JP3824619B2 - Measles virus recombinant poxvirus vaccine - Google Patents

Description

DESCRIPTION OF RELATED APPLICATIONS The present invention is a continuation-in-part of prior application copending application 07 / 621,614 filed on November 20, 1990.

TECHNICAL FIELD The present invention relates to a modified poxvirus and a method for producing and using the same. More particularly, the present invention relates to a recombinant poxvirus in which the virus expresses a gene product of a measles virus gene and a vaccine that provides protective immunity against measles virus infection.

  In this application several publications are cited by Arabic numerals in parentheses. All citations relating to these references are listed at the end of the specification immediately preceding the claims. These references describe the prior art to which the present invention belongs.

  Vaccinia virus and more recently other poxviruses have been used for the insertion and expression of heterologous genes. The basic technique of inserting a heterologous gene into a live infectious poxvirus is to intervene between a pox DNA sequence flanked by a heterologous gene element in the donor plasmid and a homologous sequence present in a rescued poxvirus. Includes recombination (Piccini et al., 1987).

  In particular, the recombinant poxvirus is composed of two steps known in the prior art and is similar to the method of producing a synthetic recombinant of vaccinia virus described in Patent Document 1, and its patent Is hereby incorporated by reference.

  First, DNA gene sequences that are inserted into the virus, particularly open reading frames from non-pox sources, are those that contain DNA that is homologous to the poxvirus DNA portion. E. coli plasmid construct. Apart from that, the inserted DNA gene sequence is linked to a promoter. Promoter gene binding is located in the plasmid construct so that the promoter gene binding is flanked on both sides by DNA homologous to the DNA sequence flanking the region of pox DNA containing the missing locus. The resulting plasmid construct is then E. coli. Amplified by growth in E. coli bacteria (Clewell, 1972) and isolated (Clewell et al., 1969; Maniatis et al., 1982).

  Second, the isolated plasmid containing the inserted DNA gene sequence is transfected with the poxvirus into a cell culture, such as chick embryo fibroblasts. Each recombinant between the homologous pox DNA in the plasmid and the viral genome gives a poxvirus that is modified by the presence of a heterologous DNA sequence in the essential region of the genome. The term “heterologous” DNA refers to exogenous DNA, particularly DNA from non-pox sources, that encodes a gene product that is not normally produced by the genome in which the exogenous DNA is located.

  Genetic recombination is generally the exchange of homologous portions of DNA between two strands of DNA. In some viruses, RNA replaces DNA. A homologous portion of a nucleic acid is a portion of a nucleic acid (DNA or RNA) having the same nucleotide base sequence.

  Genetic recombination occurs naturally during the replication or production of new viral genomes in infected host cells. Therefore, genetic recombination between viral genes occurs during the viral replication cycle that occurs in host cells co-infected with two or more different viruses or other genetic constructs. The portion of DNA from the first genome is used interchangeably to constitute the portion of the genome of the second co-infected virus whose DNA is homologous to the DNA of the first viral genome.

  However, recombination can also occur between portions of DNA in different genomes that are not completely homologous. A first genome in which one such part is homologous to another genome except for the presence in a first part of a gene or genetic marker encoding an antigenic determinant inserted into, for example, a part of homologous DNA The recombination still occurs and the product of the recombination can then be detected by the presence of the gene or genetic marker in the recombinant viral genome.

  Two conditions are required for successful expression of the inserted DNA gene sequence by the modified infectious virus. First, insertions must be made in the essential region of the virus so that the modified virus continues to survive. The second condition for expression of the inserted DNA is the presence of a promoter in appropriate relationship to the inserted DNA. A promoter must be placed so that it is located upstream from the DNA sequence to be expressed.

  Canine distemper virus (CDV) and measles virus (MV) are members of the measles virus subtype of the family Paramyxovirus (Diaro, 1990; Kingsbury et al., 1978). The virus contains a negative polarity non-segmented single-stranded RNA genome. Canine distemper is a febrile disease of dogs or other carnivorous animals that are very susceptible to infection. Mortality is high; it ranges between 30 and 80 percent. Even if a dog survives, the permanent central nervous system can often be damaged (Fenner et al., 1987). Similarly, measles virus produces a severely susceptible febrile disease characterized by a systemic papule rash. The disease mainly affects children.

  The characteristics of the measles virus genus have been recently reported by Nobby and Oxman (1990) and Gialo (1990). As reported in other paramyxovirus genera (Avery and Niben, 1979; Marts et al., 1980), two structural proteins are important in eliciting a protective immune response. These proteins are hemagglutinating and the membrane glycoprotein hemagglutinin (HA) responsible for viral adsorption to host cells, and between virus and infected cells or between infected and adjacent uninfected cells. A fusion glycoprotein (F) that causes membrane fusion (Graves et al., 1978). The order of the genes in the MV genome was speculated by Richardson et al. (1985) and Doring et al. (1986). The nucleotide sequences of the MVHA and MVF genes were determined by Alkachib and Bridis (1986) and Richardson et al. (1986), respectively.

  CDV and MV are structurally similar and share similar serum relationships. Immunoprecipitation studies have shown that antisera against MV precipitate all CDV proteins (P, NP, F, HA and M). In contrast, antisera against CDV precipitate all MV proteins except HA glycoproteins (Hole et al., 1980; Ober et al., 1980; Stefenson et al., 1979). In light of this similar serum relationship, MV vaccination has previously been shown to elicit protection against canine CDV challenge (Gillespie et al., 1960; Mora et al., 1961; Wallen et al., 1960). Although neutralizing antibodies against CDV have been reported in human anti-MV sera (Adams et al., 1957; Imagawa et al., 1960; Curzon, 1955; Curzon, 1962), neutralizing antibodies against MV are found in anti-CDV sera from dogs. (Delay et al., 1965; Curzon, 1962; Roberts, 1965). MV HA and F genes are expressed in vaccinia virus (Dorrian et al., 1988; Wilde et al., 1991), fowlpox virus (Sphener et al., 1990; Wilde et al., 1990), adenovirus (Alhachib et al., 1990) and baculovirus (Builarard Et al., 1990). In these studies, the authenticity that functioned in the hemagglutination (Bearard et al., 1990) hemolysis (Alhativ et al., 1990; Beardard et al., 1990) or cell fusion (Alhativ et al., 1990; Beardard et al., 1990; Wilde et al., 1991) assay. Of MV protein was expressed. When inserted into a vaccinia virus vector, expression of either HA or F protein could elicit a protective immune response in mice against MV encephalitis (Dorien et al., 1988). Similarly, expression of F protein in fowlpox virus vector elicited protective immunity against MV encephalitis in mice (Wild et al., 1990). No defense studies were reported for other vectors.

  Patent Document 2 relates to the expression of the MV gene in fowlpox.

  Parkus et al. (1990) recently described the definition of two unique host range genes in vaccinia virus. These genes encode host range functions that allow vaccinia virus replication on various cell substrates in vitro. The gene encodes the host range function of vaccinia virus replication on human cells as well as cells of domestic rabbit and pig sources. These gene definitions, on the other hand, provide for the development of vaccinia virus vectors that are severely limited in their ability to express heterologous genes of interest and replicate in defined cells. This greatly enhances the safety characteristics of vaccinia virus recombinants. Attenuated vectors have been developed due to lineage deletion of six essential regions from the Copenhagen strain of vaccinia virus. These regions are known to encode proteins that have a role in viral toxicity. The missing region is the tk gene, hemorrhagic gene, type A-containing gene, hemagglutination gene, and the large subunit of ribonucleotide reductase and the gene encoding the previously defined C7L to K1L sequence (Percus et al., 1990). The sequence and gene arrangement of these genes in the Copenhagen strain of vaccinia virus has been previously defined (Goebel et al., 1990a, b). The attenuated vaccinia strain produced is referred to as NYVAC.

  The technology for producing vaccinia virus recombinants has recently been extended to other members of the Poxviridae family with a more restricted host range. The avipox virus, fowlpox, is designed as a recombinant virus expressing the rabies G gene (Taylor et al., 1988b). This recombinant virus is also described in US Pat. Inoculation of a large number of recombinant chickens elicits an immune response against rabies that protects against lethal doses of rabies challenge in mice, cats and dogs.

  Both canine distemper and measles are currently controlled by the use of attenuated vaccines (Fenner et al., 1987; Preblood et al., 1988). Immunization using live attenuated vaccines at 8 weeks of age and 12-16 weeks of age is recommended for CDV control. Although immunity against CDV is lifelong, regular revaccination is usually recommended because of the severity of the disease and the high infectious nature of the agent.

  One problem with the current policy of continuous revaccination is that the CDV immunized mother passes neutralizing antibodies against colostrum progeny. It is difficult to ascertain when puppy vaccination levels of these antibodies decline. This leaves clues when puppies are susceptible to infection with CDV. The use of a recombinant vaccine that expresses only measles virus glycoprotein provides a method of overcoming the inhibitory effect of maternal antibodies and vaccinating newborns. Indeed, it has been shown that CDV-specific antibodies in pups that have received a CDV immunized mother did not interfere with the development of MV-specific antibodies when vaccinated with MV vaccines (Baker et al., 1966).

  Other limitations of commonly used modified live CDV vaccines have been previously described (Chizard, 1990) and are associated with the ability of these vaccine strains to replicate in vaccinated animals. These deficient effects are most pronounced when the CDV vaccine strain is inoculated with canine adenovirus 1 and 2 in dogs with immunosuppression, thrombocytopenia, and encephalitis (Vestetti et al., 1987; Hartley, 1974; Phillips et al. 1989). Modified live CDV vaccines have also been shown to induce distemper in other animal species including foxes, Kinkajos, ferrets and pandas (Bush et al., 1976; Carpenter et al., 1976; Kazakos et al., 1981). . Therefore, the use of recombinant CDV vaccine candidates eliminates the continued introduction of modified live CDV into the environment and the potential vaccine association and vaccine induction that arises from the use of conventional CDV vaccines. The use of poxviruses also provides a means to overcome the suppressive effects described in the literature possessed by maternal antibodies upon vaccination with currently used canine attenuated CDV strains. Puppies born to mothers immunized with poxwill recombinant at a young age avoid interference with CDV-specific maternal antibodies. In addition, the ability of both vaccinia virus and canarypox virus vectors containing the MV HA and F genes to elicit these reactions and the lack of close reactivity of serum between the two poxviruses is Is used early in the life of a puppy and the other is used late to provide additional benefits of enhancing CDV-specific immunity. This eliminates the release of attenuated DCV strains to the environment and events associated with the occurrence of vaccine induction and vaccine-related concomitant (Chizard, 1990).

Therefore, it will be appreciated that providing a measles virus genus recombinant poxvirus and a vaccine that provides protective immunity against measles virus infection is a highly desirable advantage over the current state of the art.
U.S. Pat.No. 4,603,112 European Patent No. 0 314 569 International Publication No. 89/03429 Pamphlet

  Therefore, it is an object of the present invention to provide a recombinant poxvirus that expresses a gene product of the measles virus genus and to provide a method for producing such a recombinant poxvirus.

