JP4441640B2 - Replication control of human cytomegalovirus - Google Patents

Description

  The present invention relates to recombinant human cytomegalovirus and genomic DNA of each virus, characterized by site-specific mutation of all GC boxes present in the MIE gene enhancer region, and methods for using them.

  Human cytomegalovirus (HCMV) is a type of β-herpesvirus that invisibly infects most humans. Reactivation of latent HCMV causes various diseases such as pneumonia, hepatitis, and retinitis, but the mechanism of conversion from latent infection to lytic infection of the viral genome has not yet been elucidated.

  The host range of HCMV in vitro is narrow and replicates and proliferates only in differentiated cells such as fibroblasts, epithelial cells, endothelial cells, monocyte-derived macrophages. It has been found that the major immediate-early (MIE) gene plays an important role in the replication efficiency of HCMV in the host. The promoter upstream region of this MIE gene consists of three regions: a modulator, a unique region, and an enhancer. Modulators have been reported to have no effect on MIE transcription or viral replication in vitro. The unique region also does not affect transcription from the MIE promoter, but one or more cis-acting elements are known to repress transcription from the various UL127 early promoters of the virus.

  Enhancers can be further divided into two components, proximal and distal, and recombinant viruses without distal enhancers are known to replicate slowly and have a small human fibroblast plaque phenotype (Refer nonpatent literature 1). The inventors have confirmed that when the human and mouse CMV enhancers are chimerized proximally and distally, the replication efficiency at low MOI is reduced and the plaque phenotype is also reduced (Non-patent Document 2). . The inventors also examined the relationship between the gradual deletion of the proximal enhancer region and the transcription of the MIE gene and viral self-replication. It has been reported that viruses lacking -636 to -67 are capable of self-replication (see Non-Patent Document 3). In this replicable recombinant virus, one GC box existing upstream of the MIE promoter was retained.

  The Sp1 family of transcription factors is composed of four proteins (Sp1, Sp2, Sp3, Sp4). Sp1 and Sp3 recognize and bind to GC-rich sequences known as GC boxes, and Sp2 recognizes GT-rich sequences. In general, Sp1 is involved in the activation of many genes essential for cellular processes such as cell cycle regulation, chromatin remodeling, and unmethylated CpG island elongation. Sp3 has been shown to act as a transcriptional activator at Sp1-like sites on many promoters. So far, although there is a report (Non-patent Document 4) that HCMV infection up-regulates the amount of Sp1 in human fibroblasts, the relationship between the Sp1 family and virus replication has not been studied in detail.

Meier, J. L., and J. A. Pruessner, (2000) J. Virol. 74: p1602-1613 Isomura, H., and M. F. Stinski, (2003) J. Virol. 77: p3602-3614 Isomura, H., T. Tsurumi, and M. F. Stinski, (2004) J. Virol. 78: p12788-12799 Yurochko, A. D., et al., (1997) J. Virol. 71: p4638-4648

  An object of the present invention is to elucidate the replication mechanism of human cytomegalovirus and provide a new means and method for the treatment and prevention of HCMV infection.

  The HCMV MIE gene proximal enhancer has two Sp1 / Sp3 binding sites (GC boxes) at about -55 and -75 sites from the transcription start site (+1). The inventors deleted the -55 and -75 GC boxes and examined the effects on viral gene expression and replication. It was found that the mutation of one GC box does not significantly affect the expression and replication of the viral gene, but the expression and replication of the viral gene are remarkably suppressed when both GC boxes are mutated.

  That is, the present invention is characterized by site-specific mutation of all GC boxes present in the MIE gene enhancer region, wherein recombinant HCMV (however, when the transcription start position of the MIE gene is +1, (Excluding viruses lacking the entire region from -636 to -67).

  In the present invention, the mutation may be a mutation that inhibits the binding of Sp1 and Sp3 transcription factors to the GC box, for example, deletion or substitution of a part or all of the sequence in the GC box, or This can be realized by adding other arrangements.

  In a preferred embodiment, the recombinant HCMV has a self-renewal ability of about 1/100 or less compared to the wild type.

  The present invention also provides recombinant HCMV genomic DNA (provided that the transcription start position of the MIE gene is +1), wherein all GC boxes existing in the MIE gene enhancer region are site-specifically mutated. , Except for DNA lacking the entire region from -636 to -67).

  The present invention also provides a vector containing the recombinant HCMV genomic DNA, and a host cell transformed with each vector. In preferred embodiments, the host cell is a human fibroblast, glioma cell or human fetal fibroblast.

  The present invention also transforms host cells with a vector containing HCMV genomic DNA obtained by site-specific mutation of all GC boxes present in the MIE gene enhancer region, and recovers virus particles from the culture supernatant of each cell. Recombinant HCMV production method (except for the production method of viruses lacking the entire region from -636 to -67 when the transcription start position of MIE gene is +1) To do.

  The recombinant HCMV of the present invention is an attenuated virus whose infectivity and pathogenicity in the host are significantly reduced, and the virus or a part thereof can be suitably used for producing a vaccine for HCMV infection. Such vaccines are also provided.

  Furthermore, the present invention provides a method for reducing the replication efficiency of HCMV by inhibiting the binding of Sp1 or Sp3 transcription factors to all GC boxes present in the MIE gene enhancer region in HCMV genomic DNA.

  According to the present invention, it has been clarified that the virus replication ability can be controlled by mutation of the Sp1 / Sp3 binding site (GC box) present in the MIE gene enhancer region. The attenuated recombinant HCMV provided by the present invention can be used as a vaccine for the treatment of HCMV infection. Furthermore, it becomes possible to search for and develop new anti-HCMV drugs targeting the replication control mechanism via the Sp1 / Sp3 binding site clarified in the present invention.

  Hereinafter, the present invention will be described in detail.

1. Recombinant human cytomegalovirus (HCMV)
Human cytomegalovirus (HCMV) is a member of the β-herpesvirus subfamily, whose genome consists of 230 kb of linear double-stranded DNA. Although the replication mechanism of HCMV in the host has not been fully elucidated, it is known that the MIE (major immediate-early) gene plays an important role in the replication efficiency. The entire genome sequence of HCMV has already been analyzed, and those skilled in the art can easily obtain the sequence through a public database such as GenBank (GenBank Accession: NC_001347).

  The HCMV MIE gene proximal enhancer has two Sp1 / Sp3 binding sites (GC boxes) at about -55 and -75 sites from the transcription start site (+1). The GC box is a recognition sequence for the transcription factors Sp1 and Sp3, and the inventors have confirmed that these transcription factors cannot bind to the enhancer due to site-specific mutation to the GC box. Furthermore, it was found that the mutation of one GC box has no significant effect on the expression and replication of the viral gene, but the expression and replication of the viral gene is remarkably suppressed when both GC boxes are mutated.

