JP4416495B2 - Probe set and identification method for identifying HLA-C allele - Google Patents

Description

  The present invention relates to a probe set and identification method for identifying a human HLA-C allele.

  Serological typing has been performed for human leukocyte HLA-C alleles. In this case, no special sample processing is required, and it is possible to easily type by antigen-antibody reaction. However, the content that can be identified is a level at which the difference in amino acid sequence can be distinguished by 3 or more in the nomenclature with 4 or more digits. In the case of the fourth digit, the first two digits are levels that can be identified by typing at the serological level (Japanese Society for Histological Compatibility HLA Standardization Committee “Allyl Notation and Principles of Result Reporting 2000” http : //jshi.umin.ac.jp/standarization/hyoki.html).

Most of the other types of commercially available kits that involve genome extraction are not accurate enough to identify each allele individually, but are currently distinguished as a set of multiple alleles. Even with kits based on the SBT (Sequencing Based Typing) method, which enables the most detailed polymorphism analysis, most samples are heterozygotes, so the problem of ambiguity cannot be solved at once, and re-examination is necessary. And often. Alleles with these problems are summarized in IHWG Society's http://www.ihwg.org/protocols/sbt/ambiguities2.pdf.
(Japan Society for Histological Compatibility HLA Standardization Committee “Allyl Notation and Result Reporting Principles 2000” (http://jshi.umin.ac.jp/standarization/hyoki.html site) http://www.ihwg.org/protocols/sbt/ambiguities2.pdf

  On the other hand, in recent years, with the advancement of advanced medical care, detailed typing is required for organ transplantation, etc., and in diabetes, cancer, and other multifactorial diseases, it is suggested that there is an association with drug administration, and there is evidence for medical practices. Is required. From such a background, a test method capable of individually identifying each allele is desired, and the present invention responds to such a demand by using a probe set useful for identifying each allele of HLA-C individually and using the probe set. It is an object of the present invention to provide a method for identifying alleles of HLA-C.

The probe set for identifying an HLA-C type allele according to the present invention includes a probe group or a sequence including all probes having the respective base sequences represented by SEQ ID NOs: 126 to 238 in the specification or a part thereof. Consisting of a probe group including all probes having each base sequence represented by numbers 239 to 339 or a part thereof,
Each probe of the two probe groups is selected from the HLA-C type allyl list consisting of the base sequences represented by SEQ ID NOs: 1-125 in the specification as long as the bases written in capital letters are not lost. This probe set is composed of 15 to 30 bases of selected bases and can be used for identifying HLA-C type alleles contained in a specimen .

  The HLA-C allele identification method according to the present invention is a method for identifying an HLA-C type allele contained in a sample from a specimen using a probe set, wherein the probe set has the above-described configuration. It is a method for identifying an HLA-C type allele characterized by being a probe set.

  By identifying the probe set according to the present invention and the HLA-C allele using the probe set, it is possible to contribute to constitution determination and tailor-made medicine required in organ transplantation, cancer, diabetes, and other multifactorial diseases.

Each probe constituting the probe set of the present invention has a partial sequence including a base in capital letters in each allele of the allele list described later. A probe set is constructed using a probe consisting of a partial base sequence obtained by selecting a portion consisting of 15 to 30 consecutive bases including upper case bases . As a specific example, a probe set can be configured from each probe group listed in the probe lists 1 and 2 in Tables 1 and 2 described later. For example, the probe number 0 in the probe list 1 is composed of an 18 base sequence of the portion “acgcatagaccaacaggG” including the first capital letter (G) of Cw * 0102, and the probe number 0 in the probe list 2 is also It consists of an 18 base sequence of the part “g tgg atg tGt ggc tgc g” including the first capital letter G of the same allyl.

  In addition, the number indicated by “Cw *” in the allyl list described later is a unique number assigned to each allyl and is in accordance with “Allyl Notation” by the HLA Standardization Committee of the Japanese Society for Histological Compatibility. It is.

