JP3025248B2 - Method for producing peptide promoting protein C activation and antibody thereof - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for producing a novel recombinant peptide having an action of binding to thrombin and promoting the activation of protein C of thrombin, and a method for producing an antibody against the recombinant peptide.

[0002] In the present specification, amino acids and peptides are defined as IUPAC-IUB Biochemical Nomenclature Committee (C
BN). In addition, when there is an optical isomer for an amino acid or the like, the L-form is indicated unless otherwise specified. Further, unless otherwise specified, the left and right ends of the amino acid sequence of the peptide are the N-terminal and C-terminal, respectively. Gln: glutamine residue Asp: aspartic acid residue Pro: proline residue Tyr: tyrosine residue Val: valine residue Lys: lysine residue Glu: glutamic acid residue Ala: alanine residue Asn: asparagine residue Leu: leucine residue Group Phe: Phenylalanine residue Gly: Glycine residue His: Histidine residue Ser: Serine residue Thr: Threonine residue Ile: Isoleucine residue Trp: Tryptophan residue Arg: Arginine residue Met: Methionine residue Cys: Cysteine residue Base

[0003] Further, polydeoxyribonucleotides and oligonucleotides are represented by deoxyribonucleotide sequences represented by the following abbreviations. A: 2'-deoxyadenylic acid residue C: 2'-deoxycytidylic acid residue G: 2'-deoxyguanylic acid residue T: thymidylic acid residue Unless otherwise specified, the left and right ends of the deoxyribonucleotide sequence are respectively 5 'end and 3' end.

[0004]

2. Description of the Related Art Streptokinase and urokinase are currently used as thrombolytic agents. Heparin and warfarin are used as anticoagulants. Further, as a platelet aggregation inhibitor, aspirin, sulfinpyrazone, dipyridamole and the like are used. These thrombolytic agents, anticoagulants and platelet aggregation inhibitors are used separately or in combination, for example, myocardial infarction, thrombosis, embolism, peripheral vascular obstruction, obstructive atherosclerosis, intravascular Blood clotting syndrome (DI
C), for the treatment and prevention of diseases such as angina pectoris, transient ischemic attack, preeclampsia and the like. However, these thrombolytics, anticoagulants and platelet aggregation inhibitors act only on a very small part of the blood coagulation / fibrinolysis system, which consists of a very complex mechanism. Thus, there has been a demand for a drug that acts widely on the coagulation / fibrinolysis system of blood and has an excellent blood coagulation inhibitory action.

[0005] By the way, protein C is known as a vitamin K-dependent protein which plays an important role in the blood coagulation mechanism. In recent years, substances that promote the activation of protein C and suppress platelet activation and fibrin formation due to the action of thrombin are present in rabbit lung, bovine lung, human lung and human placenta, etc. It has been reported that it has an excellent blood coagulation inhibitory effect as compared with the aforementioned drugs. Regarding substances present in rabbit lungs, for example, CT Esmon (CT Esmon)
Proceding of National Academy of Science USA (Proc. Nat)
l. Acad. Sci. USA), 78, 2249 (1981); N. Esmon (NL Es)
mon) et al., The Journal of Biological
Chemistry (J. Biol. Chem.), 257
Vol. 859 (1982); CT Esmon et al., The Journal of Biological Chemistry (J. Biol. Che).
m. ), 257, 7944 (1982);
NL Esmon et al., The Journal of Biological Chemistry (J. Bi)
ol. Chem. 258, 12238 (198
2 years).

[0006] With respect to substances present in bovine lungs, reference can be made to, for example, Kusumoto et al., Biochemistry, 56, 890 (1984). In addition, for substances present in the human placenta, for example, JP-A-60-199819; Kurosawa et al., Journal of the Japanese Society of Hematology, 47, 632 (1984).
Year); Etch Etch Salem (HH Sale)
m) et al., Journal of Biological Chemistry (J. Biol. Chem.), 259, 122
46 (1984); Kurosawa (S. Kuro)
sawa) et al., Thrombosis Research (Thromb)
ossis Research), 37, 353 (1
985). Regarding substances present in the human lung, for example, Kusumoto et al., Biochemistry, 57
Vol. 1102 (1985).

[0007] The above-mentioned prior art documents describe the general properties of the above substances, but the structure of the substance, for example, the amino acid sequence, has not been elucidated, and the substance has not yet been identified. Therefore, it is completely unknown whether the substances reported in the above-mentioned prior art documents are single substances, and whether the same substances can be repeatedly obtained according to the descriptions of these prior art documents. . Furthermore,
The substances reported in the above-mentioned prior art documents cannot secure a sufficient amount because they are originally derived from living organisms,
It is present on the cell membrane, is insoluble in the absence of a surfactant, and cannot be tested for its safety as a pharmaceutical composition for the treatment of cardiovascular diseases, etc. Was always constant content,
I was very worried that quality could be maintained.