  In the “recombinant HCMV” of the present invention, all the GC boxes existing in the enhancer region upstream of the MIE gene in the genomic DNA (that is, two GC boxes existing at −55 and −75) are site-specifically mutated. As a result, the self-replicating ability is remarkably reduced. In other words, the recombinant HCMV of the present invention is an attenuated recombinant HCMV that does not have sufficient self-renewal ability in an infected host and substantially lacks infectivity and pathogenicity.

  In the present invention, the replication efficiency of recombinant HCMV is at least 1/100 or less, preferably 1/500 or less, more preferably 1/1000 or less compared to the wild type. This is because with such a replication efficiency, infectivity and pathogenicity to the host cannot be expected, and research and clinical applicability can be expected.

  The “GC box mutation” in the present invention may be any mutation that prevents binding of Sp1 and Sp2 to the site, and deletion or substitution of a part or all of the sequence in the GC box, or an appropriate This can be done by adding sequences.

2. Recombinant HCMV genomic DNA and vector The recombinant HCMV of the present invention produces recombinant HCMV genomic DNA in which all GC boxes present in HCMV genomic DNA are artificially mutated (deleted, substituted, or added). It can be prepared by incorporating it into an appropriate vector and expressing it in a host. The present invention provides such “recombinant HCMV genomic DNA” and “vector”.

  The “recombinant HCMV genomic DNA” of the present invention is a set in which all GC boxes in the MIE gene enhancer region present in the HCMV genomic DNA are artificially site-specifically mutated (deleted, substituted, or added). It is a replacement HCMV genomic DNA.

  Further, the “vector” of the present invention is a vector containing the above-mentioned recombinant HCMV genomic DNA, which can express HCMV particles in a host cell but has infectivity and pathogenicity (self-replication ability). It is a vector that cannot express particles.

  When an animal cell is used as a host, a vector having a promoter located upstream of the gene to be expressed, an RNA splice site, a polyadenylation site, a transcription termination sequence, and the like can be used. For example, pSV2dhfr having an early promoter of SV40, pcDNAI / Amp (Invitrogen), pcDNAI, pAMoERC3Sc, pCDM8, pREP4 (Invitrogen), pCAT3-Basic (Promega) and the like can be mentioned.

  The promoter is not particularly limited as long as it can be expressed in animal cells, for example, cytomegalovirus (CMV) IE (immediate early) gene promoter, SV40 early promoter or metallothionein promoter, retrovirus promoter, A heat shock promoter, SRα promoter, CAG or the like can be used. Also, the CMV IE gene enhancer may be used together with a promoter.

  The vector of the present invention may further contain a selection marker and other foreign genes. When the foreign gene is translated in the introduced cell, each foreign gene product can be expressed. Accordingly, the foreign gene can be suitably used also when the gene product of the foreign gene is generated in the cell or is intended to be expressed in or on the surface of the HCMV particle. The foreign gene and the recombinant HCMV genomic DNA may be linked to each other via a protease cleavage site or the like so that the foreign gene and the recombinant HCMV genomic DNA are translated and expressed as a continuous polypeptide with HCMV, then cleaved by a protease and released.

3. Recombinant HCMV producing cells By introducing the vector of the present invention prepared as described above into a host cell, recombinant HCMV particles can be produced transiently or continuously in the culture solution of cultured cells. . Hereinafter, a recombinant cell containing this recombinant HCMV expression vector is referred to as a “recombinant HCMV producing cell”.

  The host cell is preferably a eukaryotic cell, particularly an animal cell. Examples of such cells include human normal fibroblasts, immortalized human fibroblasts, human fetal fibroblasts such as HEL cells, glioma cells such as U373 cells, etc. preferable. Commercially available cells may be used, obtained from a cell depository, or cells established from any cell may be used.

  Introduction of the vector of the present invention into a host cell can be performed using any technique known to those skilled in the art. Examples of such introduction method include electroporation, particle gun method, lipofection method, calcium phosphate method, microinjection method, DEAE sepharose method, and the like, but the method by calcium phosphate method is particularly preferable.

The amount of the vector used for the intracellular introduction may be determined according to the introduction method to be used, but preferably 1 picogram to 100 microgram, more preferably 10 picogram to 10 microgram.
Expression of recombinant HCMV in cells can be confirmed by Western blot analysis using an anti-HCMV antibody.

4). Other Embodiments of the Present Invention (1) Production of Vaccine Using Recombinant HCMV Recombinant HCMV produced from the recombinant HCMV-producing cells of the present invention has a complete structure as HCMV, ie, immunogenicity. Nevertheless, it is a recombinant HCMV that has a significantly reduced ability to self-replicate and substantially lacks infectivity and pathogenicity in an infected host. Therefore, the recombinant HCMV of the present invention or a part thereof can be used for the production of vaccines against various diseases caused by HCMV infection.

(2) Diagnostic or therapeutic agent for HCMV infection According to the present invention, the Sp1 / Sp3 binding site (GC box) present in the MIE gene enhancer region of human cytomegalovirus is mutated in a site-specific manner so that the transcription factors Sp1 and Sp3 It was confirmed that the ability to replicate the virus could be reduced by inhibiting the binding to the site. Therefore, it becomes possible to research and develop new therapeutic agents and treatment methods for HCMV infection targeting the action of transcription factors on the Sp1 / Sp3 binding site.

  The present invention will be described more specifically based on the following examples and drawings. However, the technical scope of the present invention is not limited to these examples.

1. Materials and Methods (1) Cells and viral load Primary human foreskin fibroblasts (HFF) are Eagle MEM medium containing 10% fetal bovine serum (Sigma), penicillin (100 U / ml), streptomycin (100 mg / ml) And cultured at 37 ° C., 5% CO ₂ (59).

  Viral load of wild-type (wt) HCMV Towne and recombinant virus was determined by a standard plaque assay on HFF cells. The amount of recombinant virus with a mutated Sp1 binding site was normalized to wild type virus as follows. Viral DNA uptake was measured in triplicate for HFF cells infected with 35 mm or 60 mm plates. 4 hours after infection (pi), cells were collected in PCR lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.001% TritonX-100, 0.001% SDS) containing 50 mg / ml proteinase K. . After standing at 55 ° C. for 100 minutes, proteinase K was inactivated by treatment at 95 ° C. for 10 minutes. The relative amount of viral DNA was measured by real-time PCR using HCMV gB primer and probe (Isomura, H., T. Tsurumi, and MF Stinski, (2004) J. Virol. 78: p12788-12799 ).

