JP3227475B2 - Total nucleotide sequence of Akabane virus S RNA and primer sequences for abnormal production related virus disease gene diagnosis - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for diagnosing Akabane virus and Ainovirus disease in animals such as cows, sheep and goats.

[0002]

2. Description of the Related Art Akabane virus, Kasbah virus, bovine viral diarrhea virus and Ainovirus are known in Japan as viruses that cause abnormal production such as abortion, stillbirth, premature birth and the like in mammals such as cows, sheep and goats. . Among these viruses, Akabane virus and Aino virus belong to the same taxonomic group (Vunyaviridae).

The gene of the virus belonging to the Bunyaviridae family is a single-stranded negative RNA divided into three segments, and L (large) and M (mediu) in descending order of molecular weight.
m) and S (small). Each RNA
Is known to encode the L protein, glycoproteins of G1 and G2, and the N protein. The 8-13 nucleotides at both ends of each segment are well conserved among the same genera. 'The ends are known to be complementary and form a panhandle structure.

Since the properties of Akabane virus and Aino virus are very similar, it is not easy to distinguish Akabane virus infection from Aino virus infection. On the other hand, discriminating between Akabane virus infection and Ainovirus infection is important not only in the treatment of viral diseases but also in predicting the spread of viral diseases.

Conventionally, the distinction between Akabane virus infection and Aino virus infection has been made by serodiagnosis.

However, according to this method, it is necessary to use serum that has not been ingested by colostrum of a calf or the like that has exhibited an abnormality, that cells need to be used for the serum reaction itself, and that it takes more than one week to determine the presence or absence of infection. For example, there is a problem that the operation is complicated and a long time is required for the determination. Therefore, development of a method that can easily and accurately discriminate between Akabane virus infection and Ainovirus infection in animals such as cows, sheep, and goats is desired.

[0007]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for easily and accurately distinguishing Akabane virus infection and Ainovirus infection from animals such as cows, sheep and goats.

[0008]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, have found that
Succeeded in determining the entire nucleotide sequence of the S RNA, and by comparing the nucleotide sequence of this Akabane virus S RNA with the nucleotide sequence of the already known Ainovirus S RNA, the different portions of both nucleotide sequences were determined. Revealed. And
Based on this base sequence difference,
Primers for RT-PCR and nested PCR that can specifically amplify RNA, and R that can specifically amplify inovirus S RNA
The present invention was completed by preparing primers for T-PCR and nested PCR.

That is, the present invention provides the following steps: (a) a step of preparing a sample containing RNA from cells and / or blood of a target animal; and (b) specificity of the sample to Akabane virus S RNA. Performing a step of performing RT-PCR using primers that bind specifically, and (c) determining whether the target animal is infected with Akabane virus based on the presence or absence of the amplified fragment obtained in step (b). A method for determining Akabane virus infection, comprising:

Further, the present invention is the above-mentioned discriminating method, wherein the primer is the following two primers: 5′-TAACTACGCATTGCAATGGC-3 ′ 5′-TAAGCTTAGATCTGGATACC-3 ′. further,
According to the present invention, in the step (b), the RT-PCR product is further subjected to nested PCR using the following two primers: 5′-GAAGGCCAAGATGGTCTTAC-3′5′-GGCATCACAATTGTGGCAGC-3 ′. This is the above-described determination method.

[0011] Further, the present invention provides a method according to the present invention, wherein in the step (c), the amplified fragment obtained in the step (b) is treated with a restriction enzyme, and the restriction fragment length polymorphism determines whether the target animal is infected with the Akabane virus. The above-mentioned determination method is characterized in that it is determined whether or not it is not. Further, the present invention provides the following steps: (a) a step of preparing a sample containing RNA from cells and / or blood of a target animal; (b) specific binding of the sample to inovirus S RNA (C) determining whether the target animal is infected with an inovirus based on the presence or absence of the amplified fragment obtained in step (b). A method for discriminating inovirus infection.

