JP3927975B2 - Oil body proteins for carriers of high-value peptides in plants - Google Patents

Description

  The present invention relates to a method for producing a protein of interest by recombinant means, which can be easily purified from host cell components. The present invention is exemplified by expressing a protein of interest in a plant, particularly in a seed, as an oil body protein and a chimeric peptide containing the protein of interest.

  Various proteins have been expressed in plants. However, while it has been shown that methods for obtaining expression of foreign proteins in plants have been generally possible, obtaining purified proteins from this source has some limitations. These limitations include the purification steps necessary to obtain a pure protein that is substantially free of plant-derived material, and this purification when the resulting recombinant protein is in contact with an aqueous buffer. There is degradation that can occur in the extract produced during the process.

  Plants that retain oil seeds, such as soybeans, rapeseed, sunflower, and many other plant species such as corn, carrots, store triglycerides in their seeds. In this plant, these triglycerides act as an energy source for germinating seeds and subsequent seedlings. This triglyceride is widely used in food products, during the production of food products, and as a vegetable oil for some industrial applications.

  Triglycerides are immiscible with water and are immiscible with the compartments by floating on the surface of an aqueous solution or by forming small spheres or liposomes as a suspension in this aqueous phase. Such spheroids will coalesce naturally if not stabilized by a modified surface layer. This coalescence can result in a suspension of spheres of various sizes. In seeds, when storing triglycerides, the oil globules are actually usually encapsulated lipids or oil bodies of uniform size. Associating with the surface of these oil bodies is a half-unit film interspersed with several proteins, and is generally called oil body proteins.

At least one family of oil body proteins has several properties that are highly conserved among species. This family of oil body proteins is called "oleosin". The hydrophilic N- or C-termini of these proteins appear to be quite dispersed, while this lipophilic inner region (central core) appears to be highly conserved among species. This oleosin associates strongly with the oil bodies; this strong association to the oil bodies appears to be due primarily to the lipophilicity of these central cores. Accordingly, it is of interest to determine whether oil body proteins such as oleosins can be useful in the production of recombinant proteins by providing a method for separating recombinant proteins from plant-derived materials.
Related Literature The production of exogenous (recombinant) peptides in plants has been studied using a variety of approaches, including strong constitutive plant promoters [eg, cauliflower mosaic virus from -Sijmons et al., 1990 "Bio / Technology" 8: 217-221] and transcriptional fusion using foreign protein encryption; transcriptional fusion with organ-specific sequences [Radke et al., 1988, "Theoret. Appl. Genet. 75: 685-694]; and subsequent transcriptional fusions that require cleavage of the recombinant protein (VanderKelcove et al., 1989, “Bio / Technology” 7: 929-932). . Examples of foreign proteins that have been expressed in plant cells include bacteria (Fraley et al., 1983, “Proc. Nat'l. Acad. Sci. USA” 80: 4803-4807), animals [Misra ( Misra and Gedamu 1989, “Theor. Appl. Genet.” 78: 161-168], fungi and other plant species (Fraley et al., 1983, “Proc. Nat'l. Acad. Sci. USA "80: 4803-4807]].

  Some proteins, usually incorporated markers, have been expressed in a tissue-specific manner, some of which are mentioned in seeds [Sen Gupta-Gopalan et al., 1985, “Proc Nat'l. Acad. Sci. USA "82: 3320-3324: Radke et al., 1988," Theore. Appl. Genet., "75: 685-694]. These reports are particularly focused on using the seed storage protein promoter as a means to drive seed specific expression. Using such a device, VanderKelcove et al., 1989 “Bio / Technology” 7: 929-932, found that high-value peptides (leu- Enkephalin) was expressed. The yield of this peptide is very low, but indicates the potential for expression of animal peptide hormones in plant tissue. Corn oleodine was expressed in the seed oil body in “Brassicanapus” transformed with the corn oleodine gene. This gene was expressed under the control of regulators from the “Brassica” gene, which encodes the major seed storage protein napin. This temporal regulation of tissue expression and tissue specificity was reported to be correct with respect to the promoter / terminator of the napin gene. See Lee et al., "Proc. Nat'l. Acad. Sci." (USA) 1991: 88: 6181-6185.

  The oil globules produced in the seeds all appear to be of similar dimensions, indicating that they are stabilized [Huang A. et al. H. C, 1985, “Modern Methods of Plant Analysis: Modern meths. Plant Analysis”, pp. 145-151, Springer-Berlag Berlin]. Upon closer inspection, it was discovered that these are not just oil spheres, but rather oil bodies surrounded by a membrane. These oil bodies have been named variously by micrographers, such as oleosomes, lipid bodies and spherosomes [Gurr MI. 1980, The Biochemistry of Plants, 4: 205-248, Acad. Press Orlando Fla]. A few species of oil bodies have been studied, and this general conclusion is that they are encapsulated by an unusual “half-unit” membrane, which has a classic lipid bilayer. Rather, it has a single amphiphilic layer with a hydrophobic group on its inside and a hydrophilic group on its outside [Huang A. et al. H. C, 1985, “Modern Methods of Plant Analysis: Modern meths. Plant Analysis”, pp. 145-151, Springer-Berlag Berlin].

  Analysis of lipid body content shows that apart from triglycerides and membrane materials, there are also some polypeptides or proteins associated with the surface or lumen of this oil body [Bowman-Vance and Fan 1987, “J. Biol. Chem.” 262: 11275-11279, Murphy et al., 1989, “Biochem. J.” 258: 285-293, Taylor et al., 1990, “Planta” 181: 18. -Page 26]. Oil body proteins have been identified in a wide range of taxonomically dispersed species [Morrow et al., 1980, “Plant Physiol.” 65: 1176-1180, Kew et al., 1986, “Biochem. J. "235: 57-65], found to be uniquely localized in the oil body and not found in vegetable tissue organelles. In “Brassicanapus”, there are at least three polypeptides that are associated with the oil bodies of growing seeds (Taylor et al., 1990, “Planta” 181: 18-26).

  The number and size of proteins with which the oil bodies are associated can vary from species to species. For example, in corn, two immunologically distinct polypeprads are found in oil bodies (Bowman-Vance and Juan, 1988, “J. Biol. Chem.” 263: 1476-1481). It was discovered that oleodine has alternating hydrophilic, hydrophobic and hydrophilic regions [Bowman-Vance and Fan, 1987, “J. Biol. Chem.” 262: 11275-11279]. The amino acid sequence of oleodine from corn, rapeseed and carrot was obtained. See Cue and Fan, 1990, “J. Biol. Chem.” 265: 2238-2243, Hatzopulos et al., 1990, “Plant Cell” 2: 457-467, respectively. In oil seeds such as rapeseed, oleodine is 8% of total seed protein [Taylor et al., 1990, “Planta” 181: 18-26] to 20% [Murphy et al., 1989, “ Biochem. J. "258: 285-293]. This level is comparable to that found in many seed storage plants.

The genes encoding oil body proteins are found in maize [Maize: Bowman-Vance and Fan, 1987, “J. Biol. Chem.” 262: 11275-11279; and Kew and Fan, 1990, “J. Biol. Chem., 265: 2238-2243], and carrots (Hatsupoulos et al., 1990, "plant Cell" 2: 457-467) have been reported.
Sijmons et al., 1990, “Bio / Technology” 8: 217-221 Radke et al., 1988, “Theoret. Appl. Genet.” 75: 685-694. Vander Kelcove et al., 1989, “Bio / Technology” 7: 929-932 Fraley et al., 1983, “Proc. Nat'l. Acad. Sci. USA” 80: 4803-4807. Misra and Gedamu 1989, “Theor. Appl. Genet.” 78: 161-168. Fraley et al., 1983, “Proc. Nat'l. Acad. Sci. USA” 80: 4803-4807. Sen Gupta-Gopalan et al., 1985, “Proc. Nat'l. Acad. Sci. USA” 82: 3320-3324. Radke et al., 1988, “Theore. Appl. Genet.,” 75: 685-694. VanderKelcove et al., 1989 “Bio / Technology” 7: 929-932. Lee et al., "Proc. Nat'l. Acad. Sci." (USA) 1991: 88: 6181-6185. Huang A. H. C, 1985, “Modernmeths. Plant Analysis,” Volume 1, pages 145-151, Springer Berlag Berlin Gurr MI. 1980, “The Biochemistry of Plants” 4: 205-248, Acad. Press Orlando Fla. Huang A. H. C, 1985, “Modernmeths. Plant Analysis,” Volume 1, pages 145-151, Springer Berlag Berlin Bowman-Vance and Fan, 1987, “J. Biol. Chem.” 262: 11275-11279 Murphy et al., 1989, “Biochem. J.” 258: 285-293. Taylor et al., 1990, “Planta” 181: 18-26 Morrow et al., 1980, “Plant Physiol.” 65: 1176-1180. Kew et al., 1986, “Biochem. J.” 235: 57-65. Taylor et al., 1990, “Planta” 181: 18-26 Bowman-Vance and Juan, 1988, “J. Biol. Chem.” 263: 1476-1481 Bowman-Vance and Fan, 1987, “J. Biol. Chem.” 262: 11275-11279 Kew and Fan, 1990, “J. Biol. Chem.” 265: 2238-2243. Hatzopoulos et al., 1990, “PlantCell” 2: 457-467. Taylor et al., 1990, “Planta” 181: 18-26 Murphy et al., 1989, “Biochem. J.” 258: 285-293. Bowman-Vance and Fan, 1987, “J. Biol. Chem.” 262: 11275-11279 Kew and Fan, 1990, “J. Biol. Chem.” 265: 2238-2243. Hatzopoulos et al., 1990, “Plant Cell” 2: 457-467.