  To estimate the plaque size of the virus, plaques were made from wt or recombinant virus with MOI = 0.01 and further agar overlaid for 3 days after infection. The shortest and longest lengths of plaques were measured with an inverted microscope (model SZ, Olympus), and the results were expressed as average values per 10 plaques.

(2) Enzyme Restriction endonuclease and calf intestine-derived alkaline phosphatase (CIP) were purchased from New England Biolabs. High Fidelity and Expanded High Fidelity Taq DNA polymerase were purchased from Invitrogen and Roche, respectively. RNasin and RNase-free DNase were purchased from Promega and Takara, respectively. These enzymes were used according to the manufacturer's instructions.

(3) Vector construction In the following, the transcription start site of the MIE gene is set to +1, the Sp1 / Sp3 recognition sequence near the position -55 GC box is Sp1 (-55), and the GC box near the position-75 is Sp1. (-75), and the sequences obtained by mutating them are described as mutSp1 (-55) and mutSp1 (-75).

  The recombinant vector was constructed using plasmid pCAT3-Basic (Promega) having a multiple cloning site upstream of the CAT gene. First, by PCR, (i) MIE promoter (48 to +53), (ii) MIE promoter (58 to +53) including Sp1 (-55), (iii) Sp1 (-55) and Sp1 (-75) The sequence of only the MIE promoter including the MIE promoter (77 to +53) and (iv) mutations Sp1 (-55) and Sp1 (-75) was amplified. As a template, plasmid pKS + MIE 583 / + 78 containing HCMV Towne DNA from 583 to +78 of the MIE enhancer and promoter was used, and the forward primer and reverse primer Bg1IISp1R shown below were used as primers, respectively.

NheITATAF: 5'-CTAGCTAGCGGCGTGTACGGTGGGAGGTCTATATAAGC-3 '(SEQ ID NO: 1)
NheISpI (-55) F: 5'-CTAGCTAGCATGGGCGGTAGGCGTGTACGGT-3 '(SEQ ID NO: 2)
NheISpI (-75) F: 5'-CTAGCTAGCCCCGCCCCGTTGACGCAAATG-3 '(SEQ ID NO: 3)
NheImutSpI (-55) F: 5'-CTAGCTAGCCCCGCCCCGTTGACGCAAATGgatccTAGGCGTGTACG-3 '(SEQ ID NO: 4)
Bg1IISpIR: 5'-GGAAGATCTCGGTGTCTTCTATGGAGGTCAAAACAGCG-3 '(SEQ ID NO: 5)
Lower case letters indicate mutated bases.

  The amplified product was confirmed by sequencing, treated with Bg1II and NheI, incorporated into each restriction enzyme site of the pCAT3-Basic vector, and cloned.

(4) CAT assay
Transfection of HFF cells was performed 3 times on a 35 mm diameter plate using 2 mg of each expression plasmid, Lipofectamine and PLUS reagent (Invitrogen), and collected 72 hours later. Furthermore, a cell lysate was prepared and CAT assay was performed according to the previous report (38). Acetylated and non-acetylated 14C chloramphenicol (Amersham Pharmacia Biotech) was separated by thin layer chromatography using chloroform-methanol (95: 5) solvent. Signal intensity was measured using an image reader (BAS2500, Fuji Film), and the conversion rate from non-acetylated 14C chloramphenicol to acetylated compound was calculated. The relative CAT activity of each reporter plasmid was determined based on pCAT TATA.

(5) Electrophoretic mobility shift analysis (EMSA)
Probes (sense) and competitor DNA (antisense) having the following sequences were purchased from Invitrogen.
Sp1 (-55) and Sp1 (-75):
Probe: 5'-GTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGA-3 '(SEQ ID NO: 6)
Competitor: 5'-CCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAACGGGGCGGGGTTATTACGAC-3 '(SEQ ID NO: 7)
Sp1 (-55):
Probe: 5'-TGACGCAAATGGGCGGTAGGCGTGT-3 '(SEQ ID NO: 8)
Competitor: 5'-CGTACACGCCTACCGCCCATTTGC-3 '(SEQ ID NO: 9)
mutSp1 (-55):
Probe: 5'-TGACGCAAATtttCttTAGGCGTGT-3 '(SEQ ID NO: 10)
Competitor: 5'-CGTACACGCCTAaaGaaaATTTGC-3 '(SEQ ID NO: 11)
Sp1 (-75):
Probe: 5'-GTCGTAATAACCCCGCCCCGTTGAC-3 '(SEQ ID NO: 12)
Competitor: 5'-TGCGTCAACGGGGCGGGGTTATTAC-3 '(SEQ ID NO: 13)
mutSp1 (-75):
Probe: 5'-GTCGTAATAAttttGttttGTTGAC-3 '(SEQ ID NO: 14)
Competitor: 5'-TGCGTCAACaaaaCaaaaTTATTAC-3 '(SEQ ID NO: 15)
Lower case letters indicate mutated bases.

Probe and competitor DNA were mixed at an equimolar ratio, denatured at 95 ° C., and gradually cooled to room temperature (RT) and annealed. The 3 'end was labeled with a Klenow fragment of E. coli DNA polymerase I and ³² P-dGTP (Amersham) to prepare a ³² P-labeled probe. Unincorporated deoxynucleoside triphosphate was removed with a chromaspin + TE 10 column (Clontech).

a) Gel supershift assay A gel supershift assay using a specific antibody was performed according to the following procedure. Hela cell nuclear extract 2 mg, buffer I (20 mM HEPES, pH 7.9, 6.25 mM MgCl ₂ , 0.5 mM EDTA, 0.5 mM dithiothreitol, 0.01 mg added with 2 mg poly (dI-dC) % Nonidet P-40, 9% glycerol) and preincubated for 15 minutes at room temperature. Next, 10 mg of anti-Sp1 and / or anti-Sp3 polyclonal antibody or control IgG (Zymed) was added to the reaction solution (20 ml in total), incubated at room temperature for 30 minutes, and then 176 fmol of ³² P-labeled. Probe (50,000 cpm) was added. This reaction solution was further incubated at room temperature for 15 minutes, and the probe-protein complex was separated by electrophoresis. Electrophoresis was performed at 4 ° C. using 5% non-denaturing polyacrylamide gel using 0.5 × TAE (20 mM Tris-acetic acid, pH 7.2, 1.0 mM EDTA) as an electrophoresis buffer. The gel was dried and exposed to Hyperfilm MP (Amersham).

