JP3030349B2 - Insect-derived cellulase gene - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a cellulase produced by an insect and acting to digest cellulose in the body, a gene thereof, and a method for producing the cellulase.

[0002]

2. Description of the Related Art Insects eating cellulose such as wood have a cellulose digestive enzyme (cellulase) in their bodies, and digest cellulose as an energy source. It is thought that these cellulases are produced by microorganisms symbiotic in the digestive tract, suggesting that insects themselves make cellulases, but the cellulase gene has not been removed from animals. On the other hand, cellulase genes have been extracted from bacteria and filamentous fungi, but have a high molecular weight and are known to be composed of an adsorption domain and a domain connecting them in addition to the active domain. To date, very few cellulases have been isolated from insects, and their physicochemical properties are also high in the wandering cockroach ( Panethia cribrata ).
Has only been investigated for endo-β-1,4-glucanase and the like, but the gene is not known at all.

[0003]

SUMMARY OF THE INVENTION It is an object of the present invention to establish a method for purifying cellulase from insects, clarify its enzymatic characteristics, further extract the gene, and use the gene for genetic engineering. An object of the present invention is to provide a method for producing the enzyme by a technique.

[0004]

That is, the present invention resides in an insect cellulase having the following enzymatic chemical properties. Substrate specificity: Degrades cellulose made in the salivary glands or intestine of insects and taken up as food. Molecular weight: 40,000-50,000 Thermal stability: 6060 ° C. Optimum pH: 5.0-6.0 Specific activity for carboxymethyl cellulose: 70-1300
Unit / mg The above insects include the Japanese termite ( Reticulitermes spe
r atus) or Takasago termites (Nasutiterm es takasago
ensis ).

Further, the present invention provides the following (a) or (b)
In a recombinant protein having cellulase activity. (A) a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2; (B) a protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence (a), and having a cellulase enzyme activity;

Further, the present invention provides the following (a) or (b)
Encoding a protein having cellulase activity
A. (A) a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2; (B) a protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence (a), and having a cellulase enzyme activity; And as said DNA, what is represented by sequence number 1 or 2 is mentioned, for example.

[0007] Further, the present invention is a recombinant vector containing the above DNA. Furthermore, the present invention is a transformant transformed by the above-mentioned recombinant vector. Further, the present invention is a method for producing a recombinant protein, comprising culturing the above transformant in a medium and collecting the recombinant protein having cellulase activity according to claim 3 from the resulting culture. .

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail. 1) Separation / Purification of Insect Cellulase Protein Various methods commonly used for separation and purification of proteins can be applied to the separation of enzyme proteins from insects.
In the present invention, termites are ground and the acetone-precipitated fraction can be purified to a single peak using chromatography. For example, almost pure cellulase can be obtained by performing gel filtration and hydroxyapatite adsorption chromatography. The enzymatic properties of this cellulase can be investigated using the purified enzyme by the activity measurement method described later. Then, the optimum pH, the optimum temperature, the temperature resistance, the substrate characteristics and the like are examined. The insects targeted in the present invention are the lower termite, the termite Yamato termite, and the higher termite, the Takasago termite.

2) Cloning of insect cellulase gene In cloning of insect cellulase gene, cellulase (endo-β-1,4-glucanase) is efficiently purified from insects by chromatography or the like, and its antibody is prepared. This can be achieved by searching for the cDNA incorporated into the phage or by decoding the N-terminal amino acid sequence by the Edman method, obtaining the cDNA by the PCR method, and then incorporating the cDNA into a plasmid to prepare a transformant.

[0010] Various molecular biology techniques can be applied to the method for determining the gene (cDNA) base sequence of the enzyme protein. For example, the purified enzyme is subjected to electrophoresis, transferred to a nylon membrane or the like, and the membrane is applied to a protein sequencer to determine the N-terminal amino acid sequence of the enzyme. And, from the amino acid sequence,
R primers, and using mRNA as template
A plurality of PCR fragments containing the 5 ′ end and 3 ′ end of A are obtained, and a known plasmid (for example, pB
luescript II, pUC18, etc.)
Use a sequencer (eg, ABI 373A, 373S)
The full-length nucleotide sequence of DNA can be determined.