SUMMARY OF THE INVENTION Methods and compositions are provided for producing peptides that can be readily purified from host proteins. The method produces a chimeric DNA construct, the chimeric DNA construct comprising a sequence encoding an oil body specific sequence having a coding sequence of a seed specific oil body protein gene, or at least an oil body Contains a sequence that encodes the hydrophobic core portion of the protein, and a coding sequence of the peptide of interest from which a transcriptional expression cassette containing the chimeric DNA construct can be produced; Transforming host cells with this phenotypic cassette under genomic integration conditions; and growing the resulting transgenic plants to produce seeds, in which the polypeptide of interest is used as a fusion protein with oleodine It has the process of transforming.

  The polypeptide of interest can be purified by separating the oil body from the seed cells and destroying the oil body to release the fusion protein. This oil body protein is then easily separated from other proteins and plant-derived materials by layer separation. If necessary, the cleavage site is located at least one position before the N-terminus and behind the C-terminus of the polypeptide of interest, and the fusion polypeptide is cleaved and separated into its component peptides by layer separation. And can be separated. Thus, the production equipment provides targeting of the chimeric peptide by the oil body protein functionality of the chimeric peptide relative to the oil body protein, which also allows rapid purification of the polypeptide of interest. This production device finds use in the production of a large number of peptides, such as peptides having drugs, enzymes, flow properties and adhesive properties.

According to the invention, a fusion polypeptide that can be targeted to an oil body comprising:
(A)

A first peptide having the formula
aa ²⁵ may be any amino acid;
aa ²⁶ is a neutral aliphatic amino acid;
aa ³¹ is a neutral unsubstituted aliphatic amino acid having 3 to 6 carbon atoms;
aa ³³ is a neutral unsubstituted aliphatic amino acid having 3 to 6 carbon atoms;
aa ³⁶ is a neutral unsubstituted aliphatic amino acid having 3 to 5 carbon atoms;
aa ³⁷ is a neutral unsubstituted amino acid;
aa ³⁹ is a neutral unsubstituted aliphatic amino acid;
aa ⁴¹ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁴⁴ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁴⁶ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁴⁷ is a neutral unsubstituted aliphatic amino acid;
aa ⁵¹ is glycine, leucine, alanine, valine or isoleucine;
aa ⁵³ is alanine, glycine, valine, leucine, isoleucine or threonine;
aa ⁵⁹ is a neutral unsubstituted aliphatic or aromatic amino acid;
aa ⁷² is threonine, alanine or leucine;
aa ⁷³ is valine, leucine, isoleucine or threonine;
aa ⁷⁴ is alanine or glycine;
aa ⁷⁵ is leucine or threonine;
aa ⁷⁶ is a neutral unsubstituted aliphatic amino acid or sulfur-substituted amino acid;
aa ⁷⁷ is isoleucine, alanine or valine;
aa ⁷⁸ is a neutral unsubstituted aliphatic amino acid;
aa ⁸³ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁸⁴ is glycine;
aa ⁸⁵ is glycine or alanine;
aa ⁸⁶ is phenylalanine or leucine;
aa ⁸⁹ is alanine, threonine or glycine;
aa ⁹⁰ is alanine or glycine;
aa ⁹² is a neutral aliphatic amino acid with oxygen substitution;
aa ⁹³ is valine or serine;
aa ⁹⁴ is phenylalanine or leucine;
aa ⁹⁶ is a neutral sulfur-substituted aliphatic amino acid or a neutral aromatic heterocyclic amino acid;
aa ⁹⁷ is a neutral unsubstituted aliphatic amino acid or sulfur-substituted amino acid;
aa ⁹⁸ is a neutral unsubstituted aliphatic amino acid or oxygen-substituted aromatic amino acid;
aa ⁹⁹ can be any amino acid:
aa ¹⁰⁰ is an oxygen-substituted amino acid and may be aliphatic or aromatic;
aa ¹⁰¹ is a neutral unsubstituted aliphatic or aromatic amino acid;
A first peptide and (b) a second peptide fused thereto, wherein the second peptide is other than a portion of the oleodin protein naturally occurring from "Arabidopsis" or "Brassica" A fusion polypeptide characterized in that it comprises a peptide.

In addition, the fusion polypeptide provided by the present invention can be a target of oil bodies,
(A)
(1) The following amino acid sequence
MMGRDRDQYQMSGRGSDYSK-
SRQIAKAATAVTAGGSLLVL-
SSLTLVGTVIALTVATPLLV-
IFSPILVPALITVALLITGF-
LSSGGFGIAAITVFSWIYK ★ -Y-
ATGEHPQGSDKLDSARMKLG-
SKAQDLKDRAQYYGQQHTGG-
EHDRDRTRGGQHTT
A peptide containing at least 8 consecutive amino acid sequences contained therein; and (2) encoded with a DNA sequence identified by an oligonucleotide probe designed based on said amino acid sequence or fragment thereof in (1) A first peptide selected from the group consisting of the first peptide, except that the first peptide is other than the full length that naturally generates 16 kd oleodin from carrots or 16 kd or 18 kd oleodin from corn. And (b) a second peptide fused thereto, wherein the second peptide is other than a portion of an oleodin protein naturally occurring from "Arabidopsis" or "Brassica" It is characterized by containing.

The chimeric DNA construct further provided by the present invention encodes (a) a first DNA sequence that encodes oleodine or a portion thereof sufficient to provide targeting to an oil body and (b) a peptide. A second DNA sequence, wherein the peptide contains a second DNA sequence that is other than part of an oleodin protein naturally occurring from "Arabidopsis" or "Brassica".

The expression cassettes further provided by the present invention are:
As a component, in the direction of transcription;
A regulatory DNA sequence having a substantial portion from the region 5 ′ of the gene expressed in the seed to the translation initiation site, resulting in expression of the DNA sequence in the seed;
(A) a first DNA sequence encoding oleodine or its equivalent that results in targeting of the oil body, the first DNA sequence comprising at least one restriction site; And (b) a second DNA sequence encoding the peptide, wherein the peptide has a second DNA sequence that is other than a portion of the oleodin protein naturally occurring from "Arabidopsis" or "Brassica" A DNA sequence; and a translation and transcription termination region;
Here, the components are operably linked and the expression of the chimeric DNA sequence is regulated by the regulatory DNA sequence.

Further, the expression cassette provided by the present invention is:
An oil body protein (OBP) gene having a substantial part from region 5 ′ to the translation initiation site, which gives expression of this gene in seeds, and from just 5 ′ of said OBP gene An oil body protein gene having at least one restriction site between the methionine start codon and 5 'to the translation stop signal; and inserted into the restriction site in the open reading frame by the OBP gene A DNA sequence having a DNA sequence encoding a peptide that is other than a portion of an oleodin protein naturally occurring from "Arabidopsis" or "Brassica".

Further provided in the present invention are expression cassettes:
A first DNA sequence that encodes a peptide, except that the peptide is other than part of an oleodin protein that naturally occurs from "Arabidopsis" or "Brassica" and is read into an oil body protein (OBP) gene The oil body protein gene inserted in the frame has a substantial part from the regulatory region 5 ′ of the OBP gene to the translation initiation site, which gives expression of this gene in the seed, The sequence has a first DNA sequence inserted at a site in the gene so that the sequence is expressed under the regulatory region.

Furthermore, the method for expressing a polypeptide of interest in seeds provided by the present invention includes:
A host plant cell is transformed with a phenotypic cassette under genomic integration conditions, where the phenotypic cassette serves as a component in the direction of transcription from the region 5 ′ of the gene expressed in the seed to the translation start site. A first DNA sequence having a substantial part and resulting in expression of the DNA sequence in the seed; a second DNA sequence encoding oleodine or its substantial part resulting in the targeting of the oil body, This second DNA sequence contains at least one natural or synthetic restriction site into which a third DNA sequence encoding the polypeptide of interest is inserted into the reading frame. Wherein the peptide is a second DNA sequence that is other than part of an oleodin protein naturally occurring from "Arabidopsis" or "Brassica"; and A transcription termination region; wherein said components are operably linked and said first DNA sequence such that expression of said second DNA sequence results in expression in seeds Including being adjusted by.

Further methods for obtaining the desired purified polypeptide provided by the present invention include:
A host plant cell is transformed with the DNA construct under genomic integration conditions, wherein the DNA construct has a first DNA sequence that encodes the peptide of interest, provided that the peptide contains “Arabidopsis Or a portion of the oleodin protein naturally occurring from “Brassica” and inserted in an open reading frame into an oil body protein (OBP) gene, wherein the oil body protein gene is It has a substantial part from the regulatory region 5 ′ of the OBP gene that brings about expression to the translation initiation site, wherein the sequence is contained in the gene so that the expression of the DNA sequence is regulated by the regulatory region. The DNA construct begins to integrate into the genome of the plant cell;
Growing the plant to produce seeds, whereby the polypeptide of interest is expressed as a fusion protein along with the OBP gene expression product;
Separating oil bodies from said seed cells;
Breaking the oil body to release the fusion protein; and purifying the polypeptide of interest.
BRIEF DESCRIPTION OF THE FIGURES FIG. 1A shows the nucleotide sequence and deduced amino acid sequence (17 kDa protein) of the oil body protein gene (oleodine) from “Arabidopsis thaliana”. Underlined are direct repeat (R1 and R2) and retrograde repeat (T), CACA, TATA, TAAT and polyadenylation signals. Intron sequences are shown in lower case letters and putative ABA-binding sites are shown in bold letters.