b) Competition assay In the competition assay, 2 mg of nuclear extract of Hela cells is added to buffer I containing a fixed molar excess of non-radiolabeled competing dsDNA and 2 mg poly (dI-dC) (20 ml total) Pre-incubated for 15 minutes at room temperature. Next, 176 fmol radiolabeled probe was added to the reaction mixture and incubated for an additional 15 minutes at room temperature. Electrophoresis was performed as described above.

c) Western blot analysis Cells were collected at a fixed time after infection, washed with PBS, and then lysis buffer (0.02% SDS, 0.5% Triton X-100, 300 mM NaCl, 20 mM Tris-HCl (pH 7.6). ), 1 mM EDTA, 1 mM DTT, 10 mg / ml leupeptin, 5 mg / ml A) for 20 minutes on ice. Samples were centrifuged at 15,000 rpm for 10 minutes at 4 ° C. and protein concentration was measured using the BioRad protein assay kit. 20 mg of protein was separated by SDS 10% polyacrylamide (acrylamide 29.2, bisacrylamide 0.8) gel electrophoresis (SDS-PAGE). This was transferred to a PVDF membrane, washed with a blotting buffer (1 × PBS + 0.1% Tween 20), and blocked with a blotting buffer containing 10% nonfat dry milk for 60 minutes. The primary antibody was added to the washed PVDF membrane and incubated for 60 minutes at room temperature in a blotting buffer containing 5% nonfat dry milk. After washing, a horseradish peroxidase-conjugated secondary antibody was further added and incubated at room temperature for 60 minutes. The target protein was detected using an improved chemiluminescence detection system (Amersham). Images were detected with LumiVision PRO (Aisin / Taitec) equipped with a cooled CCD camera and configured with Adobe Photoshop 5.0 on an Apple G4 computer.

(6) Antibody The anti-Sp1 and anti-Sp3 polyclonal antibodies sc59 and sc644 were obtained from Santa Cruz Biotechnology. Monoclonal antibody NEA9221 against pIE72 and pIE86 was obtained from Perkin Elmer. Polyclonal antibody MAB374 against p36 protein encoded by cellular GAPDH was obtained from Chemicon.

(7) HCMV BAC (bacterial artificial chromosome) DNA mutagenesis
Mutation induction of HCMV was performed using the homologous recombination system of E. coli expressing the recombinant proteins exo, beta and gam of λ phage (provided by Dr. D. Court, National Institutes of Health) (Ellis, HM). , et al., 2001. Proc. Natl. Acad. Sci. USA 98: 6742-6746. 42). HCMV Towne BAC-DNA was provided by F. Liu (Dunn, W., CF Liu et al., 2003 Sci. USA 100: 14223-14228). This BAC-DNA contains a kanamycin resistance gene flanked by a 34 bp minimal FRT (FLP recognition target) site (5'-GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3 ': SEQ ID NO: 16) and a 50-70 bp homologous viral DNA sequence. Yes.

  BACdelSp1 (-55) R and BACdelSp1 (-55) F, BACdelSp1 (-75) R and BACdelSp1 (-75) to delete both Sp1 (-55) and Sp1 (-75) GC boxes, or one of them ) F, BACdelSp1 (-55) R and BACdelSp1 (-75) F primer pairs were used, respectively. Control recombinant viruses with FRT sequences (wt + FRT1 and wt + FRT2) are BAC Control (−75) F and BACdelSp1 (−75) R, or BACdelSp1 (−75) F and BAC Control (−75) R. It was constructed using a primer pair. The primer sequences are shown below.

BACdelSp1 (-55) F:
5'-GAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCGATTTATTCAAC -3 '(SEQ ID NO: 17)
BACdelSp1 (-55) R:
5'-ACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGCCAGTGTTACAACCA-3 '(SEQ ID NO: 18)
BACdelSp1 (-75) F:
5'-ACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAAGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCGATTTATTCAAC-3 '(SEQ ID NO: 19)
BACdelSp1 (-75) R:
5'-GACGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAAGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGCCAGTGTTACAACCA-3 '(SEQ ID NO: 20)
BACcontrol (-75) F:
5'-TTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAACTCAGCAAAAGTTCGATTTATTCAAC-3 '(SEQ ID NO: 21)
BACcontrol (-75) R:
5'-CTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAACGGGGCGGGGGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCTAATGCTCTGCCAGTGTTACAACCA-3 '(SEQ ID NO: 22)

  PCR amplification includes 94 ° C for 2 minutes, 1 cycle of denaturation, 94 ° C for 15 seconds, 55 ° C for 30 seconds, 72 ° C for 5 minutes for 40 cycles, 72 ° C for 7 minutes or 94 ° C for 2 minutes for 1 cycle, 94 ° C for 2 minutes, 55 ° C C. for 2 minutes, 72.degree. C. for 2 minutes for 30 cycles, and 72.degree.

  The PCR product was treated with Dpn I at 37 ° C. for 1.5 hours to remove the remaining template DNA, extracted with phenol chloroform, and precipitated with 95% ethanol. About 100 ng of each DNA fragment was introduced into competent E. coli DY380 containing HCMV Towne-BAC DNA by electroporation. Bacteriophage-encoded recombinant protein for homologous recombination was induced by treatment at 42 ° C. for 15 minutes.

(8) Removal of kanamycin resistance gene In order to remove the kanamycin resistance gene, recombinant HCMV BAC DNA was transformed into E. coli DH10B. pCP20 (donated by Max von Pettenkofer Institute, G. Hahn, 21) was transformed into DH10B containing recombinant HCMV BAC-DNA, and kanamycin-free HCMV BAC DNA was converted to ampicillin and chloramphenicol. Selected on LB plates containing

(9) Identification of recombinant virus
In the presence of 1 mg of pSVpp71, 5 mg or 10 mg of each recombinant BAC DNA was transfected into HFF cells by the calcium phosphate precipitation method. Viral plaques appeared after 5-20 days. Five to seven days after the cytopathic effect (CPE) reached 100%, the extracellular fluid containing the free virus was stored in 50% fetal bovine serum at 80 ° C. The stock virus was undiluted or diluted 1:10 and used to infect HFF cells.

(10) PCR analysis
PCR analysis was performed at 94 ° C for 2 minutes with 1 cycle of denaturation, 94 ° C for 15 seconds, 55 ° C for 30 seconds, 72 ° C for 1 minute, 30 seconds for 30 cycles, and 72 ° C for 7 minutes for 1 cycle. did.
HCMVF: 5'-CCCGGTGTCTTCTATGGAGGT-3 '(SEQ ID NO: 23)
HCMVUL127R: 5'-GGTTATATAGCATAAATCAATATTGGCTATTGG-3 '(SEQ ID NO: 24)
The PCR product was confirmed by sequencing after cloning into the TA cloning vector.

