JP3244284B2 - Method for measuring hepatitis C virus-related antibodies and antigens - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an antibody against a hepatitis C virus (hereinafter sometimes referred to as HCV) -related antigen, a hepatitis C virus-related antigen, and a reagent useful for a test and measurement reagent and a purification reagent. Related to uses.

[0002]

2. Description of the Related Art cDNA from RNA prepared from chimpanzee plasma of non-A non-B (NANB) chronic hepatitis
A library was created. NA from this library
A positive clone (5-1-1) reactive with the convalescent serum of a hepatitis NB patient was isolated, and gene walking finally revealed the majority (7310 bp) of the approximately 10 kb HCV gene (7310 bp) (WO 89/04669; JP-A-2-50088
0). Subsequently, a fusion protein consisting of the HCV antigen C100-3 (363 amino acid residues) and human superoxide dismutase (154 amino acid residues) is produced in yeast, and an anti-HCV antibody assay system using this antigen is produced. QL Choo et al., Science, 244 , 359
(1989); G. Kuo et al., Science, 244 , 362 (1989)]. HCV antibodies measured by this method are based on NANB on a conventional basis.
In the United States, 71% of post-transfusion NANB hepatitis, sporadic NANB
Hepatitis was detected in 58%. Anti-HCV antibodies were detected in 84% of Italian and 78% of post-transfusion chronic NANB hepatitis [G. Kuo et al., Science, 244 , 3].
62 (1989)]. 85 post-transfusion NANB hepatitis in Spain
% Anti-HCV antibody was detected. In addition, anti-HCV antibodies were detected in 70% of drug users, suggesting that HCV is highly likely to be transmitted via syringes and needles [JI
Esteban et al., Lancet ii , 294 (1989)].
Y. Kubo et al. [New Clay Acids Research (N
ucl. Acids Res.), 17 , 10367 (1989)]
RNA from Japanese donor plasma with hepatitis NB
To produce HCV cDNA, and an oligonucleotide / specific oligonucleotide for the nonstructural protein region 3 (NS3) of HCV.
The cDNA was amplified by polymerase chain reaction (PCR) using primers. This cD
NA (designated J1; 583 nucleotides) showed 79.8% homology at the nucleotide level and 92.2% at the amino acid level as compared to the prototype HCV cDNA from chimpanzee described above. The result is H
This suggests the presence of subtypes in CV.

[0003] H. Okamoto et al. [Japanese Journal of Experimental Medicine (Jpn. J. Ex.)
p. Med.), 60 , 167 (1990)] extracted RNA from human plasma positive for anti-HCV antibodies and from chimpanzee plasma proven negative for anti-HCV antibodies and infectious of NANB hepatitis, respectively. CDNA prepared based on
The HCV genome was cloned from the library, and the 5 ′ terminal sequences of two subtypes (named HC-J1 and HC-J4, respectively) were reported. In the upstream region of this sequence, a highly conserved amino acid sequence was found, and the content of basic amino acids such as arginine was found to be high. From these results, it was presumed that this sequence encodes the capsid protein of the virus. Also,
It has been shown that the nucleotide sequence published in WO89 / 04669 is continued downstream of 1674 nucleotides from the sequence reported by Okamoto et al.

[0004]

Although the entire genome of HCV has been elucidated as described above, it has been proved that subtypes exist in HCV. In particular, the detection of the HCV subtype in a sample that shows infectivity of hepatitis NANB but was negative in the conventional anti-HCV antibody measurement system using the C100-3 antigen is a new addition to the conventional HCV diagnostic method. Raised a problem. Therefore, it is desired to produce another type of anti-HCV antibody measurement system using an antigen other than the C100-3 antigen. In particular, an antibody measurement system using a 5'-terminal coding region in which amino acid sequences are conserved between subtypes is expected to be useful for detection and quantification of antibodies of HCV-infected patients having different subtypes. Further, if an antibody against the antigen in this region can be prepared, application to detection and quantification of HCV-related antigens having different subtypes is expected.

However, this region (for example, Met ¹
ＧGly ¹²⁰ ) has an abnormally high basic amino acid content of 23%, and it is expected that the product will be susceptible to degradation by host protease when produced by genetic engineering. By producing it as a fusion protein with, it was possible to produce it stably in large quantities.

[0006]

Means for Solving the Problems In view of the above circumstances, the present inventors have conducted intensive studies and have made an antibody utilizing a fusion protein consisting of a capsid protein encoded by the HCV 5 'terminal region and a T7 phage gene 10 product. When the measurement method was set, this measurement method frequently detected serum of a patient with NANB hepatitis, and produced an antibody against the capsid protein encoded by the HCV 5 'terminal region. It has been found that HCV-related antigens can be detected and quantified with high sensitivity when subjected to immunohistochemical and immunochemical measurement methods, and that HCV-related antigens can be efficiently purified using the antibodies. As a result of research, the present invention has been completed.

[0007] The present invention relates to (1) the amino acid sequence of the capsid protein which is a hepatitis C virus structural protein: Ser-Thr-Ile-Pr
o-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-Asn-Thr-Asn-Arg-
Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-Gly-Gly-Gln-Il
e-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Cys-Arg-Gly-Pro-
Arg-Leu-Gly-Val-Arg-Thr-Thr-Arg-Lys-Thr-Ser-Glu-Ar
g-Ser-Gln-Pro-Cys-Gly-Arg-Arg-Gln-Pro-Ile-Pro-Lys-
Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-Ala-Gln-Pro-Gl
y (SEQ ID NO: 1, polypeptide (I)) or Ser-Thr-Il
e-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-Asn-Thr-Asn-
Arg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-Gly-Gly-Gl
n-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Arg-Arg-Gly-
Pro-Arg-Leu-Gly-Val-Arg-Ala-Thr-Arg-Lys-Thr-Ser-Gl
u-Arg-Ser-Gln-Pro-Arg-Gly-Trp-Arg-Gln-Pro-Ile-Pro-
Lys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-Ala-Gln-Pr
an antibody that binds to an antigen containing o-Gly (SEQ ID NO: 2, polypeptide (II)); (2) immunohistochemically detecting and quantifying an HCV-related antigen using the antibody And (3) a method for purifying hepatitis C virus-related antigen, which comprises purifying the hepatitis C virus-related antigen using the above antibody; (4) a method for purifying hepatitis C virus-related antigen; Hepatitis C virus-related antigen obtained; (5)
The present invention relates to an immunochemical measurement method comprising detecting and quantifying an antibody against a hepatitis C virus-related antigen using a protein containing the antigen of (4). Detect antibodies
Since the capsid protein relating to the method of quantification has a high basic amino acid content and is easily degraded by the host protease, it is obtained as a relatively stable product when produced as a fusion protein comprising this capsid protein and the gene 10 product of T7 phage. Therefore, in the above 5, Ser-Thr-Ile-Pro-Ly
s-Pro-Gln-Arg-Lys-Thr-Lys-Arg-Asn-Thr-Asn-Arg-Arg-
Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-Gly-Gly-Gln-Ile-Va
l-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Cys-Arg-Gly-Pro-Arg-
Leu-Gly-Val-Arg-Thr-Thr-Arg-Lys-Thr-Ser-Glu-Arg-Se
r-Gln-Pro-Cys-Gly-Arg-Arg-Gln-Pro-Ile-Pro-Lys-Ala-
Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-Ala-Gln-Pro-Gly
(SEQ ID NO: 1, polypeptide (I)) or Ser-Thr-Ile
-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-Asn-Thr-Asn-A
rg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-Gly-Gly-Gln
-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Arg-Arg-Gly-P
ro-Arg-Leu-Gly-Val-Arg-Ala-Thr-Arg-Lys-Thr-Ser-Glu
-Arg-Ser-Gln-Pro-Arg-Gly-Trp-Arg-Gln-Pro-Ile-Pro-L
ys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-Ala-Gln-Pro
Hepatitis C virus by using a fusion protein consisting of the capsid region of the hepatitis C virus structural protein containing the amino acid sequence of -Gly (SEQ ID NO: 2, polypeptide (II)) and the T7 phage gene 10 product as an antigen It also includes an immunological assay for detecting and quantifying an antibody against a related antigen.

