JP4166725B2 - Method for detecting methylated DNA - Google Patents

Description

  The present invention relates to a methylated DNA detection method and a method for using the same. More specifically, the present invention uses a methylated DNA detection method, a detection kit for carrying out the method, and the detection method and detection kit. The present invention relates to a disease determination method.

  In higher eukaryotes, cytosine (C) located on the 5 ′ side of guanine (G) is methylated in 5′-CG-3 ′ DNA (hereinafter referred to as CpG) portion present in the genomic DNA sequence. The phenomenon is known. This modification of methylation of CpG is considered to affect gene expression. In particular, when a CpG-rich region (CpG island) is present in the promoter region of a gene, it has an important effect on gene expression. It is thought to affect.

  Usually, many genes in the chromosome are protected from the above-mentioned methylation, but if for some reason the CpG island present in the promoter region of the gene is methylated, the transcription of the gene will be suppressed. For this reason, for example, when transcription of a tumor suppressor gene in the human body is inactivated due to abnormal methylation of CpG islands, cell growth control becomes ineffective, and cell proliferative diseases such as cancer progress. Will end up.

  On the other hand, with the recent development of molecular biological techniques, it has become possible to monitor the early detection and treatment of cancer and tumors by detecting the presence or absence of DNA methylation. For example, in Patent Documents 1 and 2 (hereinafter referred to as conventional examples), PCR is used to rapidly detect methylation in a CpG-containing nucleic acid, and DNA methylation is specifically detected to detect cancer. A method for diagnosing the above is disclosed.

In these methods, a nucleic acid sample is prepared from a tissue or cell line (nucleic acid extraction step), and a modification that converts unmethylated cytosine to uracil by bisulfite or the like (treatment step with bisulfite) is performed. In this method, methylated DNA is detected by PCR amplification (PCR amplification step) using specific primers that can distinguish methylated DNA from methylated DNA. By detecting the presence of methylated DNA in the base sequence of a specific gene by the above method, early detection and treatment of cancer and tumor can be monitored.
Special table 2000-511776 gazette (announced September 12, 2000) International Publication No. 02/38801 A1 pamphlet (May 16, 2002 international publication)

  However, the detection methods described above have the following problems.

  In the conventional example, a nucleic acid sample (DNA sample) for treatment with bisulfite is a nucleic acid sample extracted from a tissue or a cell system. That is, a mixture of nucleic acids from which proteins and the like have been removed from tissues or cell lines is used as a nucleic acid sample.

  Therefore, in the conventional nucleic acid extraction step of extracting nucleic acid from cells, a step of removing proteins and the like (protein removal step) is required. When there are a large number of cell specimens to be detected, the above-mentioned protein removal step causes a problem that the nucleic acid extraction step is complicated and time-consuming, and further takes time.

  Moreover, since the nucleic acid sample obtained by the said nucleic acid extraction process loses a nucleic acid in the process of extraction, it must extract a nucleic acid sample from a lot of specimens. Therefore, in the conventional example, 1 μg of DNA sample is extracted from tissues and various cell lines, then treated with bisulfite, and only about 50 ng of DNA is used for PCR amplification in the 1 μg DNA sample. ing. That is, in order to detect DNA methylation for one sample by PCR amplification, a tissue or cell system equivalent to 1 μg of DNA is required. Thus, the problem arises that nucleic acid samples must be extracted from large quantities of tissues or cell lines in order to detect DNA methylation.

  Therefore, there has been a strong demand for the development of a method that can easily detect a methylated DNA from a small amount of a cell sample without the step of preparing a nucleic acid sample from the sample.

  The present invention has been made in view of the above problems, and an object of the present invention is to easily detect methylated DNA from a small amount of a cell sample by omitting a step of extracting a nucleic acid from cells in the cell sample. It is in providing the method and its utilization method which can be performed.

  As a result of intensive studies in view of the above problems, the present inventor directly processed a cell sample lysate prepared by dissolving a very small amount of cell sample with bisulfite without performing a process such as protein removal. The present inventors have found that DNA contained in a cell sample can be modified, thereby realizing a method for detecting methylated DNA easily and with a small amount of cell sample, thereby completing the present invention.

  That is, in order to solve the above problems, the methylated DNA detection method according to the present invention is obtained by a cell lysis step of preparing a cell sample lysate by dissolving a cell sample with a lysis solution, and the cell lysis step. A DNA conversion step of treating a cell sample lysate with a bisulfite-containing reagent and converting unmethylated cytosine in the base sequence of the CpG-containing DNA contained in the cell sample lysate to uracil; and the DNA conversion step The obtained CpG-containing DNA is amplified by a polymerase chain reaction using a predetermined methylation-specific oligonucleotide primer, and whether the CpG-containing DNA is amplified by the DNA amplification step is detected. And a methylation detecting step.

  According to the above methylated DNA detection method, the cell sample lysate obtained in the cell lysis step is treated with bisulfite to thereby obtain unmethylated cytosine (unmethylated cytosine in the base sequence of CpG-containing DNA. ) Is converted to uracil, but methylated cytosine (methylated cytosine) is not converted. For this reason, the CpG-containing DNA after the DNA conversion step is amplified by PCR using a predetermined methylation-specific oligonucleotide primer. Whether or not methylated cytosine is contained in the base sequence can be determined.

  According to the above method, the cell sample is dissolved by the lysis solution, and this cell sample lysis solution is treated with bisulfite. Therefore, unlike conventional methods, it is not necessary to treat a nucleic acid sample obtained by a complicated and complicated nucleic acid extraction step including protein removal and the like with a bisulfite, which can be said to be a very simple and easy method.

  Further, according to the above method, there is no problem that a nucleic acid sample must be extracted from a large amount of specimen in order to detect DNA methylation. That is, in the above method, since all the DNA contained in the cell sample lysate obtained by lysing the cell sample in the cell lysis step is used in the gene modification step, the nucleic acid found in the nucleic acid extraction step in the conventional example described above. There will be no loss. Therefore, according to the method of the present invention, it is possible to detect methylated DNA from a very small amount of cell sample without requiring a large amount of cell sample.

  The methylated DNA detection method according to the present invention further comprises the DNA amplification step of amplifying the CpG-containing DNA obtained by the DNA conversion step by a polymerase chain reaction using a predetermined unmethylated specific oligonucleotide primer. It is characterized by including.

  According to the above method, the CpG-containing DNA after the DNA conversion step is PCR amplified using both the methylation specific primer and the non-methylation specific primer. For this reason, DNA methylated with higher accuracy can be detected.

  In the method for detecting methylated DNA according to the present invention, the CpG-containing DNA is preferably present in the promoter region of the gene. When CpG-containing DNA is present in the promoter region of a gene, by detecting whether cytosine in the CpG-containing DNA is methylated, abnormal expression of the gene (for example, suppression of expression, etc.) Presence / absence can be determined. For this reason, for example, it is very effective in the diagnosis, treatment, and prevention of diseases caused by abnormal expression of the gene.

  The gene is preferably a tumor suppressor gene or a cancer-related gene. Abnormal expression of a tumor suppressor gene can be detected, and can be used for early detection, diagnosis, treatment, etc. of cancer.

  The gene is more preferably an SHP1 gene, a p16Ink4a gene, a p15Ink4b gene, a CDH1 gene, or a CDH13 gene. The “SHP1 gene” here refers to the protein tyrosine phosphatase SHP1 gene.

  More preferably, the cell sample is a cell sample containing hematopoietic cells. When the cell specimen is a hematopoietic cell, hematopoietic tumors such as malignant lymphoma and leukemia can be examined by the above method.

  The cell sample is preferably a cell sample selected from at least one of blood, blood adsorbed on a carrier, coagulated blood clot, bone marrow fluid, and bone marrow fluid adsorbed on a carrier. In the above method, not only fresh blood but also blood adsorbed on a filter paper or a coagulated blood clot can be used as a cell sample. For this reason, for example, blood is collected from the earlobe at home, and the blood adhered to the filter paper or the like is sent to a hospital located remotely from the home. By carrying out, the presence or absence of methylated DNA can be easily detected. For this reason, for example, it can be used for general purposes for early diagnosis of cancer.

  Moreover, it is preferable that the said solution is a solution containing guanidine thiocyanate or sodium iodide.

  Moreover, it is preferable that the said bisulfite containing reagent is a reagent containing sodium bisulfite. By using the reagent described above, the methylated DNA detection method according to the present invention can be carried out reliably and simply.

  In addition, a methylated DNA detection kit according to the present invention is a methylated DNA detection kit for detecting methylated DNA contained in a cell sample, in order to solve the above problems, and dissolves the cell sample. And a bisulphite-containing reagent for converting unmethylated cytosine in the base sequence of the CpG-containing DNA contained in the cell specimen into uracil, and the base sequence of the CpG-containing DNA. And a predetermined methylation-specific oligonucleotide primer for determining the presence or absence of methylated cytosine.

  According to said structure, the said methylated DNA detection method can be implemented simply and reliably. For this reason, it is very effective for making the methylated DNA detection method versatile.

  Furthermore, it is preferable that a reagent for PCR is included. There is an advantage that it is easier to use.

  Furthermore, it is preferable that a non-medical institution includes a blood collection kit for collecting blood from the subject by the subject himself or a third party. As a result, the peripheral blood of the subject can be collected by the subject himself / herself or a third party in a non-medical institution, so the versatility of the methylation detection kit is further expanded.

  In addition, in order to solve the above-mentioned problem, the disease determination method according to the present invention uses any one of the above-described methylated DNA detection method and methylated DNA detection kit or the kit to detect methyl in a cell sample. It is characterized by determining the onset of the disease caused by the abnormal expression of the gene due to DNA methylation or the possibility of the onset of the disease by detecting the presence or absence of the activated DNA.

  According to the above method, when CpG-containing DNA in which cytosine is methylated is present, for example, in the promoter region of a gene, the expression state of the gene is abnormal, for example, expression suppression occurs. Therefore, by detecting methylated DNA using the above-described method or kit, various diseases caused by abnormal expression of the gene or the onset possibility of the disease are determined (diagnosed) simply and with high accuracy. be able to.

  In addition, in order to solve the above problems, the disease determination method according to the present invention uses a method or kit of any one of the above-described methylated DNA detection method and methylated DNA detection kit. By detecting the presence or absence of methylation of CpG-containing DNA present in the promoter region of the gene, the onset of a disease caused by abnormal gene expression due to the methylation of the DNA, or the possibility of the onset of the disease It is characterized by determining.

  By monitoring abnormal expression of a plurality of genes, it is possible to determine the onset of a disease associated with the expression of the genes or the possibility of the onset with higher accuracy and sensitivity.

  Furthermore, in the disease determination method according to the present invention, the gene is preferably a tumor suppressor gene or a cancer-related gene.

  By monitoring a plurality of tumor suppressor genes or cancer-related genes, the onset of cancer or the possibility of cancer onset can be determined with higher accuracy and sensitivity.

  Still further, in the disease determination method according to the present invention, the tumor suppressor gene or cancer-related gene is a SHP1 gene and / or p16Ink4a gene and / or p15Ink4b gene and / or CDH1 gene and / or CDH13 gene. It is preferable.

  By monitoring abnormal expression of the plurality of genes, it is possible to determine the onset of hematopoietic cell tumors such as malignant lymphoma and leukemia or the possibility of the onset with higher accuracy and sensitivity.