(11) Southern blot analysis Recombinant BAC DNA was purified with NucleoBond kit (Macherey-Nagel Duren), digested with restriction endonucleases BlpI and XhoI, subjected to 1.0% agarose gel electrophoresis, and Southern blot analysis was performed according to the standard method. It was. The DNA fragment of pKS 583 / + 78 (EagI-SpeI) (see FIG. 4) was labeled using a megaprime DNA labeling system (Amersham Pharmacia Biotech) and ³² P-dCTP (Amersham Pharmacia Biotech).

(12) Northern blot analysis Cytoplasmic RNA was purified from mock-infected or HCMV-infected HFF cells according to a conventional method, 20 mg of which was subjected to electrophoresis using a 1% agarose gel containing 2.2 M formaldehyde, and the highest strength Hybond N + (Amersham ) And Northern blot analysis was performed.

IE1 DNA was amplified by PCR using primers (ex4F: 5′-AAGCGGGAGATGTGGATGGC-3 ′ (SEQ ID NO: 25) and ex4R: 5′-GGGATAGTCGCGGGTACAGG-3 ′ (SEQ ID NO: 26)), and TA cloning vector (Invitrogen) And then labeled with ³² P-dCTP to prepare an IE1 DNA probe.

(13) Real-time PCR and RT-PCR analysis In order to detect low concentrations of MIE RNA, total cell RNA was purified using TRI reagent (Invitrogen) according to the manufacturer's instructions. Synthesize first strand cDNA from 2 mg RNA and 250 ng oligo dT primer (Roche) using reverse transcriptase (RT) Transciptor (Roche Applied Science) as per manufacturer's instructions, final volume 20 μl Adjusted. The sample was inactivated by treatment at 70 ° C. for 15 minutes. For viral DNA detection, cells in 60 mm plates were harvested 3 times in PCR lysis buffer containing 50 mg / ml proteinase K as described above 4 hours after infection. Amplification was performed in a final volume of 25 μl containing quantitative PCR SUPERMIX-UDG Cocktail “PLATINUM” (Invitrogen). Each reaction mixture contains 2 mg of first-strand cDNA or DNA, 5 mM MgCl ₂ , 500 nM MIE primer or gB primer, 250 nM MIE probe or gB probe. The MIE primer and MIE reporter probe were degraded according to a conventional method. HCMV gB primer and gB reporter probe were commissioned to PE Applied Biosystems.

HCMV gB primer:
Forward: 5'-GGCGAGGACAACGAAATCC-3 '(SEQ ID NO: 27)
Reverse: 5'-TGAGGCTGGGAAGCTGACAT-3 '(SEQ ID NO: 28)
HCMV gB reporter probe: 5'-FAM-TTGGGCAACCACCGCACTGAGG-TAMRA-3 '(SEQ ID NO: 29)
MIE primer:
Forward: 5'-GCATTGGAACGCGGATTC-3 '(SEQ ID NO: 30)
Reverse: 5'-CAGGATTATCAGGGTCCATC-3 '(SEQ ID NO: 31)
MIE reporter probe: 5'-AGTGACTCACCGTCCTTGACACGATGG-3 '(SEQ ID NO: 32)
PCR conditions were 50 ° C for 2 minutes and 95 ° C for 2 minutes, followed by 40 cycles of 95 ° C for 15 seconds and 60 ° C for 1 minute. Quantification of relative MIE RNA and gB DNA amounts was performed by standard curve analysis.

(14) Viral DNA replication analysis Cells were collected after a certain period of time after infection with an equal amount of viral DNA. Cells in 35 mm plates were suspended in lysis buffer containing 50 mg / ml proteinase K (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% SDS and 20 mg / ml RNase A). (Implemented 3 times). After incubation at 55 ° C. for 10 minutes and further at 95 ° C. for 10 minutes, the DNA was extracted with phenol chloroform and precipitated with ethanol. After cell lysis, Lambda DNA (2 mg) was added to each sample before proteolysis and phenol chloroform extraction. The viral genome was treated with Hind III, separated on a 0.6% agarose gel, and subjected to Southern blot analysis. According to previous reports, the 1.6-kbp BamHI-Hind III fragment (T probe) in plasmid p1.6 was used to examine the HCMV genome ends including terminal repeat long (TRL) and inverted repeat long (IRL) (Meier, JL, and JA Pruessner, (2000) J. Virol. 74: p1602-1613).

2. Results (1) Binding of proximal enhancers of Sp1 and Sp3 transcription factors to the GC box Previously, the inventor reported that minimal sequence is required upstream of the HCMV promoter for viral replication (Isomura, H., T. Tsurumi, and MF Stinski, (2004) J. Virol. 78: p12788-12799). That is, HCMV (39 + F) with a TATA box and no enhancer does not replicate in cell culture, but has a recombinant virus (67+ with a GC box located 57-52 from the promoter and transcription start position (+1). F) Duplicate. The upstream region from 78 to 70 contained one GC box, and the region from 116 to 67 increased the amount of MIE transcription from the MIE promoter.

  To determine whether Sp1 (-55) and Sp1 (-75) bind to Sp1 and Sp3, EMSA was performed. The results are shown in FIG. 1A. FIG. 1A (lane 1) shows the result of EMSA using the Sp1 (−75) probe, and complexes X and Y were detected. Both complexes were shown to be specific for these probes in experiments using an excess of the non-radioactive competitor Sp1 (-75) (data not shown). When rabbit polyclonal IgG specific for Sp1 was used, most of complex X was shifted upward, but complex Y had little effect. Control IgG also had no effect (FIG. 1A lanes 3 and 4). Antibodies to Sp3 shifted all of complex Y upward (FIG. 1A lanes 5-7). When Sp1 and Sp3 antibodies were mixed and used, both complexes X and Y shifted upward (FIG. 1A lane 8). The same EMSA upshift result was obtained when the Sp1 (-55) probe was used (data not shown). From the above data, it was confirmed that both Sp1 and Sp3 transcription factors can bind to the GC box present at about -75 and -55 of the HCMV MIE proximal enhancer.

  Next, the influence of HCMV infection on the expression level of Sp1 and Sp3 was also examined. HFF cells were infected with wild type virus at MOI = 3 and harvested at 3, 6, 12, 24 and 48 hours after infection. Equal amounts of protein were analyzed by SDS-PAGE and Western blot. The results are shown in FIG. 1B. The expression level of Sp3 isoform from the alternative translation start position (-55) was constant throughout the infection (FIG. 1B). In contrast, the amount of Sp1 increased with time after infection (FIG. 1B). These results suggest that Sp3 binds to the proximal enhancer immediately after infection, and that the amount of Sp1 binding increases with time after infection.