  FIG. 1B shows a sequence comparison of 16 kd oil body protein from carrot, 18 kd and 16 kd oil body protein from corn and 17 kd oil body protein from “Arabidopsisthaliana”, the conserved and branched regions of this protein. The amino acid sequence is arranged to show the conservation of the sequence in the central region of the protein.

  FIG. 2 shows the construct used for the fusion of the oil body protein gene with the gene encoding the foreign peptide. IA is a C-terminal fusion of the desired peptide to OBP. IB is the N-terminal fusion of the desired peptide to OBP; II is the internal fusion of the desired peptide within OBP; and III is between two substantially complete oil body protein target sequences It is an interdimer transcriptional fusion of the desired peptide involved. The upper part of FIG. (A) shows the DNA construct used for transcriptional fusion of the desired peptide to the oil body protein. The lower part of the figure (B) shows the arrangement of the gene product, which is shown on the upper part of the translation and transport to this oil body. The key to this figure is as follows: the hatched box with the left side at the bottom and the right side at the top indicates the OBP promoter or other seed-specific promoter; the right side is at the bottom The hatched box with the left side up indicates the desired peptide coding sequence; the blank box indicates the oil body protein coding sequence or synthetic target sequence based on the OBP conserved motif; vertical and horizontal The hatched box indicates the gene terminator containing the polyadenylation signal; the hatched circle indicates the protease recognition motif; the helical line indicates the natural C or N terminus of OBP.

  FIG. 3 shows the detailed arrangement for the C-terminal fusion construct. This arrangement shown is a collagenase recognition motif coding sequence as a linker for the fusion of a typical oil body protein gene and fusion peptide, here using NcoI for cloning and transformation in plants. Are chained.

  FIG. 4 schematically shows the construction of the fusion peptide vectors, their introduction into plants and subsequent extraction and measurement of the desired recombinant peptide.

  FIG. 5 shows a schematic diagram of the structure of pCGOBBPILT. Dashed box indicates the oleosin promoter; box with left side top and right side bottom hatch indicates the oleodin coding sequence; box with horizontal and vertical hatching indicates intron; The box marked 3 'untranslated sequence; the left-handed top and right-handed bottom, widely spaced hatched box represents the interleukin 1-β sequence with the sequence encoding the protease cleavage site (Factor Xa or thrombin directly upstream).

  FIG. 6 shows the design of oligonucleotide GVR11. The 3 'coding sequence of the “A. thaliana” oleodine shown in FIG. 3A is translationally fused to the factor Xa / IL-1-β coding sequence followed by a TAA stop codon. For future cloning purposes, PvuI and Sa1I restriction enzyme recognition sites are included. Generation of a PvuI restriction site provides an additional coding sequence for alanine (ala). This restriction enzyme recognition site is underlined. The “A. thaliana” oleodine sequence and the factor Xa recognition sequence are overlined. This actual cleavage site is indicated by an asterisk (star). In FIG. 3B, the sequence of GVR11 is shown. In order to fuse with “A. thaliana” oleodine, the primer GVR11 needs to be a sequence complementary to the top strand.

  FIG. 7 shows the nucleotide sequence of OBPILT. Underlined is the sequence encoding IL-1-β; the sequence encoding the factor Xa recognition site is shown in bold letters. The nopaline synthase terminator sequence is shown in lower case letters.

BEST MODE FOR CARRYING OUT THE INVENTION

  In accordance with the present invention, methods and compositions for producing easily purified peptides are provided. The method produces an expression cassette comprising a DNA sequence that encodes a substantial portion of an oil body-specific sequence, such as oleodine, resulting in targeting to the oil body and the desired peptide; A plant cell host; generating a transgenic plant, growing it to produce seed, from which a chimeric protein is expressed and transported to the oil body . This chimeric peptide contains the target peptide and an oil body protein such as oleodine. The peptide of interest is generally a foreign peptide that is not normally expressed in seeds or found on oil bodies. By using oil body proteins as a carrier or targeting means, a simple method of obtaining purification of this foreign protein can be obtained. The chimeric protein is separated from the cellular protein bulk in one step (such as centrifugation or flotation); this separation also removes non-specific proteases from contact with the oil body, so This protein is protected from degradation during extraction. This gene encoding the foreign peptide may be derived from any source including plant, bacterial, fungal or animal sources. Desirably, the chimeric peptide will contain a sequence that allows cleavage of the peptide of interest from oleodine. The method can be used to express various peptides, which are then easily purified.

  Targeting exogenous recombinant proteins to the oil body has several benefits, including: This protein can be separated from the bulk of the cell contents after cell lysis by centrifugation. The oil body fraction will float on the surface of the extract. This protein can optionally be provided with a peptide linker containing a protease recognition site. This allows release of the peptide from this oil body. The protein can be introduced into the recombinant polypeptide such that it is within the lipophilic conserved region. This results in internalization of the recombinant peptide into the oil body, thus protecting it from protease attack.

  This phenotypic cassette generally directs phenotypic expression in the growing seed, as represented by the promoter and upstream region associated with the oil body protein, in the 5'-3 'direction of its transcription. A DNA sequence that encodes a chimeric protein that contains transcriptional and translational regulatory regions that allow it to contain the chimeric protein in seeds, the oil body targeting means and the amino acid sequence that results in the protein of interest, and plants It will lead to expression of transcription and translation termination regions that function in it. One or more introns may also be present.

  In this oil body specific antibody, an analogy is found in oil body proteins, particularly fragments of oleodine. This oil body specific sequence may be the same as that obtainable from the oil body protein, which has sufficient homology to provide the desired targeting of the protein of interest to the oil body. is doing. By “obtainable” is intended an amino acid sequence that is sufficiently similar to a natural oil body protein amino acid sequence to provide the desired targeting, and may be natural, synthetic or a combination thereof. Of particular interest is the central hydrophobic region of oil body proteins, fragments thereof and homologous sequences at the amino acid level that appear to be highly conserved among different plant species.

The deduced amino acid sequence for the oil body protein of “Arabidopsis thaliana” is as follows.
10 20
MMGRDRDQYQMSGRGSDYSK-
30 40
SRQIAKAATAVTAGGSLLVL-
50 60
SSLTLVGTVIALTVATPLLV-
70 80
IFSPILVPALITVALLITGF-
90 100
LSSGGFGIAAITVFSWIYK ★ -Y-
110 120
ATGEHPQGSDKLDSARMKLG-
130 140
SKAQDLKDRAQYYGQQHTGG-
150
EHDRDRTRGGQHTT

About 25 to 101 amino acids have a central hydrophobic region.

  Of particular interest as targeting means for some applications are oil body specific sequences of the following formula or fragments thereof that result in targeting to oil bodies:

here:
pp ¹ and pp ² are the same or different and may be the same or different from the natural oil body protein, usually different; these may be hydrogen and are indicated Indicates the terminal portion of the polypeptide or may be a polypeptide having a total of up to 1000 amino acids, more usually up to about 500 amino acids, and may have only a total of only one amino acid, or Independently or separately, it may be a polypeptide consisting of 1-100 amino acids, more usually 1-75 amino acids, more particularly 5-50 amino acids; Will have the specific use of modifying sequences specifically described for;
aa ²⁵ may be any amino acid, generally a neutral aliphatic amino acid having 3 to 6 carbon atoms, more particularly leucine or alanine;
aa ²⁶ is a neutral aliphatic amino acid, in particular alanine or a hydrogen-substituted amino acid having 3 to 4 carbon atoms, in particular threonine or a basic amino acid having 5 to 6 carbon atoms. , In particular lysine;
aa ³¹ is a neutral unsubstituted aliphatic amino acid having 3 to 6 carbon atoms, in particular an alanine, valine, leucine or aromatic unsubstituted amino acid, in particular phenylalanine;
aa ³³ is a neutral unsubstituted aliphatic amino acid having 3 to 6 carbon atoms, in particular alanine, valine or leucine or an oxygen-substituted aliphatic amino acid, in particular threonine;
aa ³⁶ is a neutral aliphatic unsubstituted amino acid having 3 to 5 carbon atoms, in particular leucine or a neutral aliphatic oxygen substituted amino acid having 3 to 4 carbon atoms, in particular Threonine or serine;
aa ³⁷ is a neutral unsubstituted amino acid, in particular a leucine or sulfur substituted amino acid, in particular methionine;
aa ³⁹ is a neutral aliphatic unsubstituted amino acid, in particular a valine or an aromatic unsubstituted amino acid, in particular phenylalanine;
aa ⁴¹ is a neutral aliphatic unsubstituted or oxygen substituted amino acid, in particular alanine, leucine or serine;
aa ⁴⁴ is a neutral aliphatic unsubstituted or oxygen substituted amino acid, in particular alanine, isoleucine or threonine;
aa ⁴⁶ is a neutral aliphatic unsubstituted or oxygen-substituted amino acid, in particular alanine, valine or threonine;
aa ⁴⁷ is a neutral aliphatic unsubstituted amino acid, in particular glycine or alanine;
aa ⁵⁹ is a neutral aliphatic or aromatic unsubstituted amino acid, in particular leucine or phenylalanine;
aa ⁷⁶ is a neutral aliphatic unsubstituted or sulfur substituted amino acid, in particular alanine, leucine or methionine;
aa ⁷⁸ is a neutral aliphatic unsubstituted amino acid, in particular alanine, or an aliphatic amino acid having a neutral sulfur or oxygen substitution, in particular methionine or threonine;
aa ⁸³ is a neutral aliphatic unsubstituted or oxygen substituted amino acid, in particular glycine, serine or threonine;
aa ⁹² is a neutral aliphatic amino acid with oxygen substitution, in particular serine or threonine;
aa ⁹⁵ is a neutral aliphatic sulfur-substituted amino acid or a neutral aromatic heterocyclic amino acid, in particular tryptophan;
aa ⁹⁷ is a neutral aliphatic unsubstituted or sulfur substituted amino acid, in particular valine, leucine, isoleucine or methionine;
aa ⁹⁸ is a neutral unsubstituted aliphatic or aromatic oxygen-substituted amino acid, in particular alanine, leucine or tyrosine;
aa ⁹⁹ may be any amino acid:
aa ¹⁰⁰ is an oxygen-substituted amino acid, aliphatic or aromatic, in particular tyrosine or threonine;
aa ¹⁰¹ is a neutral unsubstituted aliphatic or aromatic amino acid, in particular alanine, leucine or phenylalanine.