[0011] The cellulase gene thus determined and the amino acid sequence encoded by this gene are shown in SEQ ID NOs: 1 and 2, provided that the gene of the present invention essentially expresses cellulase and has a cellulolytic activity. ,
Further, as long as the protein of the present invention has cellulase activity, it means that mutations such as deletion, substitution, and insertion may occur in the amino acid sequence contained in the protein or the base sequence of the gene.

Therefore, for example, those in which the first methionine (Met) contained in the amino acid sequences represented by SEQ ID NOs: 1 and 2 are deleted are also included in the protein resulting from the change in the amino acid sequence. In addition to the nucleotide sequence encoding the amino acid contained in the protein of the present invention, the gene of the present invention also includes degenerate isomers encoding the same polypeptide that differs only in degenerate codons.

The above mutation can be easily introduced by using a known mutagenesis kit (eg, manufactured by Takara). Further, once the base sequence is determined, the gene of the present invention can be obtained by chemical synthesis, PCR, or hybridization using a DNA fragment having the base sequence as a probe. On the other hand, vectors for retaining the gene DNA fragments are known plasmid vectors (for example, Stratagene).
PBluescript II, pUC18, etc.) can be used.

3) Preparation of Transformant The transformant of the present invention comprises the recombinant vector of the present invention,
Obtained by introduction into a suitable host. The host is not particularly limited as long as it can express the gene of interest. For example, Escherichia coli,
Bacillus subtilis and other bacteria such as Saccharomyces cere
visiae ), insect cells such as SF9 and SF21, C
Animal cells such as OS cells and CHO cells are exemplified.

When a bacterium such as Escherichia coli is used as a host, the recombinant DNA of the present invention must be capable of autonomous replication in the host and contain a promoter, the DNA of the present invention, and a transcription termination sequence. Is preferred. Examples of expression vectors include pET3, pET11 (Stratagene), pM
AL (New England Biolabs) and the like. Any promoter can be used as long as it can be expressed in a host such as Escherichia coli. For example, T ₇ promoter,
trp promoter, lac promoter, P _L promoter, promoters derived from Escherichia coli or phage, etc., such as P _R promoter. Recombinant D for bacteria
Examples of the method for introducing NA include a method using calcium ions, and an electroporation method.

When yeast is used as a host, examples of expression vectors include pYEUra3, YEp13, and YCp50. Examples of the promoter include a gal 1 promoter and a gal 10 promoter. Examples of a method for introducing a recombinant vector into yeast include an electroporation method, a spheroplast method, and a lithium acetate method.

When an insect cell is used as a host, pBacPAK8 (Clontec), pBlueB
ac (manufactured by Invitrogen) or the like is used. Examples of a method for introducing the recombinant vector into insect cells include an electroporation method and a lipofection method. When an animal cell is used as a host, pMAM (manufactured by Clontec), pcDNA (Invitrogen)
And the like are used. Examples of a method for introducing a recombinant vector into animal cells include an electroporation method and a calcium phosphate method.

4) Purification of Insect Cellulase Gene-Expressed Protein The protein of the present invention is obtained by culturing the transformant of the present invention in a medium, producing and accumulating the polypeptide of the present invention in the culture and in the transformant. The polypeptide can be produced by collecting the polypeptide from the culture and the transformant. The method for culturing the transformant of the present invention in a medium is performed according to a usual method used for culturing a host.

A culture medium for culturing a transformant obtained by using a microorganism such as Escherichia coli or yeast as a host contains a carbon source, a nitrogen source, inorganic salts, and the like which can be utilized by the microorganism. If the medium can be performed efficiently, natural medium,
Any of the synthetic media may be used.

The culture is usually performed at 25 to 37 ° C. under aerobic conditions such as shaking culture. During the culture, an antibiotic such as ampicillin or tetracycline may be added to the medium. When culturing a microorganism transformed with an expression vector using an inducible promoter, an inducer can be added to the medium. For example, isopropyl-β-D-thiogalactopyranoside (IPTG), indoleacrylic acid
(IAA) can be added to the medium.

As a medium for culturing the transformant obtained using insect cells as a host, Grace's medium or a medium obtained by adding fetal bovine serum to this medium is used. As a medium for culturing the transformant obtained using animal cells as a host,
For example, RPMI-1640, DMEM medium or a medium obtained by adding fetal bovine serum to these mediums is used. During culture, antibiotics such as kanamycin and penicillin may be added to the medium.