  It is a further object of the present invention to provide cloning and expression of measles virus genus coding sequences, particularly measles virus coding sequences, in pox vectors, particularly vaccinia virus vectors or canary pox virus vectors.

  Another object of the present invention is to provide a measles virus genus neutralizing antibody, a hemagglutination-inhibiting antibody, and a vaccine capable of eliciting protective immunity against measles virus genus infection and administration of a lethal dose of measles virus genus. It is to provide a dog's close protection against canine distemper using a measles virus recombinant poxvirus vaccine.

  These and other objects and advantages of the present invention will be readily apparent after the following discussion.

  In one aspect, the present invention relates to a recombinant poxvirus containing a DNA sequence from the measles virus genus in an integral region of the poxvirus genome. The poxvirus is preferably an avipox virus such as a canary pox virus or a vaccinia virus. The measles virus genus is preferably measles virus.

  According to the present invention, the recombinant poxvirus expresses a gene product of a heterologous measles virus gene. In particular, the heterologous DNA encodes a measles virus glycoprotein, preferably a measles virus hemagglutinin glycoprotein and a measles virus fusion glycoprotein. Preferably, multiple measles virus glycoproteins are expressed together in a host by a recombinant poxvirus.

  In another aspect, the invention relates to a vaccine that elicits an immune response in a vaccinated host animal, wherein the vaccine contains recombinant from measles virus genus, particularly measles virus, in the integral region. Includes poxvirus and carrier. Preferably, the DNA encodes and expresses a measles virus glycoprotein, particularly a measles virus hemagglutinin glycoprotein and a measles virus fusion glycoprotein. Multiple measles virus glycoproteins are preferably expressed together in the host. The poxvirus used in the vaccine according to the invention is preferably an avipox virus such as vaccinia virus or canarypox virus.

  For a better understanding of the present invention, reference is made to the accompanying drawings.

  The invention and its many advantages will be described in detail with reference to the following examples, which are given for illustration.

Example 1 Production of Vaccinia Virus Recombinant Containing Measles Hemagglutinin Gene The rescue virus used for the production of both recombinants is a vaccinia virus deficient in the thymidine kinase gene. Copenhagen strain. All viruses were grown and titrated on Vero cell monolayers.

  The early / late vaccinia virus H6 promoter (Rocell et al., 1986; Taylor et al., 1988a, b) was constructed by annealing four overlapping oligonucleotides, H6SYN AD. The generated H6 sequence is as follows.

Vaccinia virus H6 promoter (SEQ ID NO: 1 / SEQ ID NO: 2):
HindIII

5'AGCTTCTTTATTCTATAACTTAAAAAGTGAAAATAAAATACAAAGGTTCTTGAGGGTTGT

AGAATAAGATATAGGAATTTTTCACTTTTTATTTAGTTTCCAAGAACTCCCAACA

GTTAAATTGAAAGCGAGAAATAATCATAAATTATTTTCATTATCGCATACATCCGTTAAGTT
CAATTTAACTTTCGCTCTTTATTTAGTATTTAATAAAGTAATAGCCGCTATAGGCAATTCAA

TGTATCCGTAC-3 '
ACATAGCATGAGCT-5 '

XhoI
Reference is now made to FIG. The annealed H6SYN oligonucleotide was ligated into pMP2LVC cut with XhoI / HindIII to produce plasmid pSP131. Plasmid pMP2LVC contains the leftmost 0.4 kbp of the vaccinia virus (Copenhagen strain) HindIII K region in pUC8. The construction of pMP2LVC was performed as follows: a 0.4 kbp HindIII / SalI fragment from the HindIII K region was isolated and E. coli in the presence of 2 mM dNTPs. The DNA was blunted with a Klenow fragment of E. coli DNA polymerase. This fragment was inserted into pUC18 cut with PvuII. The resulting plasmid was called pMP2VC. Plasmid pMP2VC was linearized with SspI. Synthetic oligonucleotides MPSYN52 (SEQ ID NO: 3) (5′-ATTATTTTTATAAGCTTGGATCCCCTGAGGGGTACCCCCGGGGAGCTCCGAATTCT-3 ′) and MPSYN53 (SEQ ID NO: 4) (5′-AGAATTCGAGCTCCCCGGGGTACCC Inserted at the far left. The resulting plasmid pMP2LVC contains a multiple cloning region in the intergenic region between the K1L and K2L reading frames.

  Annealed oligonucleotide 3P1 (SEQ ID NO: 5) (5'-GGGAAG-ATGGGAACCCAATCGCAGATAGAG-3 ') and 3P2 (SEQ ID NO: 6) (5'-AATTCTATTCTG-GATTTGGGGTTCCATCTTCTCCC containing the 3' sequence at the tip of the HA gene and the sticky end EcoRI -3 ') was ligated to a 1.8 kbp XhoI / SmaI fragment from pMH22 containing the residual group of the HA gene and pSP131 cut with XhoI and EcoRI. The resulting plasmid was called pSPMHA11. Plasmid pMH22 was derived from a full length cDNA clone of the measles HA gene by creating an XhoI site in the ATG initiation codon (Alhachib et al., 1986).

  A 1.9 kbp HindIII / EcoRI fragment from pSPMHA11 containing the measles HA gene was isolated and E. coli in the presence of 2 mM dntp. The DNA was blunted with a Klenow fragment of E. coli DNA polymerase. The isolated fragment was inserted into pMP409DVC cut with BglII (Guo et al., 1989) and blunted by treatment with a mung bean nuclease. Plasmid pSPMHA41 was produced by insertion into this vector. An XhoI site between the H6 promoter and the start codon of the HA gene was inserted into the oligonucleotide-directed double-strand cleavage mutation (Mandeck, 1982) using the oligonucleotide HAXHOD (SEQ ID NO: 7) (5'-ATATCCCGTTAAGTTTGTATCGTATGTTCACCACAACGAGACCGGAT-3 '). ). The plasmid pSPM2LHAVC was produced by this method. In an in vitro recombination experiment with vaccinia virus vP458 as a rescue virus, recombinant vP557 was produced using insertion of plasmid pSPM2LHAVC. vP458 is E. coli at the M2L insertion site of vP410. contains the E. coli milk Z gene. This vaccinia virus recombinant contains the measles HA gene in the M2L locus of the genome, replacing the milk Z gene.

Example 2 Production of Recombinant Vaccinia Virus Containing Measles Fusion Gene Reference is made to FIG. Annealed oligonucleotide 3PA (SEQ ID NO: 8) (5'-CCTAAAGTTGATCTTACGGGAACATCAAAATCCTATGTAAGGTCGCTCTGATTTTTATCGGCCGA-3 ') and measles fusion gene containing 3' end, vaccinia virus early transcription termination signal (Yuen et al., 1987) and EagI end 3PB (SEQ ID NO: 9) (5'-AGCTTCGGCCGATAAAAAATCAGAGGCGACCCTATACATGAGTTTGATGTTCCCGTAAGATCAGGCTTTAGG-3 ') from pUC8 and pCRF2 cleaved with SalI and HindIII. Down, it was linked to the National Research Council Canada obtained from (Biological Engineering Institute)). The resulting plasmid pMF3PR14 contained the 3 'end of the 1 kbp fragment of the measles fusion gene.

  Annealed oligonucleotide 5PA (SEQ ID NO: 10) (5'-GGGATGGGTCTCAAGGTGAACGTCTCTGCCATATTC-3 ') and 5PB (SEQ ID NO: 11) (5'-ATGGCAGAGAGTTCACCCT-3GASTCAT-3) containing 5' SmaI and 3'BstXI sites It was ligated to the 820 bp BstXI / SalI fragment from pCRF2 and pUP8 cut with SmaI and SalI. The resulting plasmid pSPMF5P16 contained the 5 'portion of the measles fusion gene. The 820 bp SmaI / SalI fragment from pSPMF5P16 and the 1 kbp SalI / EagI fragment from pMF3PR14 were ligated into pTP15 cut with SmaI and EagI. Plasmid pTP15 (Guo et al., 1989) contains the vaccinia virus early / late H6 promoter linked flanked by sequences from the HA locus of the vaccinia virus (Copenhagen strain) genome. The resulting plasmid containing the 3 'measles fusion gene in parallel with the H6 promoter in the HA insertion plasmid was designated pSPHMF7.

  Oligonucleotide directed mutations were made in pSPHMF7. First, an in vitro mutation reaction (Mandeck, 1982) was performed, and the SmaI site was removed using oligonucleotide PSMAD (SEQ ID NO: 12) (5'-TATCCGTTAAGT-TTGTATGGTAATGGGTCTCAAGGTGAACGTCT-3 '). The correct ATG: ATG linkage was generated. This produced pSPMF75M20. Subsequently, the BglII site at the 5 'end of the H6 promoter was removed using the oligonucleotide SPBGLD (SEQ ID NO: 13) (5'-AATAAACACTTTTTATATACTATTCTTTATTCTATATACTAAAAAGT-3') according to known methods (Mandeck, 1982). The resulting plasmid was called pSPMFVC. VP455 was produced using this plasmid in ex vivo recombination experiments with vaccinia virus vP410 as a rescue virus.

Example 3-Immunoprecipitation analysis To confirm that recombinants vP455 and vP557 expressed authentic proteins, immunoprecipitation experiments were performed according to the method described (Taylor et al., 1990). Briefly, Vero cell monolayers were infected with either parental or recombinant virus at 10 pfu per cell in the presence of ³⁵ S-methionine. The fusion protein was specifically precipitated from infected cell lysates using a home rabbit antiserum in series against the carboxy-terminal fusion peptide. Hemagglutinin protein was specifically precipitated from infected cell lysates using polyclonal monospecific live antisera. For immunoprecipitation using fusion specific serum, no radiolabeled product was detected in uninfected Vero cells, parent infected Vero cells, or cells infected with HA recombinant vP557. In cells infected with the fusion recombinant vP455, the fusion precursors F ₀ with a molecular weight of approximately 60 kd and two cleavage products F ₁ and F ₂ with a molecular weight of 44 kd and 23 kd were detected. Similarly, no product is detected in uninfected Vero cells, parent infected cells, or Vero cells infected with vP455 for immunoprecipitation of glycosylated forms of HA protein having a molecular weight of about 75 to 77 kd It was.

  In addition, immunofluorescence studies showed that both proteins were expressed on the infected cell surface.

Example 4-Cell fusion experiments A characteristic of measles virus genus cytopathic properties is the formation of fused cells resulting from the fusion of infected cells with surrounding uninfected cells, followed by the movement of the nucleus towards the center of the fused cells. (Noby et al., 1982). This has been shown to be an important method of viral spreading, which can occur in the presence of hemagglutinin specific antibodies for the Paramyxovirus genus (Marts et al., 1980). This ability has been attributed to the amino terminus of the F1 peptide by analogy with other genera of Paramyxovirus (Chopin et al., 1981; Novic et al., 1988; Patterson et al., 1987).