  Of particular interest as a source of DNA encoding sequences that can result in targeting to oil body proteins are oil body protein genes that can be obtained from “Arabidopsis” or “Brassica napus”, which are of interest in seeds. (See Taylor et al. 1990 “Planta” 181: 18-26). The regions and amino acid sequences necessary to provide this oil body targeting ability appear to be the highly hydrophobic central region of the oil body proteins.

  To identify other oil body proteins with the desired properties, when the oil body protein is isolated or separated, the protein may be partially sequenced thereby identifying the mRNA. Probes can be designed for this purpose. Such probes are particularly valuable when the probes are designed to target the coding region of the central hydrophobic region that is highly conserved among different plant species. As a result, DNA or RNA probes for this region may be particularly useful for identifying oil body protein coding sequences from other plant species. To further increase the concentration of mRNA, cDNA can be produced, which is subtracted from non-oil body producing cells. This remaining cDNA can then be used to probe the genome of the complementary sequence using an appropriate library prepared from plant cells. The sequence that hybridizes to this cDNA under stringent conditions can then be isolated.

  In some cases, as described above, an oil body protein gene probe (conservation region) is used to screen the cDNA genomic library directly by employing the probe and identify the sequence that hybridizes to this probe. can do. This separation can also be performed by standard immunological screening techniques of seed-specific cDNA expression libraries. Using the purification procedure and antibody preparation protocol described in Taylor et al. 1990 “Planta” 181: 18-26, antibodies for oil body proteins can be readily obtained. CDNA expression library screening using antibodies was substantially performed by Huynh et al. [1985, DNA Cloning, Volume 1, “practical approach” DM Glover, IRL Press, pp. 49-78. )] Technology. Sequence confirmation can be facilitated by the high degree of conservation seen in the central hydrophobic region (see FIG. 1). Sanger et al. ("Proc. Nat'l. Acad. Sci. USA" 1977, 74: 5463-5467) or Maxam and Gilbert (1980, "Meth. Enzymol. 1980 65: 497-560"). DNA sequencing by methods can be performed for all putative clones and performed homology studies. The homology of the sequence encoding this central hydrophobic region is usually greater than 70% between different species, both at the amino acid level and at the nucleotide level. If the antibody is available, confirmation of sequence identification is also as described in Sambrook et al. ["Molecular Cloning" 1990, 2nd edition, Cold Spring Harbor Press, pages 8-49 to 8-51]. , Hybrid selection from seed mRNA preparation and translation experiments.

  CDNA clones made from seeds can be screened using cDNA probes made from the conserved coding region of any available oil body protein gene [eg Bowman-Vance and Fan, “J. Biol. Chem. 1987, 262: 11275-11279]. A clone is selected that has a stronger hybridization with the seed DNA compared to the seedling cDNA. This screen is repeated to identify specific cDNAs associated with growing seed oil bodies using direct antibody screening or hybrid selection and translation. MRNA complementary to this specific cDNA is not present in other tissues tested. This cDNA is then used to screen selected genomic libraries and fragments that hybridize with the subject cDNA.

  In order to obtain the expression of this chimeric gene in the seed, the untranslated 5 ', which is responsible for translation initiation and ribosome binding from any gene preferentially expressed in the seed. The transcription initiation regulatory region and translation initiation regulatory region, “ribosome binding site” of the sequence can be used. Examples of such genes include seed storage proteins such as from napin [Josephson et al. “J. Biol. Chem.” 1987, 262: 12196-12201; R. And Crochet M. L. "J. Biol. Chem." 1987 262: 1222-1208]. Preferably, this region is obtained from oil body proteins that can be obtained from oil body proteins ["Arabidopsis", carrots [Hatsupoulos et al., Supra] or maize [fans et al., 1987 and 1990, supra]. be able to. This region generally has at least 100 bp from 5 'to the start of translation of this structural gene coding sequence and has a maximum of 2.5 Kb from 5' to the same translation start. It is preferred that all transcriptional and translational functional elements of this initiation regulatory region are derived from or “obtainable” from the same gene. By “obtainable” is intended a DNA sequence that is sufficiently similar to that of the native sequence to provide the desired specificity for transcription of the DNA sequence encoding the chimeric protein. This includes natural and synthetic sequences, and may be a combination of synthetic and natural sequences.

  This transcription level must be sufficient to provide an amount of RNA that can result in a modified seed. By “modified seed” is meant a seed having a different phenotype that is detectable from the seed of an untransformed plant of the same species, eg, the expression cassette of interest in its genome. I do not have it. Various changes in phenotype are interesting. These changes include the overexpression of oil body proteins or the accumulation of OBP on the oil body or in the cytoplasm of the resulting chimeric protein.

  The polypeptide of interest may be any protein, such as an enzyme, an anticoagulant, a neuropeptide, a hormone, or an adhesive precursor. Examples of proteins include interleukin-1-β, the anticoagulant hirudin, the enzyme β-glucoronidase or a single chain antibody having a transcriptional fusion of an immunoglobulin VH or VL chain. This DNA sequence encoding the polypeptide of interest may be synthetic, naturally derived, or a combination thereof. Depending on the nature or source of the DNA that encodes the polypeptide of interest, it may be desirable to synthesize the DNA sequence with a plant-preferred codon. This plant-preferred codon can be determined from the highest frequency codon in the protein expressed in the greatest amount in the particular plant species of interest as a host cell.

  The termination region employed can be primarily convenient because in many cases the termination region appears to be relatively interchangeable. This termination region may be natural with the transcription initiation region, natural with the DNA encoding the polypeptide of interest, or may be derived from other sources. A convenient termination region can be obtained from the “A. tumefaciens” Ti plasmid, such as the octopine synthase or nopaline synthase termination region.

  Binding of the DNA sequence encoding the target sequence to the gene encoding the peptide of interest can occur in a variety of ways, including terminal fusion, internal fusion, and polymerization fusion. In all cases, the fusion is made so as not to disturb the oil body protein reading frame and to avoid any translational stop signal in or near the junction. Different types of end and internal fusions are shown in FIG. 2, along with a representation of their in vivo configuration.

  In all cases described, the linkage of the gene that encodes this peptide will preferably include a linker that encodes the protease target motif. This makes it possible to release the peptide once extracted as a fusion protein. Possible cleavage sites that can be employed are the thrombin recognition motif (leu-val-pro-arg-gly) [Fujikawa et al., “Biochemistry” 1972, 11: 4892-4899], factor Xa (phe-glu-gly). -Arg-aa.) [Nagai et al., "Proc. Nat'l. Acad. Sci. USA" 1985, 82: 7252-7255] or collagenase (pro-leu-gly-pro) [Scholtissek] And Grosse “Gene”: 1988, 62: 55-64].

  The complementary ends of this fragment can be joined and joined by appropriate manipulation such as restriction, chewing back or filling in the overhang (overhang), linker attachment, etc. Can be provided. When performing these various steps, cloning can be used to amplify the amount of DNA and allow analysis of this DNA, confirming that these operations have occurred in the proper state. . A wide range of cloning vectors can be employed, where the cloning vector includes a replication system that operates in "E. coli" and a label that allows selection of transformed cells. Examples of vectors include pBR332, pUC series, M13mp series, pACYC184, and the like. Thus, this sequence can be inserted into the vector at the appropriate restriction sites, and the plasmid thus obtained is used to transform an “E. coli” host and the “E. coli” Growing in nutrient medium, the cells are harvested and lysed, and the plasmid is harvested. Examples of the analysis include sequence analysis, restriction analysis, electrophoresis, and the like. After each manipulation, the DNA sequence used in this final construct can be restricted and joined to the next sequence, where each of the partial constructs is cloned in the same or different plasmid. Can do.