[0008] The hepatitis C virus-related antigen that immunizes mammals is HCV if the resulting antibody binds to the polypeptide (I) or polypeptide (II) that is the capsid protein of the HCV structural protein described above. A fusion protein comprising polypeptide (I) or polypeptide (II) and a T7 phage gene 10 product, which may be of natural origin, of genetic origin, or of chemical synthesis, may be used. Genetic engineering techniques that can be efficiently used are conveniently used.

The recombinant DNA containing the nucleotide sequence encoding the polypeptide (I) includes, for example, the nucleotide sequence: 5'-AGCACGATTCCCAAACCTCAAAGAAAAACCAAACGTAACACCA
ACCGCCGCCCACAGGACGTCAAGTTCCCGGGCGGTGGTCAGATCGTTGGT
GGAGTTTACCTGTTGCCGTGCAGGGGCCCCAGGTTGGGTGTGCGCACGAC
TAGGAAGACTTCCGAGCGGTCGCAACCTTGTGGAAGGCGACAACCTATCC
CCAAGGCTCGCCGACCCGAGGGCAGGGCCTGGGCTCAGCCCGGG-3 '
(SEQ ID NO: 3). The recombinant DNA containing the nucleotide sequence encoding the above polypeptide (II) includes, for example, the nucleotide sequence: 5'-AGCACGATTCCCAAACCTCAA
AGAAAAACCAAACGTAACACCAACCGCCGCCCACAGGACGTCAAGTTCCC
GGGCGGTGGTCAGATCGTTGGTGGAGTTTACCTGTTGCCGCGCAGGGGCC
CCAGGTTGGGTGTGCGCGCGACTAGGAAGACTTCCGAGCGGTCGCAACCT
CGTGGATGGCGACAACCTATCCCCAAGGCTCGCCGACCCGAGGGCAGGGC
CTGGGCTCAGCCCGGG-3 '(SEQ ID NO: 4) and the like. The base sequence of the T7 phage gene 10 may be the original sequence of the phage, or may be any sequence as long as it is changed so as not to change the properties of the T7 phage gene 10 product forming the inclusion body.

The R encoding the HCV polypeptide described above
NA can be obtained from plasma or liver of patients with NANB hepatitis. As a method for preparing RNA from these materials, a guanidine thiocyanate method [J.
M. Chirgwin et al., Biochemistry,
18 , 5294 (1979)]. To the thus obtained RNA, an antisense primer (A) synthesized based on the 5 ′ terminal region of the HCV genome described in [WO 89/04669] was added, followed by adding reverse transcriptase. cDNA can be synthesized. This cDNA preparation was previously reported [H. Okamoto et al., Jpn. J. Exp.
ed., 60 , 167 (1990)], adding a sense primer (B) and an antisense primer (C) corresponding to the 5'-terminal coding region of HC-J1 and adding them to the manufacturer (for example, Cetus / Perkin). -Elmer) according to the kit instructions
CR can be performed. After separating the amplified cDNA by a method known per se, for example, agarose electrophoresis,
Can be recovered from the gel. The nucleotide sequence of this cDNA was determined by the dideoxynucleotide synthesis chain termination method [T.
Nucl. Acids Res., 9 , 309 (1981)].

The plasmid having the cloned cDNA can be used as it is or, if desired, cut out with an appropriate restriction enzyme and inserted into another vector. Any vector can be used as long as it can be replicated corresponding to the host. The host is Escherichia ( Escher
ichia coli , a plasmid derived from E. coli, for example, pBR322 [F. Bolivar et al., Gene, 2 , 9
5 (1979)], pBR325, pUCL2, pUCL3 and the like. When the host is a bacterium belonging to the genus Bacillus, a plasmid derived from Staphylococcus , for example, pUB110 (TJ Gryczan and D.C.
Dubnau, Proc. Natl. Acad. Sci. USA, 75 , 128 (197
8)], pTP5 [N. Noguchi, Gene, 2 , 95 (1979)], p.
Cl94 [D. Dubnau, Experimental Manipulation of Gene Expression (Expe
rimental Manipulation of Gene Expression; ed.M.I
nouye), p. 83, Academic Press
s), (1983)]. When the host is yeast, a yeast-derived plasmid such as pSH19 [S.
ashima et al., Molecular and Cellular Biology (Mol. Cell. Biol.), 4 , 771 (1984)], pSHl
9-1 (European Patent Application Publication EP-A-0235430). When the host is an animal cell, for example, pBR
PSV2-X with the ori of SV40 inserted in 322
[RC Mulligan and P. Berg, Proc. Natl. Acad. Sc
i. USA, 78 , 2072 (1981)], pcD-X [H. Okayama a
nd P. Berg, Mol. Cell. Biol., 3 , 280 (1983)].

[0012] The cloned cDNA may have a translation initiation codon (ATG) at the 5 'end and a translation termination codon (TAG, TGA or TAA) at the 3' end. In order to further express the cDNA, a promoter sequence, a promoter-pre-pro sequence or a promoter-signal sequence is connected upstream thereof. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. If the host is E. coli, tr
p promoter, lac promoter, λPL (L is a subscript L) promoter, T7 promoter, t
Examples thereof include an ac promoter, an lpp promoter, a recA promoter, and the like, and a T7 promoter is particularly preferable. When the host is a Bacillus sp.
1 promoter, SPO2 promoter, penP promoter, MWP promoter and the like, and MWP promoter is particularly preferable. When the host is yeast, GAPDH promoter, PGK promoter, PHO5 promoter, ADH promoter, PH
O81 promoter and the like.
The H promoter is preferred. When the host is an animal cell, examples thereof include an SV40-derived promoter and a retrovirus promoter. A promoter can be prepared from the corresponding gene. Also, it can be chemically synthesized.

The signal sequence and pre-pro sequence may be any as long as they function in the host. In the case of Escherichia coli, a signal sequence of the β-lactamase gene, a signal sequence of the enterotoxin gene, a signal sequence of the alkaline phosphatase gene, a signal sequence of the OmpA gene and the like can be mentioned. In the case of Bacillus, α-
Examples include the signal sequence of the amylase gene, the signal sequence of the neutral protease gene, and the signal sequence of the MWP gene. In the case of yeast, a signal sequence of an egg white lysozyme gene, a signal sequence of a human lysozyme gene, a signal sequence of an invertase gene, a pre-pro sequence of an α-factor gene and the like can be mentioned. In the case of animal cells, examples include the signal sequence of the interleukin 2 gene. A transformant is produced using the thus constructed vector containing the recombinant DNA containing the nucleotide sequence encoding polypeptide I or II. Examples of the host include Escherichia, Bacillus, yeast, animal cells and the like. Escherichia bacteria include Escherichia coli K12DH1
[B. Low, Proc. Natl. Acad. Sci. USA, 60 , 160 (196
8)], C600 [RK Appleyard, Genetics, 39 , 440 (1954)], MM294 [K. Back
Man et al., Proc. Natl. Acad. Sci. USA, 73 , 4174 (1976).
And the like. Examples of Bacillus spp. Include, for example, Bacillus subtilis MI114
[K. Yoshimura et al., Gene. 24 , 255 (1983)], 207-
21 [K. Ohmura et al., Journal of Biochem., 95 , 87 (1984)], Bacillus
Brevis 47 [S. Udaka. Agricultural biological chemistry (Agric. Biol. Chem.), 40 , 5]
23 (1976)]. As yeast, for example, Saccharomyses cereviche
siae ) AH22R ~ [A. Miyanohara et al., Proc. Natl. Ac
ad.Sci. USA, 80 , 1 (1983)], NA87-11A, DK
D-5D, NA74-3A, NA74-3A ρ ~ [Y.Kai
sho et al., Yeast, 5 , 91 (1989)] and Schizosaccharomyces pombe .
ATCC 38399 (h ~ leul-32), TH168 (h ⁹⁰ a
de6-M210 ural leul) [M. Kishida and C. Shimada, Current Genetics, 10 , 443
(1986)]. Examples of animal cells include monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary (CHO) cells, mouse L cells, human FL cells, and mouse myeloma cells (SP2 / 0 etc.), which are suspension cells. ), Mouse YAC-
1 cell, mouse MethA cell, mouse P388 cell,
Mouse EL-4 cells and the like can be mentioned.