  To confirm that the measles virus protein expressed in vaccinia virus is functionally active, Vero cell monolayers were inoculated with 1 pfu per cell of parental or recombinant viruses vP455 and vP557, respectively. After 1 hour of absorption at 37 ° C., the inoculum was removed, the overlay medium was replaced, and the plate with the inoculum was incubated overnight at 37 ° C. 18 hours after infection, the plates were observed under a microscope and photographed. No cell fusion activity was seen in Vero cells inoculated with the parental virus vP455 or vP557. However, sufficient cell fusion activity was observed when both vP455 and vP557 were inoculated.

  The results confirmed that the formation of fused cells in various cell lines infected with measles / vaccinia virus recombinants required the expression of both fusion and hemagglutinin genes (1991). Recently confirmed. However, the results are markedly different from previous reports (Alhachib, 1990) that described cell fusion in 293 cells infected with highly multiplexed adenovirus recombinants expressing measles fusion proteins. Similarly, in insect cells infected with baculovirus recombinants expressing measles fusion proteins, it has been reported that cell fusion was observed only when cultured at pH 5.8 (Bearard et al., 1990). . In either case, the fusion activity was not enhanced by co-infection with an appropriate recombinant expressing the measles hemagglutinin protein. Factors involved in the fusion process are the cell type (Gilaudon et al., 1984), the pH of the medium (Builard et al., 1990) and the expression level of the fusion protein (Noby et al., 1982).

Example 5 Serum Testing The technique of virus neutralization (VN) antibody testing has been described in detail previously (Apel et al., 1973). CDV-VN antibody titration studies were performed in Vero cells with an adapted Onderstepport strain of CDV. Tests of MV-VN antibody titration were performed in Vero cells with an adapted Edmonston strain of MV. The results of the serum test are shown in Table 1.

As described in Example 6, dogs immunized with either vP455 expressing measles fusion protein or vaccinia parental virus did not develop neutralizing antibodies against MV. Dogs immunized with vP577 expressing HA protein or co-inoculated with both recombinant vP455 and vP557 developed neutralizing antibodies after a single inoculation. The level of antibody was equal to the level induced by inoculation with attenuated Edmonston strain of MV.

Example 6 Animal Protection Studies To determine whether the expression of measles virus protein in dogs inoculated with recombinants is sufficient to elicit a protective immune response to CDV challenge, 14 10 Weekly beagle dogs without specific pathogens were studied. Blood samples were collected repeatedly at the beginning of the experiment and thereafter. Four groups of 2 animals each were immunized with 2 injections at 3 week intervals. The first group was injected with vaccinia virus only. The second group was injected with vaccinia virus with an insert of the measles virus F protein (vP455). The third group was injected with vaccinia virus with an infusion of MV HA antigen (vP557), and the fourth group was injected with the second and third combination. Each dog was inoculated with about 4 × 10 ⁸ pfu (0.6 ml subcutaneously, 0.4 ml intramuscularly) of vaccinia virus in a volume of 1 ml. Two control dogs were injected intramuscularly with 10 ⁵ 50% tissue culture infectious dose (TCID ₅₀ ) of MV attenuated Edmonston strain (1 ml volume), and two control dogs had toxic CDV Prior to challenge, an attenuated rockbone strain of 10 ⁴ TCID ₅₀ CDV was injected subcutaneously. Two dogs were not vaccinated prior to challenge.

Two weeks after the last inoculation, all dogs were challenged by intranasal inoculation with 1 ml of cell culture fluid containing 10 ⁴ TCID ₅₀ of virulent CDV Snyderhill strain. The dog's clinical response was monitored by daily observation and recording of body temperature and by recording weight gain or loss once every two weeks. Circulating blood lymphocytes were counted on days before and after challenge (dpc) 3, 5, 7, and 10. Isolation of virus from capsule-forming cells by co-culture with macrophages from canine lung (Apel et al., 1967) was performed at dpc 3, 5, 7 and 10. Serum test blood samples were accumulated prior to vaccination, weekly until the time of challenge, and at dpc 7, 10 and 20.

The results of antigen administration are shown in Table 2.

  Non-immunized control dogs and dogs vaccinated with parental vaccinia virus showed clinical signs of severe illness and were euthanized when dehydration became apparent. Therapy dogs immunized with vP455 showed signs of CDV infection, including weight loss, increased body temperature, and lymphopenia, albeit for a shorter period than that seen in control dogs. Needless to say, both dogs survived despite challenge with a lethal dose of CDV. Dogs vaccinated with vP557 or co-inoculated with therapy recombinants showed minimal signs of infection and survived challenge. Dogs inoculated with either the MV attenuated Edmonstone strain or the CDV attenuated Rockbone strain also survived the challenge with minimal signs of disease.

Example 7-Additional Vaccinia / Measles Composition Reference is now made to FIG. Insertion of plasmid pRW843 produced a second vaccinia virus recombinant containing the measles HA gene in the tk locus (vP756). pRW843 was constructed according to the following method. Exact ATG: A 1.8 kbp EcoRV / SmaI fragment containing 24 bp 3′-terminal of the H6 promoter fused to the HA gene lacking 26 bp 3′-terminal in the ATG sequence was isolated from pSPM2LHAVC . This fragment was used to replace the 1.8 kbp EcoRV / SmaI fragment of pSPMHA11 to produce pRW803. Plasmid pRW803 contains the complete H6 promoter linked to the exact complete measles HA gene.

Upon confirmation of the previous construct with the measles HA gene, it was found that the sequence of coden 18 (CCC) was deleted compared to the published sequence (Alhachib et al., 1986). Oligonucleotide RW117 (SEQ ID NO: 14) (5′-GACTATCCTACTT-CCCTTGGGATGGGGGTTATCTTTGTA-3 ′)
Pro 18
The CCC sequence was replaced by oligonucleotide mutagenesis using the Kunkel method (Kunkel, 1985). A single-stranded template was derived from plasmid pRW819 containing the H6 / HA cassette from pRW803 in pIBI25 (IBI, New Haven, CT.). The mutagenesis plasmid containing an insert (CCC) encoding a proline residue at codon 18 was designated pRW820. The sequence between the HindIII and XbaI sites of pRW820 was confirmed by nucleotide sequence analysis. The HindIII site is located at the 5 'edge of the H6 promoter, while the XbaI site is located 230 bp downstream from the start codon of the HA gene. A 1.6 kbp XbaI / EcoRI fragment from pRW803, containing the HA coding sequence downstream from XbaI and containing the termination codon, was used to replace an equal fragment of pRW820 to produce pRW837. The mutagenic expression cassette contained within pRW837 is induced by cleavage with HindIII and EcoRI and E. coli in the presence of 2 mM dNTPs. A blunt end was inserted into the SmaI site of pSD573VCQ using the Klenow fragment of E. coli DNA polymerase to produce pRW843. VP756 was produced using plasmid pRW843 in an in vitro recombination experiment with vP618 as a rescue virus. The parental virus vP618 is a Copenhagen strain virus that is deficient in thymidine kinase, hemorrhagic and type A containing genes. Recombinant vP756 is shown by immunoprecipitation analysis that accurately expresses the hemagglutinin glycoprotein of about 75 kd.

  Reference is now made to FIG. A second vaccinia virus recombinant (vP800) containing the measles fusion gene at the ATI locus of the genome was produced by insertion of plasmid pRW850. In order to construct pRW850, the following operations were performed. The plasmid pSPMF75M20 containing the measles fusion gene linked to the H6 promoter exactly in the ATG: ATG sequence was cut with NruI and EagI. A 1.7 kbp blunt fragment containing 28 bp 3'-terminal of the H6 promoter and the complete fusion gene was isolated and inserted into pRW823 which had been cut with NruI and XbaI and blunt-ended. The resulting plasmid pRW841 contains the H6 promoter linked to the measles fusion gene in the pIBI25 plasmid vector (IBI, New Haven, CT.). A cassette expressing H6 / measles fusion was induced from pRW841 by digestion with SmaI, and the resulting 1.8 kbp fragment was inserted into pSD494VC digested with SmaI to produce pRW850. VP800 was produced using plasmid pRW850 in in vitro recombination experiments with vP618 as a rescue virus. Recombinant vP800 was shown by immunoprecipitation analysis expressing a reliably processed fusion glycoprotein.

Example 8 Evaluation of Measles Neutralizing Antibody in Rabbits Inoculated with vP455 and Guinea Pigs Two rabbits were skinned at 5 sites with a total of 1 × 10 ⁸ pfu of recombinant vP455 expressing measles fusion protein. Inoculated inside. Both rabbits were boosted by inoculation 12 weeks later. Consecutive blood bleeds were collected 2 weeks after boosting, i.e. 14 weeks, and rabbits were tested for the presence of serum neutralizing antibodies.

Four guinea pigs were inoculated subcutaneously with 1 × 10 ⁸ pfu of recombinant vP455 each. Each challenge was given 21 days later. Continuous bleeding accumulated.

The presence of measles virus serum neutralizing antibodies was assessed by a microtiter test (Apel et al., 1973) using 10 TCID ₅₀ viruses per microtiter well. The results are shown in Table 3.

Example 9 Production of Measles Virus Recombinant Canary Pox Virus A measles / canary pox virus recombinant was produced using a method similar to that previously described for fowlpox virus (Taylor et al., 1988a, b).

  A plasmid for inserting the measles F and HA genes into the canarypox virus was produced as follows.

  Reference is now made to FIG. A 1.8 kbp blunt BglII / EagI fragment from pSPMF75M20 containing the H6 promoted measles F gene was inserted into the blunt EcoRI site of pRW764.2. Plasmid pRW764.2 contains a 3.4 kbp PvuII fragment from the canarypox genome with a unique EcoRI site that has been confirmed to be essential for viral replication. The resulting plasmid containing the measles F gene was called pRW800 and was used in a recombination experiment with canarypox as a rescue virus to produce vCP40.

  Reference is now made to FIG. A 1.8 kbp EcoRV / SmaI fragment from pSPM2LHA containing 28 bp 3'-end of the H6 promoter fused to HA with the correct ATG: ATG sequence was inserted between the EcoRV and SmaI sites of pSPMHA11. The resulting plasmid was called pRW803. The 2 kbp HindIII / EcoRI fragment of pRW803 containing the H6 promoted measles HA gene was inserted as a blunt end into the blunt end BglII site of plasmid pRW764.5. Plasmid pRW764.5 contains an 800 bp PvuII fragment of the canarypox genome with a unique BglII site previously identified as essential for viral growth. By this insertion, plasmid pRW810 used for the recombination test was generated to produce vCP50.

  Recombinant vCP40 and vCP50 were generated separately by insertion of measles F and HA sequences, respectively. In order to generate a double recombinant, single F recombinant vCP40 was used as a rescue virus to insert the HA gene contained in pRW810. This generated a double recombinant vCP57.

