum-free DMEM medium (Invitrogen Corp.) was mixed with 75 μl of Plus reagent and left at 25 ° C. for 15 minutes. Lipofectamine (100 μl) was added to 650 μl of serum-free DMEM medium, which was then added to the cDNA-Plus mixture and left at 25 ° C. for 15 minutes. This cDNA mixture was added to 10 ml of serum-free DMEM medium and 3T3 cells were incubated therein at 37 ° C. for 4 hours under a 5% CO ₂ atmosphere. The medium was replaced with DMEM medium containing 10% FCS (Invitrogen Corp.) and incubated overnight. The next day, G418 (Calbiochem) was added to a final concentration of 500 μg / ml. G418 was kept at this concentration throughout the culture period. The medium was changed every 2-3 days. After 4 weeks in culture, several G418 resistant colonies could be isolated and SCCA-1 and SCCA-2 expressing cell lines were established.

  Cells into which cDNA encoding SCCA-1 has been introduced (SCCA-1-introduced cells) express SCCA-1 specifically and stably, and cells into which cDNA encoding SCCA-2 has been introduced (SCCA-2) The introduced cells) were confirmed to express SCCA-2 specifically and stably. In addition, 3T3 cells (control cells) into which non-specific sequences were introduced by the same operation did not express either SCCA-1 or SCCA-2.

  Using the above-mentioned SCCA-1 introduced cells, SCCA-2 introduced cells and control cells, the role played by SCCA-1 and SCCA-2 when UV irradiation was applied to epidermal cells was examined. Specifically, the role of SCCA-1 and SCCA-2 on UV-induced apoptosis in epidermal cells was examined.

The various cells were cultured in a DMEM medium containing 10% FCS at 37 ° C. in an atmosphere of high humidity and 5% CO ₂ . Cells with confluence of 60-70% were irradiated with UVB for 0-48 hours. UVB irradiation was performed using a transluminator TOREX FL205-E-30 / DMR (Toshiba Medical Supply) at an intensity of 50 mJ / cm ² .

  Apoptosis evaluation for these cells was performed using FACS COULTER (EPIX XL-MCL, Becjman Coulter), using Annexin V-FITC and propidium iodyne (PI) double staining method (Annexin V-FITC kit, Immunotech) as an index. FACS (fluorescence activated cell sorter) analysis was performed.

The result is shown in FIG. As is clear from FIG. 4, it was confirmed that apoptosis by UV irradiation was significantly reduced in both the SCCA-1 and SCCA-2 introduced cells. Therefore, it was estimated that both SCCA-1 and SCCA-2 can suppress apoptosis induced by UV.
In order to confirm this, the inventor next established SCCA-1 and SCCA-2 knockdown cell lines by RNA interference, and the role of SCCA-1 and SCCA-2 in epidermal cells in UV irradiation. Further investigation was made.

Establishment of SCCA knockdown cells HaCat cells (H. Hans. Et al. Experimental Cell Research 239, 399-410 (1998)) are human keratinocytes that highly express SCCA. According to the RNA interference method, siRNA (short interference RNA) was constantly expressed in this cell using the pSilencer vector (Ambion), thereby establishing SCCA-1 and 2 knockdown cell lines.
siRNA was constructed using the pSilencer vector according to the attached instructions. Specifically, a 65-mer sense oligonucleotide (SEQ ID NO: 12) including a 21-mer oligonucleotide (ACATGAACTT GGTGTTGGCT T: SEQ ID NO: 1) complementary to nucleotide positions 46 to 66 of the gene encoding SCCA; A double-stranded oligonucleotide consisting of a 65-mer antisense oligonucleotide (SEQ ID NO: 13) containing a 21-mer oligonucleotide homologous to position 66 (AAGCCAACAC CAAGTTCATGT; SEQ ID NO: 2 ) is converted into a Hind III site and a Bam HI site of the pSilencer vector. Cloned into. Transfection into HaCat cells was performed using Lipofectamine 2000 (Invitrogen) according to the attached instructions. Control cells were prepared using double-stranded oligonucleotides consisting of two oligonucleotides having no significant homology or complementarity with mammalian gene sequences. A stable cell line was obtained by culturing the transfected cells in hygromycin-B selection medium for 4-6 weeks and selecting. In order to confirm that the expression of SCCA was suppressed, the expression of SCCA-1 and SCCA-2 was measured by real-time PCR as described above.
Sense oligonucleotide (SEQ ID NO: 12)
GATCCCGGCCAACACCAAGTTCATGTTTCAAGAGA ACATGAACTTGGTGTTGGCTT TTTTGGAAA
(Underlined regions are homologous regions)
Antisense oligonucleotide (SEQ ID NO: 13)
AGCTTTTCCAAAA AAGCCAACACCAAGTTCATGT TCTCTTGAAACATGAACTTGGTGTTGGCCGG
(Underlined region is complementary region)

  The result is shown in FIG. In the cells into which the siRNA was introduced, it was confirmed that the expression of both SCCA-1 and 2 was suppressed (knocked down) by 90% or more compared to the control.

Using the knockdown cells and control cells, the role of SCCA-1 and 2 for UV-induced apoptosis in epidermal cells was examined.
The various cells were cultured in keratinocyte-SFM medium (GIBCO, Invitrogen) at 37 ° C. in the presence of L-glutamine and epidermal growth factor in an atmosphere of high humidity and 5% CO ₂ . Cells with a confluence of 60-70% were irradiated with UVB. UVB irradiation was performed using a transluminator TOREX FL205-E-30 / DMR (Toshiba Medical Supply) at an intensity of 50 mJ / cm ² .

Apoptosis evaluation for these cells was performed by FACS (fluorescence activated cell sorter) analysis using FACS COULTER and annexin V-FITC and propidium iodyne (PI) double staining method as indices.
The result is shown in FIG. As a result of UV irradiation of the knockdown cells, it was revealed that 38% of the cells caused apoptosis in the control cells, whereas about 80% of the knockdown cells caused apoptosis. Therefore, it was found that SCCA significantly suppressed apoptosis of epidermal cells induced by UV irradiation. Thus, it was revealed that SCCA is a protein that plays a role in the UV protection mechanism of epidermal cells and has an action of suppressing apoptosis.

Expression of SCCA in the epidermis of exposed and unexposed sites. Variation in the expression of SCCA in the epidermis by UV irradiation. Effect of UV irradiation on SSCA expression in cultured human keratinocytes. Comparison of the apoptosis rate induced by UV irradiation between SCCA high-expressing cells and SCCA non-expressing cells. The establishment of an SSCA knockdown cell line is shown. Comparison of apoptosis rate induced by UV irradiation between SCCA knockdown cells and control cells.

Claims (3)

A method for preparing a cell in which the expression of squamous cell carcinoma-associated antigen (SCCA) is suppressed, wherein the suppression of SCCA expression is performed by RNA interference of a gene encoding SCCA. A method comprising using a double-stranded RNA comprising a sense oligonucleotide chain consisting of one oligonucleotide and an antisense oligonucleotide chain consisting of the oligonucleotide of SEQ ID NO: 2 . A cell in which SCCA expression is suppressed by the method according to claim 1 . An animal other than a human having the cell according to claim 2 .