To transform Escherichia, for example, T. Maniatis et al., Molecular Cloning, Cold Spring
It is performed according to the method described in Harbor Laboratory, page 249 (1982). Methods for transforming Bacillus sp. Include S. Chang and SN Cohen, Molecular and General Genetics (Mol. Gen. Genet.),
168 , 111 (1979). To transform yeast, for example, A. Hinnen et al., Pr.
Natl. Acad. Sci. USA, 75 , 1929 (1978). To transform animal cells,
For example, the method is performed according to the method described in M. Wigler et al., Cell, 14 , 725 (1978). The transformant thus obtained is cultured by a method known per se. When culturing a transformant whose host is a bacterium belonging to the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [JH Miller, Experiments in Molecular Genet.
ics), p.431, Cold Spring Harbor Laboratory, (197
2)] is preferred. If necessary, a drug such as isopropylthiogalactoside (IPTG) or indolyl-3-acrylic acid can be added in order to make the promoter work efficiently. Culture is usually about 15-43
C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When culturing a transformant whose host is a bacterium belonging to the genus Bacillus, examples of the medium include an L-broth medium and a T2 medium [S. Udaka, Agric. Biol. Chem., 40 , 52].
3 (1976)]. Culture is usually about 15-37
C. for about 6 to 96 hours, and if necessary, aeration and stirring can be added. When culturing a transformant whose host is yeast, for example, Burkholder (Burkhold)
er) Minimal medium [KL Bostain et al., Proc. Natl. Acad. Sc.
i. USA, 77 , 4504 (1980)]. Medium p
H is preferably adjusted to about 5 to 8. Culture is usually about 2
The reaction is performed at 0 to 35 ° C. for about 24 to 72 hours, and aeration and stirring are added as necessary. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [H. Eagle, Science
ce), 130 , 432 (1959)], DMEM medium [R. Dulbecco
and G. Freeman, Virology, 8 , 396 (1
959)], RPMI-1640 medium [GE More et al., Journal of the American Medical Association (J. Am. Med. Assoc.), 199 , 519 (1967)],
199 medium [JF Morgan et al., Processing of
The Society for Experimental Biology and Medicine (Proc. Soc. Exp. Bio
l. Med.), 73 , 1 (1950)]. The cultivation is usually performed at about 30 to 40 ° C. for about 15 to 60 hours, and if necessary, aeration or stirring is added. In order to isolate a novel polypeptide derived from HCV from the above culture, a known separation /
Purification methods can be combined appropriately. These known separation / purification methods include methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, and the like. Method using difference, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, method using hydrophobic difference such as reversed phase high performance liquid chromatography And a method utilizing the difference in isoelectric point such as isoelectric focusing method.

When immunizing the HCV-derived polypeptide thus obtained, the polypeptide may be used as a complex with a carrier protein and then used for immunization. Examples of the carrier protein include bovine serum albumin, bovine thyroglobulin, hemocyanin and the like. The binding between the polypeptide and the protein for carrier can be carried out by using known conventional means. Examples of the reagent used for the binding include glutaraldehyde and water-soluble carbodiimide. An appropriate ratio of the peptide to the carrier protein is about 1: 1 to about 1: 4,
The pH of the reaction around neutral, especially around 7.3, often gives good results. The time required for the reaction is about 2
Six hours is often good, but about three hours is particularly appropriate. The composite thus prepared may be dialyzed against water at about 4 ° C. by conventional means and stored frozen or may be freeze-dried and stored.

In order to produce a polyclonal antibody,
The immunogen produced as described above is inoculated into a warm-blooded animal. As a warm-blooded animal used for the production of the antibody,
For example, warm-blooded mammals (eg, rabbits, sheep, cows, rats, mice, guinea pigs, horses, pigs), birds (eg,
Chicken, pigeon, duck, goose, quail) and the like. As a method of inoculating the immunogen into a warm-blooded animal, the amount of the immunogen to be inoculated into the animal may be an amount effective for producing antibodies. For example, 1 mg per rabbit may be added to 1 ml of physiological saline and Freund's complete solution. Antibodies are often produced by emulsifying with an adjuvant and inoculating the back and subcutaneous palms 5 times every 4 weeks. As a method for collecting the antibody formed in the warm-blooded animal in this way, for example, in rabbits, usually, from 7 to 12 days after the final inoculation, the antibody is collected from the ear vein and centrifuged to obtain serum. Can be The polyclonal antibody can be purified from the obtained antiserum by collecting the fraction adsorbed by affinity chromatography using a carrier holding the HCV-derived polypeptide. Also, Milstein
ein) et al. [Nature, 256 , 495 (1
975)] can also be used. That is, the monoclonal antibody is used to immunize a mammal with the polypeptide or protein complex of the immunogen, and to obtain a hybridoma by cell fusion between the removed spleen cells and allogeneic or heterologous lymphoid cells,
This is cloned, and the obtained hybridoma is inoculated into a mammal to produce and accumulate a monoclonal antibody, which is collected and produced. The antibody molecule may be an IgG or a fraction thereof, eg, F (ab ') ₂ , F
ab ′ or Fab｝. Above all, the antibody molecule to which the labeling agent is directly bound is preferably Fab '. The antibody thus obtained can be used as a reagent in an immunohistochemical / immunochemical assay for HCV-related antigen. According to the immunohistochemical and immunochemical assay for the HCV-related antigen, H
Detection and quantification of CV-related antigens becomes possible. This allows
For example, detection and quantification of HCV-related antigens in liver tissues and body fluids may be useful for diagnosis of HCV-related hepatitis. The antibody against the HCV-related antigen used in the immunochemical assay of the present invention may be any antibody capable of binding to the capsid protein of the HCV structural protein. In particular, an antibody obtained by using a fusion protein comprising the capsid protein and the T7 phage gene 10 product as an immunogen is preferable.

Examples of the carrier in the antibody held on the carrier used in the method for measuring an HCV-related antigen include gel particles (eg, agarose gel [eg, Sepharose 4B, Sepharose 6B, (Pharmacia Fine Chemicals (Sweden)) Dextran gel (eg, Sephadex G-75, Sephadex G-100, Sephadex G-200 (Pharmacia Fine Chemical Co., Sweden)), polyacrylamide gel (eg, Biogel P-30, Biogel) P-60, Biogel P-
100 (Bio-Rad Laboratories (USA)
Manufactured)), cellulose particles [eg, Avicel (made by Asahi Kasei),
Ion exchange cellulose (eg, diethylaminoethylcellulose, carboxymethylcellulose)], material adsorbent [eg, glass (eg, glass sphere, glass rod, aminoalkyl glass sphere, aminoalkyl glass rod), silicon piece, stainless steel resin (eg, , Polystyrene spheres, polystyrene particles), plates for immunoassay (eg, manufactured by Nunc (Denmark)), ion-exchange resins {eg, weakly acidic ion-exchange resins [eg, Amberlite IRC-50 (Rohm and Haas (USA) )), Zeocurve 226
(Made by Palm Chit (West Germany)), weakly basic anion exchange resin [eg, Amberlite IR-4B, Dowex 3
(Manufactured by Dow Chemical Company (USA)). In order to retain the antibody on the carrier, known conventional means can be applied. For example, the Bromcian method, the glutaraldehyde method described in “Metabolism”, Vol. 8 (1971), p. No. In addition, as a simpler method, it may be physically adsorbed on the antibody surface.