Further, the present invention provides the above-described method, wherein the primer is the following two primers: 5′-CCCAACTCAATTTCGATACC-3 ′ 5′-TTTGGAACACCATACTGGGG-3 ′. further,
According to the present invention, in the step (b), the RT-PCR product is further subjected to nested PCR using the following two primers: 5′-CCATCGTCTCTCAGGATATC-3 ′ 5′-ACAGCATTGAAGGCTGCACG-3 ′. This is the above-described determination method. Further, in the present invention, in the above step (c), the amplified fragment obtained in the step (b) is treated with a restriction enzyme, and whether or not the target animal is infected with an inovirus is determined by the restriction fragment length polymorphism. It is the above-mentioned discrimination method characterized by discriminating.

[0013]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail. 1. The method for determining Akabane virus infection The method for determining Akabane virus infection according to the present invention comprises the following steps: (a) a step of preparing a sample containing RNA from cells and / or blood of a target animal; Whether the subject animal is infected with Akabane virus by RT-PCR using a primer that specifically binds to Akabane virus S RNA, and (c) the presence or absence of the amplified fragment obtained in step (b). Judging whether or not the image data is not included.

Hereinafter, each step will be described. (1) Step (a) In the step (a), RN is obtained from cells and / or blood of a target animal.
This is a step of preparing a sample containing A. The target animal in the step (a) means an animal for which the presence or absence of Akabane virus infection is to be determined. The target animal is not particularly limited as long as it is an animal that can be infected with Akabane virus,
It can be any animal. Examples of such target animals include cows, sheep, goats, mice, hamsters, chicken fetuses, and the like.

The cells and / or blood of the target animal used in step (a) are not particularly limited as long as they are derived from the target animal, and may be cells and / or blood derived from any tissue. As such cells and / or blood, for example, cells and / or blood derived from tissues such as brain, heart, lung, spleen, kidney, and liver can be used. The cells and / or blood of the target animal can be collected from the target animal according to a conventional method. In addition, the blood of the target animal can be collected from blood-sucking insect materials such as mosquitoes and brassicae according to a conventional method.

The sample containing RNA prepared in step (a) means a sample containing RNA derived from cells and / or blood of a target animal. Therefore, the RNA-containing sample may contain any RNA, DNA, protein, etc. as long as it contains Akabane virus genomic RNA. Further, the sample containing RNA may be purified according to a conventional method.

RN from cells and / or blood of a subject animal
Preparation of the sample containing A can be performed according to a conventional method. For example, by crushing cells and / or blood of a target animal, solubilizing with a solubilizing agent, removing the protein with a denaturing agent, and precipitating with ethanol or the like, a sample containing RNA is obtained from the cells of the target animal. Can be prepared.

(2) Step (b) In step (b), Akabane virus S
This is a step of performing RT-PCR using a primer that specifically binds to RNA. The nucleotide sequence of the primer used in step (b) is not particularly limited as long as it specifically binds to Akabane virus S RNA. The nucleotide sequence of such a primer can be determined, for example, based on a portion where the nucleotide sequence differs between the nucleotide sequence of Akabane virus S RNA and the nucleotide sequence of Ainovirus S RNA. here,
FIG. 1 shows the portions where the nucleotide sequences differ between the nucleotide sequences of both virus S RNAs. In FIG. 1, a portion where the nucleotide sequences of both virus S RNAs are the same is represented by “:”, and a different portion is represented by a blank. Therefore, the nucleotide sequence of a primer that specifically binds to Akabane virus S RNA can be determined by appropriately selecting different portions of the nucleotide sequence of both virus S RNAs shown in FIG.

Examples of primers that specifically bind to Akabane virus S RNA include the following two primers: 5'-TAACTACGCATTGCAATGGC-3 '5'-TAAGCTTAGATCTGGATACC-3'.

Of these primers, 5'-TAACTAC
GCATTGCAATGGC −3 ′ is 19 to 3 of Akabane virus S RNA.
Complementary to the eighth base sequence, 5'-TAAGCTTAGATCTG
GATACC-3 'is 721 of the complement of Akabane virus S RNA.
It is complementary to the 740th base sequence. Thus, these primers specifically bind to Akabane virus genomic S RNA. Primers that specifically bind to Akabane virus S RNA can be chemically synthesized, for example, according to a conventional method.

For the above sample, Akabane virus S RN
By performing RT-PCR using a primer that specifically binds to A, if Akabane virus S RNA is contained in the sample, Akabane virus S RNA can be specifically amplified. RT-PCR using a primer that specifically binds to Akabane virus S RNA can be performed according to a conventional method. The conditions for RT-PCR are not particularly limited as long as a primer that specifically binds to Akabane virus S RNA is used.