  By the way, the disease determination method according to the present invention described above can determine that the onset of a disease or the onset of the disease is high when methylated DNA is present in a cell sample. For example, when CpG-containing DNA in which cytosine is methylated is present in the promoter region of a gene, the expression state of the gene is abnormal, for example, expression suppression occurs. Therefore, by detecting methylated DNA using the above-described method or kit, various diseases caused by abnormal expression of the gene or the onset possibility of the disease are determined (diagnosed) simply and with high accuracy. be able to.

  In the disease determination method according to the present invention, a cell sample containing hematopoietic cells is preferably used as the cell sample. According to the above configuration, the onset of hematopoietic tumor or the possibility of onset of hematopoietic tumor can be determined.

  In the disease determination method according to the present invention, the disease is preferably a cell proliferative disease. Examples of cell proliferative diseases here include tumors and cancers (malignant tumors).

  In the disease determination method according to the present invention, the cell proliferative disease is preferably a hematopoietic tumor or a solid tumor. According to the above method, for example, by using fresh blood, blood adsorbed on filter paper, or coagulated blood clot, it is possible to easily and accurately determine the onset of hematopoietic tumor and solid tumor, or the possibility of their onset. can do.

  In addition, this method is further expanded to include other cell proliferative diseases including solid tumors and epigenetics-related diseases including alveolar mitochondria, genome imprinting diseases such as Wilms tumor, schizophrenia, Rett syndrome, etc. Monitoring, diagnosis, predicting the likelihood of onset, etc. can be performed using body fluids such as sputum, urine, and cerebrospinal fluid in addition to blood samples.

  As described above, according to the methylated DNA detection method according to the present invention, DNA methylation can be performed easily and with high accuracy by directly using a very small amount of cell specimen without going through a DNA extraction step such as protein purification. There is an effect that it can be detected.

  Moreover, according to the methylated DNA detection kit which concerns on this invention, there exists an effect that the said methylated DNA detection method can be implemented simply and easily.

  Furthermore, by using the above-mentioned methylated DNA detection method or methylated DNA detection kit, various diseases or diseases caused by abnormal gene expression due to DNA methylation can be efficiently and highly probable. The effect is that it can be determined (diagnostic). For this reason, it can be said that this invention is an important invention with a very strong social impact.

  The object of the present invention is to directly detect a cell sample, thereby omitting the step of extracting a nucleic acid as in the prior art, and easily detecting the presence or absence of methylation of a predetermined gene in a very small amount of a cell sample. It is to provide a method and its usage.

  For example, when DNA methylation occurs in the promoter region of a gene, the expression of the gene is suppressed. Furthermore, when this gene is a tumor suppressor gene, the expression of the tumor suppressor gene is suppressed in the living body, and thus cancer occurs and progresses. Therefore, by the presence or absence of methylation of a predetermined gene, particularly the promoter region of a tumor suppressor gene, by the methylated DNA detection method according to the present invention, determination of cell proliferative diseases such as cancer can be performed easily and accurately ( The present invention has a very strong social impact in that it can be diagnosed.

  Furthermore, the present invention can detect DNA methylation directly from a cell sample without the need to extract a complicated DNA sample. Moreover, the amount of cell specimen required for carrying out the method may be very small. As the most familiar cell specimen, for example, blood can be mentioned, but according to the methylated DNA detection method of the present invention, even when dry blood or coagulated blood is used, fresh blood is used. It can be detected with similar accuracy.

  For this reason, for example, when using blood as a cell sample, only a small amount of blood is collected from a peripheral blood vessel by the subject himself and the blood soaked in filter paper is sent to a disease determination center located in a remote place. There is also an advantage that a disease such as cancer can be easily determined. That is, a methylated DNA detection method has been developed that can determine, diagnose, and test a disease by mailing a blood sample from a home, for example, without depending on blood collection by a doctor. This method is expected to enable early detection of diseases such as hematopoietic tumors. In addition, because it is not necessary for the subject to go to the medical institution, have blood collected, and have the test performed on it, it is also excellent in that it saves labor and time not only for the subject but also for the medical institution. It is an invention.

  Hereinafter, the method for detecting methylated DNA of the present invention will be described in detail. An embodiment of the method for detecting methylated DNA according to the present invention will be described below with reference to FIGS. Note that the present invention is not limited to this.

(1) Methylation detection method A methylation detection method according to the present invention comprises a cell lysis step in which a cell sample is dissolved in a lysis solution to prepare a cell sample lysis solution, and a cell sample lysis solution obtained by the cell lysis step. A DNA conversion step of treating with a bisulfite-containing reagent and converting unmethylated cytosine in the base sequence of the CpG-containing DNA contained in the cell sample lysate to uracil; and the CpG-containing DNA obtained by the DNA conversion step A DNA amplification step for amplifying the DNA by a polymerase chain reaction using a predetermined methylation-specific oligonucleotide primer; and a methylation detection step for detecting whether or not the CpG-containing DNA is amplified by the DNA amplification step; Any other specific conditions, methods, etc. are not particularly limited.

  That is, in the methylated DNA detection method of the present invention, first, a cell sample is dissolved in a lysis solution to prepare a cell sample lysis solution (cell lysis step), and this cell sample lysis solution is directly treated with a bisulfite-containing reagent. Then, unmethylated cytosine in the base sequence of the CpG-containing DNA contained in the cell sample lysate is converted to uracil (DNA conversion step). The CpG-containing DNA thus obtained is amplified by a polymerase chain reaction method (PCR) using a predetermined methylation-specific oligonucleotide primer (DNA amplification step), and then the CpG-containing DNA is amplified. (Methylation detection step).

  The (1-1) cell lysis step, (1-2) DNA conversion step, (1-3) DNA amplification step, and (1-4) methylation detection step will be described in detail below.

(1-1) Cell Lysis Step The cell lysis step may be a step for preparing a cell sample lysate by dissolving a cell sample with a lysate, and other specific methods, conditions, etc. are particularly limited. It is not a thing.

  In the above step, the membrane structure of the cell sample is destroyed by dissolving the cell sample with a lysis solution. Thereby, nucleic acids such as genomic DNA contained in the cell specimen are exposed. In conventional methylated DNA detection methods, proteins other than nucleic acids, membranes, and the like are removed, and methylated DNA is detected using a purified DNA sample. However, the methylated DNA detection method of the present invention does not require such a DNA purification step, and the genome (CpG-containing DNA) contained in the cell sample can be directly used as the DNA sample, so that it is complicated as in the past. Therefore, methylated DNA can be detected very easily and quickly without going through complicated steps.

  The above “cell specimen” may be any body fluid, tissue, cultured cell or the like containing cells of mammals including humans, and its specific type and properties are not particularly limited. Preferably, a specimen containing hematopoietic cells, such as a cultured cell line containing blood, bone marrow fluid or hematopoietic cells, is preferred.

  Furthermore, as the “cell specimen containing cell proliferative diseases including hematopoietic cells”, in addition to the collected blood (fresh blood), blood adsorbed on a carrier, coagulated blood clot, bone marrow fluid, Alternatively, it may be bone marrow fluid adsorbed on a carrier. According to the method of the present invention, DNA methylation can be sufficiently detected not only with fresh blood but also with blood that has been collected and dried as a cell sample, as shown in the examples described later. Because.

  Here, the blood or bone marrow fluid “adsorbed on a carrier” means blood or bone marrow dried after adhering (adsorbing) to a paper carrier such as filter paper or other conventionally known carrier such as resin or plastic. Refers to liquid. The material of the carrier is not particularly limited, but preferably a filter paper or the like is preferable as shown in the examples described later. In addition, the “clotting blood clot” is a blood clot that is dried and coagulated after blood collection as the wording indicates.

  In addition, as a method for collecting blood or bone marrow fluid, a method for preparing blood adhered to a carrier, a method for preparing bone marrow fluid, and a method for preparing a coagulated blood clot, conventionally known methods can be used and are not particularly limited. Specifically, the method shown in the Example mentioned later is mentioned.

  In addition, there is no difference in the above-described processing operation with respect to peripheral blood and bone marrow fluid, and both can be reacted in the same manner. If you dare to mention different points, it can be said that there is a difference in blood collection operation before this processing operation. In other words, peripheral blood can be collected without relying on a doctor, but bone marrow fluid cannot be obtained by an individual. Therefore, it is considered that bone marrow fluid is collected and diagnosed in a hospital. It is considered that blood is collected in a blood collection tube, mainly as “non-coagulated blood” and partly “adsorbed on filter paper”. Peripheral blood, on the other hand, is “adsorbed to filter paper” or “coagulated blood” for individuals, and is “non-coagulated blood” as in the case of bone marrow fluid when blood is collected in hospitals, and partly “adsorbed to filter paper” The method will be taken.

The “lysis solution” is not particularly limited as long as it can dissolve the cell sample and cleave the membrane, but a reagent that causes protein denaturation is preferable. Specific examples of the solution include a solution containing a conventionally known protein denaturant such as guanidine thiocyanate or sodium iodide . Further, these may contain a conventionally known crosslinking agent such as β-mercaptoethanol.

  In addition, the reaction conditions such as the composition, concentration, reaction temperature, and reaction time of the lysis solution in the cell lysis step are not particularly limited, and can be appropriately set depending on the concentration and type of the cell sample to be lysed in the lysis solution. . Moreover, it is preferable to include a step of heating the mixed solution for a certain time after mixing the cell sample and the lysate. This is because cell lysis can be further promoted by heating after mixing the cell specimen and the lysate.

  In addition, as described above, the “cell sample lysate” refers to a solution in which the cell sample is destroyed by the lysate and the genomic DNA in the cell sample flows out of the cell.

  Below, a suitable example is given and demonstrated about the suitable conditions of this cell lysis process.

First, when using a solution containing guanidine thiocyanate as a solution, the composition is [6.5M Guanidium Thiocyanate / 0.81% N-Lauroylsarcosine sodium salt / 40.63mM Sodium Citrate / 163mM β-mercaptoethanol (pH7.0)]. Preferably there is. Here, this solution is referred to as a 6.5 M guanidine thiocyanate solution. Then, prepare this 6.5 M guanidine thiocyanate solution as a stock solution (however, it is only a guide because it can be corrected by the amount used even if the concentration is slightly different).
Subsequently, a method for preparing a cell sample lysate using the lysate will be described by taking as an example the case of using blood as a cell sample. First, (i) When using blood directly: 40 μl of 6.5 M guanidine thiocyanate solution is added to 5 μl of blood to obtain a final concentration of 5.8 M (however, 1 μl to 25 μl of blood can be directly reacted, At that time, it is not necessary to correct the volume with distilled water). (ii) When blood is used by adsorbing and drying on filter paper: 40 μl of 6.5 M guanidine thiocyanate solution is added to the filter paper with blood attached to a final concentration of 6.5 M (however, adding distilled water within 25 μl) There is no effect even if it reacts). (iii) When using a clotted blood clot: Add 40 μl of a 6.5 M guanidine thiocyanate solution to the clotted blood clot and let it react.

  Moreover, when using the solution containing sodium iodide as a solution, it is preferable that the composition is 6M NaI. Then, instead of the 6.5 M guanidine thiocyanate solution described above, 6M sodium iodide is used.

  In addition, it is preferable that the lysate and the cell sample are mixed and then heated at 100 ° C. for 10 minutes.

(1-2) DNA conversion step In the DNA conversion step, the cell sample lysate obtained by the cell lysis step is treated with a bisulfite-containing reagent, and the CpG-containing DNA contained in the cell sample lysate Any non-methylated cytosine may be converted to uracil, and other specific methods and conditions are not particularly limited.