  Various techniques can be employed to introduce DNA into plant host cells. For example, chimeric DNA constructs are introduced into host cells obtained from dicotyledonous plants such as tobacco and oily plants such as “Brassica napus” [Moloney et al. “Plant CellRep.” 1989 8: 238-242] or [Hinch et al., Bio / Technol. 1988, 6: 915-922] or other techniques known to those skilled in the art. It can be introduced using standard Agrobacterium vectors according to the protocol. For example, the use of T-DNA for plant cell transformation has been intensively studied, EPA serial number 120,516; Hoekeme: binary plant vector system offset-drukkerij Kanters BV Arblasserdam, 1985, Chapter 5: Knauf et al., “Genetic analysis of host range expression by Agrobacterium: Genetic Analysis of Host Bacteria”: “Molecular Genetics of the Bacteria” "Plant interaction" PuhlerA. Edition, Springer-Barrag, New York, 1983, 245, and An et al., “EMBO J.” 1985 4: 277-284. For convenience, the tissue piece is Tumefaciens or A.I. By culturing with lysogenes, the transcriptional construct can be transferred to plant cells. Following transformation with Agrobacterium, the plant cells are dispersed in a suitable selective medium for selection, grown to callus, shoots grown, and grown in rooted medium. Regenerate plantlets from callus. The Agrobacterium host can contain a plasmid having a vir gene necessary for transfer of T-DNA to plant cells, and may or may not have T-DNA. For injection and electroporation (see below) an unarmed Ti plasmid (its oncogene, in particular its T-DNA region is missing) can be introduced into this plant cell.

  By employing non-Agrobacterium technology, the constructs described herein can be used to transduce and transform in a wide range of dicotyledonous and monocotyledonous plants. These techniques are particularly useful for species that are difficult to handle in an Agrobacterium transformation system. Other techniques for transferring genes include Biolistics (Sanford “Trends in Biotech.” 1988, 6: 299-302), electroporation [From et al., “Proc. Nat'l. Acad. Sci. USA, 1985, 82: 5824-5828] [Riggs and Bates, Proc. Nat'l. Acad. Sci. USA, 1986, 83: 5602-5606] or PEG-mediated DNA uptake (potrices (Potrykus) et al. “Mol. Gen. Genet.” 1985, 199: 169-177].

As host cells, cells from any of a number of seed-bearing plants can be used, where the cells are parts of a plant, such as stems, leaves, roots, or seeds or regenerated structures with these seeds. Is derived from. The cell may be an isolated cell or a part of a plant, for example a leaf disc. In certain applications, such as for “Brassica napus”, this host cell is generally derived from the cotyledon described in [Moloney et al. “PlantCell Rep.” 1989 8: 238-242]. be able to. Other examples using commercial oilseeds include cotyledon transformation in soybean plant pieces (Hinch et al. “Biotechnology” 1988, 6: 915-922) and cotton stem transformation (Ambeck et al. “Biotechnology”). 1981, 5: 263-266] Following transformation, the cells are grown in selective media, for example as leaf disks. Once the shoots begin to appear, they are incised and placed on the rooted medium. After sufficient shoots are formed, these plants are transferred to the soil. The putative transformed plants are then tested in the presence of the label. Appropriate probes such as A.I. Using the “thaliana” gene, Southern blotting is performed on genomic DNA to show that integration of the desired sequence into the host cell genome occurs.

  This transformation cassette will normally be conjugated to a label for selection in plant cells. For convenience, this label may be particularly resistant to antibiotics, such as herbicides, kana insi, G418, bleomycin, hygromycin, chloramphenicol and the like. The particular label employed may be one that will allow selection of transformed cells over cells lacking introduced DNA.

  The fusion peptide in the expression cassette constructed as described above is at least preferentially expressed in the growing seed. Thus, transformed plants that grow according to conventional methods establish seeds. For example, see [McCormick et al. “Plant cell Reports” 1986, 5: 81-84]. Northern blotting can be performed using appropriate gene probes with RNA isolated from tissues where transcription is expected to occur, such as seed embryos. The transcript dimensions are then compared to the expected dimensions for the fusion protein transcript.

  The oil body protein is then separated from the seed and an analysis is performed to determine that the fusion peptide has been transformed. The analysis can be, for example, PAGE. The fusion peptide can be detected using an antibody against the oleodin portion of the fusion peptide. The dimensions of the fusion peptide thus obtained can then be compared to the dimensions expected for this fusion protein.

  Two or more generations of transgenic plants are grown and pollinated with the same phenotypic strain or with different strains to identify hybrids with the desired phenotypic characteristics thus obtained, and the subject phenotype It can be confirmed that the properties are stably maintained and inherited, and then the seeds can be harvested to isolate the peptide of interest, or used to obtain seeds with new phenotypic properties.

  From the same or different seeds for the introduced trait by various techniques, including using aqueous buffered extraction media and other means of grinding, breaking, grinding or seed cell grinding, the desired Protein can be extracted. The seed thus extracted can then be separated into three fractions (eg by centrifugation or Bray sedimentation): precipitated or insoluble pellets, aqueous supernatant, and seed storage lipids and oil bodies. It is a floating substance "scum" containing. These oil bodies contain both natural oil body proteins and chimeric oil body proteins, the latter containing exogenous peptides. These oil bodies are separated from the water-soluble protein and resuspended in an aqueous buffer.

  If a linker containing a protease recognition motif is included in the expression cassette, it is specific for the recognition motif produced by translation of the linker sequence into the resuspension buffer. Add typical protease. This releases the required peptide into this aqueous phase. A second centrifugation step will now cause the treated oil body to resuspend with its attached protein, leaving an aqueous solution of the required peptide. The desired peptide can be precipitated, chemically modified or lyophilized according to its nature and desired application.

  For certain applications, it may not be necessary to remove the chimeric protein from the oil body protein. Such uses would include the case where the fusion peptide contains an enzyme that is tolerant to and retains activity for N- or C-terminal fusions; such enzyme does not require further cleavage or purification. Can be used. This chimeric enzyme OBP can contact the substrate as a fusion protein. If desired, the enzyme-OBP fusion protein can be purified using an immunoaffinity column containing an immobilized high titer antibody against the OBP (see, eg, [Taylor 1990] supra). Is possible.

  Other uses for the present invention are as follows. OBP contains a high percentage of total seed protein, thus enriching certain desired properties of the seed, such as high lysine, high methionine, etc., simply by producing a fusion protein rich in the amino acid of interest. It is possible to find a particularly advantageous use in the modification of grains or grains used directly or indirectly as a food source for livestock and humans, including cattle and poultry. This fusion protein can include enzymes that can assist in the subsequent processing of oil or coarse flour during normal oilseed grinding and extraction, for example, an increase used to treat seeds. Heat-stable lipid-modifying enzymes may be included which will retain activity at the milling temperature, thereby adding value to the extracted triglyceride or protein product. Other uses of the fusion protein include uses that promote the agronomic health of the crop. For example, insecticidal proteins or parts of immunoglobulins specific to cultivated pests, such as fungal cell walls or membranes, are bound to this oil body protein, thereby seeding certain plant pests Can reduce attacks on

  The following examples are provided for purposes of illustration and not for limitation.

Example 1
Expression of heat fusion of foreign peptides by oil body proteins
A. A genomic clone of an oil body protein gene containing at least 100 bp from the C-terminal fusion 5 ′ to the start of transcription into a plasmid vehicle capable of replication in a suitable bacterial host (eg, pUC or pBR322 in E. coli). And cloning. The restriction site is located in the region encoding the hydrophilic C-terminal part of the gene. In the 19 kDa OBP, this region typically extends from codon 125 to the end of the clone. This ideal restriction site is single, but this is not absolutely essential. If a suitable restriction site is not located in this region, the site-specific mutation of [Kunkel "Proc. Nat'l Acad. Sci. USA" 1985, 82: 488-492] It can be introduced according to the mutation method. The only major restriction on the introduction of this site is that it must be placed 5 'to the translation stop signal of this OBP clone.

  With this suitable mutated clone, a synthetic oligonucleotide adapter can be produced that contains a coding sequence for the protease recognition site, such as Pro-Leu-Gly-Pro or a multimer thereof. This is a recognition site for the protease collagenase. The adapter; a 4 base overhang at the 5 'end that is compatible with the restriction site at the 3' end of the OBP clone, 4 at the 3 'end of the adapter to facilitate binding to the foreign peptide coding sequence. Can be synthesized in such a way as to give a base overhang and, if necessary, more bases, to ensure that there is no frameshift in the transfer between the OBP coding sequence, the protease recognition site and the foreign peptide coding sequence . A typical arrangement for such a fusion is shown in FIG. In the example shown here, the Xho1 site present near the stop codon of carrot OBP [Hatsupouro et al. “Plant cell” 1990, 2: 457-467] is used. This can be digested and combined with an adapter composed of the two oligonucleotides described. This adapter will form a complete Xhol overhang at the end and will not inhibit this translation frame. This other end is arbitrarily chosen (any 6-base cutter is sufficient), but forms an Nco1 overhang that encompasses ATG from the desired foreign peptide.

  This final ligation product will contain the almost complete OBP gene, the coding sequence for the collagenase recognition motif and the desired peptide coding region, all in a single reading frame. This three-part fragment has been widely used to transfer foreign DNA into plants [Frayley et al., “Proc. Nat'l Acad. Sci. USA” 1983, 80: 4803-4807. ] Agrobacterium binary plasmid [Bevan et al., "Nucl. Acid Res." 1984, 12: 8711-8721], and used to [Moloney et al. "Plant cell Rep." 1989, 8: 238-242] or similar procedures are used to transform oilseed plants such as rapeseed. Transgenic plants can be recovered from this transformation experiment and can be grown and flowered. The plant then ties seeds by self-pollination.