In step (b), Akabane virus S
It is preferable to further perform nested PCR using a primer that specifically binds to the RT-PCR product on an RT-PCR product obtained by RT-PCR using a primer that specifically binds to RNA. For example, 5 'as a primer for RT-PCR
− TAACTACGCATTGCAATGGC −3 ′ and 5′− TAAGCTTAGATCT
When GGATACC-3 'is used, the following two primers can be used as primers for nested PCR: 5'-GAAGGCCAAGATGGTCTTAC-3'5'-GGCATCACAATTGTGGCAGC-3'.

Of these primers, 5'-GAAGGCC
AAGATGGTCTTAC -3 'is 177 to
Complementary to the base sequence at position 196, 5'-GGCATCACAATT
GTGGCAGC −3 ′ is 38% of the complementary strand of Akabane virus S RNA.
It is complementary to the nucleotide sequence at positions 8 to 407. Thus, these primers specifically bind to the RT-PCR product. RT-P
Primers that specifically bind to the CR product can be chemically synthesized, for example, according to a conventional method.

The RT-PCR product is specifically amplified by performing nested PCR using a primer that specifically binds to the RT-PCR product. This allows
Products derived from regions other than the target region can be removed. Using primers that specifically bind to RT-PCR products
Nested PCR can be performed according to a conventional method. nested
PCR conditions are not particularly limited as long as a primer that specifically binds to the RT-PCR product is used.

(3) Step (c) Step (c) is a step of judging whether or not the target animal is infected with the Akabane virus based on the presence or absence of the amplified fragment obtained in step (b). Confirmation of the presence or absence of the amplified fragment can be performed according to a conventional method. For example, the presence or absence of the amplified fragment can be confirmed by electrophoresis.

As a result of confirming the presence or absence of the amplified fragment, if the amplified fragment is present, it can be determined that there is a high possibility that the target animal is infected with the Akabane virus. For example, 5'-TAACTACGCATTGCAATGGC-3 '
If an amplified fragment is obtained as a result of RT-PCR using 5′-TAAGCTTAGATCTGGATACC-3 ′, it is highly likely that the target animal is infected with Akabane virus or Tinaroo virus. In addition, as a result of confirming the presence or absence of the amplified fragment, if the amplified fragment does not exist, it can be determined that there is a high possibility that the target animal is not infected with the Akabane virus. In particular, if there is no amplified fragment after performing nested PCR, it is highly likely that the target animal is not infected with Akabane virus.

In order to more accurately determine whether or not the target animal is infected with Akabane virus, it is preferable to confirm that the amplified fragment is derived from Akabane virus S RNA. As a method for confirming that the amplified fragment is derived from Akabane virus S RNA, for example, a method of performing restriction fragment length polymorphism analysis obtained by treating the amplified fragment with a restriction enzyme can be mentioned.

The restriction enzyme used at this time is not particularly limited as long as it can cleave the amplified fragment and show a restriction fragment length polymorphism. Such restriction enzymes include, for example,
Restriction enzymes capable of cleaving amplified fragments derived from Akabane virus S RNA (eg, Hph I) and restriction enzymes capable of cleaving amplified fragments derived from Akabane virus S RNA (eg, BstEI)
I etc.) can be used. These restriction enzymes
Although they may be used alone, it is desirable to use two or more kinds in combination.

The restriction fragment length polymorphism obtained by treating the amplified fragment with a restriction enzyme can be detected by, for example, Southern blotting. Based on the restriction fragment length polymorphism obtained by treating the amplified fragment with a restriction enzyme, it can be determined whether or not the amplified fragment is a fragment amplified using the Akabane virus genomic RNA as a template. Therefore, it is possible to determine whether or not the sample contains the Akabane virus genomic RNA based on the restriction fragment length polymorphism, thereby more accurately determining whether or not the target animal is infected with the Akabane virus. be able to.