[0008] In addition, there is a disclosure that some of the compounds exist in forms other than those present on cell membranes, for example, in blood or urine [Ishii et al., Journal of Clinical Investigation (J. Clin. Invest. ), 7
6, 2178 (1985)], it is clear that purification has not been sufficiently performed, and its activity, action, physical properties, origin, and the like have not been sufficiently analyzed or studied. There was no analysis of the structure at all, and it had no effect and safety that could be used as a drug in the first place, and could not be positioned as a drug that could always be stably supplied as a drug.

[0009]

Heretofore, there has been known a method which can provide a sufficiently purified peptide which is useful mainly for controlling blood coagulation, for controlling platelet aggregation, or for thrombolysis. Was sought. There has also been a need to provide antibodies to the peptide that are necessary for detection and measurement.

[0010]

Means for Solving the Problems Under the above-mentioned technical background, the present inventors have made intensive studies, and as a result, have encoded a peptide that binds to thrombin and promotes protein C activation by thrombin. DNA can be isolated and the peptide produced in large quantities and easily by recombinant DNA technology, preferably in pure form, free of any other human-derived protein, which binds to thrombin and Not only can promote protein C activation to control blood coagulation, but also can promote fibrinolysis, an agent that controls blood coagulation, ie, to control blood coagulation or platelet aggregation Or as a pharmaceutical composition for controlling thrombolysis or thrombolysis.

Furthermore, in view of the usefulness of these substances, when these substances are used as a pharmaceutical composition, it is necessary to detect or measure the administered substance, and it is also necessary to detect the presence of the substance on the cell surface in a human body. Binds to thrombin,
In addition, it is necessary to detect and measure a peptide that promotes protein C activation by thrombin, and as one of the means, it has been necessary to consider preparing an antibody using these substances as antigens. Conventionally, attempts have been made to prepare an antibody against the human-derived peptide, but since the substance used as the antigen is an extract from a natural product and is a membrane protein, other contaminants derived entirely from humans Cannot be excluded and there is no other alternative technique, but this is not always an efficient antibody production technique.

On the other hand, according to the present invention, a recombinant peptide substantially free of other human-derived contaminants can be obtained,
Only by using this recombinant peptide as an antigen, an extra antibody for a human-derived contaminant component is not produced, and a much more efficient method for producing an antibody than the conventional method is disclosed. Furthermore, when a peptide comprising a shorter amino acid sequence, which binds to thrombin and promotes the activation of protein C by thrombin, is used as an antigen as disclosed by the present invention, the peptide binds to thrombin and binds to protein by thrombin. It is easily predicted that an antibody that directly recognizes an active site that promotes C activation can be obtained with high probability, and the features of the present invention can be sufficiently recognized.

[0013] That is, the first invention of the present invention is a method for producing a recombinant peptide which is substantially free of human-derived contaminants and binds to thrombin and has an action of promoting the activation of protein C by thrombin. And then
(A) DN containing a nucleotide sequence encoding the peptide
A is ligated to a replicable expression vector to obtain a replicable recombinant DNA containing the DNA and the replicable expression vector, and (b) a microorganism or a human (C) selecting the transformant from the parent cell of the microorganism or cell, and (d) culturing the transformant to transform the animal cell. Expressing the DNA in a body to produce the peptide, and (e) isolating the peptide from a cultured transformant.

[0014] The second invention of the present invention is:
(A) a DNA containing a nucleotide sequence encoding the amino acid sequence of 1 to 575 of SEQ ID NO: 7 is ligated to a replicable expression vector, and the replicable expression vector containing the DNA and the replicable expression vector is Obtaining a recombinant DNA, (b) transforming a microorganism or a non-human cell with the replicable recombinant DNA to form a transformant, and (c) transforming the transformant with the microorganism or the non-human (D) culturing the transformant, allowing the transformant to express the DNA, binding to thrombin,
(E) isolating the peptide from a cultured transformant to produce a recombinant peptide having an action of promoting the activation of protein C by thrombin; Preparing a recombinant peptide having an action of binding and promoting the activation of protein C by thrombin, and (f) obtaining an antibody that binds to the recombinant peptide by immunizing an animal with the recombinant peptide. A method for producing the antibody.