In the allyl identification method according to the present invention, for example, two methods are possible for detection of allyl by a probe. One is the case of detection by the hybridization method, and the other is the case of detection by the PCR method directly without hybridization. In either case, the probe is designed to include the capitalized base in 15-30 contiguous oligonucleotides containing the capitalized base.

In addition, it can be said that the probe array provided in the present invention presents a set of mutant bases for individually identifying each allele at a position to be selected as a probe. As a method for detecting this mutated base, a detection method by a hybridization method and a method for direct detection without hybridization by a PCR method can be suitably used. In these cases as well, probes are designed to include capitalized bases in 15-30 consecutive oligonucleotides containing capitalized bases.

  When detecting a mutation by hybridization, it is easier to design a probe so that the mismatch is located near the center of the probe (ie, the mutated base shown in capital letters), and the Tm is more likely to differ between the full match and mismatch sequences. It is easy to separate the two by adjusting the reaction temperature of the hybridization.

  On the other hand, when a mutation is directly detected by the PCR method, a mismatch is placed on the 3 'end side rather than the enzyme recognizing the annealed duplex and not extending. Also, like Allel Spcific Primer, a mismatch is placed second from the 3 'end, and a mismatch is artificially added to the third (Toyobo Co., Ltd.), or a mismatch is placed on the 3' end. There are several variations such as ligation to cyclize the probe (Amersham Biosciences), TaqMan-MGB method (ABI) 3 'end mismatch using LNA (Proligo Japan) Is possible.

  For example, the first capital letter part of Cw * 0103 is “gggtatAaccagt”, and the corresponding part of Cw * 0102 of the same serotype is “gggtatgaccagA”, and these parts are 2 bases. Mutation has occurred. If a probe consisting of one of these parts is used, it can be distinguished from the other by mismatch.

Example 1
DNA was extracted from 1ml of human blood using Amersham Bioscience's GFX Genomic Blood DNA Purification Kit. The protocol is shown below.
1ml blood
↓ ＋ RBC Lysis Solution
↓ + blood sample (mix gently)
↓ Room temperature, 5 minutes ↓ Centrifuge at 12,000-16,000 xg for 20 seconds ↓ Discard the supernatant leaving 20-50 μl ↓ Resuspend the precipitate ↓ + Extraction Solution (violently vortex)
↓ 5 minutes at room temperature (DNA extraction)
↓ Set GFX Column in Collection Tube ↓ Warm elution buffer to 70 ℃ ↓ + Sample ↓ Centrifuge at 5,000 × g for 1 minute (DNA binding)
↓ + Extraction Solution (cleaning)
↓ 5,000 xg, 1 minute centrifugation ↓ + Wash Solution (washing)
↓ Centrifuge at 12,000 xg for 3 minutes ↓ Set GFX Column in centrifuge tube ↓ Elution with pure water ↓ Room temperature for 1 minute ↓ Centrifuge at 5,000 to 8,000 xg for 1 minute
Concentration adjustment to 230 μl ……… Solution (1)
Next, quantitative PCR was performed using Qiagen QuantiTect SYBR Green PCR Kit and ABI GeneAmp5700. The reaction composition and protocol are shown below.
1) Reaction composition / well (96-well microplate)
QuantiTect SYBR Green 2 × Premix: 10 μl
Solution (1): 1 μl
Each probe in Tables 1-1 to 1-4: 1 μl
Mix primer (10 pmol / μl) Note): 4 μl
Ultrapure water: 4μl
(Total: 20 μl)
Note) 1 μl each of 10 pmol / μl aqueous solution with the following sequence
AAACACGGTCACCTCAGGGGGAT (SEQ ID NO: 340)
GGCCTGAGTGTGGTTGGAACG (SEQ ID NO: 341)
CCAGCTCGTAGTTGTGTCTGCA (SEQ ID NO: 342)
2) PCR program
After 94 ° C .: 180 sec, 30 cycles (94 ° C .: 10 sec + 66 ° C .: 10 sec + 72 ° C .: 20 sec) were performed.