2. Method for discriminating inovirus infection The method for discriminating inovirus infection of the present invention comprises the following steps: (a) a step of preparing a sample containing RNA from cells and / or blood of a target animal; Performing the RT-PCR using primers that specifically bind to the inovirus S RNA, and (c) determining whether the target animal is infected with the inovirus by the presence or absence of the amplified fragment obtained in the step (b). Judging whether or not the image data is not included.

Hereinafter, each step will be described. (1) Step (a) In step (a), RN is obtained from cells and / or blood of a target animal.
This is a step of preparing a sample containing A. Step (a)
Shows the step (a) of the method for determining Akabane virus infection.
Can be performed in the same manner as described above.

(2) Step (b) In the step (b), the inovirus SRN
This is a step of performing RT-PCR using a primer that specifically binds to A. Step (b) is performed using a primer that specifically binds to inovirus S RNA as a primer.
Except for performing T-PCR, it can be performed in the same manner as in step (b) of the above-described method for determining Akabane virus infection.

The nucleotide sequence of the primer used in step (b) is not particularly limited, as long as it specifically binds to inovirus S RNA. The nucleotide sequence of such a primer can be determined, for example, based on a portion where the nucleotide sequence differs between the nucleotide sequence of Akabane virus S RNA and the nucleotide sequence of Ainovirus S RNA. Both viruses SR
FIG. 1 shows a portion where the nucleotide sequence differs between the nucleotide sequences of NA. Therefore, the nucleotide sequence of a primer that specifically binds to the inovirus S RNA can be determined by appropriately selecting different portions of the nucleotide sequence of both virus S RNAs shown in FIG.

Examples of primers that specifically bind to inovirus S RNA include the following two primers: 5'-CCCAACTCAATTTCGATACC-3'5'-TTTGGAACACCATACTGGGG-3 '.

Of these primers, 5'-CCCAA
CTCAATTTCGATACC -3 'is 132-15 of inovirus S RNA
Complementary to the first nucleotide sequence, 5′-TTTGGAACACCATA
CTGGGG-3 'is the complement of the Ainovirus S RNA 761-780
Complementary to the base sequence. Thus, these primers specifically bind to the Ainovirus S RNA.

In the step (b), RT-PCR using primers that specifically bind to inovirus S RNA
It is preferable to further perform nested PCR using a primer that specifically binds to the RT-PCR product obtained by the above. For example, as a primer for RT-PCR
5'-CCCAACTCAATTTCGATACC -3 'and 5'-TTTGGAACACCA
When TACTGGGG-3 'is used, the following two primers can be used as primers for nested PCR: 5'-CCATCGTCTCTCAGGATATC-3'5'-ACAGCATTGAAGGCTGCACG-3'.

Of these primers, 5'-CCATCGT
CTCTCAGGATATC -3 'is 313-332 of inovirus S RNA
5'-ACAGCATTGAAGGCT
GCACG-3 'is complementary to the nucleotide sequence at positions 638 to 657 of the complementary strand of inovirus S RNA. Thus, these primers specifically bind to the RT-PCR product.

(3) Step (c) Step (c) is a step of judging whether or not the target animal is infected with an inovirus based on the presence or absence of the amplified fragment obtained in step (b). Step (c) can be performed in the same manner as in step (c) of the above-described method for determining Akabane virus infection. As a result of confirming the presence or absence of the amplified fragment, if the amplified fragment is present, it can be determined that there is a high possibility that the target animal is infected with the Ainovirus. For example,
5'-CCCAACTCAATTTCGATACC-3 'as a primer and
When RT-PCR using 5′-TTTGGAACACCATACTGGGG-3 ′ is performed and an amplified fragment is obtained, there is a high possibility that the target animal is infected with an inovirus or a Peaton virus.

In addition, as a result of confirming the presence or absence of the amplified fragment, if the amplified fragment does not exist, it can be determined that there is a high possibility that the target animal is not infected with the inovirus. In particular, if there is no amplified fragment after performing nested PCR, it is highly likely that the target animal has not been infected with the Ainovirus. In step (c), it is preferable to confirm that the amplified fragment is derived from the inovirus S RNA in order to more accurately determine whether or not the target animal is infected with the inovirus.