Example 10-Immunoprecipitation analysis Monospecific serum directed against either HA or F protein to confirm that recombinants vCP40, vCP50 and vCP57 expressed authentic proteins The immunoprecipitation analysis using was performed. Correctly treated fusion polypeptides were specifically precipitated from the lysates of cells infected with vCP40 and vCP57. A fusion precursor F ₀ having a molecular weight of about 60 kd and two cleavage products F ₁ and F ₂ having a molecular weight of about 44 kd and 23 kd, respectively, were detected. No fusion-specific product was detectable in uninfected CEF cells, parent infected CEF cells or CEF cells infected with HA recombinant vCP50. Similarly, about 75 kd glycoprotein was specifically precipitated from CEF cells infected with single HA recombinant vCP50 and double recombinant vCP57. No HA specific product was detected in uninfected cells, parent infected cells or cells infected with fusion recombinant vCP40.

Example 11-Cell fusion experiment To confirm that the measles virus recombinant is functionally active, a cell fusion assay was performed. Vero cell monolayers were infected with 1 pfu CP parent or recombinant virus per cell and tested for cytopathic effect 18 hours after infection. No cell fusion activity was evident in Vero cells inoculated with the parent, vCP40 or vCP50 virus. However, sufficient cell fusion activity was shown when Vero cells were inoculated with double recombinant vCP57 or when cells were co-inoculated with both vCP40 and vCP50.

Example 12-Serum test As described in Example 13, canine pox / HA recombinant vCP50, vaccinia / HA recombinant vP557, canarypox / HA / F double recombinant vCP57 inoculated dogs or vP455 and Dogs co-inoculated with vP557 developed significant serum neutralizing antibodies against measles virus after a single inoculation. Neither of the two dogs inoculated with the canarypox / F recombinant vCP40 developed neutralizing antibodies after one or two inoculations. The results of the serum test are shown in Table 4.

In addition, guinea pigs inoculated with vCP40 produced reproducible but low levels of serum neutralizing antibodies.

Example 13-Animal Protection Study To determine whether a non-replicating canarypox vector expressing measles virus protein elicits a protective immune response to CDV challenge, a 10 week old beagle dog without a specific pathogen Were inoculated with canarypox parent and recombinant virus. Two dogs were inoculated simultaneously with 1 × 10 ⁸ pfu of each recombinant injection twice at 3 week intervals. For comparison, one dog was inoculated with the same regimen, each of a single vaccinia virus recombinant vP455 and vP557 and a combination of both. One dog also inoculated intramuscularly with a single dose of 10 ⁵ TCID ₅₀ of MV attenuated Edmonstone. One dog was inoculated subcutaneously with a single dose of 10 ⁴ TCID ₅₀ of an attenuated rockbone strain of CDV. Each dog was challenged with a lethal dose of 10 ⁴ TCID ₅₀ of the toxic Snyderhill strain of CDV two weeks after the final intranasal inoculation. Dog clinical responses were monitored daily. The results are shown in Table 5.

  None of the dogs responded to vaccination during the course of the experiment. Two dogs immunized with parental canarypox virus and two non-immunized control dogs showed serious illness after challenge with virulent CDV. All four dogs showed elevated body temperature, weight loss, lymphopenia and severe dehydration. Dogs immunized with CDV rockbone developed serum neutralizing antibodies against CDV but not against MV prior to challenge, survived challenge and showed no symptoms. Dogs immunized with attenuated MVs developed serum neutralizing antibodies to MV but not CDV prior to challenge and showed mild signs of infection but survived challenge. Dogs vaccinated with vCP50, vCP57, vP557 or dogs co-inoculated with vP445 and vP557 developed significant serum neutralizing antibodies to MV after a single inoculation and survived the challenge with few symptoms.

Example 14-Additional Canary Pox / Measles Composition Reference is now made to FIG. In order to produce a canarypox Lewis recombinant that expresses the MV HA gene, the following insertion plasmid was generated. The pRW837 to 1.8 kbp EcoRV / EcoRI fragment containing 26 bp 3 'of the H6 promoter exactly linked to measles HA was ligated to the 3.2 kbp EcoRV / EcoRI fragment from pRW838. The pRW838 derived fragment contains the 5 'portion of the H6 promoter and the C5 locomotor arm. Plasmids pRW838 and pRW831 (see below) were derived as follows.

  An 880 bp PvuII canarypox gene fragment was inserted between the PvuII sites of pUC9. The resulting plasmid was called pRW764.5. The nucleotide sequence of the 880 bp canarypox fragment was determined using an improved T7 enzyme Sequenase ™ kit (USA, Biochemical, Cleveland, OH) according to manufacturer's specifications. The sequence reaction used custom synthetic primers (17-18mers) prepared by Biosearch 8700 (Saint-Raphael, CA) or Applied Biosystems 3800 (Foster City, CA). This made it possible to define the C5 reading frame.

  In order to specifically lack the C5 open reading frame, pRW764.5 was partially cut with RsaI and the linear product was isolated. The RsaI linear fragment was cut again with BglII and a pRW764.5 fragment with RsaI-BglII lacking position 462 from position 156 was isolated and used as a vector for the following synthetic oligonucleotide: RW145 (SEQ ID NO: 15) : (5'-ACTCTCAAAAGCTTCCCGGGAATTCTAGCTAGCTAGTTTTTATAAA-3 ') RW146 (SEQ ID NO: 16): (5'-GATCTTTAAAAAACTAGCTAGCTAGAAATTCCCCGGGAAGCTTTGAGAGT-3'). Oligonucleotides RW145 and RW146 were annealed and inserted into the pRW764.5RsaI-BglII vector described above. The resulting plasmid is pRW831.

  This C5-deficient plasmid was formed without interference with other canarypox virus reading frames. The C5 coding sequence was replaced with the above annealed oligonucleotides (RW145 and RW146) containing HindIII, SmaI, and EcoRI restriction sites.

  Plasmid pRW838 was derived from pRW831 by inserting a SmaI fragment containing the rabies G gene (Taylor et al., 1988b) side-by-side 3 'into the vaccinia virus H6 promoter. Plasmid pRW852 was constructed by ligating the 1.8 kbp EcoRV / EcoRI fragment from pRW837 to the 3.2 kbp EcoRV / EcoRI fragment from pRW838. Plasmid pRW852 was used in a recombinant example with a canarypox isolate designated ALVAC to produce vCP85. ALVAC is a plaque clone isolate of CPV derived from the Rentschler strain, which is a highly attenuated strain of canarypox virus (CPV) used for vaccination of canary. The replication of ALVAC and induced recombinants is restricted to avian species. Immunoprecipitation analysis confirmed that an approximately 75 kd protein recognized by home rabbit anti-HA serum was expressed in CEF cells infected with recombinant vCP85.

  Reference is now made to FIG. In order to produce canarypox virus recombinants containing both MV HA and F genes, the following constructs were generated. A SmaI restriction site was added to the end of the H6 promoted measles fusion gene. To do this, pRW823, pIBI25 containing the vaccinia virus H6 promoter, was cut downstream of the promoter sequence at the XbaI site. The ends were E. coli in the presence of 2 mM dNTPs. The DNA was blunted with a Klenow fragment of E. coli DNA polymerase. The blunt end DNA was subsequently cut with NruI to regenerate a 3.0 kbp fragment containing 100 bp at the 5 'end of the H6 promoter. This fragment was isolated and ligated to the 1.7 kbp blunt EagI / NruI fragment from pSPMF75. The resulting plasmid was called pRW841.

  The 1.8 kbp SmaI fragment derived by cleavage of pRW841 was inserted into the C5-deficient vector, pRW831. Plasmid pRW851 was linearized at the EcoRI site with the 3 'end located in the fusion gene and E. coli in the presence of 2 mM dNTPs. The DNA was blunted with a Klenow fragment of E. coli DNA polymerase. Plasmid pRW837 containing the measles HA gene juxtaposed 3 'end to the H6 promoter sequence was cut with HindIII and EcoRI and blunted with Klenow fragment. The resulting 1.8 kbp fragment was isolated and inserted into pRW851, which was linearized with EcoRI and blunted. The resulting plasmid contains both genes in a tail-to-tail configuration, referred to as pRW853A, and used in in vitro recombination experiments with canarypox (ALVAC) as a rescue virus to produce vCP82, which is used as ALVAC. -It was called MV. Expression analysis using immunoprecipitation and immunofluorescence confirmed that authentic treated HA and F proteins were expressed in cells infected with recombinant vCP82. The recombinant was functional for cell fusion activity.

Serum analysis results of sera from guinea pigs and domestic rabbits inoculated with ALVAC-MV (vCP82) Four guinea pigs were inoculated with ALVAC-MV (vCP82) by the subcutaneous route. Two guinea pigs (026 and 027) were each inoculated with 1 × 10 ⁸ pfu, and the other two guinea pigs (028 and 029) were inoculated with 1 × 10 ⁷ pfu, respectively. After 28 days, guinea pigs were re-inoculated with the same amount. Two domestic rabbits were inoculated with 1 × 10 ⁸ ALVAC-MV (vCP82) by the subcutaneous route. After 28 days, the rabbits were re-inoculated with the same amount. Using either the microtiter neutralization test described by Apel and Robinson (1973) or the plaque reduction neutralization test described by Albrevt et al. (1981), the continuous blood flow of these animals was measured in measles virus. The sum activity was analyzed. In addition, sera were analyzed for the presence of antibodies capable of inhibiting measles virus-induced cell-cell fusion in an anti-fusion assay performed as described by Marz et al. (1980).

The analysis results for the presence of measles virus serum neutralizing antibodies are shown in Tables 6 and 7. Both guinea pigs (026 and 027) inoculated with 1 × 10 ⁸ ALVAC-MV seroconverted after one inoculation and the sera showed an increase in antibody after the booster inoculation. One guinea pig (029) inoculated with 1 × 10 ⁷ pfu also seroconverted after one inoculation. The fourth guinea pig showed no appreciable response after the first inoculation but achieved an equivalent titer after the second inoculation.

Rabbit sera were also analyzed using the plaque reduction neutralization method. The results are shown in Table 7. Both animals seroconverted after a single inoculation. Rabbit 063 serum was tested by both the microtiter neutralization test and the plaque reduction neutralization test. The titers obtained using both methods were the same. Disease protection has been reported to require a minimum serum neutralization titer of 1.2 to 1.9 for vaccinated children (Lennon and Black, 1986; Black et al., 1984). Using this classification criteria, all animals showed a protective level of antibody after one inoculation, with the exception of one guinea pig that did not show seroconversion until the second inoculation.

  Previous studies have shown that inactivated vaccines are associated with measles disease that is enhanced by poor protective efficacy and re-exposure to the virus. Inactive vaccine hosts show no antibodies to the fusion protein and it has been proposed that the inactivation process renders the protein non-immune inherited (Noby and Golmer, 1975; Noby et al., 1975). In addition, with respect to other paramyxoviruses, it has been shown that antibodies against F protein can promote cell-to-cell spread of viruses in tissue culture, whereas antibodies against hemagglutinin components cannot. (Marts et al., 1980).