  These seeds are allowed to reach maturity (60-80 days), then harvested and ground in aqueous extraction buffer (Taylor et al., “Planta” 1990, 181: 18-26). Centrifugation of this slurry at 5000 × g for 20 minutes will result in surface scum. The scum is collected again and suspended by vigorous shaking in collagenase measurement buffer (Shortysec and Gross “Gene”: 1988, 62: 55-64). Five units of collagenase are added and the suspension is incubated with shaking for 4 hours. After this time, the suspension is centrifuged again at 5000 × g for 20 minutes. The surface float is removed and the protein content of the aqueous phase is analyzed by SDS-polyacrylamide gel electrophoresis. A band of approximately the required peptide size can be found and the protein precipitated using ammonium sulfate and concentrated using ultrafiltration or lyophilization.

B. The hydrophilic N-terminus of the N -terminal fusion oil body protein allows the fusion of the peptide to the N-terminus, while the foreign peptide will be retained on the outer surface of the oil body. Continue to guarantee. The arrangement of this fusion is shown in FIG. 2IB.
This arrangement can consist of starting materials similar to those used for C-terminal fusions, but requires convenient restriction site identification close to the initiation of translation of the oil body protein gene. A convenient site can be generated in many oil body protein genes by introducing a single base change from just 5 'to this first ATG, without any change in the coding sequence. In the oil body proteins thus far studied, this second amino acid is an alanine whose codon begins with “G”. The context of this sequence is shown below.

  A single base change in adenine prior to this “ATG” will result in both cases the Nco1 site ... CCATGG. Thus, by changing this base using the site-directed mutagenesis protocol of [Kunkel "Proc. Nat'l Acad. Sci. USA" 1985, 82: 488-492], other Nco1 sites in this sequence This clone can be produced for use without estimating.

へと突然変異する。 The coding sequence for the foreign peptide may require a preparation that will allow its direct binding into the Nco1 site. This typically involves changing one or two bases by site-directed mutagenesis (Kunkel, 1985, supra) to generate an Nco1 site around the translation start of this foreign peptide. Need. The peptide is then dissected from the cloning vehicle using a second enzyme that cleaves in close proximity to the target translational stop and Nco1. Again, using the methods described above, a second convenient site can be introduced by site-directed mutagenesis. As suggested by Kew and Fan (1990, supra), this N-terminal methionine can be removed during protein processing in vivo and this direct downstream alanine is acylated. Can do. Given this possibility, it may be necessary to retain a Met-Ala sequence at the N-terminus of the protein. This can be easily achieved by applying various strategies, such as introducing appropriate restriction sites into the coding sequence in or behind the Ala codon. For example, by site-directed mutagenesis, this sequence can be modified as follows.

Mutates to.

This change in one codon will introduce a Sph1 site into this coding sequence. The second change, which can be introduced during the same round of mutation, will convert the two bases of codon 6 resulting in GGC GCC, Nar1. This mutated gene can then be opened with Sph1 and Nar1 sites to confer a directional cloning break that can remove three codons. An adapter containing a 3 ′ overhang having the sequence CATG... (Compatible with Sph1) and a GC5 ′ overhang at the opposite end can be introduced into this site. The exact sequence of this adapter is shown below:

  This adapter again generates both Sph1 and Nar1 restriction sites, which will be used for diagnostic purposes. This Sph1 site can now be used to open the plasmid and in-frame clone a DNA fragment containing sequences for useful peptides. The direction of cloning can then be analyzed by cutting at any asymmetrically placed site and Nar1 of this plasmid.

  The construct obtained from these N-terminal fusions can typically be that of Example IB of FIG. These are an in-frame fusion within the first few codons of the OBP gene of the high-value peptide coding sequence with its own ATG as a starting signal, if necessary, and the remainder of this OBP gene and terminator May be contained.

  This modified gene is introduced into a binary Agrobacterium plasmid (Bevan, 1984, supra) and immobilized in Agrobacterium. Transformation is performed as described above. Recovery of high value protein from seeds is performed as described for “C-terminal fusion”.

C. Internal translation fusion A third type of fusion includes placing a coding sequence of a high-value protein within the coding sequence of OBP. This type of fusion requires the same strategy as in N-terminal fusions, but can only function within a less conserved region, and the more conserved regions of these OBPs This is because it is considered essential for targeting the mature protein.
A key difference in this type of fusion is the need to flank the collagenase recognition site to the protein release site. This means that instead of the standard linker / adapter system as previously described, it is necessary to provide a linker having the following form:

  Sticky ends 1 and 2 can be used to clone this adapter into the OBP clone in a directional manner. The restriction site thus incorporated is then used to introduce a high-value peptide coding sequence next to the appropriate restriction site or linker. Directionality is checked by using a restriction site placed asymmetrically in the high-value peptide coding sequence and one of the two restriction sites aligned with the coding sequence of the collagenase recognition motif.

  Immobilizing these constructs on an Agrobacterium plasmid and then on a plant is the same as the procedure already described. The recovery of high-value proteins from the seeds of transgenic plants is somewhat different from that after the oil body has been separated and washed, and this oil body is defatted and within the lipid phase the oil body is recovered. It may be necessary to evaluate collagenase recognition sites that may be hidden inside. This step may reduce the benefits of using oil body proteins as a carrier, but on the other hand is highly preferred for protein sequences that are unstable in aqueous media or in the plant cytoplasm.

D. It is possible to generate constructs in which the entire coding sequence of the interdimer transcription fusion OBP is repeated. The dimeric protein produced from this construct may still contain all the factors necessary to target this OBP to the oil body. Such constructs may contain a promoter region, the entire reading frame of the OBP or an almost complete reading frame, but exclude the translation stop and even the entire reading frame of the second OBP, this time the translation “stop” And a terminator area.
In this chimeric gene configuration, a pair of dissimilar restriction sites are found or produced in the two replication junction regions. These sites are used to allow the introduction of linkers as described above for internal translation fusion. This linker not only contains a set of collagenase recognition motifs, but also contains internal restriction sites that incorporate sequences encoding high-value proteins. The form of this construct is shown in FIG. 2III. Immobilization of this construct to Agrobacterium and even plants is as described above. Recovery of high value protein from the seed of this transformed plant can be performed using the same procedure as described for the C-terminal fusion above.

Example 2
Interleukin-1-β (IL-1 as a fusion with oleodine in plants
Strategies for Cloning and Expression of -β)
A. Cloning and sequencing of the Arabidopsis thaliana oleodine gene The “Brassica napus” oleodin gene (Murphy et al., 1991, “Biochem Biophys Acta” 1088: 86-94) was used in EMBL3A (Stratagene). A genomic library of "thaliana" (Columbia) was screened. This screening results in the isolation of an EMBLA3A clone (λ2.1) containing a 15 kb genomic fragment from “A. thaliana”. The oleodine is mapped into this 15 kb fragment (FIG. 5) in the 6.6 kb KpnI insert. The 1.8 kb NcoI / KpnI fragment containing this oleogene gene is end-filled and subcloned in the SmaI site of RFM13mp19. This 1.8 kb insert is digested with the appropriate restriction enzymes and subcloned for sequencing in M13mp19. The 1800 bp sequence of this “A. thaliana” oleodine gene is shown in FIG. All these cloning steps were carried out according to [Sambrook et al., “Molecular cloning a laboratory manual, 2nd edition, Cold Spring Harbor Laboratory Press”.

B. Design of oligonucleotides encoding IL-1-β IL-1-β consists of 9 amino acids (aa); val-gln-gly-glu-glu-ser-asn-asp-lys [Antoni et al., 1986 “J. Immunol.” 137: 3201-204]. This protease factor Xa can cleave a protein sequence containing the amino acid sequence ile-glu-gly-arg. Cleavage occurs after aa arg. Based on these sequences, oligonucleotides were designed (GVR11, FIG. 5), which, in addition to the IL-1-β coding sequence, the coding sequence for this factor Xa cleavage site, and the “A. thaliana” oleodine ( Contains 18 nucleotides of the 3 ′ coding region at base positions 742-759). This IL-1-β coding sequence was designed using optimal codon usage for “B. napus” and “A. thaliana” oleodins (Table 1).