  In the DNA conversion step, cytosine that is not methylated in the base sequence of the CpG-containing DNA is converted to uracil by bisulfite treatment. On the other hand, the methylated cytosine remains cytosine even after bisulfite treatment. Therefore, whether cytosine in the base sequence of CpG-containing DNA is methylated can be distinguished by whether it is converted to uracil by bisulfite treatment. Hereinafter, the principle of DNA conversion by bisulfite treatment will be described in detail with reference to FIG. 1 and FIG.

  First, when DNA is treated with bisulfite, cytosine is converted to uracil. Specifically, as shown in FIG. 1, cytosine is sulfonated with bisulfite (Sulphonation), further hydrolyzed (ahydrolytic deamination), and further desulfonated (Alkali in the presence of alkali). desulphonation), converted to uracil. In contrast, methylated cytosine is not converted to uracil even when treated with bisulfite.

  FIG. 2 shows the bisulfite treatment of DNA having the same base sequence when CpG in the base sequence is methylated or not methylated. As shown in the figure, in the unmethylated DNA, all cytosine is converted to uracil by bisulfite treatment as described above. In contrast, in methylated DNA, methylated cytosine in the figure (indicated by M in a circle in the figure) is not converted to uracil by bisulfite treatment, and other methylated DNAs are not converted. Only non-cytosine is converted to uracil. That is, even in the case of DNA having the same base sequence, there is a difference in the base sequence after bisulfite treatment depending on whether it is methylated or not. By detecting this difference in base sequence, the presence or absence of methylation of the CpG-containing specimen can be detected.

The “bisulfite-containing reagent” is not particularly limited as long as it is a conventionally known reagent containing bisulfite, and examples thereof include sodium bisulfite (Na ₂ S ₂ O ₅ , metabisulfite). Sodium sulfite, sodium disulfite, or sodium pyrosulfite) can be preferably used. Further, a bisulfite compound and urea may be used in combination.

  The “CpG-containing DNA” is not particularly limited as long as it is DNA contained in the cell specimen and has a base sequence containing a CpG sequence. The DNA specimen here is genomic DNA.

  The “CpG-containing DNA” is preferably present in the promoter region of the gene. Furthermore, it is more preferable that this gene is a tumor suppressor gene or a cancer-related gene.

  When a region rich in CpG sequence (CpG island) is present in the promoter region of a gene, methylation of cytosine in the CpG island is related to transcriptional control of the gene. Therefore, by detecting cytosine methylation in the promoter region of a gene, abnormal expression of the gene (for example, whether transcription is activated or suppressed) can be detected. Further, when the gene is a tumor suppressor gene, it is detected whether or not the cell contained in the cell specimen is a cancer cell by detecting methylation of cytosine of CpG island in the promoter region of the tumor suppressor gene. be able to.

  The tumor suppressor gene is not particularly limited. For example, protein tyrosine phosphatase SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, and CDH13 gene are preferable, but p15, p14, DAPK, p73, CDH1, APC, GSTP1, anthrogen receptor, estrogen receptor, TGF-β1, TGF-β2, p130, BRCA, NF1, NF2, TSG101, MDG1, GST-pi, caltonin, HIC-1, endothelin B receptor, TIMP-2 , TIMP-3, 06-MGMT, MLH1, MSH2, and GFAP. For example, in patients with hematopoietic tumors, particularly malignant lymphoma and leukemia patients, the CpG region present in the promoter region of the SHP1 gene is methylated, so that SHP1 protein cannot be expressed and cell growth control becomes ineffective. The mechanism is known.

  In addition, the p16Ink4a gene binds to Cyclin-dependent protein kinases 4 and 6 (CDK: cyclin-dependent protein kinases 4 and 6) and inhibits the activity thereof, thereby suppressing phosphorylation of RB protein and cell cycle. Is a factor that regulates It is frequently inactivated (chromosomal deletion) in acute lymphocytic leukemia, bladder cancer, esophageal cancer, pancreatic cancer, familial melanoma and glioma. In adult T-cell leukemia, HTLV-1 oncogene Tax binds to p16 and inhibits complex formation of CDK and P16, thus increasing CDK kinase activity and cell cycle progression to G1. Yes. In breast cancer and esophageal cancer, the p16Ink4a gene is normal, but methylation occurs in the DNA of the promoter region, resulting in a decrease in gene expression. It is known that the presence or absence of cancer cells can be examined by examining the presence or absence of methylation in the promoter region of this gene.

  The p15Ink4b gene is a cell cycle regulator that binds to Cyclin-dependent protein kinase 4 (CDK: cyclin-dependent protein kinase) and inhibits its activity. It is located adjacent to the p16Ink4a gene present on chromosome 9p21 and has been confirmed to be deleted together with the p16Ink4a gene in many cancer cells. It is known that the presence or absence of cancer cells can be examined by examining the presence or absence of methylation in the promoter region of this gene.

  The following is known about the CDH1 (E-cadherin) gene. Cadherin is a glycoprotein related to cell-cell adhesion with a molecular weight of 120 kDa, and plays an important role in embryonic tissue organization and organogenesis. In cancer cells, E-cadherin (epithelium-derived) (CDH1) is known to control adhesion between cancer cells, and cancer cells that have infiltrated the blood vessels dissociated and drifted to the target organ It is thought to be involved in the process. E-cadherin is known to lose its expression in tumor cells of acute myeloid leukemia or Hodgkin lymphoma, and its relation to onset is suggested.

  The CDH13 (H cadherin) gene lacks the intracellular domain and is known to be associated with intracellular signaling as well as intercellular adhesion. In addition, it has been reported that the expression of H-cadherin disappears in various cancers such as ovarian cancer, breast cancer, lung cancer and colon cancer due to abnormal DNA methylation or gene deletion. Several studies, including those of our group recently, have shown that strong cadherin promoter methylation is observed in early chronic myeloid leukemia or interferon-treated hyporesponsive chronic myeloid leukemia, It is known that a decrease or disappearance of gene expression is observed due to abnormal methylation of H-cadherin DNA and allelic deletion in diffuse large B-cell lymphoma.

  Therefore, by examining the methylation of the SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, and CDH13 gene, it can be effectively used for early detection of hematopoietic tumors, genetic diagnosis, and the like.

  The reaction conditions such as the reaction time, reaction temperature, and bisulfite concentration in the bisulfite treatment are appropriately set according to the conditions of the cell sample lysate such as the nucleic acid concentration contained in the cell sample lysate. can do.

  Further, the above-described bisulfite-treated CpG-containing DNA is extracted from a cell sample lysate and PCR amplified in a DNA amplification step described later. A method for extracting the CpG-containing DNA from the cell sample lysate is not particularly limited, and a conventionally known method can be used. For example, as shown in the Examples described later, there is a method of adsorbing a CpG-containing specimen on glass beads. In this method, the CpG-containing DNA is adsorbed on glass beads and washed, and then the CpG-containing DNA adsorbed on the glass beads is eluted again. Moreover, as a method for extracting CpG-containing DNA, a method using ethanol precipitation may be used.

  The methylated DNA detection method of the present invention includes a case where a cell sample is dissolved with a lysis solution and treated with a bisulfite-containing reagent. That is, the cell lysis step and the DNA conversion step may be performed consistently and continuously. For example, by consistently treating a cell sample with a lysate containing bisulfite, unmethylated cytosine can be converted to uracil almost simultaneously with the preparation of the cell sample lysate. In this case, bisulfite-treated CpG-containing DNA can be prepared in a shorter time than when the two steps of the cell lysis step and the DNA conversion step are performed separately.

  Hereinafter, the preferred conditions for the DNA conversion step will be described with a specific example.

  A 6.2M Urea / 2M Bisulfite solution is used as the bisulfite-containing reagent. The cell sample lysate obtained in the above cell lysis step is mixed with 208 μl of 6.2 M Urea / 2M Bisulfite solution and 1 μl of 10 mM Hydroquinone (can be reacted even if the amount is slightly different), and 3 drops of mineral oil are overlaid. To do. Then, after heating at 95 ° C. for 5 minutes, “95 ° C. for 1 minute, 55 ° C. for 1 hour” is repeated 20 cycles (reaction is possible even if conditions are slightly different). After mixing the above reaction solution with 6M NaI (sodium iodide), 10 μl of Glassbeads is added to adsorb the DNA to Glassbeads. After centrifugation, the DNA / Glassbeads complex is washed with a [10 mM Tris / HCl (pH 7.5) / 1 mM EDTA / 100 mM NaCl / 50% ethanol] solution. 20 mM NaOH / 90% ethanol is added to the DNA / Glassbeads complex and reacted at 37 ° C. for 15 minutes to desulfonate the DNA. After washing the DNA / Glassbeads complex with 90% ethanol, the DNA is eluted with a 10 mM Tris / HCl / 1 mM EDTA buffer (DNA can be recovered by the ethanol precipitation method without using the Glassbeads method).

(1-3) DNA amplification step The DNA amplification step is a step of amplifying the CpG-containing DNA obtained by the DNA conversion step by polymerase chain reaction (PCR) using a predetermined methylation-specific oligonucleotide primer. Other specific methods and conditions are not particularly limited.

  In the DNA amplification step, whether cytosine in the base sequence of the CpG-containing DNA is converted to uracil is examined by PCR using a predetermined methylation-specific oligonucleotide primer. That is, this predetermined methylation-specific oligonucleotide primer is specifically annealed to CpG-containing DNA in which cytosine in the CpG sequence is not converted to uracil by bisulfite treatment (hereinafter referred to as methylated CpG-containing DNA). (Complementary). Therefore, the methylated CpG-containing DNA is specifically amplified by PCR using the methylation-specific oligonucleotide primer.

  On the other hand, CpG-containing DNA in which cytosine in the base sequence of CpG-containing DNA is converted to uracil by bisulfite treatment (hereinafter referred to as unmethylated CpG-containing DNA) is annealed with the above-mentioned methylation-specific oligonucleotide primer. Therefore, it is not amplified by PCR using the methylation-specific oligonucleotide primer.

  Therefore, by detecting whether or not the CpG-containing DNA obtained by the DNA conversion step is amplified by PCR using a methylation-specific oligonucleotide primer, cytosine in the base sequence of the CpG-containing DNA is methylated. Can be detected.

  Here, the “predetermined methylation-specific oligonucleotide primer” is designed to specifically anneal to an arbitrary region containing a CpG sequence in DNA (genomic DNA) contained in a cell sample. An oligonucleotide primer, in particular, an oligonucleotide primer having a base sequence in which the CpG sequence in the region is conserved and C (cytosine) other than the CpG sequence is converted to T (thymine) (FIG. 3 (b)). By designing in this way, the methylation-specific oligonucleotide primer can specifically anneal (complement) with the methylated CpG-containing DNA. In the methylation-specific oligonucleotide primer, only one of the forward primer and the reverse primer specifically anneals with the methylated CpG-containing DNA region. If present, DNA methylation can be detected, but more preferably, both the forward primer and the reverse primer are annealed specifically with the methylated CpG-containing DNA region. It is preferable that

  Here, primer design will be briefly described with reference to FIG. As shown in FIG. 3, when DNA is treated with bisulfite, unmethylated cytosine is converted to uracil, but methylated cytosine is stored without being converted. Here, cytosine (C) having a CG sequence (5'-CG-3 ') aligned with CG from the 5' sequence side is the only cytosine that may undergo methylation in the cell. For this reason, all the cytosines other than the CG sequence are converted to uracil (U) by bisulfite treatment. Therefore, assuming that all CG sequences have undergone methylation, the base sequence of CpG-containing DNA is converted, and primers are set. Note that uracil in DNA is recognized as thymine (T) and is replaced by thymine by PCR.