It was therefore critical to show that animals inoculated with ALVAC-MV (vCP82) were able to elicit antibodies against F protein that could inhibit cell-to-cell transmission of measles virus. The results of this antifusion assay are shown in Table 8. Antifusion activity was evident in the sera of both guinea pigs and domestic rabbits inoculated with ALVAC-MV (vCP82). Analyzed serum was collected 2 or 3 weeks after the booster inoculation. No anti-fusion activity could be detected in the serum of domestic rabbits inoculated with ALVAC parental virus.

  In a further study showing the presence of antibodies against both MV hemagglutinin and MV fusion protein in the serum of animals inoculated with ALVAC-MV, immunoprecipitation experiments were performed. Sera from home rabbits inoculated with ALVAC-MV were shown to specifically precipitate both hemagglutinin and fusion proteins from radiolabeled lysates of Vero cells inoculated with Edmonstone strain MV.

In a similar study, groups of guinea pigs, domestic rabbits and mice were inoculated intramuscularly with ALVAC-MV and their serum response to measles virus was monitored using a hemagglutination-inhibition (HI) test. Serum response to canarypox virus was monitored by ELISA assay. In this study, 5 guinea pigs were inoculated with 5.5 log ₁₀ TCID ₅₀ , 30 mice were inoculated with 4.8 log ₁₀ TCID ₅₀ , and 5 domestic rabbits were inoculated with 5.8 log ₁₀ TCID ₅₀ . All animals were re-inoculated with an equal volume after 28 days. The animals were bled at regular intervals and their response to measles virus was assessed by HI test. The limit of detection in the HI test corresponds to a log ₁₀ titer of 1 and seropositive (protective) children are considered to have a serum titer ranging from 1.6 to 2.8. The analysis results are shown in Tables 9, 10 and 11.

Murine serum was analyzed in groups of 5 animals (Table 9). All animals showed an initial response to canarypox virus boosted after the second inoculation. The mice showed no response to MV after a single inoculation. Three out of the six groups showed in-protection titers 8 weeks after inoculation. Similarly, all guinea pigs (Table 10) responded to the canarypox virus after the first inoculation that was boosted after the second inoculation. Four out of five animals developed anti-HI titers after one inoculation, one of which was within the protective range. One week after the second inoculation, all animal titers were within protection. These titers were maintained for up to 8 weeks after inoculation when the experiment was terminated. All domestic rabbits (Table 11) inoculated with ALVAC-MV (vCP82) responded serologically to the canarypox inoculation. Four out of five animals seroconverted to measles virus after one inoculation (one of which was in the protective range). Serum titers for all animals were within the protective range one week after the second inoculation.

Results of sera analysis of squirrel monkey sera inoculated with ALVAC-MV (vCP82): infection before exposure to poxvirus in the induction of measles virus specific immune response Nine squirrel monkeys (ALVAC-MV) (VCP82) was inoculated. All monkeys had no experience with measles virus. Seven monkeys were previously exposed to vaccinia virus and / or canarypox virus. The previous immunization history is shown in Table 12. All monkeys were inoculated with an amount of 5.8 log ₁₀ pfu by the subcutaneous route. Four monkeys (39, 42, 53 and 58) were re-inoculated with an equal volume 15 weeks after the first inoculation. Anti-measles antibody was measured by HI test. The results are shown in Table 12.

After the first inoculation, 2 out of 9 monkeys showed a low response to the ALVAC-MV inoculation. After the second inoculation, 4 re-inoculated monkeys were seroconverted with significant antibody titers in the range required for protective immunity. The achieved titer corresponds to whether the monkey was previously exposed to vaccinia virus and ALVAC or not exposed to poxvirus at all.

Example 15-Attenuated Vaccinia Vaccine Strain NYVAC
In order to generate a new vaccinia vaccine strain, the Copenhagen vaccine strain of vaccinia lewis was denatured by deleting six essential regions of the genome encoding known or potential virulence factors. The sequence defects are shown in detail below. All names of vaccinia restriction fragments, open reading frames and nucleotide positions are based on the terms reported in Goebel et al. (1990a, b).

  A defective locus was also generated as a receptor for insertion of heterologous genes.

The regions lacking sequence in NYVAC are listed below. The abbreviation of the defect region and the name of the open reading frame (Gobel et al., 1990a, b) and the name of the vaccinia recombinant (vP) containing all the defects of the defect identified below are also listed:
(1) Thymidine kinase (TK; J2R) vP410;
(2) Hemorrhagic region (u; B13R + B14R) vP553;
(3) type inclusion body region (ATI; A26L) vP618;
(4) hemagglutinin gene (HA; A56R) vP723;
(5) a host range gene region (C7L-K1L) vP804; and
(6) Large subunit, ribonucleotide reductase (I4L)
vP866 (NYVAC).

DNA cloning and synthesis Plasmids were constructed, screened, and grown by standard methods (Maniatis et al., 1986; Percus et al., 1985; Pitchini et al., 1987). Restricted endoglucanases were obtained from Maryland, Gaithersburg, GIBCO / BRL; Massachusetts, Beverly, New England Biolabs; and Indiana, Indianapolis, Boehringer Mannheim Biochemicals. BAL-31 exonuclease and phage T4 DNA ligase were obtained from New England Biolabs. Reagents were used as specified by various suppliers. Synthetic oligodeoxyribonucleotides were prepared on a Biosearch 8750 or Applied Biosystems 380B DNA synthesizer as previously described (Percus et al., 1989). As described above (Guo et al., 1989), the DNA base sequence was determined by the dideoxy chain termination method (Sanger et al., 1977) using Sequenase (Tabar et al., 1987). Proof of sequence (Engelke et al., 1988) DNA amplification by polymerase chain reaction (PCR) was performed using a custom synthesized oligonucleotide primer and gene amp DNA amplification reagent kit (Perkin Elmer Cetus, Norwalk, in an automated Perkin Elmer Cetus DNA thermal cycler. CT). Excess DNA sequence was deleted from the plasmid by restriction endonuclease digestion, followed by restriction digestion with BAL-31 exonuclease and mutagenesis using synthetic oligonucleotides (Mandec et al., 1986).

Cells, Viruses, and Transfection Culture conditions and origin of the Copenhagen strain of vaccinia virus have been previously described (Guo et al., 1989). Production of recombinant virus by recombination, in situ hybridization of nitrocellulose filters and screening for beta-galactosidase activity has been described previously (Panikari et al., 1982; Percuss et al., 1989).

Construction of plasmid pSD460 lacking thymidine kinase gene (J2R) Reference is now made to FIG. Plasmid pSD406 contains vaccinia HindIII J (position 83359-88377) cloned into pUC8. pSD406 was cut with HindIII and PvuII, and a 1.7 kb fragment from the left side of HindIII J was cloned into pCU8 cut with HindIII / SmaI to form pSD447. pSD447 contains the complete gene for J2R (position 83855-84385). The initiation coden is contained within the NlaIII site and the termination coden is contained within the SspI site. The direction of transcription is indicated by the arrow in FIG.

To obtain the left flank arm, a 0.8 kb HindIII / EcoRI fragment was isolated from pSD447, then cut with NlaIII, and a 0.5 kb HindIII / NlaIII fragment was isolated. Annealed synthetic oligonucleotide NPSYN43 / MPSYN44 (SEQ ID NO: 17 / SEQ ID NO: 18)

Was ligated with a 0.5 kb HindIII / NlaIII fragment and inserted into a pUC18 vector plasmid cut with HindIII / EcoRI to produce plasmid pSD449.

To obtain a restriction fragment containing the vaccinia right flank arm and the pUC vector sequence, pSD447 was digested with SspI (partial) within the vaccinia sequence and HindIII at the pUC / vaccinia junction, and the 2.9 kb vector fragment was single-cut. Released. Synthetic oligonucleotide NPSYN45 / MPSYN46 annealed to this vector fragment (SEQ ID NO: 19 / SEQ ID NO: 20)

And produced pSD459.

  To join the left and right flank arms into one plasmid, a 0.5 kb HindIII / SmaI fragment was isolated from pSD449 and ligated with the HindIII / SmaI digested pSD459 vector plasmid to produce plasmid pSD460. . PSD460 was used as a donor plasmid for recombination with the wild-type parent vaccinia virus Copenhagen strain VC-2. A 32P-labeled probe was synthesized by primer extension using MPSYN45 (SEQ ID NO: 19) as a template and complementary 20-mer oligonucleotide MPSYN47 (SEQ ID NO: 21) (5'-TTAGTAATTTAGGCGGCCGC-3 ') as a primer. Recombinant virus vP410 was identified by plaque hybridization.

Construction of plasmid pSD486 lacking the hemorrhagic region (B13R + B14R) Reference is now made to FIG. Plasmid pSD419 contains vaccinia SalI G (position 160, 744-173, 351) cloned into pUC8. pSD422 contains a flanking vaccinia SalI fragment on its right, SalI J (positions 173, 351-182, 746) cloned into pUC8. In order to construct a plasmid lacking the hemorrhagic region, u, B13R-B14R (positions 172, 549-173, 552), pSD419 is used as the source of the left flank arm and pSD422 is used as the source of the right flank arm It was. The transcription direction of the u region is indicated by an arrow in FIG.

To remove unwanted sequences from pSD419, pSD419 was digested with NcoI / SmaI to remove the sequence to the left of the NcoI site (positions 172, 253), followed by E. coli. The plasmid pSD476 was produced by blunting with the Klenow fragment of E. coli polymerase and ligating. A vaccinia right flank arm was obtained by cleavage of pSD422 with HpaI at the B14R termination codon and 0.3 kb of NruI on the right side. This 0.3 kb fragment was isolated and ligated with the 3.4 kb HincII vector fragment isolated from pSD476 to produce plasmid pSD477. The position of the partial deletion of the vaccinia u region in pSD477 is indicated by a triangle. The remaining B13R coding sequence in pSD477 was removed by cleavage with ClaI / HpaI and the resulting vector fragment was annealed with synthetic oligonucleotides SD22mer / SD20mer (SEQ ID NO: 22 / SEQ ID NO: 23).

And produced pSD479. pSD479 contains the initiation codon (underlined) indicated by the BmaHI site. under the control of the u promoter. To place the E. coli beta galactosidase at the B13-B14 (u) deletion locus, a 3.2 kb BamHI fragment containing the beta galactosidase gene (Shapira et al., 1983) was inserted into the BamHI site of pSD479, producing pSD479BG. . pSD479BG was used as a donor plasmid for recombination with vaccinia lewis vP410. Recombinant vaccinia virus vP533 was isolated as a blue plaque in the presence of dye substrate X gal. In vP533, the B13R-B14R region is deleted and replaced by beta-galactosidase.

To remove the beta galactosidase sequence from vP533, plasmid pSD486, a derivative of pSD477 that contains a polylinker region but no initiation codon at the u-deficient junction was used. Synthetic oligonucleotide SD42mer / SD40mer (SEQ ID NO: 24 / SEQ ID NO: 25) which was first annealed with the ClaI / HpaI vector fragment from pSD477 described above.