Examples of the labeling agent in the antibody to which the labeling agent is bound include a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like, and it is preferable to use an enzyme. As the enzyme, a stable enzyme having a large specific activity is preferable, and peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase and the like can be used, but peroxidase is preferable. As the peroxidase, those of various origins can be used.Examples include peroxidase obtained from horseradish, pineapple, fig, sweet potato, broad bean, corn, and the like, and particularly hose extracted from horseradish. Horseradish peroxidase (HRP) is preferred. In binding peroxidase to the antibody, it is convenient to use a peroxidase in which a maleimide group has been introduced in advance in order to utilize the thiol group of Fab 'as an antibody molecule. As a method for introducing a maleimide group into peroxidase, a maleimide group can be introduced via an amino group of peroxidase. For this purpose, an N-succinimidyl-maleimide-carboxylate derivative can be used, and N- (γ-maleimidobutyloxy) succinimide (sometimes abbreviated as GMBS) is preferred. Therefore, a certain group may be inserted between the maleimide group and the peroxidase.
The reaction of GMBS with peroxidase is carried out by reacting both at a temperature of about 10 to 50 ° C. for about 10 minutes to 24 hours in a buffer having a pH of about 6 to 8. Examples of the buffer include 0.1 M phosphate buffer at pH 7.0. The maleimidated peroxidase thus obtained can be purified, for example, by gel filtration chromatography. As the carrier used when performing the gel filtration chromatography, for example, Sephadex G-25 [Pharmacia.
Fine Chemicals (Sweden)], Biogel
P-2 [Bio-Rad Laboratories (USA)]. The reaction between the maleimidated peroxidase and the antibody molecule can be carried out by reacting the two in a buffer at a temperature of about 0 ° C to 40 ° C for about 1 to 48 hours. As the buffer, for example, 5 m of pH 6.0
M 0.1 M phosphate buffer containing ethylenediaminetetraacetic acid sodium salt. The thus obtained peroxidase-labeled antibody can be purified by, for example, gel filtration chromatography. Examples of the carrier used for performing the gel filtration chromatography include Sephadex G-25 [Pharmacia Fine Chemical Co. (Sweden)] and Biogel P-2.
[Bio-Rad Laboratories (USA)]. Further, a thiol group may be introduced into peroxidase and reacted with a maleimidated antibody molecule. The direct binding of an enzyme other than peroxidase to the antibody can be carried out according to the method of peroxidase, and a per se known glutaraldehyde method, periodate method, water-soluble carbodiimide method and the like are used. As a test sample in the immunochemical measurement system of the present invention, urine,
Examples include body fluids such as serum, plasma, and cerebrospinal fluid, or extracts of animal tissues, animal cells and bacterial cells, or culture supernatants thereof.

When performing an immunohistochemical search, HCV
Although an antibody against the capsid protein of the structural protein can be directly labeled with peroxidase as described above, a direct or indirect avidin-biotin complex staining method using a biotinylated secondary antibody can be used. [ABC method, Journal of Histochemistry.
And cytochemistry (J. Histochem. Cytoche)
m.) 29 , 577 (1981) is advantageously used because of its high sensitivity and low non-specific staining. Test materials in the immunohistochemical search of the present invention include liver of humans, chimpanzees, etc., and cells and tissue fragments derived therefrom. Purification of the HCV-related antigen using an antibody against the capsid protein of the HCV structural protein can be performed by performing affinity column chromatography using the antibody. The affinity column chromatography can be performed, for example, by coupling the antibody to a suitable carrier, packing it into a column,
This can be done by adsorbing a solution containing the CV-related antigen through a column and then eluting it. Examples of the carrier include those similar to the carriers described above. In particular, gel particles and various synthetic resins are advantageously used. For example, CNBr-activated sepharose
4B (Pharmacia Fine Chemicals), Affigel-10, Affigel 15 (Bio-Rad Laboratories) and the like. For coupling the antibody to the carrier, known conventional methods can be applied, and examples thereof include the Bromcian method and the glutaraldehyde method described in “Metabolism”, Vol. 8, (1971), p. 696. Can be In addition, a method using a water-soluble carbodiimide, an active ester method, and the like can also be used. However, as a simpler method, the compound may be physically adsorbed on the carrier surface.

In order to carry out purification using the antibody column thus obtained, an HCV-related antigen in a buffer near neutrality is adsorbed on an antibody column packed with a carrier to which the antibody is bound. Next, after washing the column with the same buffer,
The specifically adsorbed HCV-related antigen is eluted. To elute specifically absorbed antigens, for example, low pH
Alternatively, a high pH buffer or a buffer containing a high concentration of salt is used. Examples of the low pH buffer include a 0.17 M glycine-hydrochloric acid buffer at pH 2.3 and a buffer at pH 1.8.
0.1 M sodium citrate-hydrochloric acid buffer and the like. Examples of the high pH buffer include ammonia water at pH 11 and 0.2 M sodium borate buffer at pH 11.7. Examples of the buffer containing the salt at a high concentration include a 6M guanidine hydrochloride solution, a 7M urea solution and the like. The above-mentioned elution may be a batch method or a method using a column. The antigen eluate is purified, for example, by dialysis. When eluted with a low pH buffer, a 0.1 M sodium carbonate buffer (pH 10.
5) When eluted with high pH buffer, 0.1M glycine-
After neutralization with hydrochloric acid buffer (pH 3.0), 0.1% NaN
Dialysis against a 0.02 M phosphate buffer (pH 8.0) containing ₃ The antigen solution eluted with a buffer containing a high concentration of salt can be directly dialyzed and stored in the above-mentioned phosphate buffer. Further, the eluate or dialysate can be stored as a freeze-dried preparation obtained by freeze-drying.