The purification of the protein of the present invention can be carried out in the same manner as the separation and purification from insects. For example, a clone such as Escherichia coli having the gene of the present invention is subjected to shaking culture in an LB medium containing an antibiotic such as ampicillin. The obtained culture is centrifuged to collect the cells, the cells are crushed with a sonicator, and then purified by gel filtration or the like alone or in an appropriate combination. Confirmation that the obtained purified substance is the target protein can be carried out by a usual method, for example, SDS polyacrylamide gel electrophoresis, Western blotting, or the like, or by measurement of cellulase activity.

[0023]

[Example 1]

1) Preparation of cellulase of Takasago termite and measurement of its activity The gastrointestinal tract and salivary glands are dissected out of about 20 termites, and the digestive tract is divided into foregut, midgut, hindgut, etc.
Microliter of buffer (0.1 M sodium acetate, pH 5.
Triturated in 5) and centrifuged at about 20,000 g for 20 minutes. The supernatant was diluted with 600 microliters of a buffer to obtain an enzyme solution. The activity of endo-β-1,4-glucanase was determined by adding 25 microliters of an enzyme solution to 200 microliters of 2.0% sodium carboxymethylcellulose (CMC) (dissolved in a buffer) and incubating at 37 ° C. for 30 minutes. Color development was measured with tetrazolium blue (Sigma). The amount of protein at that time uses the absorption of ultraviolet light at 280 and 260 nm, and creates a standard line using fetal calf serum.
Determined from the standard line. As a result, a site having a high activity can be known, and it becomes a reference for the next purification operation.

2) Separation and purification of enzyme by column chromatography About 15 g of termites were ground with 150 ml of distilled water,
The supernatant was collected by centrifugation at 24,000 g for 30 minutes. The precipitate at 35-70% concentration by adding ammonium sulfate was collected by centrifugation. The precipitate was dissolved in 30 ml of 0.3 M ammonium acetate buffer (pH 5.0) and subjected to column chromatography. The sample was concentrated using an ultrafiltration membrane (Amicon models 8010, 8050, etc.).

The sample was placed on a column (26 × 900 mm) packed with Sephacryl S-200HR (Pharmacia), and a 0.3 M ammonium acetate buffer solution was flowed (1.0 ml per minute). Active fractions were concentrated and then HiLoad 16/6
Purified on a Superdex-75 (Pharmacia) column (0.6 ml per minute). Furthermore, similarly, hydroxyapa
Using a column (10 × 50 mm) of tite (Bio-Rad), the active fraction was recovered by flowing the gradient from 20 mM to 1 M phosphate buffer (pH 5.5) with a gradient (0.2 ml per minute).
Repeating purification on the hydroxyapatite column again could further increase the purity. The purified enzyme was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) to confirm that it was well purified.

3) Investigation of Enzyme Chemical Properties of the Enzyme To examine the optimum temperature using the purified enzyme, put the enzyme in a 2% CMC solution dissolved in a sodium acetate buffer or the like, and add the enzyme at 20 ° C. After holding each sample for 5 minutes at 5 ° C intervals from 5 to 70 ° C, the color was developed with tetrazolium at 37 ° C for 5 minutes, and the activity was measured. The optimum pH is p
The buffer used was changed according to the H range, and the activity was measured at 37 ° C. in the same manner.

The substrate specificity of the enzyme (cellopentaose, cellopenta
To investigate tetraose, cellotriose, cellobiose), 10 microliters of enzyme solution was added to 10 microliters of a 60 mM substrate solution and incubated at 37 ° C. The degradation products are developed by thin layer chromatography (TLC),
Color formers (aniline, diphenylamine, acetone, H
₃ PO ₄ ) was sprayed and heated to detect. As a result, this enzyme was found to degrade cellopentaose and cellotetraose better.

The specific activity of this enzyme was measured using carboxymethylcellulose as a substrate, and was found to be 70 to 1300 units / mg (unit: amount of enzyme that produces 1 micromol of reducing sugar equivalent to glucose per minute). . The molecular weight was estimated from the electrophoretic mobility of polyacrylamide gel (SDS-PAGE). The enzymatic chemical properties of the cellulase (endo-β-1,4-glucanase) of Yamato termite and Takasago termite are as shown in Table 1.