And ligated to produce plasmid pSD478. Next, the EcoRI site at the pUC / vaccinia junction was disrupted by digestion of pSD478 with EcoRI. The plasmid pSD478E- was produced by blunting with the Klenow fragment of E. coli polymerase and ligating. pSD478E− was digested with BamHI and HpaI and annealed synthetic oligonucleotides HEM5 / HEM6 (SEQ ID NO: 26 / SEQ ID NO: 27)

To produce plasmid pSD486. PSD486 was used as a recombinant donor plasmid for recombinant vaccinia virus vP533 to produce vP553, which was isolated as a clear plaque in the presence of X-gal.

Construction of plasmid pMP494Δ lacking the ATI region (A26L) Reference is now made to FIG. pSD414 contains SalIB cloned in pUC8. To remove unwanted DNA sequences to the left of the A26L region, pSD414 was cut with XbaI (position 137,079) in the vaccinia sequence and HindIII at the pUC / vaccinia junction. Blunted with the Klenow fragment of E. coli polymerase and ligated to produce plasmid pSD483. To remove unwanted DNA sequences to the right of the A26L region, pSD483 was cut with EcoRI (positions 140,665 and pUC / vaccinia junction) and ligated to produce plasmid pSD484. To remove the A26L encryption region, pSD484 was cut at NdeI (position 139,004) (partial) slightly upstream of the A26L ORF and HpaI (position 137,889) slightly downstream of the A26L ORF. A 5.2 kb vector fragment was isolated and annealed synthetic oligonucleotides ATI3 / ATI4 (SEQ ID NO: 28 / SEQ ID NO: 29)

And the region upstream from A26L was reconstituted and replaced with the A26L ORF with a short polylinker region containing the restriction sites BglII, EcoRI and HpaI as described above. The resulting plasmid was called pSD485. Since the BglII and EcoRI sites in the polylinker region of pSD485 are not unique, the unnecessary BglII and EcoRI sites were removed from plasmid pSD483 by cleavage with BglII (positions 140, 136) and EcoRI at the pUC / vaccinia junction; Subsequently, E.E. The blunt ends were ligated with the Klenow fragment of E. coli polymerase. The resulting plasmid was called pSD489. The 1.8 kb ClaI (position 137,198) / EcoRV (position 139,048) fragment from pSD489 containing the A26L ORF was replaced with the corresponding 0.7 kb polylinker-containing ClaI / EcoRV fragment from pSD485. PSD492 was produced. The BglII and EcoRI sites of the polylinker region of pSD492 are unique.

  A 3.3 kb BglII cassette (Shapira et al., 1983) containing the Ecoli beta galactosidase gene under the control of the vaccinia 11 kDa promoter (Bartlett et al., 1985; Percus et al., 1990) was inserted into the BglII site of pSD492 to insert pSD493KBG. Produced. The plasmid pSD493KBG was used for recombination with the rescue virus vP553. Recombinant vaccinia virus vP581 containing beta-galactosidase in the A26L-deficient region was isolated as a blue plaque in the presence of X-gal.

  Mutagenesis (Mandeck, 1986) using synthetic oligonucleotide MPSYN177 (SEQ ID NO: 30) (5'-AAAAGGGGCGGTGTTAACTTTATATA-ACTTTTTTTTTGAATATAC-3 ') to produce a plasmid in which the beta-galactosidase sequence has been removed from vaccinia recombinant virus vP581 ), The polylinker region of plasmid pSD492 was deleted. In the resulting plasmid, pMP494Δ, the vaccinia DNA inclusion position [137, 889-138, 937] containing the complete A26L ORF is deleted. Recombination between pMP494Δ and beta-galactosidase containing the vaccinia recombinant vP581 produces a vaccinia-deficient mutant vP618, which is isolated as a clear plaque in the presence of X-gal.

Construction of plasmid pSD467 lacking the hemagglutinin gene (A56R) Reference is now made to FIG. The vaccinia SalI G restriction fragment (position 160, 744-173, 351) crosses the HindIII A / B junction (position 162, 539). pSD419 contains vaccinia SalI G cloned in pUC8. The direction of transcription of the hemagglutinin (HA) gene is indicated by the arrow in FIG. The vaccinia sequence derived from HindIII B was removed by cleavage of pSD419 with HindIII within the vaccinia sequence and at the pUC / vaccinia junction and then ligated. The resulting plasmid, pSD456, contains the HA gene, A56R, and has a 0.4 kb vaccinia sequence on the left side and a 0.4 kb vaccinia sequence on the right side. The A56R coding sequence was removed by cleaving pSD456 at the upstream RsaI (partial; position 161,090) and EagI (position 162,054) near the gene from the A56R coding sequence. A 3.6 kb RsaI / EagI vector fragment from pSD456 was isolated and annealed synthetic oligonucleotides MPSYN59 (SEQ ID NO: 31), MPSY62 (SEQ ID NO: 32), MPSYN60 (SEQ ID NO: 33), and MPSYN61 (SEQ ID NO: 34).

And reconstructed the DNA sequence upstream from the A56R ORF, replacing the A56R ORF with the polylinker region as described above. The resulting plasmid is pSD466. A vaccinia deficient in pSD466 encompasses positions [161, 185-162, 053]. The site lacking pSD466 is indicated by the triangle in FIG.

  E. coli under the control of the vaccinia 11 kDa promoter (Bartlett et al., 1985; Guo et al., 1989). A 3.2 kb BglII / BamHI cassette (partial) containing the E. coli beta galactosidase gene (partial) (Shapira et al., 1983) was inserted into the BglII site of pSD466 to produce pSD466KBG. Plasmid pSD466KBG was used for recombination with the rescue virus vP618. VP708, a recombinant vaccinia virus containing beta-galactosidase in the A56R deletion, was isolated as a blue plaque in the presence of X-gal.

  The donor galactosidase sequence was deleted from vP708 using the donor plasmid pSD467. Cleavage of pSD466 with EcoRI / BamHI removed the EcoRI, SmaI and BamHI sites from the pUC / vaccinia junction, followed by E. coli. pSD467 is equal to pSD466 except that it is blunted and ligated with a Klenow fragment of E. coli polymerase. Recombination between vP708 and pSD467 produced a recombinant vaccinia-deficient mutant, vP723, which was isolated as a clear plaque in the presence of X-gal.

Construction of plasmid pMPCSK1Δ lacking the open reading frame [C7L-K1L] Reference is now made to FIG. The following vaccinia clones were used for the construction of pMPCSK1Δ. pSD420 is SalI H cloned in pUC8. pSD435 is KpnI F cloned in pUC18. pSD435 was cut with SphI and religated to produce pSD451. In pSD451, the DNA sequence to the left of the SphI site (position 27, 416) in HindIII M is removed (Percus et al., 1990). pSD409 is HindIII M cloned in pUC8. To provide a substrate deficient in the [C7L-K1L] gene cluster from vaccinia, E. coli beta galactosidase was inserted into the vaccinia M2L deletion locus as follows (Guo et al., 1990). To remove the BglII site in pSD409, the plasmid was cut with BglII (positions 28, 212) in the vaccinia sequence and BamHI at the pUC / vaccinia junction and then ligated to produce plasmid pMP409B. pMP409B was cleaved at a specific SphI site (positions 27, 416). Synthetic oligonucleotide

The M2L coding sequence was removed by mutagenesis using (Guo et al., 1990; Mandeck, 1986).

  The resulting plasmid, pMP409D, contains a unique BglII site inserted at the M2L deletion locus as described above. Under the control of the 11 kDa promoter (Bartlett et al., 1985). A 3.2 kb BamHI (partial) / BglII cassette (Shapil et al., 1985) containing the E. coli beta galactosidase gene was inserted into pMP409D cut with BglII. The resulting plasmid pMP409DBG (Guo et al., 1990) was used as a donor plasmid for recombination with rescue vaccinia virus vP723. A recombinant vaccinia virus, vP784, containing beta galactosidase inserted into the M2L deletion locus, was isolated as a blue plaque in the presence of X-gal.

  A plasmid lacking the vaccinia gene [C7L-K1L] was assembled into pUC8 cut with SmaI and HindIII. It was blunted with a Klenow fragment of E. coli polymerase. The left flank arm consisting of the vaccinia HindIII C sequence was obtained by cleavage of pSD420 at XbaI (position 18, 628) and then E. coli. It was blunted with Klenow fragment of E. coli polymerase and cut with BglII (position 19,706). The right flank arm consisting of the vaccinia HindIII K sequence was obtained by cleavage of pSD451 with BglII (position 29,062) and EcoRV (position 29,778). The generated pMP581CK lacks the vaccinia sequence between the BglII site in HindIII C (position 19,706) and the BglII site in HindIII K (position 29062). The site lacking the vaccinia sequence in the plasmid pMP581CK is indicated by a triangle in FIG.

  To remove excess DNA at the vaccinia-deficient junction, plasmid pMP581CK was cut at the NcoI site within the vaccinia sequence (positions 18, 811; 19,655), treated with Bal31 exonuclease, and the synthetic oligonucleotide MPSYN233 ( SEQ ID NO: 36) Mutagenesis (Mandeck, 1986) was performed using 5'-TGTCATTTAACACTA-TACTCATATTAATAAAAAATAATTTTATT-3 '. The resulting plasmid pMPCSK1Δ lacks vaccinia sequence positions 18,805-29,108, which includes 12 vaccinia open reading frames [C7L-K1L]. Recombination between pMPCSK1Δ and beta-galactosidase containing vaccinia recombinant vP784 produced vaccinia-deficient mutant vP804, which was isolated as a clear plaque in the presence of X-gal.

Construction of plasmid pSD548 lacking a large unit of ribonucleotide reductase (I4L) Reference is now made to FIG. Plasmid pSD405 contains vaccinia HindIII (positions 63, 875-70, 367) cloned into pUC8. pSD405 was ligated by cutting with EcoRV (position 67,933) within the vaccinia sequence and SmaI at the pUC / vaccinia junction to produce plasmid pSD518. pSD518 was used as the source of all vaccinia restriction fragments used in the construction of pSD548.

  The vaccinia I4L gene spans positions 67,371-65,059. The direction of I4L transcription is indicated by the arrow in FIG. To obtain a vector plasmid fragment lacking the I4L coding sequence, pSD518 was digested with BamHI (position 65,381) and HpaI (position 67,001). The blunt end was obtained using the Klenow fragment of E. coli polymerase. This 4.8 kb vector fragment was transformed into E. coli under the control of the vaccinia 11 kDa promoter (Bartlett et al., 1985; Percus et al., 1990). Ligation into a 3.2 kb SmaI cassette containing the E. coli beta galactosidase gene (Shapira et al., 1983) produced the plasmid pSD524KBG. pSD524KBG was used as a donor plasmid for recombination with vaccinia virus vP804. A recombinant vaccinia virus, vP855, containing beta-galactosidase partially lacking the I4L gene, was isolated as a blue plaque in the presence of X-gal.

  In order to remove the residues of I4L ORF from beta galactosidase and vP855, the defective plasmid pSD548 was constructed. The left and right vaccinia flank arms were assembled separately in pUC8 as described above and are shown schematically in FIG.