  Specific examples of the above-mentioned methylation-specific oligonucleotide primer include, for example, CpG sequences present in promoter regions of tumor suppressor genes (SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, CDH13 gene, etc.) An oligonucleotide primer having a base sequence in which a CpG sequence in the region is conserved and C (cytosine) other than the CpG sequence is converted to T (thymine). However, the present invention is not limited to this.

  The “polymerase chain reaction” may be a PCR (Polymerase Chain Reaction) or a LAMP method that does not use PCR, and its specific method and conditions are not particularly limited.

  In the DNA amplification step, CpG-containing DNA obtained by converting the unmethylated cytosine into uracil obtained in the DNA conversion step is further subjected to polymerase chain reaction using a predetermined unmethylated specific oligonucleotide primer. A step of amplification by (PCR) may be included.

  Thereby, unmethylated CpG containing DNA is amplified in PCR using an unmethylated specific oligonucleotide primer. On the other hand, methylated CpG-containing DNA is not amplified. Therefore, whether cytosine in the base sequence of the CpG-containing DNA is methylated can be examined based on whether or not the DNA specimen is amplified as a result of PCR using the unmethylated specific oligonucleotide primer. Thus, detection accuracy is further increased by detecting using both a methylation-specific oligonucleotide primer and an unmethylation-specific oligonucleotide primer.

  Here, the “unmethylated specific oligonucleotide primer” is an oligonucleotide designed to specifically anneal to an arbitrary region containing a CpG sequence in DNA (genomic DNA) contained in a cell sample. A nucleotide primer, in particular, an oligonucleotide primer having a sequence in which all C (cytosine) in the region is converted to T (thymine) (see FIG. 3A). Specific examples of the non-methylation specific oligonucleotide primer include, for example, a CpG sequence present in the promoter region of a tumor suppressor gene (SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, CDH13 gene, etc.) Although the area | region to include can be mentioned, it is not limited to this.

(1-4) Methylation detection step The methylation detection step may be a step for detecting whether or not the CpG-containing DNA is amplified by the DNA amplification step. Specific methods, conditions, and the like are as follows. There is no particular limitation.

  Whether or not CpG-containing DNA is amplified is detected by PCR using the methylation-specific oligonucleotide primer. This makes it possible to detect whether methylated cytosine is present in the base sequence of the CpG-containing DNA simply, rapidly, and with high sensitivity.

  As a specific detection method, for example, a primer may be labeled with a fluorescent label, a biotin label, a DIG label or a radioisotope label, gel electrophoresis, real-time PCR, capillary electrophoresis, fragment analysis, Any apparatus and method such as a plate reader method and immunostaining may be used. In order to improve the detection sensitivity and detection accuracy, a part of the reaction solution obtained by performing the PCR reaction once may be taken, and the second PCR may be performed using the primer located inside.

(2) Methylation detection kit The methylation detection kit according to the present invention comprises a lysate for lysing the cell sample, and unmethylated cytosine in the base sequence of the CpG-containing DNA contained in the cell sample into uracil. And a bisulfite-containing reagent for conversion, and a predetermined methylation-specific oligonucleotide primer for determining the presence or absence of methylated cytosine contained in the base sequence of the CpG-containing DNA. Other configurations are not particularly limited.

  As the above-mentioned “solution”, “bisulfite-containing reagent”, and “predetermined methylation-specific oligonucleotide primer”, for example, those described in the above section (1) can be used.

  The kit preferably further includes a PCR reagent and a DNA amplification reagent that does not use PCR. A conventionally well-known thing can be utilized for those reagents.

  Further, the kit preferably includes a blood collection kit for collecting peripheral blood of the subject by the subject himself or a third party in a non-medical institution. By including the above blood collection kit, for example, the subject himself or a third party can collect peripheral blood for methylated DNA detection without depending on a doctor. For this reason, it is not necessary to go to a medical institution to collect blood, and time and labor can be saved. Since the methylation detection kit can detect DNA methylation based on a very small amount of blood, it is sufficient to collect a very small amount of blood at a non-medical institution such as a home. Methylation can be detected for the DNA.

  An example of the blood collection kit will be described specifically. This blood collection kit is a kit for obtaining a cell sample for a methylated DNA detection kit by allowing a subject to collect his or her peripheral blood by himself or a third party.

  When using blood with this blood collection kit as a cell sample, (1) a form in which blood is soaked in filter paper, (2) a form in which blood is coagulated, (3) direct blood is used There are three types of form. The above (1) and (2) can be transported or mailed to the inspection center after drying, but the above (3) is effective only when the detection kit is in the hands of the subject.

  Blood collection kits include, for example, sterilized blood collection cutters or needles, sterilized blood collection capillaries (dropper), sterilized blood collection microtubes, sterilized filter paper pieces (approx. 2 mm x 4 mm), sterilized simple tweezers, sterilized A plastic container for blood coagulation (sample tube, vial, etc.) and a sterilized plastic container for transport (sample tube, vial, etc.) may be provided.

  A protocol for simply collecting blood using the above blood collection kit will be described.

  (1) When adsorbing to filter paper: First, thoroughly disinfect the fingertip or earlobe, cut with a needle or razor to remove blood, and soak into a small piece of filter paper with a capillary (dropper). Alternatively, once blood is collected in a microtube, it is soaked in filter paper. It is better to use 3 to 4 small pieces of filter paper soaked with blood for one time of methylation detection method, so in anticipation of this, make more filter paper soaked with blood. It is preferable to keep it. The filter paper with blood attached is placed on a wrap or air-dried in a microtube. After drying, it can be stored for 1 month at room temperature. After drying, mail to analysis center.

  (2) When using coagulated blood: After thoroughly disinfecting the fingertip or earlobe, cut it with a needle or razor to remove the blood, dispense a small amount into a microtube with a capillary (dropper), and air-dry with the lid open To do. After drying, the lid can be capped and stored at room temperature. After drying, mail to analysis center.

  (3) When non-coagulated blood is used directly: First, a 0.5 ml tube in a methylated DNA detection kit described later is placed in an incubator or a bath at about 65 ° C., and the solution is dissolved and then kept warm. Next, thoroughly disinfect the fingertip or earlobe, then cut with a needle or razor to remove blood, and dispense a small amount into a microtube with a capillary (dropper). Before the blood clots, add 5 μl (1-25 μl is acceptable) to each 0.5 ml tube that is kept warm, and stir quickly. Then, heat at 100 ° C for 10 minutes. Thereafter, the process proceeds to step (IV) of the detection protocol described later. After heating, it can be stored at 4 ° C for about 1 week.

  Further, a specific example of the methylated DNA detection kit according to the present invention will be described below. This detection kit is a detection kit for a system that can detect the presence or absence of a hematopoietic tumor, for example, by examining a small amount of blood as a cell sample. When blood is used as a cell sample, as described above, (1) blood soaked in filter paper, (2) dried clotted blood clot, and (3) fresh blood can be used. . In (1) and (2), it is possible to detect a specimen sent by transportation or mail.

  The methylated DNA detection kit includes, for example, a 0.5 ml microtube containing a blood lysis reagent (for example, a lysis solution containing guanidine thiocyanate), Urea powder, Sodium Metabisulfite powder, NaOH granules, Hydroquinone powder, mineral oil, 6M Nal solution, Glassbeads, Wash solution [10 mM Tris · HCl (pH 7.5) / 1 mM EDTA / 100 mM NaCl / 50% ethanol], Ethanol, elution solution [10 mM Tris · HCl (pH 7.5) / 1 mM EDTA], Bisulfite treatment for PCR Human normal cell genomic DNA, PCR-bisulfite-treated human hematopoietic tumor cell line genomic DNA, PCR-attached hematopoietic tumor cell-attached dry filter paper, methylated DNA detection PCR primer (with fluorescent label or non-fluorescent), non-methyl PCR primer for detection of immobilized DNA (with fluorescent label or non-fluorescence) and PCR primer for detection of bisulfite-treated DNA (with fluorescent label or non-fluorescence) may be provided.

  A simple protocol using the methylated DNA detection kit will be described.

  (I) Method of using fresh (non-coagulated) blood directly: First, place the 0.5 ml tube of (1) above in an incubator or hot water of about 65 ° C. Next, thoroughly disinfect the fingertip or earlobe, then cut with a needle or razor to remove blood, and dispense a small amount into a microtube with a capillary (dropper). Alternatively, blood is collected with a conventional injection syringe, and blood is collected in a state including a blood coagulation inhibitor. Before the blood clots, add 5 μl (1-25 μl is acceptable) to a warm 0.5 ml tube and stir quickly. Then, heat at 100 ° C. for 10 minutes. Proceed to step (IV). After heating, it can be stored at 4 ° C for about 1 week.

  (II) Method of using blood adsorbed on filter paper: First, the above 0.5 ml tube is put in an incubator of about 65 ° C. or hot water to dissolve the solution, and then kept warm. Put 3-4 pieces of dried blood adhering filter paper pieces per 0.5 ml tube and heat at 100 ° C. for 10 minutes. Proceed to step (IV).

  (III) Method of using a coagulated blood clot: First, the 0.5 ml tube is placed in an incubator of about 65 ° C. or hot water to dissolve the solution, and then kept warm. Put the coagulated blood clot into the 0.5 ml tube of (1) with tweezers and heat at 100 ° C for 10 minutes. Proceed to step (IV).

  (IV) Add 208 μl of 6.2 M Urea / 2M Bisulfite (pH 5.0) and 12 μl of 10 mM Hydroquinone to the above microtube. Then, after covering well and stirring, spin down and layer 3 drops of mineral oil. After heating at 95 ° C for 5 minutes, [95 ° C for 1 min, 55 ° C for 1 hr] is performed for 20 cycles to perform the DNA conversion step.

  (V) Mixing the reaction solution with 750 μl of 6M NaI (sodium iodide) without removing mineral oil, 10 μl of Glassbeads is added to adsorb the DNA to Glassbeads. After centrifugation, the supernatant is discarded, and the DNA / Glassbeads complex is washed with a [10 mM Tris / HCl (pH 7.5) / 1 mM EDTA / 100 mM NaCl / 50% ethanol] solution. The supernatant is discarded, and 50 μl of 20 mM NaOH / 90% ethanol is added to the DNA / Glassbeads complex, which is reacted at 37 ° C. for 15 minutes to desulfonate the DNA. After washing the DNA / Glassbeads complex with 90% ethanol, the supernatant is discarded and the DNA is eluted with 30 μl of 10 mM Tris / HCl / 1 mM EDTA buffer. Thereafter, it is stored at −80 ° C.

  (VI) Use 2 μl of DNA in a PCR reaction system with a total volume of 20 μl. As a PCR primer, a PCR primer for methylated DNA detection (methylation-specific oligonucleotide primer) is used. PCR primers for detecting unmethylated DNA and PCR primers for detecting bisulfite-treated DNA are used as controls. At the same time, the bisulfite-treated human normal cell genomic DNA for PCR, the bisulfite-treated human hematopoietic tumor cell line genomic DNA for PCR, and the dry filter paper to which hematopoietic tumor cells for PCR are attached may be used.

  As described above, the methylated DNA detection method according to the present invention can be carried out simply and easily by using the methylated DNA detection kit according to the present invention.