(2) Effects of Sp1 (-55) and Sp1 (-75) on MIE transcription
The effect of Sp1 (−55) and Sp1 (−75) on transcription from the MIE promoter was examined by transient transfection using the CAT gene construct as shown in FIG. 2A. CAT activity was measured as a ratio to pCAT TATA with only the MIE promoter TATA box. The CAT activity of pCAT TATA + Sp1 (-55) increased 2.8 times (FIGS. 2B and C). In addition, pCAT TATA + mutSp1 (-55) + Sp1 (-75) having a mutant Sp1 site at -55 showed 13.9-fold CAT activity (FIGS. 2B and C). From the above, it was confirmed that the two Sp1 / Sp3 binding sites located on the MIE proximal enhancer of HCMV both increase the amount of MIE transcription by transient transfection.

(3) Binding Affinity at Sp1 / Sp3 Binding Site To determine the relative binding affinity of Sp1 and Sp3 to each Sp1 / Sp3 binding site, EMSA using various competitor DNAs was performed. FIG. 3A shows the DNA sequences of ³² P-labeled probe and competitor DNA having a Sp1 / Sp3 binding site and its mutation site. Complexes X and Y were formed using probes with binding sites at both -55 and -75. By adding an excess of non-radioactive competitor DNA containing both -55 and -75 sites, both complexes were reduced (Fig. 3B lanes 2 and 3). Competitor DNA having a mutation at any Sp1 / Sp3 binding site could not compete with DNA complexes X and Y even when added in a 200-fold molar amount (Figure 3B lanes 6 and 9). .

  In order to estimate the affinity of transcription factors for each Sp1 / Sp3 binding site in a sequence with both binding sites, a nuclear extract and probe were used with a certain excess of non-radioactive competitor DNA containing each Sp1 / Sp3 binding site. Incubated with and compared the reduction rate of detected complexes between -55 and -75 competitor DNA. As shown in FIG. 3B (compare lanes 4 and 5 with lanes 7 and 8), competition for in vitro DNA binding with Sp1 (−75) was stronger than with Sp1 (−55).

  To confirm that the binding affinity of Sp1 / Sp3 to the -55 and -75 sites was different, a quantitative competition assay was performed. As shown in FIGS. 3C and 3D, when Sp1 (−75) non-radioactive competitor DNA in a 33-fold molar amount was used, Complex X was reduced by 70%. On the other hand, Sp1 (-55) required a 132-fold molar amount of non-radioactive competitor DNA. In vitro binding of nuclear factor to Sp1 (-75) was about 4 times stronger than binding to Sp1 (-55).

(4) Isolation of recombinant HCMV with mutated GC box
HCMV enhancers have multiple transcription factor binding sites, but it is unclear which site functions most effectively in HFF cells. To elucidate the role of the two Sp1 / Sp3 binding sites in the MIE enhancer, we constructed recombinant BAC DNA with mutations in either or both proximal Sp1 / Sp3 binding sites. . Since it was necessary to introduce a drug resistance gene as a marker for selecting recombinant BAC DNA from the original BAC DNA, a recombinant BAC DNA containing a kanamycin resistance gene (KanR) was first designed.

  KanR was removed using FLP recombinase. To rule out the effect of the remaining FRT sites in the recombinant BAC DNA, two recombinant viruses with FRT sites between the two Sp1 / Sp3 binding sites and immediately upstream of -75 were constructed as controls. All recombinant BAC DNA was digested with restriction endonucleases BlpI and XhoI. Viral DNA fragments were fractionated by electrophoresis and Southern blot hybridization was performed. Since KanR and UL127 regions each have an XhoI site, recombinant BAC DNA with KanR was detected as two DNA fragments on the Southern blot (FIG. 4B). After removing KanR, it was difficult to distinguish the size of the DNA fragment degraded by BlpI and XhoI from the original BAC DNA. Therefore, the sequence of the PCR product was determined using UL127R and HCMVF primers. As shown in FIG. 4C, the recombinant virus contained a DNA fragment of the size predicted from FIG. 4A. By amplifying this DNA fragment and determining the sequence, it was confirmed that mutation, recombination and removal were performed correctly.

(5) Effect of mutations in the Sp1 / Sp3 binding site on MIE transcription in infected cells
In order to clarify the role of the two Sp1 / Sp3 binding sites for the MIE promoter in HCMV infection, Northern blot analysis was performed to compare the amount of transcription of the IE1 gene. Viral DNA uptake for various recombinant viruses was determined by quantitative real-time PCR assay 4 hours after infection. Infections were performed at a viral DNA uptake equivalent to about 0.5 MOI of wild type (wt), and RNA was collected 24 hours after infection and subjected to agarose gel electrophoresis. 28S and 18S ribosomal RNAs were stained with ethidium bromide to confirm that equal amounts of RNA were loaded in each lane (FIG. 5A). No significant difference was detected in the steady-state IE1 RNA transcript between the wild-type and the recombinant virus in which either Sp1 (-55) or Sp1 (-75) was mutated. On the other hand, the amount of IE1 RNA was greatly reduced in the recombinant virus in which both Sp1 / Sp3 binding sites were mutated (FIG. 5A, lane 3).

  Wild-type virus or recombinant virus with both Sp1 / Sp3 mutations is used to infect at MOI = 3, and real-time RT-PCR assays are performed at various time points to quantify steady-state IE1 and IE2 RNA levels did. Wild-type IE RNA levels were maximal 12 hours after infection and then declined. In the case of the recombinant virus RdlSp1 (−55, −75) + F, the amount of virus IE RNA decreased to 1/10 or less from 3 hours to 24 hours after infection. These data indicate that at high MOI, both the -75 and -55 GC boxes control MIE transcription, and if there is no GC box site, MIE transcription is very inefficient.

(6) Effect of Sp1 / Sp3 binding site mutation on viral DNA replication In order to investigate the effect of two Sp1 / Sp3 binding sites on viral DNA replication, HFF cells were infected with wild type or recombinant virus. MOI was set to 3 or 0.01. Moreover, it was confirmed by the real-time PCR method using a gB primer that the amount of virus was taken up similarly. DNA was purified from an equal number of infected cells, and viral DNA was quantified by Southern blot hybridization using the HCMV genome ends as a probe. λDNA was used as a load control DNA. In the case of high MOI (MOI = 3), the DNA replication of the recombinant virus lacking any Sp1 / Sp3 site was almost equivalent to that of the wild type 3 days after infection. In contrast, the recombinant virus Rdl (-55, -75) + F, which lacks both Sp1 / Sp3 sites, had a third replication (FIG. 6A). At low MOI, DNA replication in recombinant viruses Rdl-55 + F and Rdl-75 + F lacking Sp (−55) or Sp (−75) was not significantly different from the wild type. In contrast, DNA replication of Rdl (-55, -75) + F was about 46 times after 8 days of infection and about 1/12 after 13 days. The above data indicate that the presence of either Sp1 / Sp3 site is essential for viral DNA replication in HFF cells.