As a method for confirming that the amplified fragment is derived from the Ainovirus S RNA, for example, there is a method of analyzing a restriction fragment length polymorphism obtained by treating the amplified fragment with a restriction enzyme. The restriction enzyme used at this time is not particularly limited as long as it can cleave the amplified fragment and show a restriction fragment length polymorphism. As such a restriction enzyme, for example, a restriction enzyme (for example, Ava II, Eco RI, Hae II, or the like) that can cleave an amplified fragment derived from inovirus S RNA can be used.

[0041]

Now, the present invention will be described in further detail with reference to specific examples. [Example 1] Determination of total nucleotide sequence of Akabane virus S RNA (1) Extraction of Akabane virus S RNA Purified Akabane virus OBE-1 strain grown in HmLu-1 cells by sucrose density gradient centrifugation did. After SDS was added to the purified Akabane virus OBE-1 strain, RNA was extracted by phenol extraction, and the RNA was recovered by ethanol precipitation.

The RNA was separated on a 1% agarose gel containing 10 mM methylmercury hydroxide. After staining with ethidium bromide, a band containing S RNA was cut out, dissolved and extracted with phenol. The RNA was then ethanol precipitated. Thus, Akabane virus S RNA
was gotten.

(2) Determination of base sequence of Akabane virus S RNA A poly A chain was added to the 3 'end of 5 µg of the purified S RNA obtained in the above (1).

The addition of the poly A chain is carried out by the method of Sippel (Sippel, AE European Journal of Biochemistry 3) using ATP and polyadenylic acid (poly A) polymerase.
7.31-40 (1973)). Poly A chain added
S RNA is purified by Sephadex G-50 column and oligo (dT)
Was used to synthesize a double-stranded cDNA using a cDNA synthesis kit (Amersham).

[0045] Deoxycytidylic acid was added to the 3 'end of the synthesized double-stranded cDNA using terminal deoxynucleotidyl transferase, digested with PstI, and pBR322 (Bethesda Res.
earch Laboratories). After transforming MC1061 cells with this plasmid, clones containing the plasmid containing the viral RNA were recovered and screened by hybridization using a cDNA probe (Bishop, dHL et al., Nucleic
Acids Research 10. 3703-3713 (1982)). The nucleotide sequence of the largest clone (789 nucleotides in length) was determined by the Maxam-Gilbert method.

Since the cDNA whose nucleotide sequence was determined as described above was not full-length, the nucleotide sequence at the 5 'end was estimated based on the S RNA nucleotide sequences of other homologous viruses already reported, and the synthesized primers were synthesized. The remaining nucleotide sequence was determined by RT-PCR using PCR. That is, it is known that a virus belonging to the Bunyaviridae has a complementary terminal sequence (mismatch (U and G) at position 9) (Elliott, RM Journal of General Virology 71.501-).
522 (1990); Elliott, RM et al. Current Topics in Micr
obiology and Immunology 169. 91-141 (1991)). In addition, according to data on the Ainovirus S RNA, the sequences of about 25 residues at the 3 ′ end and the 5 ′ end are similar (however,
There is one mismatch at position 9 and the genomic sense RNA
It is clear that one nucleotide has been added to position 10 from the 5 'end (Akashi, H. et al. Virus Re
search 1.51-63 (1984)).

Therefore, two types of reverse primers were synthesized. That is, a primer AKSRS: 5'-AGTAGTGTGCTCCAC-3 'was synthesized as the Bunya virus common type, and a primer AKSRL: 5'-AGTAGTGTGGCTCCAC-3' was synthesized as the Aino virus type. Amplification of the 5 'end of Akabane virus S RNA by RT-PCR was performed using the forward primer AKSF19: TAACTACGCATTGCAATG.
GC-3 'and the above two reverse primers (AKSRS and AK
SRL). This forward primer corresponds to residues 19-38 of Akabane virus S RNA.

RT-PCR was performed using GeneAmp thermostable rTth reverse transcriptase RNA PCR kit (Perkin-Elmer Cetus) in a final volume of 100 μl for 30 seconds at 94 ° C., 30 seconds at 55 ° C.
One minute was defined as one cycle at 72 ° C., and this cycle was performed 25 times.
RT-PC when AKSRS is used as reverse primer
The amount of R product was more than 4 times that when AKSRL was used as the reverse primer (data not shown). This RT-
From the results of PCR, it was concluded that the 5 'terminal sequence of Akabane virus S RNA was "... CACCUCGUGUGAUGA".