(3) Disease determination method As described above, by using the methylated DNA detection method or the methylated DNA detection kit according to the present invention, the presence or absence of DNA methylation can be detected from a very small amount of cell sample. it can. For this reason, for example, abnormal expression of a gene is caused by DNA methylation, and the determination (diagnosis) of a disease caused as a result can be performed.

  That is, the disease determination method according to the present invention uses the method or kit of any one of the above-mentioned methylated DNA detection method and methylated DNA detection kit to detect the presence or absence of methylated DNA in a cell sample, Any method may be used as long as it is a method for determining a disease caused by abnormal gene expression due to DNA methylation or the onset possibility of the disease, and other specific methods and conditions are not particularly limited.

  According to the above method, when methylated DNA is present in a cell sample, it can be determined that the disease is caused by abnormal gene expression due to DNA methylation, or the disease can develop. It can be determined that the sex is high, and genetic diagnosis of the disease can be performed with high probability. This is because when a CpG sequence is present in the promoter region of a gene, cytosine (C) of the CpG sequence is methylated, thereby suppressing the expression of the gene, thereby causing various diseases. It is because it is thought that it will end. In addition, when the gene is, for example, a tumor suppressor gene, the disease is a cell proliferative disease such as cancer or tumor.

  In addition, in order to solve the above-described problem, the disease determination method according to the present invention uses any one of the above-described methylated DNA detection method and methylated DNA detection kit, or a kit, in a cell sample. By detecting the presence or absence of methylation of CpG-containing DNA present in the promoter region of multiple genes, the onset of a disease caused by abnormal gene expression due to the methylation of the DNA, or the onset of the disease It is characterized by judging sex.

  By monitoring multiple genes, especially a series of expression abnormalities related to the development of any disease, and comprehensively judging the results, the expression of the gene group that was overlooked in the monitoring of only one gene It is possible to determine the onset of a related disease or the possibility of its onset with higher accuracy and sensitivity.

  For example, the case where the said gene is a tumor suppressor gene or a cancer related gene is mentioned. The onset mechanism in cancer and the like is not caused by the involvement of a single gene, but by the involvement of a plurality of genes. Therefore, if a series of genes involved in the onset is monitored as described above and the results are comprehensively evaluated, it can be performed with high accuracy and high sensitivity such as diagnosis, classification, and prognosis estimation of disease types. .

  Specific examples of the tumor suppressor gene or cancer-related gene include SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, CDH13 gene, and the like. Such a gene is a gene involved in the development of hematopoietic cell tumors such as malignant lymphoma and leukemia. Therefore, it can be said that by monitoring abnormal expression of the plurality of genes, the onset of hematopoietic cell tumors such as malignant lymphoma and leukemia, or the possibility of the onset can be determined with higher accuracy and sensitivity. In addition, examples of tumor suppressor genes and cancer-related genes include p15, p14, DAPK, p73, CDH1, APC, GSTP1, anthrogen receptor, estrogen receptor, TGF-β1, TGF-β2, p130, BRCA, NF1, and NF2. , TSG101, MDG1, GST-pi, caltonin, HIC-1, endothelin B receptor, TIMP-2, TIMP-3, 06-MGMT, MLH1, MSH2, and GFAP.

  “Tumor suppressor gene” means a gene that suppresses the onset of cancer, and “cancer-related gene” means a gene involved in the onset of cancer.

In addition, when a cell sample containing a cell proliferative disease such as hematopoietic cells (cell sample containing hematopoietic cells) is used as the above cell sample, hematopoietic tumor and solid tumor or the possibility of developing those hematopoietic tumors Can be determined. That is, a very small amount of peripheral blood from a subject is collected, and by using the peripheral blood, a methylated DNA detection method or a methylated DNA detection kit is used, so that hematopoietic tumors and solid tumors or their hematopoietic organs can be obtained easily and quickly. The likelihood of developing a tumor can be determined.

  The “probability of disease” refers to an index indicating the risk of occurrence of a disease. If the probability of onset is high, the disease is more likely to occur, and conversely, if the probability of occurrence is low, it is difficult to become a disease. Is shown.

(4) Utilization of the present invention As described above, the methylated DNA detection method and the like according to the present invention can directly utilize an extremely small amount of cell specimen. Further, when the cell specimen is blood, it may be blood adsorbed on a filter paper or a coagulated blood clot. For this reason, by using the above-described blood collection kit or the like, many people can easily collect blood at home without relying on blood collection by a doctor, and by mailing the blood sample, it is possible to test for methylated DNA. A system capable of performing the disease determination method can be constructed.

  The methylated DNA detection system or disease determination system will be described with reference to FIG.

  The subject collects peripheral blood from the earlobe or fingertip using, for example, the blood collection kit at a non-medical institution such as home, school, or workplace. The collected blood is adsorbed on a filter paper or prepared as a coagulated blood clot and sent to a predetermined examination center.

  The subject can also be collected by a doctor at a medical institution such as a hospital. In this case, the collected blood is adsorbed on a filter paper, prepared as a coagulated blood clot, or sent to a testing center as non-coagulated blood (fresh blood). Note that a medical institution such as a hospital and an inspection center may be integrated.

  In the inspection center, the methylated DNA detection method of the present invention is performed. In this case, for example, the methylated DNA detection method of the present invention is preferably performed using the above-described methylated DNA detection kit. Moreover, a disease is determined (diagnosed) by the disease determination method of the present invention.

  According to the above-mentioned methylated DNA detection system or disease determination system, blood is not necessarily collected by a doctor, and DNA methylation or disease is determined (diagnosis) using peripheral blood collected at a non-medical institution such as a home. Therefore, genetic diagnosis of diseases such as cancer and tumor can be performed very efficiently and easily. In this case, it is preferable to use a system that attaches a written consent of the subject (examiner).

  Embodiments will be described below in more detail with reference to the accompanying drawings. Of course, the present invention is not limited to the following examples, and it goes without saying that various aspects are possible in detail. Further, the present invention is not limited to the above-described embodiments, and various modifications can be made within the scope shown in the claims, and the present invention is also applied to the embodiments obtained by appropriately combining the disclosed technical means. It is included in the technical scope of the invention.

[Example A] (Preliminary Experiment) Examination of Primer First, a preliminary experiment was conducted to examine whether the primer used in PCR amplification designed under the primer design conditions described above is practical. Specifically, for DNA obtained by treatment with bisulfite, a methylation-specific primer SHP1MSP, an unmethylation-specific primer SHP1UMSP and a bisulfite-treated DNA-specific primer BSP2 in the SHP1 gene promoter region are used. PCR was performed to verify the specificity of these primers.

(A-1) Preparation of DNA sample A DNA sample was prepared from the peripheral blood of 10 healthy individuals and 9 types of cultured hematopoietic tumor cells using the conventional Proteinase K / SDS method (Molecular Cloning, A Laboratory Manual, J. Sambrook, EFFritsch). , T. Maniatis, Cold Spring Harbor Laboratory Press). Hereinafter, a DNA sample purified from peripheral blood of a healthy person is simply referred to as healthy person DNA, and a DNA sample purified from nine types of hematopoietic tumor cultured cells is referred to as hematopoietic tumor DNA.

(A-2) Treatment with bisulfite The composition of the reagent used in the treatment with bisulfite is as follows.
・ Cleaning solution [10 mM Tris / HCl (pH 7.5) / 1 mM EDTA / 100 mM NaCl / 50% ethanol]
・ Desulfonating solution (20 mM NaOH / 90% ethanol)
-DNA elution buffer (10 mM Tris / HCl / 1 mM EDTA)
The DNA purified in the above column (A-1) was treated with 0.3N sodium hydroxide at 37 ° C. for 30 minutes to denature into single-stranded DNA (DNA denaturation stage), and then 6.2M Urea / 2M Sodium 208 μl of bisulfite (sodium bisulfite) solution and 12 μl of 10 mM hydroquinone were mixed, and 3 drops of mineral oil were overlaid. The above mixed solution was used as a reaction system. After reacting at 95 ° C. for 5 minutes, the reaction of “95 ° C. for 1 minute, 55 ° C. for 1 hour” was repeated 20 cycles (reaction stage with bisulfite). This reaction solution was mixed with 6M NaI (sodium iodide), 10 μl of Glassbeads was added, and the modified DNA was adsorbed on Glassbeads. After the mixture was centrifuged, the precipitated DNA / Glassbeads complex was washed with a washing solution. Next, a desulfonating solution was added to the DNA / Glassbeads complex and reacted at 37 ° C. for 15 minutes to desulfonate the DNA. Thereafter, the DNA / Glassbeads complex was washed with 90% ethanol, and then the DNA was eluted with a DNA elution buffer to prepare a modified DNA solution (modified DNA recovery stage).

(A-3) PCR amplification PCR amplification was performed on each of the modified DNA solutions using the methylation-specific primer SHP1MSP, the unmethylation-specific primer SHP1UMSP, and the bisulfite-treated DNA-specific primer BSP2. . Here, the methylation-specific primer SHP1MSP and the non-methylation-specific primer SHP1UMSP are primers designed for the base sequence including the CpG sequence of the primer region of the SHP1 gene, respectively.

  The bisulfite-treated DNA-specific primer BSP2 is a primer designed for a region not containing the CG sequence in the SHP1 gene, and has a base sequence obtained by converting cytosine in the base sequence to thymine. It is. The bisulfite-treated DNA-specific primer is a primer for confirming whether or not bisulfite treatment is appropriately performed.

  The base sequence of PCR primers and PCR reaction conditions for PCR amplification are as follows.

(i) Methylation specific primer SHP1MSP
MF2: 5'-GAA CGT TAT TAT AGT ATA GCG TTC (SEQ ID NO: 1)
MR2: 5'-TCA CGC ATA CGA ACC CAA ACG (SEQ ID NO: 2)
94 ° C 30 seconds, 58 ° C 1 minute, 72 ° C 1 minute 45 cycles
(ii) Unmethylated specific primer SHP1UMSP
UF22: 5'- GTG AAT GTT ATT ATA GTA TAG TGT TTG G (SEQ ID NO: 3)
UR22: 5'- TTC ACA CAT ACA AAC CCA AAC AAT (SEQ ID NO: 4)
94 ° C 30 seconds, 59 ° C 1 minute, 72 ° C 1 minute 45 cycles
(iii) Bisulfite-treated DNA-specific primer BSP2
MF4: 5'-GGG TTG TGG TGA GAA ATT AAT TAG (SEQ ID NO: 5)
MR4: 5'- CCT CAA ATA CAA CTC CCA ATA CC (SEQ ID NO: 6)
94 ° C for 30 seconds, 60 ° C for 1 minute, 72 ° C for 1 minute 45 cycles (A-4) Determination of the base sequence of the PCR product After making the PCR product a blunt end with T4 DNA polymerase, the end is phosphorylated with T4 polynucleotide kinase, An insert DNA fragment was prepared. The blunt-ended plasmid pBluescript and the inserted DNA fragment were ligated using T4 DNA ligase. The reaction solution was introduced into Escherichia coli DH5α by a known method, and the target plasmid was recovered from the ampicillin resistant strain obtained in the ampicillin-containing medium. This plasmid was fluorescently labeled with a BigDye sequence kit (Applied Biosystems), and the DNA base sequence was determined using an ABI3100 sequencer (Applied Biosystems).