[0029]

[Table 1]

Example 2 Cloning of Gene and Analysis of Base Sequence (Example of Cellulase of Takasago Termite) The purified enzyme was electrophoresed by polyacrylamide gel electrophoresis and blotted on a PVDF membrane (TransBlott SD, Bi).
o-Rad), stained with Coomassie Blue, dried, cut out the stained part, and used an amino acid sequencer (LF-3
000, Beckman) was used to examine the N-terminal amino acid sequence of the enzyme protein. Decoded amino acid sequence (about 30 amino acids)
A PCR primer pair (condensation primer) capable of amplifying only the primer was prepared.

To perform RT-PCR, termite messenger RNA was extracted from the midgut using an mRNA extraction kit (Pharmacia Bioteck). Using reverse transcriptase, cDNA was synthesized with oligo dT primers (42
This reaction was used for PCR. PCR
Were performed at 94 ° C. for 30 seconds, 51 ° C. for 1 minute, and 72 ° C. for 2 minutes for 30 cycles. After confirming the PCR product by agarose gel electrophoresis,
It was connected to a vector (pBluescript II) and cloned using E. coli. The base sequence of the vector insert was decoded, and first, a part of the base sequence at the N-terminus (several tens of bases between the two primers) was revealed. Further, based on this nucleotide sequence, primers for amplifying the 5 'and 3' sides from that portion of the cDNA were prepared, and the Marathon cDNA Amplification Kit (CLONTEC
H) was used to obtain two types of PCR products. This PCR
The products were each cloned into plasmids, and the base sequence of each was decoded.

With respect to the obtained nucleotide sequence and deduced amino acid sequence, Yamato termite (YEG2)
And the termites are shown in SEQ ID NO: 2, respectively. Homologous ones were searched out of the database using the Internet from these nucleotide sequences and deduced amino acid sequences.

[Example 3] Preparation of transformant and expression of cellulase gene DNA obtained by removing the portion corresponding to the signal peptide from the protein-encoding portion of the obtained cDNA.
Portions were amplified by PCR. This DNA is called pBluescr
It was ligated to the multiple cloning site of ipt II so that the reading frame for translation into the protein fit. This plasmid was put into Escherichia coli, and the Escherichia coli was cultured in an LB medium supplemented with IPTG to express the cellulase gene.

The fact that the protein produced in E. coli has cellulase activity was confirmed by observing the activity of the protein electrophoresed on an acrylamide gel. That is, Escherichia coli is cultured at 37 ° C. to OD 660 = 1.0 (about 5 hours), the cells are digested in a buffer containing lysozyme, and the obtained protein is electrophoresed on a polyacrylamide gel containing CMC (carboxymethylcellulose). And stained with Congo Red. In the portion where the target protein was migrated, the CMC was decomposed by the cellulase activity, so that the portion was stained thinner than the surroundings.

[0035]

Industrial Applicability According to the present invention, a novel insect-derived cellulase and its gene have been provided. Using this gene, insect-derived cellulase can be produced in large quantities by genetic engineering techniques. In addition, the cellulase according to the present invention alone or in combination with a known cellulase enables more efficient degradation of cellulose.

[0036]

[Sequence list]