The HCV-related antigen purified in this manner is a highly conserved region of the amino acid sequence among HCV proteins having subtypes, and is highly purified. Can be used as an antigen. As the carrier for the HCV-related antigen retained on the carrier used in the method for measuring anti-HCV antibodies, any carrier may be used as long as it is a carrier used for retaining the above-mentioned antibodies. A synthetic resin having a spherical shape, preferably a spherical shape, preferably about 3 to 8 mm, and a spherical shape is preferred. A bead whose surface is made rough by polishing is preferred. The antigen-sensitized beads of the present invention can be prepared by subjecting the above-mentioned synthetic resin beads to HCV-related antigens by a known method [Eiji Ishikawa, Enzyme-linked immunosorbent assay (Medical Publishing), Immunoenzymatic Assay Technics (Immunoenzy)
matic Assay Techniques), p. 165, 1980 (Martinus
Nijhoff)], but it is possible to remove impurities such as proteins by washing synthetic resin beads as a pretreatment for antigen sensitization. Can be improved. About 0.1-5% (v / v), preferably about 1-2% (v / v) of the washing treatment
Non-ionic surfactants (eg, polyoxyethylene sorbitan fatty acid esters (eg, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monostearate, polyoxyethylene sorbitan monopalmitate, polyoxyethylene sorbitan monolaurate) ), Polyoxyethylene sorbitol fatty acid esters (eg, polyoxyethylene sorbitol monolaurate), polyoxyethylene fatty acid esters (eg, polyoxyethylene stearate), polyoxyethylene higher alcohol ethers (eg, polyoxyethylene) Lauryl alcohol, polyoxyethylene oleyl alcohol, etc.), polyoxyethylene alkyl aryl ether (eg, polyoxyethylene nonylphenol, etc.), polyoxy Polyoxyethylene castor oil derivatives (e.g.,
Polyoxyethylene hydrogenated castor oil derivatives such as HCO-50 and HCO-60), polyoxyethylene lanolin derivatives, polyoxyethylene lanolin alcohol derivatives, block polymer type nonionic surfactants (eg, Pluronic, L-62, L-64, F-68, etc.) and preferably a polyoxyethylene sorbitan fatty acid ester, more preferably a polyoxyethylene sorbitan monolaurate (Tween 20) dissolved in a solution of about 10%.
Washing is carried out at a temperature of -50 ° C, preferably about 20-30 ° C, for about 1-10 hours, preferably for about 2-3 hours, about 1-10 times, preferably about 3-5 times. Also, as a pretreatment for antigen sensitization, the detection sensitivity in the HCV antibody measurement method can be improved by treating synthetic resin beads with aldehydes (eg, formaldehyde, pyruvaldehyde, glutaraldehyde), preferably glutaraldehyde. In addition, the stability of a reagent for measuring HCV antibodies (synthetic resin beads sensitized with an HCV-related antigen) can be improved, which is advantageous. As treatment with aldehydes, about 0.1
About 10 to 50 ° C, preferably about 20 to 30 ° C for about 10 minutes using an aqueous solution of aldehydes, preferably glutaraldehyde, of about 0.8 to 2.5% (v / v), preferably about 0.8 to 2.5% (v / v). ~ 5
For example, a method of treating synthetic resin beads for about 1 to 2 hours is preferable. The pretreatment for antigen sensitization is preferably performed in combination with the above-mentioned washing treatment and treatment with aldehydes.After washing the synthetic resin beads, drying is performed as necessary, and treatment with aldehydes is performed. preferable. Further, it is preferable that the synthetic resin beads (preferably, the synthetic resin beads after the above pretreatment) are washed with the same buffer as the buffer used for antigen preparation described later before the antigen sensitization. HCV-related antigens used for antigen sensitization are usually about 0.5 to
After dissolving in a buffer solution of 5 μg / ml, preferably about 0.8 to 1.5 μg / ml, which is weakly alkaline, preferably about pH 9 to 10, it is used for antigen sensitization treatment. As the buffer, a carbonate buffer having a pH of about 9.6 is preferable, and the concentration of the carbonate buffer is about 0.005 to 0.05 M, especially about 0.0124 M
~ 0.025M is preferred. As described above, the antigen solution obtained by dissolving the HCV-related antigen in the buffer may be used as it is for the antigen sensitization treatment, but before the antigen sensitization treatment, the antigen solution is treated at about 10 to 40 ° C., preferably at about 20 to 30 ° C. for about 1 to 1 hour. By performing the stabilization treatment by allowing the mixture to stand for 10 hours, preferably for about 4 to 6 hours, and more preferably for about 2 to 3 hours, the variation in the method for measuring HCV antibodies can be reduced, and the measurement accuracy can be improved. The synthetic resin beads and the HCV-related antigen are used for the antigen sensitization treatment after performing the above-described pretreatment, if desired. For example, the synthetic resin beads are added to an antigen solution and left at about 4 ° C. overnight. Synthetic resin beads sensitized with an HCV-related antigen (antigen-sensitized beads) can be prepared. The obtained antigen-sensitized beads can be used for measurement of HCV antibodies after washing (for example, washing with a phosphate buffer solution containing 0.1% (v / v) Tween 20) as necessary. It is preferable to perform a blocking operation for the purpose of reducing non-specific reactions at the time of measurement, and further perform washing (for example, washing with a phosphate buffer containing 0.1% v / v Tween 20) as necessary. In the blocking operation, animal serum (for example, serum of goat, sheep, cow, horse, rabbit, guinea pig, mouse, human, etc.), preferably goat or sheep serum is used. % (V / v) Tween 20 and the like. The serum concentration to be added is about 1 to 20% (v / v), and especially about 5 to 10% (v / v).
v) is preferable, and the blocking treatment temperature is about 2 to 6
Approximately 45 ° C among 0 ° C, blocking time is about 1
Preferably, about 2 to 20 hours are preferred. In a liquid sample described later, serum from an animal different from the animal in the blocking operation is used. The antigen-sensitized beads of the present invention are used as a solid phase (sensitized solid phase) in an enzyme immunoassay for measuring HCV antibodies in a liquid sample (eg, human or chimpanzee serum or plasma). The HCV antibody in a sample (about 50 μl of human serum, etc.) is reacted with about 1 to 2 antigen-sensitized beads, and
The antibody titer of the HCV antibody can be measured by measuring the enzyme activity of the immobilized enzyme label obtained by adding an enzyme-labeled antibody that reacts with the CV antibody (immunoglobulin). As the antigen-sensitized beads, synthetic resin beads sensitized with one kind of antigen derived from HCV may be used for the measurement of HCV antibodies, or synthetic resin beads sensitized individually with two or more kinds of antigens derived from HCV may be used. HCV antibodies in the same liquid sample can be measured by placing resin beads in the same container. The synthetic resin beads sensitized with the HCV-related antigen in the present invention are stable and are excellent as reagents used for a method for measuring an antibody against HCV, and by using the beads for the measurement method, the measurement accuracy and detection sensitivity of the measurement method are improved. Since it improves reproducibility and reduces nonspecific reactions, it is advantageously used in measuring HCV antibodies for the purpose of diagnosis and prognosis management of hepatitis C. Further, the stability of the beads is further improved by treating them with aldehydes before the antigen sensitization treatment. However, the stabilizing effect of the aldehyde treatment before the antigen sensitization treatment is improved by antigens other than HCV-related antigens (eg, Pertussis, tetanus, diphtheria, mashin, rubella, mumps, antigens derived from pathogenic bacteria or viruses such as Japanese encephalitis)
This is also effective in the case of sensitizing a synthetic resin with an aldehyde, so that a stable antigen-sensitized synthetic resin can be obtained, for example, by treating the synthetic resin with an aldehyde and then sensitizing it with an arbitrary antigen.

[0022]

The antibody which reacts with the capsid protein of the hepatitis C virus structural protein obtained by the present invention can be used as a reagent in a method for assaying and quantifying a hepatitis C virus-related antigen by immunohistochemical or immunochemical assay. Is effective as a reagent for the purification of hepatitis C virus-related antigen, and the method for detecting and quantifying an antibody against hepatitis C virus-related antigen by using the capsid protein of hepatitis C virus structural protein as an antigen comprises It is expected that this can be an effective means for determining the presence or absence of hepatitis virus infection.

In the specification and the drawings of the present application, when bases and amino acids are indicated by abbreviations, IUPAC-IU
B This is based on the abbreviation by Commision on Biochemical Nomenclature or the abbreviation commonly used in the art, and examples thereof are as follows. When an amino acid can have an optical isomer, the L-isomer is indicated unless otherwise specified. DNA: deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine SDS: sodium dodecyl sulfate Gly: glycine (G) Ala: alanine (A) Val: valine (V) Leu: leucine (L) Ile: isoleucine (I) Ser): Serine (S) Thr: Threonine (T) Cys: Cysteine (C) 1/2 Cys: Half cystine Met: Methionine (M) Glu: Glutamic acid (E) Asp: Aspartic acid (D) Lys: Lysine (K) Arg: Arginine (R) His: Histidine (H) Phe: Phenylalanine (F) Tyr: Tyrosine (Y) Trp: Tryptophan (W) Pro: Proline (P) Asn: Asparagine (N) Gln: Glutamine (Q) Apr: Ampicillin resistant Tcr: tetracycline resistance gene (note: r represents superscript r) In the polypeptide of the present invention, a part of the amino acid sequence is modified (addition, Removal, substitution with other amino acids, etc.).