C. Production sequence of “A. thaliana” oleodine-IL-1-β fusion : 5′CACACCAGGAACTCTCTGGTAAGC3 ′
(Base position: -838 to 814), oligonucleotide GVR10
5'CA CTGCAG GAACTCTCTGGTAAGC3 '
Designed. GVR10 has a PstI restriction site (underlined) to facilitate cloning. This polymerase chain reaction (PCR) is used to amplify the region between GVR10 and GVR11. The reaction mixture is composed of 16 μl dNTPs (1.25 mM), 10 μl 10 × PCR buffer (100 mM Tris HCl pH 8.3, 500 mM KCl, 15 mM MgCl ₂ , 0.1% (w / v) gelatin), It contained 5 μl GVR11 (20 μM), 1 μl Taq DNA polymerase (1 u / μl) and 64 μl H ₂ O. This reaction was carried out for 30 cycles. Each cycle consisted of 1 minute denaturation at 92 ° C, 1 minute annealing at 45 ° C and 3 minutes extension at 72 ° C. This PCR reaction resulted in a single fragment consisting of 1652 nucleotides.
D. Cloning of the “A. thaliana” oleodine-IL-1-β (OBPIL) fusion The 5′Sa1I-nopaline synthase (nos) terminator-EcoRI3 ′ sequence was isolated from pBI121 (Clontech Laboratories) and the Sa1 of pUC19 / Cloned into the EcoRI site. This plasmid is called pTerm. A 1652 bp fragment (described in C) was isolated and digested with restriction enzymes PstI and Sa1I. This fragment was cloned in pTERM. The resulting plasmid was called pUCOBRILT (FIG. 5). This plasmid was digested with EcoRI and PstI and the digested pUC19 vector and EcoRI-A. A thaliana oleodine-IL-1-β-nos-PstI fusion PstI (OBPILT) was obtained. The complete sequence of OBPILT is shown in FIG. OBPILT was subcloned in the EcoRI / PstI site of pBluescript ⁺ . This plasmid (pBIOBPILT) is digested with PstI and HindIII, and this PstI-OBPILT-HindIII fragment is converted into a binary Agrobacterium plasmid (Bin 19) containing a selection marker (neomycin phosphotransferase) and a PstI-HindIII specific site. [Bevan, M.M. "Nucl. Acid Res." 1984, 12: 8711-8721]. The plasmid thus obtained was called pCGOBBPILT. A schematic diagram of this cloning procedure is shown in FIG. For a description of various binary plasmids, see: pGA642 or 645; [Anne et al., 1985, “EMBO. J.” 4, 277-288] or pCGN1558 or 1559; [MacBride and Summerfeld, 1990. Year, “Plant Molec. Biol.” 14: 269-276].
F. Transformation of pCGOBBPILT into Agrobacterium strain EHA101 One EHA101 colony [Hood et al., 1986, “J. Bact.” 168: 1291-1301] was used to culture 5 ml LB + 100 μg / ml kanamycin. The culture was grown at 28 ° C. for 48 hours. Using 5 ml of the culture, 500 ml of LB + 100 μg / ml kanamycin was cultured. The culture was grown at 28 ° C. until the culture reached a density of OD600 = 0.5 (about 4 hours). These cells were spun (10 min, 5000 × g) and resuspended in 500 ml sterile H ₂ O (repeated twice). The cells were spun again and resuspended in ₃ ml of sterile H ₂ O containing 10% glycerin. 40 μl of cells were divided into Eppendorf tubes and used directly for electroporation or stored at −80 ° C. for future use. Electroporation was performed according to [Bouer et al., “Nucl. Acid. Res.” 1988, 16: 6127-6145]. A pulse generator was set in parallel with the sample chamber at 25 μF gaper, 2.5 kV and 200 ohms.
G. Transformation of Nicosia natabumum (tobacco) with pCGOBBPIL Tobacco leaf discs were transformed with EHA101 containing pCGOBBPILT. Tobacco leaves 8-10 centimeters long are harvested from plants grown in the greenhouse, sterilized in 70% ethanol for 20 minutes, and then in 10% bleach (such as “Javex”) for 8 minutes Sterilized. These leaves were then washed 6 times in sterile water. The leaf edge and main vein were cut from the leaf and the remaining leaf pieces were divided into 5 × 7 mm square pieces or 5 mm diameter discs. About 30 leaf discs were collected and placed in a small petri dish. The Agrobacterium solution was then poured onto the tobacco disc and allowed to incubate for 9 minutes. These leaf pieces were then blotted on sterile Whatman filter paper and placed on medium I (MS, 3% sucrose and 2 mg / l 2,4-D) with the dorsal axis side down. Co-cultivation was allowed to proceed for the next 48 hours. At this point, these leaf discs are transferred onto selective media (MD, 3% sucrose, 2.5 mg / l Ba, 0.1 mg / l NAA, 500 mg / l carbenicillin, and 100 mg / l kanamycin), where These were left for the next 4 weeks. Once shoots began to appear, they were dissected and placed on rooted medium (MS, 3% sucrose, 0.1 mg / l NAA, 500 mg / l carbenicillin, and 50 mg / l kanamycin). After sufficient root formation, the tobacco plant was transferred to soil.
H. Transformation of “B. napus” with pCGOBPILT Transformation of “B. napus” [Moloney et al. “Plant cell Rep.” 1989, 8: 238-242] (with reference to this disclosure herein) Included).

Transformation Procedure A single colony of Agrobacterium tumefaciens strain EHA101 containing a binary plasmid was grown overnight in AB medium at 28 ° C. A 50 μl sample of this suspension was grown overnight at 28 ° C. in 5 ml of MG / L broth supplemented with the appropriate antibiotic. This bacterial suspension was pelleted by centrifugation at 10000 × g for 15 minutes and then resuspended in 10 ml of pH 5.8 MS medium containing 3% sucrose. A thin film of this suspension was used to cover the bottom of a 5 cm Petri dish. Each incised cotyledon was collected from the plate described above, and the cut surface of the petiole was immersed in the bacterial suspension for several seconds. These were immediately returned to the same MS medium from where they were collected. The cotyledons were cocultured with Agrobacterium for 72 hours. The feeder layer was not used.

  After co-cultivation, these cotyledons were treated with 20 μM benzyladenine, 3% sucrose, 0.7% pH 5.8 physiological agar, 500 mg / l carbenicillin (“Pyopen Ayerst” and 15 mg / Transferred to regeneration medium containing MS medium supplemented with 1 kanamycin sulfate (Bollinger Mannheim) Again, these petioles were carefully embedded in 2 mm deep agar. Maintained on individual plant pieces, the higher the density, the less frequent the regeneration.

Selection and plant regeneration The plant pieces were kept on regeneration medium for more than 2-3 weeks under light and under specific temperature conditions. During this time many shoots appeared with relatively small callus formation on more than half of the plant pieces. Some of these shoots undergo bleaching after 4 weeks of culture. The remaining green shoots were subcultured onto a shoot elongation medium in which benzyladenine was removed from the same regeneration medium. One or two weeks on this medium made it possible to establish the dominance of the apical buds from the resulting shoot clusters. The shoots derived from this were transferred to a “rooted” medium containing MS medium, 3% sucrose, 2 mg / l indolebutyric acid, 0.7% physiological agar and 500 mg / l carbenicillin. No kanamycin was used at this stage because rooting occurred more rapidly without the selection agent, while only a few “escape plants” were rooted after the second round of selection on regeneration and shoot elongation medium. It was because it was found that it was actually subcultured.
I. Stable integration putatively expressed plants of OBPILT in tobacco and “B. napus” genomes were tested for neomycin phosphotransferase activity. Genomic DNA from plants exhibiting this activity was isolated. By performing Southern blotting, it was shown that the sequence between the T-DNA periphery (OBPILT and neomycin phosphotransferase genes) was stably integrated into the tobacco and “B. napus” genomes. The tobacco Southern was tested using the “A. thaliana” oleodine gene and the neomycin phosphotransferase gene. This “B. napus” Southern was tested using the neomycin phosphotransferase gene.
J. et. Expression of Oleosin-IL-1-β Fusion in Tobacco Plants RNA was isolated from growing embryos obtained from transformed and non-transformed plants. Northern blotting was performed using "A. thaliana" oleodine as a gene probe. In all tested transformed plants, an 850 nt transcript could be detected. The dimensions of these transcripts correspond to the expected dimensions of oleodine-IL-1-β. These transcripts were not detectable in untransformed plants.
K. Accumulated oil body protein of oleodin-IL-1-β protein was isolated from transformed tobacco seeds [Holbrook et al., 1991 “Plant Physical” 97: 1051-1058]. A PAGE was performed to transfer the protein from this gel to a PVDF membrane. Antibodies grown against the 22 kDa oleodine of “B. napus” were used to detect the oleodine-IL-1-β fusion in this tobacco seed. This antibody recognizes all major oleosins in “B. napus” and “A. thaliana”. Furthermore, this antibody recognizes tobacco oleodine. Tobacco oleodine has different dimensions than "A. thaliana" and "B. napus" oleodins. In this transformed tobacco seed, the anti-22 kDa antibody recognized a 20 kDa protein that was not present in the non-transformed tobacco seed. The expected dimension of this oleodine-IL-1-β fusion is 20.1 kDa. A summary of these results is shown in Table 2.

  By expressing the peptide of interest conjugated to the oil body protein, or a substantial portion thereof, resulting in the availability of the oil body, the peptide of interest can be easily purified to be substantially free of other cellular components. Can be. The fusion protein can be cleaved following purification or can be used without cleavage. The subject methods and compositions provide a fast and simple method for purifying a polypeptide of interest.

  All publications and patent applications cited herein are hereby incorporated by reference to the same extent as if each respective publication and patent application was specifically designated as incorporated by reference. To do.

  Although the present invention has been described in detail herein, it will be apparent to those skilled in the art that it will be apparent to those skilled in the art without departing from the spirit and scope of the appended claims. Many changes and modifications can be made.

The nucleotide sequence and deduced amino acid sequence (17 kDa protein) of the oil body protein gene (oleodine) from “Arabidopsis thaliana”. A comparison of the sequence of 16 kd oil body protein from carrot, 18 kd and 16 kd oil body protein from corn and 17 kd oil body protein from “Arabidopsisthaliana” is shown, showing the conserved and branched regions of this protein. The construct used for the fusion of the oil body protein gene with the gene encoding the foreign peptide is shown. A detailed arrangement for the C-terminal fusion construct is shown. The construction of the fusion peptide vectors, their introduction into plants and subsequent extraction and measurement of the desired recombinant peptide are shown schematically. A schematic diagram of the structure of pCGOBPILT is shown. The design of oligonucleotide GVR11 is shown. The nucleotide sequence of OBPILT is shown.