  With reference to the Amp Plot and Dissociation curves on Table 53-1, Tables 3-1 to 3-4 to 2-2, it was identified as Cw * 120202.

Example 2
DNA extraction from 1 ml of human blood was performed in the same manner as in Example 1. Next, PCR of human HLA-C was performed using Ex Taq of Takara Bio Inc. and a PCR device 9700 of ABI. The reaction composition and protocol are shown below.
1) Reaction composition / tube
Ex Taq 2 × Premix: 20μl
Solution (1): 3 μl
Cy-3 dUTP (1mM): 2μl
Mix primer (10 pmol / μl) Note): 7 μl
Ultrapure water: 8μl
(Total: 40 μl)
Note) 1 μl each of 10 pmol / μl aqueous solution with the following sequence
AAACACGGTCACCTCAGGGGGAT (SEQ ID NO: 340)
GGCCTGAGTGTGGTTGGAACG (SEQ ID NO: 341)
CCAGCTCGTAGTTGTGTCTGCA (SEQ ID NO: 342)
CCATGTGTCAACTTATGCC (SEQ ID NO: 343)
AGAATTACCTTTTCCAG (SEQ ID NO: 344)
AGAATTACGTTTTCCAG (SEQ ID NO: 345)
2) PCR program
94 ° C .: After 180 sec, 30 cycles of (94 ° C .: 10 sec + 66 ° C .: 10 sec + 72 ° C. 20 sec) were performed.

  After completion of the reaction, clean-up of unreacted dNTPs and the like was performed using a purification column (QIAGEN QIAquick PCR Purification Kit).

  On the other hand, a DNA microarray for identifying the allele was prepared for the above-described specimen. The manufacturing method was in accordance with the example of JP-A-11-187900. The functional group for solid-phase formation was an SH group, and a silane coupling treatment was performed on a glass substrate and crosslinked with the SH group via a bivalent reagent EMCS (N- (6-Maleimidocaproyloxy) succinimide). Each probe of each dot was individually used in Tables 2-1 to 2-4.