(A-5) Results FIG. 4 shows analysis data obtained by electrophoresis of the PCR products obtained by the above method. FIGS. 4 (a)-(c) show electrophoresis of PCR products obtained by PCR using a methylation specific primer SHP1MSP, an unmethylation specific primer SHP1UMSP, and a bisulfite-treated DNA specific primer BSP2, respectively. The figure is shown. Lanes 1 to 10 show the results of PCR amplification for healthy human DNA, lanes 11 to 19 show the results of PCR amplification for hematopoietic tumor DNA, and lane 20 shows the results of performing the above method in the absence of a DNA sample. Lane M shows electrophoresis of molecular weight markers. FIG. 4 (d) shows the results of determining the DNA base sequence of the PCR product using the methylation specific primer SHP1MSP.

  As shown in lanes 1 to 10 of FIG. 4 (a), in PCR amplification using a methylation specific primer SHP1MSP and a normal human DNA as a template, a band corresponding to the molecular weight of the PCR product (hereinafter simply referred to as a band). Was not detected. In contrast, as shown in lanes 11 to 19 in FIG. 4A, bands were detected in PCR amplification using hematopoietic tumor DNA as template DNA.

  In order to confirm whether or not these PCR products are truly methylated DNA PCR products, the base sequences of the PCR products were determined. As shown in FIG. 4 (d), all the five CGs (parts drawn on the base sequence in the figure) existing in the PCR product were stored as CG, and all other Cs were From the conversion to T, it was shown that C of CG exists as methylcytosine.

  In addition, as shown in lanes 1 to 10 in FIG. 4 (b), bands were detected when the normal human DNA was amplified using the unmethylated specific primer SHP1UMSP. On the other hand, in the hematopoietic tumor DNA, there were those in which the PCR product bands by the above-mentioned primers were not detected (lanes 11, 12, 16) and those in which the bands were detected (lanes 13-15, 17-19). This suggests that methylated cells and unmethylated normal cells coexist in the hematopoietic tumor cultured cell specimen.

  Furthermore, as shown in FIG. 4 (c), the bisulfite-treated DNA-specific primer BSP2 is capable of performing PCR on both healthy human DNA and hematopoietic tumor DNA regardless of DNA methylation or unmethylation. Product bands can be detected. This indicates that unmethylated cytosine in the DNA base sequence is converted to uracil by bisulfite.

[Example B]
The lysis conditions for hematopoietic cells were examined.

(B-1) Cell Lysis Step A cell dilution obtained by diluting the bone marrow of a patient with myeloid leukemia with a RPMI1640 culture solution twice was used as a source of bone marrow tumor cells. Of these, 0.5 ml was used to extract and purify DNA by the above-mentioned Proteinase K / SDS method, and purified bone marrow cell DNA was prepared for control experiments.

  In addition, 25 μl of the cell dilution was dispensed, and each was added to (1) guanidine thiocyanate (GTC) solution, (2) sodium iodide solution, (3) urea solution, and (4) SDS solution. And dissolved at 100 ° C. for 10 minutes. Further, the same operation was performed for the purified bone marrow cell DNA.

  The composition and reaction system of the solutions (1) to (4) are as follows.

(1) Guanidine thiocyanate solution composition: 6.5M Guanidium Thiocyanate / 0.81% N-Lauroylsarcosine sodium salt / 40.63 mM Sodium Citrate / 163 mM β-mercaptoethanol (pH 7.0)
The solution having the above composition is referred to as a 6.5M GTC solution and used in this reaction system. A 65 μl system obtained by adding 40 μl of this 6.5 MGTC lysate to 25 μl of the cell dilution was used as a reaction system, and heated at 100 ° C. for 10 minutes (cell sample lysate). Therefore, the final concentration of GTC contained in this cell sample lysate is 4M.

(2) Sodium iodide solution composition: 6M NaI (pH11)
A sodium iodide solution having the above composition is used in this reaction system. A reaction system was prepared by adding 25 μl of a sodium iodide solution having the above composition to 25 μl of the cell dilution, and heated at 100 ° C. for 10 minutes (cell sample solution). Therefore, the final concentration of sodium iodide contained in this cell sample lysate is 3M.

(3) Urea solution composition: 6M Urea (pH11)
A urea solution having the above composition is used in this reaction system. A reaction system was prepared by adding 25 μl of the urea solution of the above composition to 25 μl of the cell dilution, and heated at 100 ° C. for 10 minutes (cell sample solution). Therefore, the final concentration of urea contained in the cell sample lysate is 3M.

(4) SDS solution composition: 1.25% SDS (sodium dodecyl sulfate)
An SDS solution of the above composition is used in this reaction system. A reaction system was prepared by adding 20 μl of an SDS lysis solution having the above composition to 25 μl of the cell dilution, and heated at 100 ° C. for 10 minutes (cell sample lysis solution). Therefore, the final concentration of SDS contained in this cell sample lysate is 0.5%.

(B-2) Treatment with bisulfite The treatment with the bisulfite was directly performed on the cell sample lysate subjected to the lysis treatment using the lysis solutions of (1) to (4) described above. The cell sample lysate treated with the lysate of (1) to (3) is not subjected to the DNA denaturation step with sodium hydroxide performed in the preliminary experiment, but the reaction step with bisulfite and the modified DNA. A modified DNA solution was prepared only by the recovery step. For the cell sample lysate treated with the lysate (4), a modified DNA solution was prepared by the DNA denaturation step, the bisulfite reaction step, and the modified DNA recovery step performed in preliminary experiments.

(B-3) PCR amplification Each DNA solution treated with bisulfite in (B-2) was subjected to PCR amplification under the same conditions as in the preliminary experiment using the methylation specific primer SHP1MSP. The PCR product was electrophoresed to detect the presence or absence of a band corresponding to the molecular weight of the PCR product.

(B-4) Results FIG. 5 shows an electrophoretogram of the PCR product. The presence of methylated DNA in the SHP1 gene in these bone marrow tumor cells was confirmed by PCR amplification using the methylated specific primer SHP1MSP using the DNA purified for the control experiment in the cell lysis step as a template. ing.

  Lanes 1 to 4 represent the methylated DNA detection results when the cell dilutions were treated with the lysis solutions (1) to (4), respectively. Lanes 5 to 8 are control experiments in which DNA purified from bone marrow cells was treated in the same manner using the lysis solutions (1) to (4). Lane 9 shows the results when the purified bone marrow cell DNA is not subjected to cell lysis treatment.

  As shown in lanes 1 and 2 of FIG. 5, when (1) GTC lysate and (2) sodium iodide lysate were used as lysates, PCR was performed without extracting and purifying DNA from cell dilutions. A product band was observed, whereby methylated DNA of the SHP1 gene could be detected. Accordingly, it has been found that it is preferable to use a lysis solution containing GTC or NaI as a lysis solution for dissolving a cell specimen.

[Example C]
It was investigated whether or not it was possible to detect whether or not the SHP1 gene in bone marrow cells was methylated using bone marrow fluid that had been adsorbed onto filter paper and dried.

(C-1) Cell lysis pre-treatment 25 μl of the cell diluent used in Example B was obtained from (1) chromatography paper (Wattmann 3MM), (2) dried blood collection filter paper (Advantic Toyo), (3) DEAE (Diethylaminoethyl) filter (Wattmann DE81 paper), (4) Nylon membrane (Amersham Hybond-N +), and (5) Nylon membrane (Ato Clear Plot Membrane-p) small piece (2mm x 4mm) After drying and allowing to stand for 3 weeks at room temperature, filter paper-adsorbed cell samples (1) to (5) were prepared.

(C-2) Cell Lysis Step A 6.5MGTC solution was used as the solution. Each of the filter papers to which the cell specimens (1) to (5) above were adsorbed was added to 40 μl of the 6.5 MGTC solution and heated at 100 ° C.

(C-3) Treatment with bisulfite For the cell specimen adsorbed on the filter paper of (1) to (5) above, the DNA denaturation step with sodium hydroxide performed in the above preliminary experiment was not performed. A modified DNA solution was prepared only by the sulfite reaction step and the modified DNA recovery step.

(C-4) PCR amplification The sample obtained by the above treatment with bisulfite was subjected to PCR under the same conditions as in Example B above.

(C-5) Results FIG. 6 shows an electrophoretogram of the PCR products of the filter paper-adsorbed cell samples (1) to (5). Lanes 1 to 5 are detection results by PCR for the filter paper-adsorbed cell samples (1) to (5), respectively. Lane (6) is a positive control in which purified bone marrow cell DNA was treated with bisulfite and PCR amplification was performed. Lane (7) was purified bone marrow cell DNA untreated with bisulfite and subjected to PCR amplification. Negative control.

  As shown in FIG. 6, in lanes (1) and (2), bands were detected and methylated DNA of the SHP1 gene could be detected. Also in lane (5), a weak PCR product band was detected, and methylated DNA of the SHP1 gene could be detected. From these results, the presence or absence of DNA methylation in the cell specimen can be detected even in the case of a cell specimen in which bone marrow fluid is adsorbed on the filter paper of (1), (2), and (5) and dried. I knew it was possible.

Example D
Next, the concentration suitable for cell lysis of the GTC lysate in the cell lysis process was examined.

(D-1) Cell Lysis Pretreatment Step Filter paper adsorbed cell specimen (1) was prepared in the same manner as in Example C using the filter paper used in Example C above (1) Chromatographic filter paper (Wattmann 3MM). .

(D-2) Cell Lysis Step 25 μl of the cell dilution is added so that the final concentration of GTC is (1) 4M, (2) 3.25M, (3) 2M, and (4) 0.8M. A cell specimen lysate was prepared. The cell specimen adsorbed on the filter paper of (1) above was added so that the final concentration of GTC was (5) 6.5M and (6) 4M to prepare a cell specimen lysate. The cell sample lysate having the above final concentrations (1) to (6) was heated at 100 ° C. for 10 minutes.

  Table 1 shows the composition of the cell sample lysate having the final GTC concentrations (1) to (6) and the lane numbers of the electropherogram of FIG.

  The cell dilution solution prepared in Example B was used as the cell dilution solution.

(D-3) Treatment with bisulfite The same procedure as in Examples B and C above was performed on the cell sample lysate obtained in the cell lysis step and having a final GTC concentration of (1) to (6). It was.

(D-4) PCR amplification The sample obtained by the above treatment with bisulfite was subjected to the same operation as in Example B above.

(D-5) Results FIG. 7 shows an electrophoretogram of the PCR products of the cell sample lysates (1) to (6) above. Lanes 1 to 6 are detection results when the cell sample lysates of (1) to (6) above are used (see Table 1, lane numbers). Lane 7 is a positive control in which purified bone marrow cell DNA was treated with bisulfite and subjected to PCR amplification, and lane 8 was a negative control in which purified bone marrow cell DNA was subjected to PCR amplification without treatment with bisulfite. is there. M represents a molecular weight marker.

  As a result, as shown in lanes 1 to 4 in FIG. 7, for the cell sample lysate having a final GTC concentration of (1) to (4), only when the final concentration is (1) 4M, It was observed. In addition, as shown in lanes 5 and 6 of FIG. 7, bands were confirmed for the cell sample lysates with final GTC concentrations of (5) and (6). From the above, it was found that when the methylated DNA of the SHP1 gene is detected directly using the above cell diluent, the final concentration of GTC is required to be at least 4M. On the other hand, in the case of using the adsorbed cell specimen adsorbed on the filter paper and dried, it was found that the methylated DNA of the SHP1 gene can be detected if the final concentration of GTC is 6.5M or 4M.