(7) Effect of Sp1 / Sp3 binding site mutation on virus plaque size To examine the effect of Sp1 / Sp3 binding site on infectious virus replication and plaque size, the plaque sizes of wild type and recombinant virus were measured. All plaques were generated by MOI = 0.01, inoculated with wild type or recombinant virus and overlayed with agar for 3 days after infection. Plaque size was measured on days 7, 10, and 14 after infection. Mutating Sp1 (-55) or Sp1 (-75) did not change the plaque size, but if both Sp1 / Sp3 binding sites were mutated, the plaque size at 10 and 14 days after infection was approximately One third (Fig. 7).

  From the above, it was confirmed that transcription of the MIE gene and viral replication can be remarkably suppressed by adding mutations to the Sp1 / Sp3 binding site of HCMV.

  According to the present invention, it was confirmed that the replication ability of a virus can be lost by adding mutations to all Sp1 / Sp3 binding sites present in the MIE gene enhancer region of human cytomegalovirus. Recombinant viruses lacking the ability to self-replicate can be used to produce vaccines for the treatment of HCMV infection. Furthermore, it is possible to search for new anti-HCMV drugs targeting the action of transcription factors on the Sp1 / Sp3 binding site.

FIG. 1 shows the results of confirming the binding of transcription factors Sp1 and Sp3 to the GC box. (A) EMSA using ³² P-labeled Sp1 (-75) as a probe (lane 1: probe + nuclear extract, lane 2: probe + nuclear extract + 10 mg rabbit control IgG, lane 3, 4: probe + nuclear extraction Product + 2 or 4 mg anti-Sp1 antibody, lanes 5, 6, 7: probe + nuclear extract + 2 or 4 or 10 mg anti-Sp3 antibody, lane 8: probe + nuclear extract + 2 mg anti-Sp1 + anti-Sp3 antibody) . Similar results were obtained when ³² P-labeled Sp1 (-55) was used as a probe. (B) Western blot analysis of Sp1 and Sp3 transcription factors after HCMV infection (Sp1 ^* : phosphorylated, Sp3li-1 and -2: Sp3 long isoform, Sp3si-3 and 4: Sp3 short isoform, lane (1) Mock infection, Lane 2: 3 hours after infection, Lane 3: 6 hours after infection, Lane 4: 12 hours after infection, Lane 5: 24 hours after infection, Lane 6: 48 hours after infection) FIG. 2 shows the correlation between Sp1 / Sp3 binding site and MIE promoter activity. (A) Structure of CAT gene construct (B) CAT assay (numbers represent conversion rate from non-acetylated chloramphenicol to acetylated form) (C) CAT activity compared to pCAT TATA (data are 3 times each) □ pCAT TATA, ■ PCAT TATA + Sp1 (-55), □ pCAT TATA + Sp1 (-55) + Sp1 (-75), □ pCAT TATA + mutSp1 (-55) + Sp1 (-75) )) FIG. 3 shows the binding activity of the transcription factor Sp1 / Sp3 to Sp1 (−75) and Sp1 (−55). (A) ³² P-labeled probe DNA sequence with both Sp1 (-55) and Sp1 (-75), and Sp1 (-55, -75), Sp1 (-55), mutSp1 (-55), Sp1 ( -75) or DNA sequence of competitor dsDNA having mutSp1 (-75). (B) Autoradiogram of competing EMSA (lane 1: probe + nuclear extract, lanes 2 and 3: probe + nuclear extract + 50 or 200-fold molar amount of Sp1 (-55, -75), lanes 4, 5 : Probe + nuclear extract + 50 or 200-fold molar amount of non-radioactive Sp1 (-55) DNA, lane 6: probe + nuclear extract + 200-fold molar amount of non-radioactive mutant Sp1 (-55) DNA, lane 7, 8: probe + nuclear extract + 50 or 200-fold molar amount of non-radioactive Sp1 (-75) DNA, lane 9: probe + nuclear extract + 200-fold molar amount of non-radioactive mutant Sp1 (-75) DNA) (C ) Autoradiogram of competing EMSA (lane 1: no competitor DNA, lanes 2, 8, 14: 33-fold molar amount of competitor DNA, lanes 3, 9, 15: 66-fold molar amount of competitor DNA, lane 4, 10,16: 99 times the molar amount of competitor DNA, lanes 5,11,17: 132 times the molar amount of competitor DNA, lanes 6,12,18: 165 times the molar amount of competitor DNA, lanes 7,13, 19 The molar amount of competitor DNA are 198 times) (D) Sp1 (-55) and / or binding affinity to Sp1 (-75) (ratio of binding in the absence of competitor DNA). FIG. 4 shows the structural analysis results of recombinant HCMV BAC-DNA. (A) Schematic diagram of Original BAC-DNA and recombinant BAC-DNA (B) Southern blot analysis (lane 1: wt, lane 2: dl-55 + F + K, lane 3: dl-55 + F, lane 4: dl-75 + F + K, lane 5: dl-75 + F, lane 6: dl (-55, -75) + F + K, lane 7: dl (-55, -75) + F, lane 8: wt + F + K 1, Lane 9: wt + F + K 2, Lane 10: wt + F 1, Lane 11: wt + F 2) (C) PCR analysis of Original BAC DNA and recombinant BAC DNA (lane 1) : Wt, lane 2: dl-55 + F + K, lane 3: dl-55 + F, lane 4: dl-75 + F + K, lane 5: dl-75 + F, lane 6: dl (-55 , -75) + F + K, lane 7: dl (-55, -75) + F, lane 8: wt + F + K 1, lane 9: wt + F 1, lane 10: wt + F + K 2 , Lane 11: wt + F 2) FIG. 5 relates to transcription of the viral MIE gene using wild type and recombinant viruses. (A) Northern blot analysis (lane 1: wt, lane 2: dl-55 + F, lane 3: dl (-55, -75) + F, lane 4: dl-75 + F) (B) real-time PCR ( (Figures are ratios to wild-type transcripts 24 hours after infection, data are average values of three independent experiments) The effect of the deletion of two Sp1 / Sp3 binding sites on viral DNA replication is shown. (A) Southern blot analysis of HFF cell DNA infected with wild-type or dl-55 + F, dl-75 + F or dl (-55, -75) + F recombinant virus (arrows indicate viral DNA) The fusion ends of 17.2 and 13.0 kbp, the free end of 9.7 kbp and the control internal lambda DNA are shown: Lane 1: wt, Lane 2: dl-55 + F, Lane 3: dl (-55, -75) + F, lane 4: dl-75 + F) (B) HFF cells were wild type, or wt + F1, wt + F2, dl-55 + F, dl-75 + F or dl (-55, -75 ) Southern blot analysis of DNA purified from HFF cells infected with + F recombinant virus (lanes 1, 7, 13: wt, lanes 2, 8, 14: dl-55 + F, lanes 3, 9, 15) : Dl (-55, -75) + F, lanes 4, 10, 16: dl-75 + F, lanes 5, 11, 17: wt + F 1, lanes 6, 12, 18: wt + F 2. Lanes (1 to 6 are 5 days after infection, lanes 7 to 12 are 8 days after infection, and lanes 13 to 18 are 13 days after infection) FIG. 7 shows plaque formation after infection with a recombinant virus in which the Sp1 / Sp3 binding site is homo-deficient. Each plaque size was determined as an average of the minimum and longest lengths at a fixed time after infection. The result is the average of 10 plaques.