[0024]

The present invention will be described more specifically with reference to the following reference examples and examples, but the present invention is not limited to these examples. The transformant Escherichia coli MM294 (DE
3) / pHCa101CF and E. coli MM2
94 (DE3) / pHCb101CF, 1990
Accession No. I to the Fermentation Research Institute (IFO) from March 9
FO 15107 and IFO 15108, respectively, and these transformants were
They have been deposited with the Ministry of International Trade and Industry at the National Institute of Advanced Industrial Science and Technology (FRI) on January 22 as deposit numbers FERM BP-3171 and FERM BP-3172, respectively.

Reference Example 1 Amplification of HCV Gene from cDNA Derived from C100-3 Antibody Positive Plasma 12 ml of 20% (w) containing 10 mM Tris-HCl (pH 8.0) in a tube for ultracentrifugal rotor SW28 manufactured by Beckman. / V) After injecting sucrose, C
23 ml of 100-3 antibody-positive plasma was layered, and
Ultracentrifugation was performed at 8,000 revolutions / minute (rpm) for 4 hours. A precipitate obtained from 70 ml of the plasma was treated with 50 mM
Tris-HCl (pH 8.0), 200 mM NaC
1, 10 mM EDTA, 2% (w / v) SDS, 1 mg
/ Ml Proteinase K (manufactured by Merck) in 3 ml and left at 65 ° C. for 1 hour. After adding an equal volume of phenol and chloroform to this solution to extract an aqueous layer, 5 μg of glycogen, 1/10 volume of a 3M sodium acetate solution (pH 4.8), and 2 volumes of ethanol were added to the aqueous phase. In addition, it was allowed to stand at -20 ° C all day and night.
This solution was centrifuged at room temperature for 10,000 in an Eppendorf microcentrifuge.
After centrifugation at 0 rpm for 10 minutes, the obtained precipitate (nucleic acid fraction) was dissolved in 30 μl of distilled water. On the other hand, H
CV nucleotide sequence [H. Okamoto et al., Jpn. J. Exp. Med., 60 ,
167 (1990); WO 89/04669; JP-A-2-500880]
2023 to 2042 when the 5 ′ end of
Antisense primer No. 2: 5 'CC corresponding to
TCCGATGACACAAGGAGG 3 '(SEQ ID NO:
5), base numbers 325 to 347 [H. Okamoto et al., Jpn.
J. Exp. Med., 60 , 167 (1990)], and primer No. 217: 5 'CAAGATCTCGGAT corresponding to
GAGCACGATTCCCAAACCT CA 3 '(SEQ ID NO: 6), base numbers 679-701 [H. Okamoto et al.
Jpn. J. Exp. Med., 60 , 167 (1990)]. Antisense primer No. 219: 5 'CTAGATC
TTCAGAGGGTATCGATGACCT TACC
CA A 3 ′ (SEQ ID NO: 7) was synthesized, and cDN
A was used as a primer for preparing A. 10 of the above nucleic acid fraction
60 pmol of primer No. 2 in 1/3 volume (3 μl)
In addition, the mixture was kept at 75 ° C. for 10 minutes and then rapidly cooled in ice.
Next, 50 mM Tris-HCl (pH 8.3), 75 m
M KCl, 3 mM MgCl ₂ , 0.4 mM each dNT
P, 10 mM DTT, 200 units reverse transcriptase [SuperScript (Trade Mark) RT (Lif
e Technologies, Inc.)] in a solution containing
The cDNA synthesis reaction was performed for 1 hour, and the reaction was stopped by heating at 70 ° C. for 10 minutes. Two types of primers (Nos. 217 and 219; 100 pmol each) were added to one fifth of the obtained cDNA fraction, and according to the kit instructions supplied by Cetus / Perkin-Elmer. , 94 ° C, 1 minute, 55 ° C, 2 minutes, 72
The reaction was repeated 40 times at 3 ° C. for 3 minutes.

Reference Example 2 Cloning of HCV cDNA and Determination of Its Base Sequence After the above PCR product was separated by 1.2% agarose electrophoresis, the size expected from the HCV base sequence (about 400
bp; corresponding to base numbers 325 to 701) from the agarose gel. The obtained DNA fragment is phosphorylated at the 5 ′ end with T4 polynucleotide kinase [manufactured by Takara Shuzo Co., Ltd.] and [γ- ³² P] -ATP, and then T4 DNA ligase [manufactured by Takara Shuzo Co., Ltd.]
Plasmid and pUC118 [Takara Shuzo Co., Ltd.]
Was inserted into the Hin cII site of manufacturing, the base sequence of the cDNA portion dideoxynucleotide synthetic chain termination method [J. Messing
Et al., Nucl. Acids Res., 9 , 309, (1981)]. As a result, it was found that the DNA fragment contained one kind of HCV cDNA (type a) which was clearly different from the previously reported sequence. The plasmid containing the a-type cDNA fragment was named pHCa101, and the nucleotide sequence of the cDNA portion and the amino acid sequence predicted from the nucleotide sequence are shown in FIG.
And FIG. Similarly, PCR was performed on other cDNAs derived from C100-3 antibody-positive plasma, and as a result, a product having the same size as that of the a-type was recovered. When the nucleotide sequence was analyzed, H. Okamoto et al. [Jpn. J. Exp. Med., 60 , 167 (199
0)] and the same HCV cDN as the HC-J4 strain reported by
In addition to A, it was found that a novel HCV cDNA (type b) was cloned. Therefore, the b-type cD
The plasmid having NA was named pHCb101.
The nucleotide sequence and the amino acid sequence predicted from the nucleotide sequence are shown in FIGS. 1 and 2, respectively. These a-type and b-type c
The amino acid sequence predicted from the DNA showed high homology to the amino acid sequence of HCV which was hitherto known.
It was found to be a CV polypeptide.

Reference Example 3 Construction of Expression Vector-1 Plasmids pHCa101 and pHC Obtained in Reference Example 2
was digested with restriction enzymes Bgl II and b101, was isolated DNA fragment 0.38kb from each. These fragments were converted to plasmid pET-3xa [Methods in Enzymology. Ed. DV Goedde.
l), 185, 68, Academic Press
ess), was inserted into the Bam HI site of the (1990)], the plasmid p
HCa101CF and pHCb101CF were prepared.

Reference Example 4 Construction of Expression Vector-2 Plasmids pHCa101 and pHC Obtained in Reference Example 2
After b101 was digested with the restriction enzyme KpnI and each was opened, the ends were blunted by treatment with T4 DNA polymerase. These have a Bam HI linker (pCGGGATC).
CCG) (NEB) was added using T4 DNA ligase [Takara Shuzo Co., Ltd.]. P added with the linker
In addition restriction enzyme Hin dIII and Bam the HCa101CF
After treatment with HI, the plasmid pUC was inserted between the Hin dIII site and the Bam HI site of plasmid pUC8
a-KF was produced. Further, the pH to which the linker is added
It was digested with restriction enzymes Xba I and Bam HI to Cb101, to produce plasmid PUCB-KF was inserted between the Xba I site and the Bam HI site of the plasmid pUC18. These plasmids were transformed with the restriction enzymes Bgl II and Bam H
It was digested with I, the 0.26kb from each Bgl II- B
The am HI fragment was obtained. These fragments were converted to plasmid pET.
-3xa at the Bam HI site and the expression plasmid p
HCa101KF and pHCb101KF were prepared.