To construct a vector plasmid that accepts the left vaccinia flank arm, pUC8 was cut with BamHI / EcoRI and annealed synthetic oligonucleotides 518A1 / 518A2 (SEQ ID NO: 37 / SEQ ID NO: 38)

To produce plasmid pSD531. pSD531 was cut with RsaI (partial) and BamHI and a 2.7 kb vector fragment was isolated. pSD518 was cut with BglII (position 64,459) / RsaI (position 64,994) and a 0.5 kb fragment was isolated. The two fragments are ligated together to produce pSD537, which contains the complete vaccinia flank arm to the left of the I4L coding sequence.

To construct a vector plasmid that accepts the right vaccinia flank arm, pUC8 was cut with BamHI / EcoRI and annealed synthetic oligonucleotides 518B1 / 518B2 (SEQ ID NO: 39 / SEQ ID NO: 40).

And ligated to produce plasmid pSD532. pSD532 was cut with RsaI (partial) / EcoRI and a 2.7 kb vector fragment was isolated. pSD518 was cut with RsaI (position 67,436) within the vaccinia sequence and EcoRI at the vaccinia / pUC junction and a 0.6 kb fragment was isolated. The two fragments are ligated together to produce pSD538, which contains the complete vaccinia flank arm to the right of the I4L coding sequence.

  The right vaccinia flank arm was isolated as a 0.6 kb EcoRI / BglII fragment from pSD538 and ligated into the pSD537 vector plasmid cut with EcoRI / BglII. In the resulting plasmid, pSD539, the I4L ORF (positions 65, 047-67, 386) was replaced with a polylinker region, all of which had 0.6 kb vaccinia DNA on the left and pUC in the background, It has 0.6 kb vaccinia DNA on its flank. Deletion sites in the vaccinia sequence are indicated by triangles in FIG. To avoid possible recombination between the beta galactosidase sequence in the pUC-inducing portion of pSD539 and the beta galactosidase sequence in recombinant vaccinia virus vP855, a vaccinia I4L-deficient cassette was removed from pSD539 and incorporated into pRC11. A pUC derivative with all beta-galactosidase sequences removed and replaced by a polylinker region (Colinas et al., 1990). pSD539 was cut with EcoRI / PstI and a 1.2 kb fragment was isolated. This fragment was ligated to pRC11 (2.35 kb) cut with EcoRI / PstI to produce pSD548. A recombinant between pSD548 and a vaccinia recombinant, beta galactosidase containing vP855, produced a vaccinia-deficient mutant vP866, which was isolated as a clear plaque in the presence of X-gal.

  DNA from recombinant vaccinia virus vP866 was analyzed by restriction digestion followed by agarose gel electrophoresis. The restriction pattern was what I expected. Polymerase chain reaction (PCR) using vP866 as a template (Engelke et al., 1988) and primers with the six deletion loci on the flank produced DNA fragments of the expected size. Sequence analysis of the PCR-produced fragments around the area of the defective junction confirmed that the junction was as expected. Recombinant vaccinia virus vP866 containing the 6 production defects transferred was designated vaccinia vaccine strain “NYVAC”.

Example 16-Construction of NYVAC-MV Recombinant Expressing Measles Fusion and Hemagglutinin Glycoprotein A cDNA copy of the sequence encoding the measles virus MV HA and F proteins (Edmonston strain) was inserted into NYVAC. Produced a double recombinant designated NYVAC-MV (vP913). The recombinant authentically expressed both measles glycoproteins on the surface of infected cells. Immunoprecipitation analysis showed an accurate method for processing both F and HA glycoproteins. The recombinant was also found to induce fusion cell formation.

Cells and virus The rescued virus used for the production of NYVAC-MV was a modified Copenhagen strain of vaccinia virus designated NYVAC. All viruses grew and were titrated on Vero cell monolayers.

Plasmid Construction Reference is now made to FIG. 15 and Taylor et al. (1991). The plasmid pSPM2LHA contains the complete measles HA gene linked to the vaccinia virus H6 promoter described above in the relationship of ATG to the correct ATG sequence (Taylor et al., 1988a, b; Guo et al., 1989; Parkas et al., 1989). ). The 1.8 kbp EcoRV / SmaI fragment contains 24 bp at the 3 ′ end of the H6 promoter fused to the HA gene lacking 26 bp at the 3 ′ end in the correct ATG: ATG sequence relationship. This fragment was used to replace pSPMHA11's 1.8 kbp EcoRV / SmaI fragment (Taylor et al., 1991) to produce pRW803. Plasmid pRW803 contains the complete H6 promoter linked to the exact complete measles HA gene.

  Plasmid pSD513VCVQ was derived from plasmid pSD460 by conversion of the polylinker sequence. Plasmid pSD460 was induced to delete the thymidine kinase gene from vaccinia virus (FIG. 9).

  To insert the measles virus F gene into the HA insertion plasmid, pSPHMF7 was manipulated. Plasmid pSPHM7 (Taylor et al., 1991) contains the measles F gene with the vaccinia virus H6 promoter described above 3 'proximal. Oligonucleotide directed mutation using oligonucleotide SPMAD (SEQ ID NO: 41) to achieve ATG sequence for complete ATG and eliminate intervening sequence between 3 'end of promoter and ATG of measles F gene Induction was performed.

SPMAD: 5'-TATCCGTTAAGTTTGTATCGTAATGGGTCTCAAGGTGAACGTCT-3 '
The resulting plasmid was called pSPMF75M20.

  Plasmid pSPMF75M20 containing the measles F gene currently linked to the H6 promoter in relation to the exact ATG to ATG was cut with NruI and EagI. The resulting 1.7 kbp blunt fragment containing 27 bp 3 'to the H6 promoter and a complete fusion cell was isolated, cut with NruI and XbaI, and inserted into the blunt-ended intermediate plasmid pRW823. H6 / Measles F cassette was removed from pRW841 by digestion with SmaI and the resulting 1.8 kb fragment was inserted into pRW843 (which contains the measles HA gene). First, plasmid pRW843 was digested with NotI and E. coli in the presence of 2 mM dNTPs. The DNA was blunted with a Klenow fragment of E. coli DNA polymerase. The resulting plasmid pRW857 therefore contains the measles virus F and HA genes linked in a tail-to-tail sequence. Both genes are linked to the vaccinia virus H6 promoter.

Development of NYVAC-MV Plasmid pRW857 was transfected into NYVAC (vP866) infected Vero cells by using the calcium phosphate precipitation method described above (Panikari et al., 1982; Pitchini et al., 1987). Based on in situ plaque hybridization to specific MV F and HA radiolabeled probes, positive plaques are selected and plaque purification is performed six consecutive times for the selected plaques until a pure solid population is achieved. It was. One representative plaque was then amplified and the resulting recombinant was designated NYVAC-MV (vP913).

Immunofluorescence Indirect immunofluorescence was performed as previously described (Taylor et al., 1990). The monospecific reagent used was serum produced by inoculating rabbits with canarypox recombinants expressing measles F or HA genes.

Immunoprecipitation An immunoprecipitation reaction was performed using guinea pig anti-measles serum (Witacker MA Bioproducts, Walkersville, MD) as described above.

Cell fusion experiments
Vero cell monolayers in 60 mm dishes were inoculated with multiple, 1 pfu parent or recombinant virus per cell. After 1 hour absorption at 37 ° C, the inoculum was removed, the stratified medium was replaced and the dishes were inoculated overnight at 37 ° C. The dishes were examined 20 hours after infection.

  To confirm that the expression products of both measles virus F and HA genes are present on the infected cell surface, they are produced in domestic rabbits against canarypox recombinants expressing either measles F or HA genes. Indirect immunofluorescence analysis was performed using monospecific serum. The results showed that the F and HA gene products were expressed on the infected cell surface as shown by strong surface fluorescence with both monospecific sera. There is no clear background staining for any of the sera of cells inoculated with the parental NYVAC strain, and when monospecific sera are tested against a vaccinia monorecombinant expressing either the HA or F gene, There is no cross-reactive staining.

Immunoprecipitation analysis was performed to show that the protein expressed by NYVAC-MV was immunoreactive with measles virus-specific serum and was genuinely processed in infected cells. Vero cell monolayers were inoculated with parental or recombinant virus in the presence of various 10 pfu / cell ³⁵ S-methionine. Immunoprecipitation analysis showed cleavage fusion-producing organism _{F 1} and _{F 2} and HA glycoproteins of about 76kDa, respectively having a molecular weight of 44kDa and 23 kDa. No measles-specific product was detected in cells infected with uninfected Vero cells or parental cell NYVAC virus.

  A characteristic of MV cell variability is the formation of fused cells resulting from fusion with infected or uninfected cells surrounding infected cells, followed by nuclear translocation toward the center of the fused cells (Noby et al., 1982). This has been shown to be an important virus spreading method for paramyxoviruses that can occur in HA-specific virus neutralizing antibodies (Marts et al., 1980). To confirm that the MV protein expressed in vaccinia virus is functionally active, Vero cell monolayers were inoculated with NYVAC and NYVAC-MV and the monolayers were observed for cell mutating effects. . About 18 hours after infection, strong cell fusion activity was evident in NYVAC-MV infected Vero cells. No cell fusion activity was evident in cells infected with parental cell NYVAC.

Results of Serum Analysis of Serum of Domestic Rabbits Inoculated with NYVAC-MV (vP913) In this study, two domestic rabbits were inoculated with 1 × 10 ⁸ pfu of NYVAC-MV (vP913) by the subcutaneous route. On day 28, the animals were boosted with an equal volume. Serial bleeding was analyzed for MV neutralizing activity using the plaque reduction method. The results are shown in Table 13. The results indicate that none of the rabbits responded to the initial inoculation of NYVAC-MV. However, a sharp rising reaction after the second inoculation indicates that the animal has been sensitized. Both animals achieved a protective neutralizing antigen titer.

The immunoantigenic in vivo analysis of ALVAC-MV (vCP82) shown in Example 14 shows that, in a range of species inoculations, the recombinant can elicit a serum response that can be measured with standard serum tests. . The achieved titer is in the range required for protection from illness. Inoculation of NYVAC-MV (vP913) in domestic rabbits also induces levels of measles virus neutralizing antibodies that are protective.

  Other reference examples are described below.

1. A recombinant poxvirus containing DNA encoding at least two antigens from the genus Measles virus in an integral region of the poxvirus genome.

2. The recombinant poxvirus according to Reference Example 1, wherein the measles virus genus is measles virus.

3. The recombinant poxvirus according to Reference Example 2, wherein one of the at least two antigens encoded by the DNA is a measles virus hemagglutinin glycoprotein.

4). The recombinant poxvirus according to Reference Example 2, wherein one of the at least two antigens encoded by the DNA is a measles virus fusion glycoprotein.

5). The recombinant poxvirus according to Reference Example 2, wherein the DNA encodes two measles virus glycoproteins.

6). The recombinant poxvirus according to Reference Example 5, wherein the measles virus glycoprotein is a hemagglutinin glycoprotein and a fusion glycoprotein.

7). The recombinant poxvirus according to Reference Example 2, wherein the DNA is expressed in a host, and the expression includes production of measles virus glycoprotein.