SEQ ID NO: 1 Sequence length: 1495 Sequence form: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Biological name: Reticuli termi
s speratus ) Sequence characteristics Symbol indicating characteristics: sig peptide Location of occurrence: 16. . 63 Method for determining feature: E Symbol representing feature: peptide Location: 64. . 1353 Method of Characterization: E Sequence CCACTACCAG CCACC ATG AAG GTC TTC GTT TGT CTT CTG TCT GCA CTC GCG 51 Met Lys Val Phe Val Cys Leu Leu Ser Ala Leu Ala -15 -10 -5 CTT TGC CAA GCT GCT TAC GAC TAT AAG ACA GTA CTA AGC AAT TCG CTA 99 Leu Cys Gln Ala Ala Tyr Asp Tyr Lys Thr Val Leu Ser Asn Ser Leu 1 5 10 CTT TTC TAC GAG GCT CAG CGA TCG GGA AAA TTG CCG TCT GAT CAG AAG 147 Leu Phe Tyr Glu Ala Gln Arg Ser Gly Lys Leu Pro Ser Asp Gln Lys 15 20 25 GTC ACG TGG AGG ATT CCG CCC TTA ACG ACA AGG GCC AGA AGG CGA GGA 195 Val Thr Trp Arg Ile Pro Pro Leu Thr Thr Arg Ala Arg Arg Arg Gly 30 35 40 CTG ACA GGA GGA TAC TAT GAC GCT GGT GAT TTT GTG AAG TTC GGC TCC 243 Leu Thr Gly Gly Tyr Tyr Asp Ala Gly Asp Phe Val Lys Phe Gly Ser 45 50 55 60 CCT ATG GCG TAC ACA GTC ACC GTC CTG GCT TGG GGT GTT ATA GAC TAC 291 Pro Met Ala Tyr Thr Val Thr Val Leu Ala Trp Gly Val Ile Asp Tyr 65 70 75 GAA TCA GCG TAT TCT GCA GCA GGA GCT CTG GAT AGT GGT CGC AAG GCT 339 Glu Ser Ala Tyr Ser Ala Ala Gly Ala Leu Asp Se r Gly Arg Lys Ala 80 85 90 CTT AAA TAT GGC ACG GAC TAC TTC CTC AAG GCG CAC ACG GCC GCG AAC 387 Leu Lys Tyr Gly Thr Asp Tyr Phe Leu Lys Ala His Thr Ala Ala Asn 95 100 105 GAA TTC TAC GGA CAA GTG GGC CAG GGA GAT GTC GAC CAC GCC TAC TGG 435 Glu Phe Tyr Gly Gln Val Gly Gln Gly Asp Val Asp His Ala Tyr Trp 110 115 120 GGA CGT CCA GAA GAC ATG ACG ATG TCC AGA CCT GCC TAC AAG ATC GAC 483 Gly Arg Pro Glu Asp Met Thr Met Ser Arg Pro Ala Tyr Lys Ile Asp 125 130 135 140 ACG TCG AAA CCA GGG TCT GAC CTG GCC GCC GAG ACA GCC GCC GCC CTC 531 Thr Ser Lys Pro Gly Ser Asp Leu Ala Ala Glu Thr Ala Ala Ala Leu 145 150 155 GCT GCA ACT GCC ATC GCC TAC AAG AGT GCT GAC GCC ACT TAT TCC AAC 579 Ala Ala Thr Ala Ile Ala Tyr Lys Ser Ala Asp Ala Thr Tyr Ser Asn 160 165 170 AAC TTG ATC ACC CAC GCC AAG CAG CTT TTC GAC TTC GCC AAC AAT TAT 627 Asn Leu Ile Thr His Ala Lys Gln Leu Phe Asp Phe Ala Asn Asn Tyr 175 180 185 CGC GGC AAA TAC AGT GAT TCA ATC ACC GAC GCG CAG AAT TTC TAC GCG 675 Arg Gly Lys Tyr Ser Asp Ser Ile Thr As p Ala Gln Asn Phe Tyr Ala 190 195 200 TCC GGA GAC TAC AAG GAC GAG TTA GTA TGG GCA GCC GCA TGG CTC TAC 723 Ser Gly Asp Tyr Lys Asp Glu Leu Val Trp Ala Ala Ala Trp Leu Tyr 205 210 215 220 AGA GCG ACC AAC GAC AAC ACC TAT CTG ACC AAA GCT GAA TCG CTA TAC 771 Arg Ala Thr Asn Asp Asn Thr Tyr Leu Thr Lys Ala Glu Ser Leu Tyr 225 230 235 AAC GAA TTC GGC CTC GGA AAC TGG AAC GGT GCC TTC AAC TGG GAT AAC 819 Asn Glu Phe Gly Leu Gly Asn Trp Asn Gly Ala Phe Asn Trp Asp Asn 240 245 250 AAG ATC TCC GGT GTA CAG GTT CTA CTG GCC AAG CTC ACA AGC AAG CAG 867 Lys Ile Ser Gly Val Gln Val Leu Leu Ala Lys Leu Thr Ser Lys Gln 255 260 265 GCA TAC AAG GAC AAG GTA CAA GGC TAC GTC GAT TAC TTG ATT TCG TCT 915 Ala Tyr Lys Asp Lys Val Gln Gly Tyr Val Asp Tyr Leu Ile Ser Ser 270 275 275 280 CAG AAG AAG ACA CCC AAG GGT CTC GTA TAC ATC GAC CAG TGG GGT ACC 963 Gln Lys Lys Thr Pro Lys Gly Leu Val Tyr Ile Asp Gln Trp Gly Thr 285 290 295 300 CTG CGA CAT GCT GCC AAT TCT GCT CTC ATT GCT CTG CAG GCA GCC GAC 1011 Leu Arg His Ala Ala A sn Ser Ala Leu Ile Ala Leu Gln Ala Ala Asp 305 310 315 CTG GGT ATC AAT GCT GCT ACT TAT CGC GCG TAT GCC AAG AAG CAG ATC 1059 Leu Gly Ile Asn Ala Ala Thr Tyr Arg Ala Tyr Ala Lys Lys Gln Ile 320 325 330 GAT TAC GCA TTA GGT GAT GGA GGT CGC AGC TAC GTC ATA GGA TTT GGT 1107 Asp Tyr Ala Leu Gly Asp Gly Gly Arg Ser Tyr Val Ile Gly Phe Gly 335 340 345 ACT AAC CCA CCC GTA CGC CCT CAC CAC AGA TCC AGC TCG TGC CCT GAC 1155 Thr Asn Pro Pro Val Arg Pro His His Arg Ser Ser Ser Cys Pro Asp 350 355 360 GCA CCA GCC GTA TGT GAC TGG AAC ACG TAC AAC AGC GCC GGC CCC AAT 1203 Ala Pro Ala Val Cys Asp Trp Asn Thr Tyr Asn Ser Ala Gly Pro Asn 365 370 375 380 GCT CAC GTA CTC ACC GGA GCC TTG GTC GGT GGT CCA GAT AGC AAC GAT 1251 Ala His Val Leu Thr Gly Ala Leu Val Gly Gly Pro Asp Ser Asn Asp 385 390 395 AGC TAC ACG GAC GCT CGC AGC GAT TAC ATC TCC AAC GAA GTG GCC ACA 1299 Ser Tyr Thr Asp Ala Arg Ser Asp Tyr Ile Ser Asn Glu Val Ala Thr 400 405 410 GAT TAC AAC GCT GGC TTC CAA TCA GCT GTC GCT GGT CTC CTC AAG GCT 1347 As p Tyr Asn Ala Gly Phe Gln Ser Ala Val Ala Gly Leu Leu Lys Ala 415 420 425 GGC GTG TAA CCGCACACAG CACTCAATGT CTCCTTGTCC ACTGGACATG TGTACAATT 1405 Gly Val 430 TGACAACGAA AATGTAATAT TCTTCAGAAA AGTTCAATAA AAGTTTAAAT TTCAACACAA 1465 AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA 1495