Next, hybridization was performed using the sample and the prepared DNA microarray. The DNA microarray was previously blocked with PBS containing 1 wt% BSA (bovine serum albumin) for 2 hours. The sample was adjusted so that its salt concentration was equal to PBS and 0.1 wt% SDS (sodium dodecyl sulfate) and 25% Form amide, and 50 μl of the sample was mixed with the previously blocked DNA microarray at 60 ° C. The reaction was allowed to proceed for a period of time, and the unreacted material was washed 3 times with 2 × SSC solution (NaCl 300 mM, Sodium Citrate (trisodium citrate dihyDPate, C6H5Na3 · 2H2O) 30 mM, pH 7.0), then twice with 0.1 × SSC solution and then air-dried. Fluorescence measurement was performed using GenePix 4000B manufactured by Axon. Next, it was identified as Cw * 120202 with reference to the list of Tables 4-1 to 4-4.
Allele list
Cw * 0102:
(SEQ ID NO: 1);
Cw * 0103:
(SEQ ID NO: 2);
Cw * 0104:
(SEQ ID NO: 3);
Cw * 0105:
(SEQ ID NO: 4);
Cw * 0106:
(SEQ ID NO: 5);
Cw * 0107:
(SEQ ID NO: 6);
Cw * 0108:
(SEQ ID NO: 7);
Cw * 0109:
(SEQ ID NO: 8);
Cw * 020201:
(SEQ ID NO: 9);
Cw * 020202:
(SEQ ID NO: 10);
Cw * 020203:
(SEQ ID NO: 11);
Cw * 020204:
(SEQ ID NO: 12);
Cw * 020205:
(SEQ ID NO: 13);
Cw * 0203:
(SEQ ID NO: 14);
Cw * 0204:
(SEQ ID NO: 15);
Cw * 0205:
(SEQ ID NO: 16);
Cw * 0206:
(SEQ ID NO: 17);
Cw * 030201:
(SEQ ID NO: 18);
Cw * 030202:
(SEQ ID NO: 19);
Cw * 030301:
(SEQ ID NO: 20);
Cw * 030302:
(SEQ ID NO: 21);
Cw * 030303:
(SEQ ID NO: 22);
Cw * 030401:
(SEQ ID NO: 23);
Cw * 030402:
(SEQ ID NO: 24);
Cw * 0305:
(SEQ ID NO: 25);
Cw * 0306:
(SEQ ID NO: 26);
Cw * 0307:
(SEQ ID NO: 27);
Cw * 0308:
(SEQ ID NO: 28);
Cw * 0309:
(SEQ ID NO: 29);
Cw * 0310:
(SEQ ID NO: 30);
Cw * 0311:
(SEQ ID NO: 31);
Cw * 0312:
(SEQ ID NO: 32);
Cw * 0313:
(SEQ ID NO: 33);
Cw * 0314:
(SEQ ID NO: 34);
Cw * 0315:
(SEQ ID NO: 35);
Cw * 0316:
(SEQ ID NO: 36);
Cw * 040101:
(SEQ ID NO: 37);
Cw * 040102:
(SEQ ID NO: 38);
Cw * 0403:
(SEQ ID NO: 39);
Cw * 0404:
(SEQ ID NO: 40);
Cw * 0405:
(SEQ ID NO: 41);
Cw * 0406:
(SEQ ID NO: 42);
Cw * 0407:
(SEQ ID NO: 43);
Cw * 0408:
(SEQ ID NO: 44);
Cw * 0410:
(SEQ ID NO: 45);
Cw * 0501:
(SEQ ID NO: 46);
Cw * 0502:
(SEQ ID NO: 47);
Cw * 0503:
(SEQ ID NO: 48);
Cw * 0504:
(SEQ ID NO: 49);
Cw * 0505:
(SEQ ID NO: 50);
Cw * 0506:
(SEQ ID NO: 51);
Cw * 0602:
(SEQ ID NO: 52);
Cw * 0603:
(SEQ ID NO: 53);
Cw * 0604:
(SEQ ID NO: 54);
Cw * 0605:
(SEQ ID NO: 55);
Cw * 0606:
(SEQ ID NO: 56);
Cw * 0607:
(SEQ ID NO: 57);
Cw * 0608:
(SEQ ID NO: 58);
Cw * 0609:
(SEQ ID NO: 59);
Cw * 070101:
(SEQ ID NO: 60);
Cw * 070102:
(SEQ ID NO: 61);
Cw * 070201:
(SEQ ID NO: 62);
Cw * 0703:
(SEQ ID NO: 63);
Cw * 070401:
(SEQ ID NO: 64);
Cw * 070402:
(SEQ ID NO: 65);
Cw * 0705:
(SEQ ID NO: 66);
Cw * 0706:
(SEQ ID NO: 67);
Cw * 0707:
(SEQ ID NO: 68);
Cw * 0708:
(SEQ ID NO: 69);
Cw * 0709:
(SEQ ID NO: 70);
Cw * 0710:
(SEQ ID NO: 71);
Cw * 0711:
(SEQ ID NO: 72);
Cw * 0712:
(SEQ ID NO: 73);
Cw * 0713:
(SEQ ID NO: 74);
Cw * 0714:
(SEQ ID NO: 75);
Cw * 0715:
(SEQ ID NO: 76);
Cw * 0716:
(SEQ ID NO: 77);
Cw * 0717:
(SEQ ID NO: 78);
Cw * 0718:
(SEQ ID NO: 79);
Cw * 080101:
(SEQ ID NO: 80);
Cw * 080102:
(SEQ ID NO: 81);
Cw * 0802:
(SEQ ID NO: 82);
Cw * 0803:
(SEQ ID NO: 83);
Cw * 0804:
(SEQ ID NO: 84);
Cw * 0805:
(SEQ ID NO: 85);
Cw * 0806:
(SEQ ID NO: 86);
Cw * 0807:
(SEQ ID NO: 87);
Cw * 0808:
(SEQ ID NO: 88);
Cw * 0809:
(SEQ ID NO: 89);
Cw * 120201:
(SEQ ID NO: 90);
Cw * 120202:
(SEQ ID NO: 91);
Cw * 120203:
(SEQ ID NO: 92);
Cw * 120301:
(SEQ ID NO: 93);
Cw * 120302:
(SEQ ID NO: 94);
Cw * 120401:
(SEQ ID NO: 95);
Cw * 120402:
(SEQ ID NO: 96);
Cw * 1205:
(SEQ ID NO: 97);
Cw * 1206:
(SEQ ID NO: 98);
Cw * 1207:
(SEQ ID NO: 99);
Cw * 1208:
(SEQ ID NO: 100);
Cw * 140201:
(SEQ ID NO: 101);
Cw * 140202:
(SEQ ID NO: 102);
Cw * 1403:
(SEQ ID NO: 103);
Cw * 1404:
(SEQ ID NO: 104);
Cw * 1405:
(SEQ ID NO: 105);
Cw * 150201:
(SEQ ID NO: 106);
Cw * 150202:
(SEQ ID NO: 107);
Cw * 1503:
(SEQ ID NO: 108);
Cw * 1504:
(SEQ ID NO: 109);
Cw * 150501:
(SEQ ID NO: 110);
Cw * 150502:
(SEQ ID NO: 111);
Cw * 1506:
(SEQ ID NO: 112);
Cw * 1507:
(SEQ ID NO: 113);
Cw * 1508:
(SEQ ID NO: 114);
Cw * 1509:
(SEQ ID NO: 115);
Cw * 1510:
(SEQ ID NO: 116);
Cw * 1511:
(SEQ ID NO: 117);
Cw * 1601: (SEQ ID NO: 118);
Cw * 1602:
(SEQ ID NO: 119);
Cw * 160401:
(SEQ ID NO: 120);
Cw * 1701:
(SEQ ID NO: 121);
Cw * 1702:
(SEQ ID NO: 122);
Cw * 1703:
(SEQ ID NO: 123);
Cw * 1801:
(SEQ ID NO: 124);
Cw * 1802:
(SEQ ID NO: 125);
The probe lists 1 and 2 are shown in Tables 1 and 2, respectively.