Therefore, RT-PCs obtained using AKSF19 and AKSRS as forward and reverse primers
The R product was cloned directly into the plasmid vector pCRII using a TA cloning kit (Invitrogen) and a 373S DNA sequencer (Applied Biosyst
ems) was used to determine its nucleotide sequence. The nucleotide sequence of the determined cDNA is shown in SEQ ID NO: 1. In addition, the base sequence of SEQ ID NO: 1 is described by the base sequence of positive strand cDNA.

Example 2 Preparation of Primers S RNA of Akabane Virus OBE-1 Strain Determined in Example 1
Nucleotide sequence and the already known nucleotide sequence of S RNA of the inovirus JaNAr28 strain (Akashi, H. et al. Virus Research 1.51
-63 (1984)), and the portion of low homology between the two was compared with a computer program (GENETYX program (Softw
are Development Co.)). Based on this result, primers were used for Oligo 1000 DNA Synthesizer (Be
ckman). The base sequences of the synthesized primers and the corresponding positions in the viral S RNA are shown in Table 1 below.

[0051]

[Table 1]

[Example 3] Virus S by RT-PCR and nested PCR using virus S RNA-specific primers
Detection of RNA (1) RNA extraction OBE-1 strain was used as Akabane virus and JaNAr28 strain was used as Ainovirus.

In order to confirm the specificity of the primers, five kinds of viruses belonging to the same virus group (Simbu serogroup virus) as Akabane virus and Aino virus, namely, CS of Douglas (DOU) virus
IRO150 strain (Division of Animal Health, Australia),
Peaton (PEA) virus strain CSIRO110 (Division of Anima
l Health, Australia), Tinaroo (TIN) virus CSIRO
153 strains (Division of Animal Health, Australia), Fac
Ch16129 strain of ey's Paddock (FP) virus (Berrimah Agri
cultural Research Center, Northern Territory, Aust
ralia) and the CSIRO1 strain of the Thimiri (THI) virus (Berri
mah Agricultural Research Center, Northern Territo
ry, Australia) was used as a control. From 5 × 10 ⁶ PFU of each virus-infected culture, RNA STAT-50LS (TEL-TEST
) And SepaGene (Sanko Junyaku) to extract RNA of each virus.

(2) Detection of virus S RNA by RT-PCR and nested PCR The RNAs of the above seven viruses were subjected to RT-PCR using the RT-PCR primers. RT-PCR
This was performed using an Amp RNA PCR kit (Perkin-Elmer Cetus). RT-PCR was performed under the following conditions.

That is, 1 μl of each virus RNA was mixed in a total volume of 19 μl of 1 × PCR buffer containing random hexamer, RNase inhibitor, MgCl ₂ , four kinds of deoxynucleotides and reverse transcriptase, and incubated at room temperature for 10 minutes.
Incubation was performed at 2 ° C for 15 minutes, 99 ° C for 5 minutes, and 5 ° C for 5 minutes. Add buffer, MgCl ₂ and TaqDNA
Add polymerase to a final volume of 100 μl, and add RT-P
Using primers for CR, 30 seconds at 94 ° C, 30 seconds at 55 ° C and
One-half cycle was performed at 72 ° C. for 25 cycles.

After keeping the RT-PCR reaction solution at 72 ° C. for further 7 minutes, the PCR product was purified by Magic PCR Preps (Promega) and used as template DNA for nested PCR. Nested PCR is performed by Taq DNA polymerase (Amersham)
And the same method as described above. PCR obtained
The product was electrophoresed in a 2% agarose gel and stained with ethidium bromide. Digestion with restriction enzymes was performed according to the conditions specified by the manufacturer.

FIG. 2 shows the results of the electrophoresis. Note that FIG.
In the middle, lane M is a molecular weight marker, lanes 1 and 9 are RNAs derived from inovirus, lanes 2 and 10 are RNAs derived from Akabane virus, lanes 3 and 11 are RNAs derived from DOU virus, and lanes 4 and 12 are RNAs derived from FP virus. RN
A, lanes 5 and 13 are RNAs derived from PEA virus, lanes 6 and 14 are RNAs derived from THI virus, lanes 7 and 1
5 represents RNA derived from TIN virus, and lanes 8 and 16 represent culture supernatant. “RT” at the top of FIG. 2 represents the result of RT-PCR, and “nested” represents the result of nested PCR. Also,
A in FIG. 2 shows the results when the inovirus S RNA-specific primer was used, and B shows the Akabane virus S RN.
The result when the A-specific primer was used is shown.