Example E
When using peripheral blood of healthy volunteers (hereinafter referred to as healthy persons A and B) as a cell sample, (a) when using fresh blood directly, (b) blood adsorbed and dried on filter paper Whether or not peripheral blood DNA can be detected when using (c) coagulated blood was examined.

(E-1) Preparation of cell specimen Peripheral blood of healthy volunteers A and B was collected from the brachial vein and earlobe. As a cell sample in the case of (b), 5 μl of the peripheral blood was adsorbed and dried on a chromatography filter paper (Whatman 3MM) in the same manner as in Example C, and a filter paper adsorbed cell sample was used. In the case of (c), 20 μl of the peripheral blood was allowed to stand for 1 month to coagulate, and a coagulated blood clot was used.

(E-2) Cell Lysis Step GTC lysate is added to the peripheral blood of healthy persons A and B, and the filter paper adsorbed cell specimen and the coagulated blood clot prepared in (E-1) above, and heated at 100 ° C. for 10 minutes. A cell sample lysate was prepared. Table 2 shows the composition of various cell specimen lysates.

  In the table, “directly” refers to the case where peripheral blood of healthy subjects is used as it is. The “filter paper adsorbed specimen” and “coagulated blood clot” refer to the filter paper adsorbed cell specimen and the coagulated blood clot prepared in the above (E-1), respectively.

(E-3) Treatment with bisulfite The same operation as in Example C was performed on the cell sample lysate obtained in the cell lysis step.

(E-4) PCR amplification The DNA solution obtained by the treatment with bisulfite was subjected to PCR amplification in the same manner as in the preliminary experiment (Example A) using the bisulfite-treated DNA-specific primer BSP2. . The PCR product was electrophoresed to detect the presence or absence of a band corresponding to the molecular weight of the PCR product.

(E-5) Results FIG. 8 shows an electrophoretogram of the PCR products obtained as a result of the PCR amplification. In addition, in the electrophoretic diagram of FIG. 8, the types of cell sample lysates and the corresponding lane numbers are shown in Table 3.

“Purified DNA ^(a) ” in the table refers to DNA purified from the peripheral blood of healthy human B by the conventional proteinase K / SDS method.

  As shown in FIG. 8, when the peripheral blood of a healthy person is used directly (1), a PCR product band can be seen in a 5 μl amount (lanes 2, 8, 12), but the PCR product band is thin in a 1 μl amount. (Lanes 1, 7, and 11). In addition, when the peripheral blood of a healthy person was adsorbed on (2) filter paper, bands of PCR products were seen (lanes 5, 6, 9, and 13). At this time, even if the final concentration of GTC was 6.5M or 4M, bands of PCR products were observed (lanes 5 and 6). Furthermore, when healthy human peripheral blood was coagulated (3), a PCR product band was also observed (lane 10).

  From the above, (1) When using peripheral blood directly, it was possible to detect peripheral blood DNA treated with bisulfite when using at least 5 μl of peripheral blood, but even at least 1 μl could be detected. It was. In addition, peripheral blood DNA could be detected both when (2) the adsorbed and dried filter paper was used and (3) when the coagulated one was used.

[Example F]
Detection of methylation of the SHP1 gene using directly peripheral blood collected from 2 hematopoietic tumor patients (hereinafter referred to as patients A and B) and 2 healthy persons (hereinafter referred to as healthy persons C and D) did.

(F-1) Cell Lysis Step 40 μl of 6.5 M GTC lysate was added to 5 μl of peripheral blood collected from patients A and B and healthy subjects C and D, and heated at 100 ° C. for 10 minutes. At this time, the final concentration of GTC is 5.8M.

(F-2) Treatment with bisulfite The same operation as in Example B was performed on the cell sample lysate obtained in the cell lysis step.

(F-3) PCR amplification For the modified DNA solution obtained by treatment with bisulfite, the same bisulfite-treated DNA-specific primer SHP1BSP2 and methylation-specific primer SHP1MSP were used. PCR amplification was performed under conditions. The PCR product was electrophoresed to detect the presence or absence of a band corresponding to the molecular weight of the PCR product.

(F-4) Results FIG. 9 shows an electrophoretogram of the PCR product obtained as a result of the PCR amplification. In addition, in the electropherogram of FIG. 9, the types of peripheral blood samples and the corresponding lane numbers are shown in Table 4.

  As shown in FIG. 9, when PCR amplification was performed using the bisulfite-treated DNA-specific primer SHP1BSP2, a band of PCR products was observed in the peripheral blood of patients A and B and healthy persons C and D (lanes). 1-4). On the other hand, when PCR amplification was performed using the methylation specific primer SHP1MSP, a PCR product band was observed in the peripheral blood of patient B (lane 6), and a thin PCR product band was observed in the peripheral blood of patient A. It was seen (lane 5). Further, no PCR product band was observed in the peripheral blood of healthy humans C and D (lanes 7 and 8).

  From the above, it was found that the presence or absence of methylation of the SHP1 gene can be detected from the blood of a hematopoietic tumor patient.

[Example G]
Peripheral blood collected from the above patients A and B and healthy persons C and D was directly used to detect methylated DNA of the p16Ink4a gene, which is a tumor suppressor gene different from the SHP1 gene.

(G-1) Cell Lysis Step 40 μl of 6.5 M GTC lysate was added to 5 μl of peripheral blood collected from patients A and B and healthy subjects C and D, and heated at 100 ° C. for 10 minutes. At this time, the final concentration of GTC is 5.8M.

(G-2) Treatment with bisulfite The same operation as in Examples B and C was performed on the cell sample lysate obtained in the cell lysis step.

(G-3) PCR amplification PCR amplification was performed on each of the modified DNA solutions using the methylation specific primer p16Ink4aMSP and the unmethylation specific primer p16Ink4aUMSP, respectively.

The nucleotide sequence of the PCR amplification primer is shown below. The PCR reaction conditions were all “94 ° C. 30 seconds, 63 ° C. 1 minute, 72 ° C. 1 minute 45 cycles”.
・ Methylation specific primer p16Ink4aMSP
Ink4a-MS1: 5'-TTA TTA GAG GGTGGG GCG GAT CGC (SEQ ID NO: 7)
Ink4a-MAS1: 5'-GAC CCC GAA CCG CGA CCG TAA (SEQ ID NO: 8)
Unmethylated specific primer p16Ink4aUMSP
US1: 5'-TTA TTA GAG GGT GGG GTG GAT TGT (SEQ ID NO: 9)
UAS1: 5'-CAA CCC CAA ACC ACA ACC ATA A (SEQ ID NO: 10)
(G-4) Results FIG. 10 shows an electrophoretogram of the PCR product obtained as a result of the PCR amplification. In addition, in the electropherogram of FIG. 10, the types of peripheral blood samples and the corresponding lane numbers are shown in Table 5.

  As shown in FIG. 10, when PCR amplification was performed using the p16Ink4a gene as a template using the unmethylated specific primer p16Ink4aUMSP, the bands of PCR products were observed in the peripheral blood of patients A and B and healthy individuals C and D. (Lanes 5-8). On the other hand, when PCR amplification was carried out using the p16Ink4a gene as a template using the methylation specific primer p16Ink4aMSP, a band of the PCR product was seen in the peripheral blood of patients A and B (lanes 1 and 2). No PCR product band was observed in peripheral blood of CD (lanes 3 and 4).

  From the above, it was found that the p16Ink4a gene was methylated in the blood of hematopoietic tumor patients, and it was possible to detect the presence or absence of methylation of the p16Ink4a gene by the methylation detection method.

[Example H]
CpG-containing DNA present in the promoter region of a series of genes (SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, CDH13 gene) that are frequently inactivated in malignant lymphoma / leukemia for various hematopoietic tumor cultured cells The presence or absence of methylation of was detected.

(H-1) Hematopoietic tumor cultured cells For examination of methylation, hematopoietic tumor cultured cells: NK-YS, KCA, K562, BALL1, RPMI8226, MT1, Daudi, and HDLM2.

  NK-YS is a cultured cell derived from NK cell lymphoma.

  KCA is a cultured cell derived from chronic myelogenous leukemia (CML).

  K562 is a cultured cell derived from chronic myelogenous leukemia (CML).

  BALL1 is a cultured cell derived from B cell acute lymphoblastic leukemia (ALL).

  RPMI8226 is a cultured cell derived from multiple myeloma.

  MT1 is a cultured cell derived from adult T cell leukemia lymphoma.

  Daudi is a cultured cell derived from Burkitt lymphoma.

HDLM2 is a cultured cell derived from Hodgikin disease.
(H-2) Method Preparation of DNA samples from the various hematopoietic tumor cultured cells, treatment with bisulfite, PCR amplification, and the like were performed according to the method described in [Example A]. For detection, methylation was detected using methylation-specific primers for various target genes. The following are various methylation specific primers.

(1) Methylation-specific primer for SHP1 gene The methylation-specific primers described in SEQ ID NOs: 11 and 12 were used.

PTP1C-MF2-2: TGTGAACGTTATTATAGTATAGCG (SEQ ID NO: 11)
PTP1C-MR2-2: CCAAATAATACTTCACGCATACG (SEQ ID NO: 12)
(2) Methylation-specific primer for p16Ink4a gene The methylation-specific primer p16Ink4aMSP described in SEQ ID NOs: 7 and 8 was used.

Ink4a-MS1: 5'-TTA TTA GAG GGTGGG GCG GAT CGC (SEQ ID NO: 7)
Ink4a-MAS1: 5'-GAC CCC GAA CCG CGA CCG TAA (SEQ ID NO: 8)
(3) Methylation specific primer for p15Ink4b gene The methylation specific primer described in SEQ ID NOs: 13 and 14 was used.

Ink4b-MF1: 5'-GCGTTCGTATTTTGCGGTT (SEQ ID NO: 13)
Ink4b-MR1: 5'-CGTACAATAACCGAACGACCGA (SEQ ID NO: 14)
(4) Methylation specific primer for CDH1 gene The methylation specific primers described in SEQ ID NOs: 15 and 16 were used.

ECADMF: TTAGGTTAGAGGGTTATCGCGT (SEQ ID NO: 15)
ECADMR: TAACTAAAAATTCACCTACCGAC (SEQ ID NO: 16)
(5) Methylation specific primer for CDH13 gene The methylation specific primers described in SEQ ID NOs: 17 and 18 were used.

HCADMF: TCGCGGGGTTCGTTTTTCGC (SEQ ID NO: 17)
HCADMR: GACGTTTTCATTCATACACGCG (SEQ ID NO: 18)
(H-3) Results FIG. 12 shows an electrophoretogram of PCR products performed for detecting the methylation of various genes for the various hematopoietic tumor cultured cells.

  Fig. 12 (a) is a diagram examining methylation of the SHP1 gene, Fig. 12 (b) is a diagram examining methylation of the p16Ink4a gene, and Fig. 12 (c) is a diagram examining methylation of the p15Ink4b gene. The figure (d) is the figure which examined methylation of CDH1 gene, and the figure (e) is the figure which examined methylation of CDH13 gene. Lane 1 shows a marker, Lane 2 is NK-YS, Lane 3 is KCA, Lane 4 is K562, Lane 5 is BALL1, Lane 6 is RPMI 8226, Lane 7 is MT1, Lane 8 is Daudi, and Lane 9 is HDLM2. Lane 10 shows the results of PBMC.

  In NK-YS in lane 2, methylation was detected in all of SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, and CDH13 gene. From the fact that the band of the p16Ink4a gene is deeper than that of SHP1, it can be said that the use of the p16Ink4a gene may increase the efficiency of tumor cell detection.