[0037] SEQ ID NO: 2 sequence length of: SEQ form of: the number of nucleic acid strands: double-stranded Topology: linear sequence type: cDNA-to mRNA Origin Organism: Takasago termite (Nasutitermes
takasagoensis ) Characteristic of sequence Symbol indicating characteristic: sig peptide Side location: 103. . 150 Method for determining feature: E Symbol representing feature: peptide Location: 151. . 1446 Method of Characterization: E Sequence ATCAGATTGA GAGTCTCTCT CCTGTTGTGC AGCCGATCAG TATAAATCGG CGGGACGGTC 60 CTACCAAAAC AACTTCACGG CCTGCAACCA ATACCAGCCA GC ATG AGG GTC TTC 114 Met Arg Val Phe -15 CTT TGT CTT CTG GCT GCT CCT GCT GCT GCT CCT GCT GCT CCT GCT GCT CCT GCT GCT CCT GCT GCT GCT CTCT GCT GTC Cys Leu Leu Ser Ala Leu Ala Leu Cys Gln Ala Ala Tyr Asp Tyr -10 -5 1 AAG CAA GTA CTG CGC GAT TCC CTA CTG TTC TAC GAG GCT CAA CGA TCG 210 Lys Gln Val Leu Arg Asp Ser Leu Leu Phe Tyr Glu Ala Gln Arg Ser 5 10 15 20 GGA AGG TTG CCC GCT GAT CAG AAA GTC ACA TGG AGA AAG GAT TCC GCC 258 Gly Arg Leu Pro Ala Asp Gln Lys Val Thr Trp Arg Lys Asp Ser Ala 25 30 35 CTA AAC GAC CAA GGA GAC CAG GGC CAG GAC CTA ACA GGA GGA TAC TTT 306 Leu Asn Asp Gln Gly Asp Gln Gly Gln Asp Leu Thr Gly Gly Tyr Phe 40 45 50 GAC GCT GGT GAT TTT GTG AAA TTC GGC TTT CCA ATG GCG TAC ACA GCC 354 Asp Ala Gly Asp Phe Val Lys Phe Gly Phe Pro Met Ala Tyr Thr Ala 55 60 65 ACC GTC CTG GCT TGG GGC CTG ATC GAC TTT GAA GCG GGC TAC TCT TCA 402 Thr Val Leu Ala Trp Gly Leu Ile Asp Phe Glu Ala Gly Tyr Ser Ser 70 75 80 GCA GGA GCT CTG GAT GAT GGT CGC AAA GCT GTT AAA TGG GCC ACA GAC 450 Ala Gly Ala Leu Asp Asp Gly Arg Lys Ala Val Lys Trp Arp Thr Asp 85 90 95 100 TAT TTC ATC AAG GCG CAC ACG TCC CAA AAT GAA TTC TAC GGA CAA GTG 498 Tyr Phe Ile Lys Ala His Thr Ser Gln Asn Glu Phe Tyr Gly Gln Val 105 110 115 GGC CAG GGA GAT GCG GAC CAC GCC TTC TGG GGA CGT CCA GAA GAC ATG 546 Gly Gln Gly Asp Ala Asp His Ala Phe Trp Gly Arg Pro Glu Asp Met 120 125 130 ACA ATG GCA AGA CCT GCC TAC AAG ATC GAC ACG TCT AGA CCA GGG TCG 594 Thr Met Ala Arg Pro Ala Tyr Lys Ile Asp Thr Ser Arg Pro Gly Ser 135 140 145 GAT CTG GCC GGC GAA ACA GCC GCC GCC CTC GCT GCA GCT TCC ATC GTG 642 Asp Leu Ala Gly Glu Thr Ala Ala Ala Leu Ala Ala Ala Ser Ile Val 150 155 160 TTC AGG AAT GTC GAC GGC ACT TAT TCC AAC AAC CTG CTC ACA CAC GCC 690 Phe Arg Asn Val Asp Gly Thr Tyr Ser Asn Asn Leu Leu Thr His Ala 165 170 175 180 AGG CAG CTT TTC GAC TTC GCC AAC AAT TAT CGC GGC AAA TAC AGT GAC 738 Arg G ln