Claims (26)

A fusion polypeptide that can be targeted to an oil body,
(A) a first peptide comprising a hydrophobic region of oleodine that provides targeting of the fusion polypeptide to the oil body;
(B) a second peptide that is other than a portion of a natural oleodin,
And a fusion polypeptide. A fusion polypeptide that can be targeted to an oil body,
(A) comprising the hydrophobic region of oleodine that provides targeting of the fusion polypeptide to the oil body and having the following amino acid sequence

(here,
aa ²⁵ may be any amino acid;
aa ²⁶ is a neutral aliphatic amino acid;
aa ³¹ is a neutral unsubstituted aliphatic amino acid having 3 to 6 carbon atoms;
aa ³³ is a neutral unsubstituted aliphatic amino acid having 3 to 6 carbon atoms;
aa ³⁶ is a neutral unsubstituted aliphatic amino acid having 3 to 5 carbon atoms;
aa ³⁷ is a neutral unsubstituted amino acid;
aa ³⁹ is a neutral unsubstituted aliphatic amino acid;
aa ⁴¹ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁴⁴ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁴⁶ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁴⁷ is a neutral unsubstituted aliphatic amino acid;
aa ⁵¹ is glycine, leucine, alanine, valine or isoleucine;
aa ⁵³ is alanine, glycine, valine, leucine, isoleucine or threonine;
aa ⁵⁹ is a neutral unsubstituted aliphatic or aromatic amino acid;
aa ⁷² is threonine, alanine or leucine;
aa ⁷³ is valine, leucine, isoleucine or threonine;
aa ⁷⁴ is alanine or glycine;
aa ⁷⁵ is leucine or threonine;
aa ⁷⁶ is a neutral unsubstituted aliphatic amino acid or sulfur-substituted amino acid;
aa ⁷⁷ is isoleucine, alanine or valine;
aa ⁷⁸ is a neutral unsubstituted aliphatic amino acid;
aa ⁸³ is a neutral unsubstituted aliphatic or oxygen-substituted amino acid;
aa ⁸⁴ is glycine;
aa ⁸⁵ is glycine or alanine;
aa ⁸⁶ is phenylalanine or leucine;
aa ⁸⁹ is alanine, threonine or glycine;
aa ⁹⁰ is alanine or glycine;
aa ⁹² is a neutral aliphatic amino acid with oxygen substitution;
aa ⁹³ is valine or serine;
aa ⁹⁴ is phenylalanine or leucine;
aa ⁹⁶ is a neutral sulfur-substituted aliphatic amino acid or a neutral aromatic heterocyclic amino acid;
aa ⁹⁷ is a neutral unsubstituted aliphatic amino acid or sulfur-substituted amino acid;
aa ⁹⁸ is a neutral unsubstituted aliphatic amino acid or oxygen-substituted aromatic amino acid;
aa ⁹⁹ can be any amino acid:
aa ¹⁰⁰ is an oxygen-substituted amino acid and may be aliphatic or aromatic;
aa ¹⁰¹ is a neutral unsubstituted aliphatic or aromatic amino acid)
Wherein the following peptide (i) or (ii):
(I) Peptides having the following formula:
AKAATAVTAGGSLLVL-
SSLTLVGTVIALTVATPLLV-
IFSPILVPALITVALLITGF-
LSSGGFGIAAITVFSWIY- KY -
A
(Ii) a first peptide wherein the amino acid sequence of (i) is a conservative amino acid substitution and is not a peptide capable of providing targeting of the fusion polypeptide to an oil body;
(B) a second peptide that is other than a portion of a natural oleodin,
And a fusion polypeptide. Said second peptide is interleukin-1-β:
V-Q-G-E-E-S-N-D-K
The fusion polypeptide according to claim 1 or 2, comprising the amino acid sequence of   The fusion polypeptide according to any one of claims 1 to 3, wherein the second peptide has an antigenic amino acid sequence that provides an immunogen. Encoding the fusion polypeptide, and
(A) a first DNA sequence that encodes a hydrophobic region of oleodine that results in targeting of the fusion polypeptide to the oil body;
(B) a chimeric DNA construct comprising a second DNA sequence encoding a peptide, but comprising a second DNA sequence other than a portion of a natural oleodin.   6. The vector DNA comprising at least one regulatory sequence operably associated with the chimeric DNA sequence, further comprising a vector DNA capable of replicating the chimeric DNA in a host cell. Chimeric DNA construct.   The chimeric DNA construct of claim 6, wherein the regulatory sequence is capable of further expressing the chimeric DNA in a host cell.   The chimeric DNA construct according to any one of claims 5 to 7, wherein the DNA is cDNA. An expression cassette,
As a component, in the direction of transcription,
A transcription initiation regulatory DNA sequence of a gene that is expressed in seed;
A chimeric DNA construct according to any one of claims 5 to 8; and a translation and transcription termination region, wherein said components are operably linked, said chimeric DNA sequence The phenotypic cassette is regulated by the regulatory DNA sequence.   The expression cassette according to claim 9, wherein at least one of the regulatory DNA sequence and the first DNA sequence is derived from an Arabidopsis thaliana genome. A method of expressing a peptide of interest in seeds,
Transform host dicotyledonous cells with a phenotypic cassette under genomic integration conditions, where the phenotypic cassette is, as a component, in the direction of transcription,
A first DNA sequence having a portion from the regulatory region 5 ′ of the gene expressed in the seed to the translation initiation site;
A second DNA sequence that encodes the hydrophobic region of oleodine that provides targeting of the peptide of interest to the oil body; and a third DNA sequence that encodes the peptide of interest, wherein the peptide is A third DNA sequence that is other than a portion of oleodin; and a translational and transcriptional termination region, wherein said component is operably linked, and expression of said second DNA sequence is expressed in seeds A method of expressing a peptide of interest in seeds that is regulated by said first DNA sequence to effect expression.   12. The method of claim 11, wherein at least one of the regulation and the first DNA sequence is derived from Arabidopsis thaliana. A method of expressing a peptide of interest in seeds,
Transforming host dicotyledonous cells with a DNA construct under genomic integration conditions, where the DNA construct is
A first DNA sequence encoding a peptide of interest, wherein the peptide is other than a portion of a natural oleodin;
A second DNA sequence having an oleodin gene, the second DNA sequence having a portion from the regulatory region 5 ′ of the oleodin gene to a translation initiation site, wherein the first DNA sequence comprises: Expressed in the control of the regulatory region, whereby the DNA construct is integrated into the genome of the dicotyledonous cell;
Growing the dicotyledonous plant to produce a seed, thereby transducing the peptide of interest in a seed comprising transfecting the peptide of interest as a fusion protein with the expression product of the oleodine gene Method.   14. The method of claim 13, further comprising separating the fusion protein from oil bodies in the seed cells. Said separation
Lysing the seed cells to release the oil bodies;
15. The method of claim 14, comprising releasing the fusion polypeptide by destroying the oil body. Said separation
16. The method of claim 15, further comprising contacting the fusion polypeptide with a protease capable of recognizing a protease recognition site in the fusion polypeptide located before the N-terminus of the peptide of interest.   17. The method of claim 16, further comprising binding the fusion protein to a solid support having an antibody capable of binding to the expression product of the oleodine gene prior to the contacting. A method for obtaining a target purified peptide comprising:
Transforming host dicotyledonous cells with a DNA construct under genomic integration conditions, where the DNA construct is
A first DNA sequence encoding a peptide of interest, wherein the peptide is other than a portion of a natural oleodin;
A second DNA sequence having an oleosin gene, the second DNA sequence having a portion from the regulatory region 5 'of the oleogene gene to a translation initiation site, wherein the first DNA sequence is the Expressed under the control of a regulatory region, whereby the DNA construct is integrated into the genome of the dicotyledonous cell;
Growing the dicotyledonous plants to produce seeds, whereby the peptide of interest is expressed as a fusion protein with the expression product of the oleodine gene;
Separating oil bodies from said seed cells;
Breaking the oil body to release the fusion protein;
A method for obtaining a purified peptide, comprising purifying the peptide of interest.   19. The method of claim 18, wherein the peptide of interest is other than a peptide encoded by a plant genome.   20. The method of claim 19, wherein the peptide of interest is other than a peptide naturally present in oil bodies. Said separation
21. The method of claim 20, comprising recovering the oil body fraction following lysis of the cells from the seed.   The dicotyledonous plant cell which has the expression cassette of Claim 9 or 10.   Dicotyledonous plants containing the expression cassette according to claim 9 or 10.   Dicotyledonous seeds containing the expression cassette according to claim 9 or 10. A method for obtaining a target peptide in an oil body, comprising:
Transfecting the peptide in the seed as a fusion polypeptide with a hydrophobic region of oleodine that results in targeting of the fusion polypeptide to the oil body, wherein the peptide is other than part of a natural oleodine , A method for obtaining a peptide of interest in an oil body.   26. A method according to claim 25, characterized in that the fusion polypeptide is the fusion polypeptide of any one of claims 1-4.

Images