  In KCA in lane 3, methylation was detected in the SHP1 gene, p16Ink4a gene, p15Ink4b gene, and CDH13 gene. Since the bands of the p16Ink4a gene, the p15Ink4b gene, and the CDH13 gene are darker than the SHP1 gene, it can be said that the use of the p16Ink4a gene, the p15Ink4b gene, and the CDH13 gene shows a possibility of increasing the tumor cell detection efficiency.

  In K562 in lane 4, methylation was detected in the SHP1 gene / CDH1 gene / CDH13 gene. From the fact that the band of the SHP1 gene is the deepest, it can be said that the use of the SHP1 gene indicates the possibility of increasing the efficiency of tumor cell detection.

  In BALL1 in lane 5, methylation was detected in the SHP1 gene, CDH1 gene, and CDH13 gene. It can be said that the use of the CDH1 gene / CDH13 gene has the potential to increase the efficiency of tumor cell detection because the bands of the CDH1 gene / CDH13 gene are deeper than those of the SHP1 gene.

  In RPMI8226 in lane 6, methylation was detected in the SHP1 gene, p16Ink4a gene, and CDH1 gene. From the fact that the band of the p16Ink4a gene is deeper than that of the SHP1 gene, it can be said that the use of the p16Ink4a gene has the potential to increase the efficiency of tumor cell detection.

  In MT1 in lane 7, methylation was detected in the SHP1 gene, p16Ink4a gene, and CDH1 gene. From the fact that the band of the p16Ink4a gene is deeper than that of the SHP1 gene, it can be said that the use of the p16Ink4a gene has the potential to increase the efficiency of tumor cell detection.

  In Daudi in lane 8, methylation was detected in the SHP1 gene, p16Ink4a gene, CDH1 gene, and HCAD gene. From the fact that the band of the SHP1 gene / p16Ink4a gene is deep, it can be said that the use of the SHP1 gene / p16Ink4a gene may increase the efficiency of tumor cell detection.

  In HDLLM2 in lane 9, methylation was detected in the SHP1 gene, p16Ink4a gene, CDH1 gene, and CDH13 gene. From the fact that the band of the SHP1 gene / p16Ink4a gene is deep, it can be said that the use of the SHP1 gene / p16Ink4a gene may increase the efficiency of tumor cell detection.

  In PBMC (normal peripheral blood mononuclear cells) in lane 10, no methylation was detected for all genes.

  As shown in the above results, no methylation-specific band is detected in PBMC (normal peripheral blood mononuclear cells), whereas methylation is detected in any gene in hematopoietic tumor cultured cells. . By creating a methylation panel of these various hematopoietic tumor genes, it is possible to increase the accuracy and sensitivity of hematopoietic tumor cell detection. Furthermore, it is considered that the relationship with prognosis can be estimated by analyzing these genes.

Example I
CpG-containing DNA present in the promoter region of a series of genes (SHP1 gene, p16Ink4a gene, p15Ink4b gene, CDH1 gene, CDH13 gene) that are frequently inactivated in malignant lymphoma / leukemia for various hematopoietic tumor patient specimens The presence or absence of methylation of was detected.

(I-1) Hematopoietic Tumor Patient Specimen For the examination of methylation, hematopoietic tumor patient specimens # 1-14 were used.

  Normal peripheral blood mononuclear cells were used as PBMC.

(I-2) Method Preparation of DNA samples from the above various hematopoietic tumor patient specimens, treatment with bisulfite, PCR amplification and the like were performed according to the method described in [Example A]. For detection, methylation was detected using methylation-specific primers for various target genes. The following are various methylation specific primers.

(1) Methylation-specific primer for SHP1 gene The methylation-specific primers described in SEQ ID NOs: 11 and 12 were used.

PTP1C-MF2-2: TGTGAACGTTATTATAGTATAGCG (SEQ ID NO: 11)
PTP1C-MR2-2: CCAAATAATACTTCACGCATACG (SEQ ID NO: 12)
(2) Methylation-specific primer for p16Ink4a gene The methylation-specific primer p16Ink4aMSP described in SEQ ID NOs: 7 and 8 was used.

Ink4a-MS1: 5'-TTA TTA GAG GGTGGG GCG GAT CGC (SEQ ID NO: 7)
Ink4a-MAS1: 5'-GAC CCC GAA CCG CGA CCG TAA (SEQ ID NO: 8)
(3) Methylation specific primer for p15Ink4b gene The methylation specific primer described in SEQ ID NOs: 13 and 14 was used.

Ink4b-MF1: 5'-GCGTTCGTATTTTGCGGTT (SEQ ID NO: 13)
Ink4b-MR1: 5'-CGTACAATAACCGAACGACCGA (SEQ ID NO: 14)
(4) Methylation specific primer for CDH1 gene The methylation specific primers described in SEQ ID NOs: 15 and 16 were used.

ECADMF: TTAGGTTAGAGGGTTATCGCGT (SEQ ID NO: 15)
ECADMR: TAACTAAAAATTCACCTACCGAC (SEQ ID NO: 16)
(5) Methylation specific primer for CDH13 gene The methylation specific primers described in SEQ ID NOs: 17 and 18 were used.

HCADMF: TCGCGGGGTTCGTTTTTCGC (SEQ ID NO: 17)
HCADMR: GACGTTTTCATTCATACACGCG (SEQ ID NO: 18)
(I-3) Results FIG. 13 shows an electrophoretogram of PCR products performed for detecting the methylation of various genes for the above various hematopoietic tumor patient specimens.

  FIG. 13a is a diagram examining methylation of the SHP1 gene, FIG. 13b is a diagram examining methylation of the CDH1 gene, FIG. 13c is a diagram examining methylation of the CDH13 gene, and FIG. Is a diagram examining methylation of the 15Ink4b gene, and FIG. E is a diagram examining methylation of the p16Ink4a gene. Lanes 1 to 14 are the results of analysis using a patient sample, and 15 is a result of analysis using a normal human peripheral blood mononuclear cell sample (PBMC).

  In the patient sample in lane 1, methylation was detected in the SHP1 gene / p16Ink4a gene. It can be said that the use of the p16Ink4a gene in combination with the SHP1 gene alone has the potential to increase the tumor cell detection efficiency.

  In lanes 2, 3 and 7, methylation was not detected in the SHP1 gene, but methylation was detected in other p16Ink4a gene, p15Ink4b gene, CDH1 gene and CDH13 gene. This indicates that tumor cells that were not detected by methylation of the SHP1 gene can be detected with high accuracy and high sensitivity by combining with these genes.

  In the specimens in lanes 4, 5, 6, 8, 9, 10, 11, 12, 13, and 14, clear methylation of the SHP1 gene was detected. Indicates that confirmation can be made.

  In PBMC in lane 15 (normal peripheral blood mononuclear cells), no methylation was detected for all genes.

  As shown in the above results, no methylation-specific band is detected in PBMC (normal peripheral blood mononuclear cells), whereas methylation is detected in any gene in hematopoietic tumor cultured cells. . By creating a methylation panel of these various hematopoietic tumor genes, it is possible to increase the accuracy and sensitivity of hematopoietic tumor cell detection. Furthermore, it is considered that the relationship with prognosis can be estimated by analyzing these genes.

  As described above, according to the methylated DNA detection method according to the present invention, DNA methylation can be performed easily and with high accuracy by directly using a very small amount of cell specimen without going through a DNA extraction step such as protein purification. There is an effect that it can be detected.

  Moreover, according to the methylated DNA detection kit which concerns on this invention, there exists an effect that the said methylated DNA detection method can be implemented simply and easily.

  Furthermore, by using the above-mentioned methylated DNA detection method or methylated DNA detection kit, various diseases or diseases caused by abnormal gene expression due to DNA methylation can be efficiently and highly probable. The effect is that it can be determined (diagnostic).

  Therefore, the present invention can be used in the medical industry. Further, if the methylation detection kit according to the present invention is used as a screening means, it is possible to develop pharmaceuticals such as cancer suppressors and use them in the pharmaceutical industry. It also contributes to basic research on diseases such as cancer. For this reason, it can be said that this invention is an important invention with a very strong social impact.

It is a reaction diagram which shows typically the reaction which DNA converts by a bisulfite process. It is a figure which shows typically a mode that the methylated cytosine is not changed by bisulfite treatment, but the unmethylated cytosine is converted into uracil by bisulfite treatment. (A) is a figure explaining the base sequence of an unmethylated specific primer, (b) is a figure explaining the base sequence of a methylated DNA specific primer. (A) to (c) are electropherograms of PCR products obtained by PCR using a methylation-specific primer SHP1MSP, an unmethylation-specific primer SHP1UMSP, and a bisulfite-treated DNA-specific primer BSP2, respectively. (D) is a figure which shows the result of having determined the DNA base sequence of the PCR product using the methylation specific primer SHP1MSP. It is a figure which shows the result of the electrophoresis of the PCR product in this Example B. It is a figure which shows the result of the electrophoresis of the PCR product in this Example C. It is a figure which shows the result of the electrophoresis of the PCR product in this Example D. It is a figure which shows the result of the electrophoresis of the PCR product in this Example E. It is a figure which shows the result of the electrophoresis of the PCR product in this Example F. It is a figure which shows the result of the electrophoresis of the PCR product in this Example G. 1 is a block diagram schematically illustrating a methylated DNA detection system and a disease determination system in the present embodiment. It is a figure which shows the result of the electrophoresis of the PCR product in this Example H. It is a figure which shows the result of the electrophoresis of the PCR product in this Example I.

Claims (8)

A cell lysis step of preparing a cell sample lysate by lysing the cell sample with a lysis solution;
A DNA conversion step of treating a cell sample lysate obtained by the cell lysis step with a bisulfite-containing reagent and converting unmethylated cytosine in the base sequence of the CpG-containing DNA contained in the cell sample lysate to uracil. When,
A DNA amplification step of amplifying the CpG-containing DNA obtained by the DNA conversion step by a polymerase chain reaction using a predetermined methylation-specific oligonucleotide primer;
And a methylation detection step for detecting whether or not the CpG-containing DNA is amplified by the DNA amplification step,
The method for detecting methylated DNA, wherein the solution is a solution containing guanidine thiocyanate or sodium iodide.   The DNA amplification step further comprises a step of amplifying the CpG-containing DNA obtained by the DNA conversion step by a polymerase chain reaction using a predetermined unmethylated specific oligonucleotide primer. The method for detecting methylated DNA according to 1.   The method for detecting methylated DNA according to claim 1 or 2, wherein the CpG-containing DNA is present in a promoter region of a gene.   The method for detecting methylated DNA according to claim 3, wherein the gene is a tumor suppressor gene or a cancer-related gene.   The method for detecting methylated DNA according to claim 3 or 4, wherein the gene is an SHP1 gene, a p16Ink4a gene, a p15Ink4b gene, a CDH1 gene, or a CDH13 gene.   The method for detecting methylated DNA according to any one of claims 1 to 5, wherein the cell sample is a cell sample containing hematopoietic cells.   The cell sample is a cell sample selected from at least one of blood, blood adsorbed on a carrier, coagulated blood clot, bone marrow fluid, and bone marrow fluid adsorbed on a carrier. 7. The method for detecting methylated DNA according to any one of 6 above.   The method for detecting methylated DNA according to any one of claims 1 to 7, wherein the bisulfite-containing reagent is a reagent containing sodium bisulfite.

Images