SEQ ID NO: 1-Description of Artificial Sequence: Primer (NheITATAF)
SEQ ID NO: 2 Description of Artificial Sequence: Primer (NheISpI (-55) F)
SEQ ID NO: 3 Description of Artificial Sequence: Primer (NheISpI (-75) F)
SEQ ID NO: 4-Description of Artificial Sequence: Primer (NheImutSpI (-55) F)
SEQ ID NO: 5-Description of Artificial Sequence: Primer (Bg1IISpIR)
SEQ ID NO: 6-description of artificial sequence: probe for Sp1 (-55) and Sp1 (-75) SEQ ID NO: 7-description of artificial sequence: competitor DNA for Sp1 (-55) and Sp1 (-75)
SEQ ID NO: 8-description of artificial sequence: probe for Sp1 (-55) SEQ ID NO: 9-description of artificial sequence: competitor DNA for Sp1 (-55)
SEQ ID NO: 10-description of artificial sequence: probe for mutSp1 (-55) SEQ ID NO: 11-description of artificial sequence: competitor DNA for DNA for mutSp1 (-55)
SEQ ID NO: 12-description of artificial sequence: probe for Sp1 (-75) SEQ ID NO: 13-description of artificial sequence: competitor DNA for Sp1 (-75)
SEQ ID NO: 14—Description of artificial sequence: probe for mutSp1 (−75)
SEQ ID NO: 15—Description of artificial sequence: competitor DNA for mutSp1 (−75)
SEQ ID NO: 16—Description of artificial sequence: FLP recognition sequence SEQ ID NO: 17—Description of artificial sequence: primer (BACdelSp1 (−55) F)
SEQ ID NO: 18—Description of Artificial Sequence: Primer (BACdelSp1 (−55) R)
SEQ ID NO: 19—Description of Artificial Sequence: Primer (BACdelSp1 (−75) F)
SEQ ID NO: 20—Description of artificial sequence: primer (BACdelSp1 (−75) R)
SEQ ID NO: 21—Description of Artificial Sequence: Primer (BACcontrol (−75) F)
SEQ ID NO: 22—Description of artificial sequence: primer (BACcontrol (−75) R)
SEQ ID NO: 23—Description of Artificial Sequence: Primer (HCMVF)
SEQ ID NO: 24—Description of Artificial Sequence: Primer (HCMVUL127R)
SEQ ID NO: 25—Description of Artificial Sequence: Primer (ex4F)
SEQ ID NO: 26—Description of Artificial Sequence: Primer (ex4R)
SEQ ID NO: 27—Description of Artificial Sequence: HCMV gB Primer (Forward)
SEQ ID NO: 28--Description of Artificial Sequence: HCMV gB Primer (Reverse)
SEQ ID NO: 29—Description of artificial sequence: HCMV gB reporter probe SEQ ID NO: 30—Description of artificial sequence: MIE primer (Forward)
SEQ ID NO: 31--Description of Artificial Sequence: MIE Primer (Reverse)
SEQ ID NO: 32—Description of Artificial Sequence: MIE Reporter Probe

Claims (11)

Recombinant human cytomegalovirus, characterized by site-specific mutation of two GC boxes present in the MIE gene enhancer region , wherein the two GC boxes + When said 1, said recombinant human cytomegalovirus, which is a GC box located at -57 to -52 and -78 to -70 :
However, when the transcription start position of the MIE gene is +1, viruses excluding the entire region from -636 to -67 are excluded.   The recombinant human cytomegalovirus according to claim 1, wherein the mutation is a mutation that inhibits binding of Sp1 and Sp3 transcription factors to the GC box.   The recombinant human cytomegalovirus according to claim 1 or 2, wherein the mutation is caused by deletion or substitution of a part or all of the sequence in the GC box, or addition of another sequence.   The recombinant human cytomegalovirus according to any one of claims 1 to 3, wherein the self-replicating ability is 1/100 or less as compared with the wild type. Recombinant human cytomegalovirus genomic DNA characterized by site-specific mutation of two GC boxes present in the MIE gene enhancer region , wherein the two GC boxes are transcription start positions of the MIE gene Wherein the recombinant human cytomegalovirus genomic DNA is a GC box located from -57 to -52 and -78 to -70,
However, when the transcription start position of the MIE gene is +1, DNA from which the entire region from -636 to -67 is deleted is excluded.   A vector comprising the recombinant human cytomegalovirus genomic DNA according to claim 5.   A host cell transformed with the vector of claim 6.   The host cell according to claim 7, wherein the host cell is a human fibroblast, a glioma cell or a human fetal fibroblast. Transforming host cells with a vector containing human cytomegalovirus genomic DNA in which two GC boxes located in the MIE gene enhancer region are site-specifically mutated, and recovering virus particles from the culture supernatant of each cell A method for producing a recombinant human cytomegalovirus, characterized in that the two GC boxes are located at -57 to -52 and -78 to -70 when the transcription start position of the MIE gene is +1. The GC box is a method that :
However, when the transcription start position of the MIE gene is +1, a method for producing a virus in which the entire region from -636 to -67 is deleted is excluded.   A vaccine for HCMV infection comprising the recombinant human cytomegalovirus according to any one of claims 1 to 4 or a part thereof. A method for reducing the replication efficiency of human cytomegalovirus by inhibiting the binding of Sp1 or Sp3 transcription factor to two GC boxes present in the MIE gene enhancer region in human cytomegalovirus genomic DNA , The above-mentioned method, wherein the two GC boxes are GC boxes located at −57 to −52 and −78 to −70, where the transcription start position of the MIE gene is +1 .

Images