Leu Phe Asp Phe Ala Asn Asn Tyr Arg Gly Lys Tyr Ser Asp 185 190 195 TCA ATC ACC GAC GCC AGG AAT TTC TAC GCG TCC GCG GAC TAC AGG GAT 786 Ser Ile Thr Asp Ala Arg Asn Phe Tyr Ala Ser Ala Asp Tyr Arg Asp 200 205 210 GAA TTA GTA TGG GCA GCC GCA TGG CTC TAC AGG GCA ACC AAC GAC AAC 834 Glu Leu Val Trp Ala Ala Ala Trp Leu Tyr Arg Ala Thr Asn Asp Asn 215 220 225 ACC TAC CTC AAC ACC GCT GAA TCG CTA TAT GAT GAA TTC GGT CTC CAG 882 Thr Tyr Leu Asn Thr Ala Glu Ser Leu Tyr Asp Glu Phe Gly Leu Gln 230 235 240 AAC TGG GGT GGT GGC CTT AAC TGG GAT AGC AAA GTG TCC GGT GTA CAG 930 Asn Trp Gly Gly Gly Gly Leu Asn Trp Asp Ser Lys Val Ser Gly Val Gln 245 250 255 260 GTT CTA CTG GCC AAA CTC ACA AAC AAG CAA GCG TAC AAG GAC ACG GTA 978 Val Leu Leu Ala Lys Leu Thr Asn Lys Gln Ala Tyr Lys Asp Thr Val 265 270 275 CAA TCA TAC GTG AAT TAC CTA ATT AAC AAC CAG CAG AAG ACA CCC AAG 1026 Gln Ser Tyr Val Asn Tyr Leu Ile Asn Asn Gln Gln Lys Thr Pro Lys 280 285 290 GGT CTT CTT TAC ATC GGA CAT GTG GGG AAC CTG CGA CAT GCT GCA AAC 1074 Gly Leu Leu Tyr Ile Gly His Val Gly Asn Leu Arg His Ala Ala Asn 295 300 305 GCT GCC TTC ATT ATG CTT GAG GCT GCG GAG CTG GGT TTG AGT GCT TCT 1122 Ala Ala Pla Ihe Met Leu Glu Ala Ala Glu Leu Gly Leu Ser Ala Ser 310 315 320 AGT TAT CGC CAG TTT GCC CAG ACG CAG ATC GAT TAC GCA TTG GGT GAC 1170 Ser Tyr Arg Gln Phe Ala Gln Thr Gln Ile Asp Tyr Ala Leu Gly Asp 325 330 335 340 GGT GGG CGC AGC TTC GTG TGT GGA TTT GGC AGT AAC CCA CCT ACC CGC 1218 Gly Gly Arg Ser Phe Val Cys Gly Phe Gly Ser Asn Pro Pro Thr Arg 345 350 355 CCT CAC CAT AGA TCT AGT TCG TGC CCA CCC GCG CCG GCC ACA TGT GAC 1266 Pro His His Arg Ser Ser Ser Cys Pro Pro Ala Pro Ala Thr Cys Asp 360 365 370 TGG AAC ACA TTC AAC AGT CCA GAT CCA AAC TAC CAC GTA CTC AGT GGA 1314 Trp Asn Thr Phe Asn Ser Pro Asp Pro Asn Tyr His Val Leu Ser Gly 375 380 385 GCT TTG GTG GGC GGT CCA GAT CAG AAC GAC AAC TAC GTG GAC GAT CGC 1362 Ala Leu Val Gly Gly Pro Asp Gln Asn Asp Asn Tyr Val Asp Asp Arg 390 395 400 AGC GAT TAC GTC CAC AAC GAA GTT GCC ACA G AT TAC AAC GCA GGC TTC 1410 Ser Asp Tyr Val His Asn Glu Val Ala Thr Asp Tyr Asn Ala Gly Phe 405 410 415 420 CAA TCA GCT CTC GCC GCT CTC GTC GCG TTG GGT TAT TAA ACTCACAAAA CA 1461 Gln Ser Ala Leu Ala Ala Leu Val Ala Leu Gly Tyr 425 430 TTCAAATTGT CCGTCTGCTG TGAGTGTGTA CAAAATAATA TAAACAATGT AACATTGTCC 1521 TTAGCAGTGA AAATAAAATC TTTGTATGCA GATACGTTTG TAGACGACGT TCAGTACTGC 1581 ATACAGGGAA GATCATTAAGAAGATCAAGAGAA GATCAAAAGA