Reference Example 5 Preparation and Expression of Transformant Escherichia coli MM294
Phage DE3 [F. W. Studier et al., Journal
Of Molecular Biology (J. Mol. Biol.),
189 , 113 (1986)] produced by lysogenization of Escherichia coli MM294 (DE3).
Is the expression vector pHCa obtained in Reference Examples 3 and 4.
101CF, pHCb101CF, pHCa101KF
And pHCb101KF was transformed using transformant E. coli MM294 (DE3) / pHCa1
01CF (IFO 15107), E. coli MM2
94 (DE3) / pHCb101CF (IFO 151
08), E. coli MM294 (DE3) / pHC
a101KF and E. coli MM294 (DE
3) / pHCb101KF was obtained respectively. Each transformant was mixed with 1.5 ml of 50 μg / ml ampicillin.
Was cultured at 37 ° C. for 16 hours in an LB medium. 0.5 ml of the obtained culture solution was added to 200 ml containing 10 ml of the same medium.
Transfer to a volumetric flask and incubate at 37 ° C.
When the concentration reached 70 to 200, IPTG was added to a final concentration of 0.1 mM, and the cells were further cultured at 37 ° C for 2 hours. 50 μl of distilled water and 50 μl of a 2 × concentration of sample buffer [50 mM T
ris-HCl (pH 6.8) -2 mM EDTA-1
% SDS-1% mercaptoethanol-8% glycerol-0.025% bromophenol blue], and then suspended at 100 ° C. for 10 minutes.
Was electrophoresed on a polyacrylamide gel containing
After electrophoresis, it was dyed the gel with Coomassie Brilliant Blue or silver staining solution, transformant E. coli
MM294 (DE3) / pHCa101CF and E. co
li MM294 (DE3) / pHCb101CF the position of about 46 kilodaltons, also E. coli MM2
94 (DE3) / pHCa101KF and E. coli
MM294 (DE3) / pHCb101KF was found to express a specific product that migrates at about 44 kDa.

Reference Example 6 T7 phage gene product and HC
Transformant E obtained in Expression Reference Example 5 in E. coli of a fusion protein gene comprising a V polypeptide. coli
MM294 (DE3) / pHCa101CF and
E. coli MM294 (DE3) / pHCb101
20 ml of a culture solution containing 50 μg / ml of ampicillin CF (10 g of bactotryptone,
After shaking culture at 37 ° C overnight in 5 g of yeast extract and 5 g of sodium chloride),
Was transferred to the same medium (300 ml, in a 1-liter flask), and further cultured at 37 ° C. with shaking. Klett
When the value reaches 170 to 200, the final concentration is 0.1 m.
M, and 750 μl of 40 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added thereto.
The cells were further cultured with shaking at 37 ° C for 2 hours, and the cells were collected by centrifugation.

Reference Example 7 Purification of Fusion Protein Consisting of 10 Products of T7 Phage Gene and HCV Polypeptide The cells collected in Reference Example 6 were suspended in 10 ml of a suspension buffer [50 mM Tris-HCl (pH 8.5) -10].
0 mM NaCl-1 mM EDTA-0.1 mM A
PMSF-0.5% Triton X-100], and sonicated.
After centrifugation for 0 minutes, a supernatant was obtained. Further, this supernatant was centrifuged at 5,000 × g for 20 minutes at 8 ° C. to obtain a precipitate, which was then added to 4 ml of a 1 M urea buffer [1 M urea-50 mM Tris-HCl (pH 8.5) -100].
mM NaCl-1 mM EDTA-0.1 mM AP
MSF-0.5% Triton X-100] and left at room temperature for 1 hour. This is 8 ℃, 5000x
g, and centrifuged for 20 minutes to obtain a precipitate. This precipitate was added to 4 ml of a 4 M urea buffer [4 M urea-50 mM T
ris-HCl (pH 8.5) -100 mM NaCl
-1 mM EDTA-0.1 mM APMSF-0.5
% Triton X-100].
Left for hours. This was centrifuged at 5,000 × g for 20 minutes at 8 ° C. to obtain a precipitate, and the precipitate was subjected to 4 ml of an 8 M urea buffer [8 M urea-50 mM Tris-HCl.
(PH 8.5) -100 mM NaCl-1 mM ED
TA-0.1 mM APMSF-0.5% Trito
nx-100] and left overnight at 4 ° C.
This was centrifuged at 5000 xg for 20 minutes at 8 ° C to obtain a supernatant. Laemmli buffe with twice the concentration of half
r was added and heated at 100 ° C. for 10 minutes. 130 after cooling
The mixture was centrifuged at 00 rpm for 5 minutes to obtain a supernatant. This was subjected to electrophoresis on an SDS-polyacrylamide gel, and then subjected to silver staining . coli MM2
94 (DE3) / pHCa101CF and MM294
Each fusion protein obtained from (DE3) / pHCb101CF (named HC-T1 antigen and HC-T2 antigen, respectively)
Were detected as a single band at a position of about 46 kilodaltons.

Example 1 Examination of Amount of Sensitized Antigen 100 ml of a 1% (v / v) aqueous solution of Tween 20 (Funakoshi Pharmaceutical Co., Ltd.) was added to 500 polystyrene beads (Immunochemical Co., Ltd.) having a diameter of 6.35 mm, and the mixture was added at room temperature. After the treatment for 2 hours, it was washed 5 times with distilled water and dried. 100 ml of a glutaraldehyde solution (Wako Pure Chemical Industries, Ltd.) was added to 500 polystyrene beads so that the final concentration was 2.5% (v / v), the mixture was treated at room temperature for 2 hours, and distilled water was used. After washing 5 times, 0.1
Washing was performed with a M sodium hydrogen carbonate solution (pH 9.6). To 50 polystyrene beads thus pretreated, the fusion antigen HC-T1 obtained in Reference Example 7 was added in an amount of 0.1%.
0.3, 1, 3, 10, with M carbonate buffer (pH 9.6)
Each prepared at a concentration of 30 μg / ml was 10 m
After stirring, the mixture was degassed under vacuum for 2 hours, and allowed to stand overnight at 4 ° C. for antigen sensitization. After sensitization, phosphate-buffered saline containing 0.1% Tween 20, 10% sheep serum (PBS, pH
Add 7.4 ml of 7.4) and add 3
Treatment with hot water of 7 ° C. for 4 hours, washing with PBS containing 0.1% Tween 20, and then 0.1% Tween 20, 10%
Sheep serum was stored refrigerated in PBS (assay solution) containing 0.01% merthiolate (Tokyo Kasei Co., Ltd.).

Each of the antigen-bound polystyrene beads prepared as described above is placed in a round bottom type serum tube (Sumitomo Bakelite), and PBS containing 0.1% Tween 20 is added.
, And 400 μl of a non-A non-B hepatitis patient serum sample diluted 10-fold with the assay solution was added thereto.
The reaction was performed while shaking for a time. After the reaction, 0.1% Tw
The HRP-labeled goat anti-human IgG antibody (Tago) was washed 3 times with PBS containing een 20 and diluted 15000-fold.
After adding 00 μl, the mixture was reacted by shaking at room temperature for 45 minutes.
After the reaction is completed, add 4% PBS containing 0.1% Tween 20.
Washed times, including peroxidase substrate (0.02% H ₂ O ₂ and 0.15% o-phenylenediamine pH5.5
Sodium citrate buffer), and the reaction was allowed to proceed at room temperature for 30 minutes. The reaction was stopped by adding 1500 μl of 1N sulfuric acid, 200 μl of the reaction was transferred to a microtiter plate, and an automatic colorimeter for microplate (MTP-32) was added. , Manufactured by Corona Co.) was measured at 492 nm. As a result, HC-T1 antigen
Sensitivity is highest when sensitized at a concentration of μg / ml,
In five of the examples, the average value of normal persons + 6S. D. The above absorbance was shown (Table 1).

Example 2 Measurement of Anti-HCV-Related Antibody in Plasma of Non-A Non-B Hepatitis Patients The two antigens HC-T1 and HC-T2 described in Reference Example 7 were prepared at a concentration of 1 μg / ml, and Using polystyrene beads sensitized by the method described in Example 1, the anti-HCV-related antibody in the serum of 21 non-A non-B hepatitis patients was measured. As a result, when HC-T1 was used as the antigen, 21
Among the cases, 16 cases were the average value of normal persons + 3S.13 when HC-T2 was used. D. It was found to exhibit the above absorbance (Table 2).