  The allyl-probe correspondence lists 1 and 2 are shown in Tables 3 and 4 below.

Claims (5)

Probe group including all probes having the respective base sequences represented by SEQ ID NOs: 126 to 238 or a part thereof in the specification, or probes having the respective base sequences represented by SEQ ID NOS: 239 to 339 or a part thereof Consisting of a group of probes including
Each probe of the two probe groups is selected from the HLA-C type allele list consisting of the base sequences represented by SEQ ID NOs: 1-125 in the specification as long as the bases written in capital letters are not lost. A probe set consisting of 15 to 30 bases of selected bases, which can be used to identify HLA-C type alleles contained in a specimen. A probe group including all probes having the base sequences represented by SEQ ID NOs: 126 to 238 in the specification or a probe group including all probes having the base sequences represented by SEQ ID NOs: 239 to 339, the probe group Probe set which consists of 30 or less bases derived from the HLA-C gene and can be used for identification of HLA-C type alleles contained in the specimen. A method for identifying an HLA-C type allele contained in a sample from a specimen using a probe set,
The probe set according to claim 1 or 2, wherein the allele-probe correspondence list described in Table 3-1 to Table 3-4 or Table 4-1 to Table 4-4 in the specification is provided. A method for identifying an allele of type HLA- C , characterized in that an allele in a specimen is identified based on the above . Amplifying the HLA-C region in the sample by a primer PCR method;
A step of subjecting the amplified specimen to a hybridization reaction with a probe array to which the probe set is fixed;
Based on the allele-probe correspondence list described in Table 3-1 to Table 3-4 or Table 4-1 to Table 4-4 in the specification , showing the combination of probes corresponding to each allele. Identifying the allele of
4. The method of claim 3, comprising: A probe array that can be used for identification of an HLA-C type allele contained in a specimen, wherein the probe set according to claim 1 or 2 is immobilized on a substrate surface.