As shown in FIG. 2, Akabane virus S RN
As a result of RT-PCR and nested PCR using A-specific primers, Akabane virus RNA and TIN virus RNA
The amplification product was detected when was used. Therefore, to identify the RT-PCR products of both viruses, the SRN
Based on the nucleotide sequence of A, restriction enzymes (Hph I and Bst EI
I) selected.

The RT-PCR product of Akabane virus was Hph I
The TIN virus RT-PCR product was digested only by Bst EII. As a result, RT-PCR products of both viruses were identified. RT-PCR using inovirus S RNA-specific primers and neste
As a result of dPCR, RT-PCR products and nested PCR products were detected in both inovirus and PEA virus.

Therefore, in order to identify nested PCR products of both viruses, three types of restriction enzymes (Ava II, Eco RI, and
Hae II) was selected. The nested PCR products of PEA virus were not digested by restriction enzymes (Ava II, Eco RI, and Hae II), whereas the nested PCR products of Ainovirus were digested by restriction enzymes (Ava II, Eco RI, and Hae II). Digested. This identified the nested PCR products of both viruses. As described above, by combining RT-PCR and nested PCR with viral S RNA-specific primers and restriction fragment length polymorphism, Akabane virus S RNA and Ainovirus S RNA can be detected with high sensitivity, and both can be easily detected. It was shown that it could be identified.

Example 4 Application to Mice To aim for field application, Akabane virus and Aino virus were inoculated into the brain and intraperitoneal cavity of 6-week-old mice.
At this time, 0.1 ml of each virus solution (10 ^5.5 TCID ₅₀ / m
l) and 0.2 ml of the virus solution was inoculated intraperitoneally.
Five days after inoculation, mice were euthanized and their organs (brain, heart,
Lung, spleen, kidney, liver) and blood were collected.

In order to detect the virus in these organs and blood, virus titer was measured, virus RNA was extracted, and RT-PCR and nested PCR using virus S RNA-specific primers were performed. The extraction of RNA from each organ and blood sample was performed using RNAzolB (TEL-T
EST). The results are shown in Table 2 below.

[0063]

[Table 2]

As shown in Table 2, according to the virus titration, both Akabane virus and Aino virus were detected only from the brain samples of mice inoculated into the brain. On the other hand, according to nested PCR, genomic SRNA of each virus could be detected from many other organs. This demonstrated the high sensitivity of virus S RNA detection by nested PCR using virus S RNA specific primers.

[0065]

According to the present invention, there is provided a method for easily and accurately discriminating Akabane virus infection and Ainovirus infection in animals such as cows, sheep and goats.
ADVANTAGE OF THE INVENTION According to this invention, the epidemic prediction and diagnosis of Akabane virus and Ainovirus infection, which had been difficult to predict and diagnose in the past, can be performed easily and with high accuracy, thereby coping with the virus infection early (vaccine vaccination). Etc.)