[0035]

[Table 1] Examination of the amount of antigen sensitization

[0036]

[Table 2] Measurement of anti-HCV-related antibodies in plasma of non-A non-B hepatitis patients

[0037]

[Sequence list] SEQ ID NO: 1 Sequence length: 79 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ser Thr Ile Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg 1 5 10 15 Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly Gly 20 25 30 Val Tyr Leu Leu Pro Cys Arg Gly Pro Arg Leu Gly Val Arg Thr Thr 35 40 45 Arg Lys Thr Ser Glu Arg Ser Gln Pro Cys Gly Arg Arg Gln Pro Ile 50 55 60 Pro Lys Ala Arg Arg Pro Glu Gly Arg Ala Trp Ala Gln Pro Gly 65 70 75.

SEQ ID NO: 2 Sequence length: 79 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ser Thr Ile Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn Arg 1 5 10 15 Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly Gly 20 25 30 Val Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala Thr 35 40 45 Arg Lys Thr Ser Glu Arg Ser Gln Pro Arg Gly Trp Arg Gln Pro Ile 50 55 60 Pro Lys Ala Arg Arg Pro Glu Gly Arg Ala Trp Ala Gln Pro Gly 65 70 75.

SEQ ID NO: 3 Sequence length: 237 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to genomic RNA sequence AGCACGATTC CCAAACCTCA AAGAAAAACC AAACGTAACA CCAACCGCCG CCCACAGGAC 60 GTCAAGTTCC CGGGCGGTGG TCAGATCGTT GGTGGCGC GTGT ACCTGGTCGATCGTGCCTGCGCGTGT ACCTGGTCGA GGTCGCAACC TTGTGGAAGG 180 CGACAACCTA TCCCCAAGGC TCGCCGACCC GAGGGCAGGG CCTGGGCTCA GCCCGGG 237.

SEQ ID NO: 4 Sequence length: 237 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to genomic RNA sequence AGCACGATTC CCAAACCTCA AAGAAAAACC AAACGTAACA CCAACCGCCG CCCACAGGAC 60 GTCAAGTTCC CGGGCGGTGG TCAGATCGTT GGTGGCGTCC GCTCGCGTGCGATCGCGCGGTCGCGCGGTCGGTCGA GGTCGCAACC TCGTGGATGG 180 CGACAACCTA TCCCCAAGGC TCGCCGACCC GAGGGCAGGG CCTGGGCTCA GCCCGGG 237.

SEQ ID NO: 5 Sequence length: 20 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to genomic RNA sequence CCTCCGATGA CACAAGGAGG20.

SEQ ID NO: 6 Sequence length: 34 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to genomic RNA sequence CAAGATCTCG GATGAGCACG ATTCCCAAAC CTCA 3
Four.

SEQ ID NO: 7 Sequence length: 35 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to genomic RNA sequence CTAGATCTTC AGAGGGTATC GATGACCTTA CCCAA 35.

[Brief description of the drawings]

FIG. 1 is a diagram showing the a-type nucleotide sequence and b-type nucleotide sequence of HCV cDNA obtained by the present invention in comparison with the a-type nucleotide sequence. "-" in type b indicates the same base as that of type a.

FIG. 2 is a diagram showing an amino acid sequence predicted from the nucleotide sequence of FIG. 1, where “-” in b-type indicates the same amino acid as that in a-type.

──────────────────────────────────────────────────続 き Continuation of the front page (51) Int.Cl. ⁷ Identification code FI C12P 21/02 C12N 15/00 ZNAA (56) References JP-A-5-148298 (JP, A) JP-A-5-91884 ( JP, A) (58) Fields investigated (Int. Cl. ⁷ , DB name) G01N 33/576 C12N 15/09 GenBank / EMBL (GENET YX)

Claims (5)

(57) [Claims] 1. Amino acid sequence: Ser-Thr-Ile-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-As
n-Thr-Asn-Arg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-
Gly-Gly-Gln-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Cy
s-Arg-Gly-Pro-Arg-Leu-Gly-Val-Arg-Thr-Thr-Arg-Lys-
Thr-Ser-Glu-Arg-Ser-Gln-Pro-Cys-Gly-Arg-Arg-Gln-Pr
o-Ile-Pro-Lys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-
Ala-Gln-Pro-Gly (I) or Ser-Thr-Ile-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-As
n-Thr-Asn-Arg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-
Gly-Gly-Gln-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Ar
g-Arg-Gly-Pro-Arg-Leu-Gly-Val-Arg-Ala-Thr-Arg-Lys-
Thr-Ser-Glu-Arg-Ser-Gln-Pro-Arg-Gly-Trp-Arg-Gln-Pr
o-Ile-Pro-Lys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-
Hepatitis C virus-related antigens including Ala-Gln-Pro-Gly (II). 2. Amino acid sequence: Ser-Thr-Ile-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-As
n-Thr-Asn-Arg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-
Gly-Gly-Gln-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Cy
s-Arg-Gly-Pro-Arg-Leu-Gly-Val-Arg-Thr-Thr-Arg-Lys-
Thr-Ser-Glu-Arg-Ser-Gln-Pro-Cys-Gly-Arg-Arg-Gln-Pr
o-Ile-Pro-Lys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-
Ala-Gln-Pro-Gly (I) or Ser-Thr-Ile-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-As
n-Thr-Asn-Arg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-
Gly-Gly-Gln-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Ar
g-Arg-Gly-Pro-Arg-Leu-Gly-Val-Arg-Ala-Thr-Arg-Lys-
Thr-Ser-Glu-Arg-Ser-Gln-Pro-Arg-Gly-Trp-Arg-Gln-Pr
o-Ile-Pro-Lys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-
An immunochemical assay method comprising detecting or quantifying an antibody against a hepatitis C virus-related antigen by using a protein containing an antigen containing Ala-Gln-Pro-Gly (II). 3. The transformant Escheric coli
hia coli) MM294 (DE3) / pHCa101CF
(FERM BP-3171) or Escheric coli
hia coli) MM294 (DE3) / pHCb101CF
Expression vector pHCa1 carried by (FERM BP-3172)
01CF or pHCb101CF. 4. A transformant, Escheric coli.
hia coli) MM294 (DE3) / pHCa101CF
(FERM BP-3171) or Escheric coli
hia coli) MM294 (DE3) / pHCb101CF
(FERM BP-3172). 5. The amino acid sequence of the capsid protein of hepatitis C virus structural protein: Ser-Thr-Ile-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-As
n-Thr-Asn-Arg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-
Gly-Gly-Gln-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Cy
s-Arg-Gly-Pro-Arg-Leu-Gly-Val-Arg-Thr-Thr-Arg-Lys-
Thr-Ser-Glu-Arg-Ser-Gln-Pro-Cys-Gly-Arg-Arg-Gln-Pr
o-Ile-Pro-Lys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-
Ala-Gln-Pro-Gly (I) or Ser-Thr-Ile-Pro-Lys-Pro-Gln-Arg-Lys-Thr-Lys-Arg-As
n-Thr-Asn-Arg-Arg-Pro-Gln-Asp-Val-Lys-Phe-Pro-Gly-
Gly-Gly-Gln-Ile-Val-Gly-Gly-Val-Tyr-Leu-Leu-Pro-Ar
g-Arg-Gly-Pro-Arg-Leu-Gly-Val-Arg-Ala-Thr-Arg-Lys-
Thr-Ser-Glu-Arg-Ser-Gln-Pro-Arg-Gly-Trp-Arg-Gln-Pr
o-Ile-Pro-Lys-Ala-Arg-Arg-Pro-Glu-Gly-Arg-Ala-Trp-
A fusion protein comprising a polypeptide containing Ala-Gln-Pro-Gly (II) and (2) a T7 phage gene 10 product.