[Brief description of the drawings]

BRIEF DESCRIPTION OF THE FIGURES FIG. 1: Takasago termite cellulase (endo-β-
Explanatory drawing which shows the analysis result by a hydroxyapatite column of (1, 4-glucanase).

FIG. 2. Termite cellulase (endo-β-1,4-
Glucanase) (bottom)
Species) and plants (third from the top).

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI (C12N 9/42 C12R 1:19) (C12N 15/09 ZNA C12R 1:91) (58) Investigated field (Int.Cl. ⁷ , DB name) C12N 15/00-15/90 C12N 1/00-1/38 C12N 9/00-9/99 BIOSIS (DIALOG) GenBank / EMBL / DDBJ / (GENETYX) WPI (DIALOG)

Claims (6)

(57) [Claims] 1. A recombinant protein having the following cellulase activity (a) or (b): (A) a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2; (B) a protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence (a), and having a cellulase enzyme activity; 2. A DNA encoding a protein having the following cellulase activity (a) or (b). (A) a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2; (B) a protein comprising an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence (a), and having a cellulase enzyme activity; 3. The DNA according to claim 2, wherein the DNA is represented by SEQ ID NO: 1 or 2. 4. A recombinant vector comprising the DNA according to claim 2 or 3. A transformant transformed by the recombinant vector according to claim 4. 6. A method for producing a recombinant protein according to claim 1, wherein the transformant according to claim 5 is cultured in a medium, and the recombinant protein having cellulase activity according to claim 1 is collected from the resulting culture. Method.