[0066]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 858 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin Organism name: Akabane virus OBE-1 strain Sequence AGTAGTGAAC TCCACTATTA ACTACGCATT GCAATGGCAA ATCAATTCAT TTTCAACGAT 60 GTTCCACAAC GGAATGCAGC TACATTTAAT CCGGATGCAG GGTATGTGGC ATTTATCAGT 120 AAGTATGGGC AGCAGCTCAA CTTTACTGTT GCTAGAGTCT TCTTCCTCAA CCAGAAGAAG 180 GCCAAGATGG TCTTACATAA GACGCCACAA CCAAGTGTCG ATCTTACTTT TGCAGGGGTC 240 AAATTTACAG TGGTTAATAA CCATTTTCCC CAGTACACTG CAAATCCAGT GTCAGACACT 300 GCCTTTACGC TTCACCGCAT CTCGGGCTAC TTAGCTCGCT GGGTTGCTGA GCAGTGCAAG 360 GCTAATCAGA TCAAATTTGC AGAGGCAGCT GCCACAATTG TGATGCCACT GGCTGAGGTG 420 AAGGGTTGCA CTTGGAGTGA CGGGTATGCA ATGTACCTGG GATTTGCCCC TGGTGCTGAG 480 ATGTTTCTGG AAACCTTTGA GTTTTACCCA CTGGTTATCG ACATGCACCG TGTGATAAAG 540 GATGGAATGG ATGTCAACTT CATGAGGAAG GTCTTACGTC AGAGGTATGG GCAGCTGACT 600 GCAGAAGAGT GGATGACATC TAAGTTGGAC GCAGTCAAGG CTGCATTTGG CTCAGTTCTC TGCAGCATATCTC CA CCTGCAGCTA GAGCTTTCCT GGCTCAATTT 720 GGTATCCAGA TCTAAGCTTA ACTGATTCTC CAGTTTTTTC TTTTTTCTCT TCCTAAGTGC 780 ACCATGTCTA TGTGGTGCAC ACCTTTGTTC AGCTGCTTGG ATTTTATTGT TTATAGTTAA 840 TTAGTGGAGC ACACTACT 858

[Brief description of the drawings]

FIG. 1 is a diagram comparing the nucleotide sequence of Akabane virus S RNA with the nucleotide sequence of Ainovirus S RNA.

FIG. 2 is a photograph showing the results of electrophoresis of an RT-PCR product and a nested PCR product.

Continued on the front page (56) References Protein Nucleic Acid Enzyme, Vol. 41 [5] (1996) p. 696-699 Virus Res. , Vol. 50 [2] (1997) p. 205-213J. Vet. Med. Sci. , Vol. 59 [9] (1997) p. 837-840 Res. Virol. , Vol. 146 [5] (1995) p. 355-362 Clinical and Microbial Studies, Vol. 24 [5] (1997) p. 557-565 Virus Research, Vol. 1 (1984) p. 51-63 (58) Fields surveyed (Int. Cl. ⁷ , DB name) C12N 15/40-15/50 C12Q 1/68 BIOSIS (DIALOG) GenBank / EMBL / DDBJ / PIR / SwissProt / Geneseq JICST file (JOIS) MEDLINE (STN) WPI (DIALOG)

Claims (6)

(57) [Claims] 1. The following steps: (a) a step of preparing a sample containing RNA from cells and / or blood of a target animal; and (b) the following primer for the sample : 5′-TAACTACGCATTGCAATGGC-3 Based on the step of performing RT-PCR using ' 5'-TAAGCTTAGATCTGGATACC-3' and (c) the presence or absence of the amplified fragment obtained in step (b), it is determined whether or not the target animal is infected with Akabane virus. A method for determining Akabane virus infection, comprising the steps of: 2. In the step (b), the RT-PCR product is further subjected to nested PCR using the following primers: 5'-GAAGGCCAAGATGGTCTTAC- 3'5'-GGCATCACAATTGTGGCAGC-3 '. Request
Item 1. The determination method according to Item 1 . 3. In the step (c), the amplified fragment obtained in the step (b) is treated with a restriction enzyme, and whether the target animal is infected with the Akabane virus is determined based on the restriction fragment length polymorphism. The method according to claim 1, wherein the determination is performed. 4. The following steps: (a) a step of preparing a sample containing RNA from cells and / or blood of a target animal; and (b) a primer with the following primer: 5'-CCCAACTCAATTTCGATACC-3 Based on the step of performing RT-PCR using ' 5'-TTTGGAACACCATACTGGGG-3' and (c) the presence or absence of the amplified fragment obtained in step (b), it is determined whether or not the target animal is infected with an inovirus. A method for determining inovirus infection, comprising the steps of: 5. wherein in the step (b), with respect to RT-PCR products, the following primers: and characterized by further performing nested PCR using 5'- CCATCGTCTCTCAGGATATC -3 '5'- ACAGCATTGAAGGCTGCACG -3' Request
Item 4. The determination method according to Item 4 . 6. in the step (c), to process the amplified fragments obtained in step (b) with a restriction enzyme, by its restriction fragment length polymorphism, determines whether the target animal is infected with Aino virus The method according to claim 4, wherein the determination is performed.