8). The recombinant poxvirus according to Reference Example 7, wherein the measles virus glycoprotein is a measles virus hemagglutinin glycoprotein.

9. The recombinant poxvirus according to Reference Example 7, wherein the measles virus glycoprotein is a measles virus fusion glycoprotein.

10. The recombinant poxvirus according to Reference Example 2, wherein the DNA is expressed in a host by the production of two measles virus glycoproteins.

11. The recombinant poxvirus according to Reference Example 10, wherein the measles virus glycoprotein is a measles virus hemagglutinin glycoprotein and a measles virus fusion glycoprotein.

12 The recombinant poxvirus according to Reference Example 1, wherein the poxvirus is a vaccinia virus.

13. The recombinant poxvirus according to Reference Example 1, wherein the poxvirus is an avipox virus.

14 The recombinant poxvirus according to Reference Example 13, wherein the avipoxvirus is a canarypox virus.

15. The recombinant poxvirus according to Reference Example 1, wherein the DNA is introduced into the poxvirus by recombination.

16. A recombinant poxvirus comprising DNA encoding at least two antigens from the genus Measles virus and a promoter expressing the DNA.

17. A vaccine that elicits an immune response in a vaccinated host animal, said vaccine comprising a recombinant poxvirus and a carrier containing DNA encoding at least two antigens from the measles virus genus in an integral region A vaccine characterized by

18. The vaccine according to Reference Example 17, wherein the measles virus genus is measles virus.

19. The vaccine according to Reference Example 18, wherein one of the at least two antigens encoded and expressed by the DNA is a measles virus hemagglutinin glycoprotein.

20. The vaccine according to Reference Example 18, wherein one of the at least two antigens encoded and expressed by the DNA is a measles virus fusion glycoprotein.

21. The vaccine according to Reference Example 18, wherein the DNA encodes and expresses two measles virus glycoproteins.

22. The vaccine according to Reference Example 21, wherein the measles virus glycoprotein is a hemagglutinin glycoprotein and a fusion glycoprotein.

23. The vaccine according to Reference Example 17, wherein the poxvirus is a vaccinia virus.

24. The vaccine according to Reference Example 17, wherein the poxvirus is an avipox virus.

25. The vaccine according to Reference Example 24, wherein the avipox virus is a canarypox virus.

26. The vaccine according to Reference Example 17, wherein the DNA is introduced into the poxvirus by recombination.

27. A method of protecting a dog against canine distemper, the method inoculating the dog with a recombinant poxvirus containing DNA encoding an antigen from the genus Measles virus in an indispensable region of the poxvirus genome. A method characterized by comprising:

28. The method according to Reference Example 27, wherein the measles virus genus is measles virus.

29. 29. The method according to Reference Example 28, wherein the DNA encodes a measles virus hemagglutinin glycoprotein.

30. The method according to Reference Example 28, wherein the DNA encodes a measles virus fusion glycoprotein.

31. A method of protecting a dog against canine distemper, the method comprising inoculating a dog with a recombinant vaccinia or avipox virus containing DNA from the genus Measles virus, which is a measles virus, A method comprising encoding a measles virus hemagglutinin glycoprotein.

32. A recombinant canarypox virus containing DNA from measles virus in an essential region of the canarypox virus genome, wherein said DNA encoding measles virus glycoprotein is measles virus hemagglutinin glycoprotein, measles virus fusion sugar A recombinant canarypox virus characterized in that it is selected from the group consisting of a protein and a combination of a measles virus hemagglutinin glycoprotein and a measles virus fusion glycoprotein.

33. The recombinant canarypox virus according to Reference Example 32, wherein the DNA encodes a measles virus hemagglutinin glycoprotein.

34. The recombinant canarypox virus according to Reference Example 32, wherein the DNA encodes a measles virus fusion glycoprotein.

35. The recombinant canarypox virus according to Reference Example 32, wherein the DNA encodes a measles virus hemagglutinin glycoprotein and a measles virus fusion glycoprotein.

36. The recombinant canarypox virus according to Reference Example 32, which is vCP82.

37. A recombinant canarypox virus containing DNA from measles virus and a promoter expressing the DNA, wherein the DNA encoding measles virus glycoprotein is measles virus hemagglutinin glycoprotein, measles virus fusion glycoprotein, and A recombinant canarypox virus selected from the group consisting of a combination of measles virus hemagglutinin glycoprotein and measles virus fusion glycoprotein.

38. A vaccine that induces an immune response in a vaccinated host animal, the vaccine comprising a recombinant canarypox virus containing DNA from measles virus in an integral region and a carrier, encoding a measles virus glycoprotein The vaccine is selected from the group consisting of measles virus hemagglutinin glycoprotein, measles virus fusion glycoprotein, and a combination of measles virus hemagglutinin glycoprotein and measles virus fusion glycoprotein.

39. The vaccine according to Reference Example 38, wherein the DNA encodes a measles virus hemagglutinin glycoprotein.

40. The vaccine according to Reference Example 38, wherein the DNA encodes a measles virus fusion glycoprotein.

41. The vaccine according to Reference Example 38, wherein the DNA encodes a measles virus hemagglutinin glycoprotein and a measles virus fusion glycoprotein.

42. The vaccine according to Reference Example 38, wherein the recombinant canarypox virus is vCP82.

43. A method of protecting a dog against canine distemper, the method comprising inoculating a dog with a recombinant canarypox virus containing DNA from a measles virus encoding a measles virus fusion glycoprotein And how to.

44. The poxvirus is a vaccinia virus lacking a thymidine kinase gene, a hemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host region gene region, and a large unit ribonucleotide reductase The recombinant poxvirus according to any one of Examples 1 to 12, 15 or 16.

45. 45. The recombinant poxvirus according to Reference Example 44, wherein the vaccinia virus is NYVAC vaccinia virus.

46. The poxvirus is a vaccinia virus lacking a thymidine kinase gene, a hemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host region gene region, and a large unit ribonucleotide reductase 27. A vaccine according to any one of Examples 17 to 23 or 26.

47. 47. The vaccine according to Reference Example 46, wherein the vaccinia virus is NYVAC vaccinia virus.

48. The poxvirus is a vaccinia virus lacking a thymidine kinase gene, a hemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host region gene region, and a large unit ribonucleotide reductase. The method according to any one of Reference Examples 27 to 30.

49. 49. The method according to Reference Example 48, wherein the vaccinia virus is NYVAC vaccinia virus.

50. The vaccinia virus is a vaccinia virus lacking a thymidine kinase gene, a hemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host range gene region, and a large unit ribonucleotide reductase. The method according to Reference Example 31.

51. The method according to Reference Example 50, wherein the vaccinia virus is NYVAC vaccinia virus.

52. The recombinant poxvirus or canarypox virus according to any one of Reference Examples 1 to 11, 13 to 16, 32 to 35, or 37, wherein the poxvirus or canarypox virus is an ALVAC canarypox virus.

53. The vaccine according to any one of Reference Examples 17 to 22, 24 to 26, and 38 to 41, wherein the poxvirus or canarypox virus is ALVAC canarypox virus.

54. 45. The method according to any one of Reference Examples 27 to 31, or 43, wherein the poxvirus, avipoxvirus or canarypox virus is an ALVAC canarypox virus.

55. The recombinant poxvirus according to Reference Example 45, which is vP913.

56. 48. The vaccine according to Reference Example 47, wherein the NYVAC vaccinia virus is vP913.

57. 52. The method according to Reference Example 49 or 51, wherein the NYVAC vaccinia virus is vP913.

References

FIG. 1 (1A and 1B) schematically shows a method for constructing the plasmid pSPM2LHAVC used to derive the recombinant vaccinia virus vP557 expressing the MV hemagglutinin gene. FIG. 2 (2A and 2B) schematically shows a method for constructing the plasmid pSPMFVC used to derive the recombinant vaccinia virus vP455 expressing the MV fusion gene. FIG. 3 schematically shows a method for constructing the plasmid pRW843 used to induce recombinant vaccinia virus vP756 expressing the MV hemagglutinin gene. FIG. 4 schematically shows a method for constructing plasmid pRW850 used to induce recombinant vaccinia virus vP800 expressing the MV fusion gene. FIG. 5 schematically shows a method for constructing the plasmid pRW800 used to induce the recombinant canarypox virus vCP40 expressing the MV fusion gene. FIG. 6 schematically shows a method for constructing the plasmid pRW810 used to induce recombinant canarypox virus vCP50 expressing the MV hemagglutinin gene and vCP57 expressing both the MV fusion gene and the MV hemagglutinin gene. Shown in FIG. 7 schematically shows a method for constructing plasmid pRW852 used to induce recombinant canarypox virus vCP85 expressing the MV hemagglutinin gene. FIG. 8 schematically shows a method for constructing the plasmid pRW853A used to induce vCP82 that expresses both the MV hemagglutinin gene and the MV fusion gene. FIG. 9 schematically shows a method for constructing plasmid pSD460 in which the thymidine kinase gene is deleted and recombinant vaccinia virus vP410 is produced. FIG. 10 schematically shows a method for constructing plasmid pSD486 in which the hemorrhagic region is deleted and recombinant vaccinia virus vP553 is produced. FIG. 11 schematically shows a method for constructing plasmid pMP494Δ in which the ATI region is deleted and recombinant vaccinia virus vP618 is produced. FIG. 12 schematically shows a method for constructing plasmid pSD467 in which the hemagglutinin gene is deleted and recombinant vaccinia virus vP723 is produced. FIG. 13 schematically shows a method for constructing a plasmid pMPCSK1Δ that produces a recombinant vaccinia virus vP804 by deleting the gene cluster [C7L-K1L]. FIG. 14 schematically shows a method for constructing plasmid pSD548 in which large subunit ribonucleotide reductase is deleted and recombinant vaccinia virus vP866 (NYVAC) is produced. FIG. 15 schematically shows a method for constructing the plasmid pRW857 used to derive the recombinant NYVAC virus vP913 that expresses both the MV hemagglutinin gene and the MV fusion gene.

Claims (5)

A recombinant poxvirus comprising DNA from the genus Measles virus in an indispensable region of the poxvirus genome, wherein the DNA comprises a measles virus hemagglutinin glycoprotein, a measles virus fusion glycoprotein, and a measles virus hemagglutinin saccharide Encoding a measles virus glycoprotein selected from the group consisting of a combination of a protein and a measles virus fusion glycoprotein, and the poxvirus is a thymidine kinase gene, a hemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host A recombinant poxvirus, which is NYVAC , a vaccinia virus deficient in a region gene region and a large unit ribonucleotide reductase.   The recombinant poxvirus according to claim 1, further comprising a promoter for expressing the DNA.   A vaccine for inducing an immune response in a vaccinated host animal, characterized in that it comprises a carrier and the recombinant poxvirus according to claim 1 or 2.   A method for protecting a dog against canine distemper, comprising the step of inoculating the dog with the recombinant poxvirus according to claim 1 or 2.   5. The method of claim 4, wherein the DNA encodes a measles virus hemagglutinin glycoprotein.

Images