Further, another invention according to the present invention provides (a)
A DNA containing a nucleotide sequence encoding the amino acid sequence of 1-498 of SEQ ID NO: 3 is linked to a replicable expression vector, and a replicable recombinant containing the DNA and the replicable expression vector DNA; (b) transforming a microorganism or non-human animal cell with the replicable recombinant DNA to form a transformant; (c) transforming the transformant with a parent cell of the microorganism or cell. Sort from
(D) culturing the transformant and adding the DN to the transformant;
A is expressed to bind to thrombin to produce a soluble peptide having an action of promoting the activation of protein C by thrombin. (E) Isolating the soluble peptide from the cultured transformant, (F) immunizing an animal with the soluble recombinant peptide by preparing a recombinant soluble peptide which is substantially free of contaminants and which binds to thrombin and has an action of promoting the activation of protein C by thrombin; A method for producing the antibody, comprising obtaining an antibody that binds to the recombinant soluble peptide.

Further, another invention according to the present invention provides (a)
A DNA containing a nucleotide sequence encoding the amino acid sequence of 1-118 of SEQ ID NO: 1 is ligated to a replicable expression vector, and a replicable recombinant containing the DNA and the replicable expression vector DNA; (b) transforming a microorganism or a non-human animal cell with the replicable recombinant DNA to form a transformant; (c) transforming the transformant with a parent cell of the microorganism or cell. Sort from
(D) culturing the transformant and adding the DN to the transformant;
A is expressed to bind to thrombin to produce a soluble peptide having an action of promoting the activation of protein C by thrombin. (E) Isolating the soluble peptide from the cultured transformant, (F) immunizing an animal with the soluble recombinant peptide by preparing a recombinant soluble peptide which is substantially free of contaminants and which binds to thrombin and has an action of promoting the activation of protein C by thrombin; A method for producing the antibody, comprising obtaining an antibody that binds to the recombinant soluble peptide.

The recombinant peptide of the present invention is not particularly limited as long as it binds to thrombin, has the effect of promoting the activation of protein C by thrombin, and is prepared based on the gene manipulation technique described below. But not
For example, substantially purified soluble peptides defined by the following (a) to (f) are particularly preferred. (A) binds to thrombin and (b) has the effect of promoting the activation of protein C by thrombin; (c) is soluble at least in the absence of a surfactant; (d) prolongs the clotting time by thrombin (E) suppress platelet aggregation by thrombin; (f) silver staining is possible on SDS-polyacrylamide gel.

[0018] Regarding a peptide that binds to thrombin and has the effect of promoting the activation of protein C by thrombin, the amino acid sequence and the like have not been elucidated so far, and there has been no example produced by genetic engineering. The purified recombinant peptide substantially free of human-derived contaminants can be said to be an unconventional peptide. Further, according to the disclosure of the present invention, a purified soluble peptide can be obtained for the first time. Therefore, as described above, a preferred example is a recombinant peptide substantially free of human-derived contaminant components, particularly a soluble recombinant peptide.

The soluble peptide of the present invention is detected and recovered as an active substance that promotes the activation of protein C by thrombin. Usually, the activity is 0.15
M salt, 2.5 mM calcium chloride, 1 mg / ml serum albumin, pH 7.4 containing 20 mM Tris-HCl buffer in the presence of thrombin and protein C, and the amount of activated protein C produced was quantified. Be evaluated. Therefore, the soluble peptide of the present invention is soluble in the buffer to at least a detectable concentration,
As will be described later, any soluble peptide having the property that it can be dissolved at least in the absence of a surfactant and can be an aqueous solution that can be injected into a blood vessel may be used.

As described above, the soluble peptide of the present invention comprises
As described above, it is extremely useful when used as a pharmaceutical composition.For example, in a conventional substance, it is insoluble in the absence of a surfactant, and an insoluble substance is present. The addition of a surfactant is essential in order not to make an injection, but in patients with cardiovascular diseases having various problems, it is undeniable that the addition of this surfactant may cause unexpected problems, and Due to the balance with the amount of surfactant added, it is conceivable that it may not always be possible to prepare a formulation with a sufficiently high content, but on the other hand, the soluble peptide of the present invention is soluble, These problems are all solved. In addition to the fact that the soluble peptide of the present invention can be easily purified, it is extremely convenient when producing a lyophilized preparation or when reusing the lyophilized preparation for use.

The binding of the peptides of the present invention to thrombin is demonstrated by the DI, as described in the Examples herein.
Confirmed by binding to P-thrombin-agarose. In addition, having the activity of promoting the activation of protein C by thrombin, extending the coagulation time by thrombin, and inhibiting platelet aggregation by thrombin are also described in Examples herein. When the soluble peptide of the present invention is used as a pharmaceutical composition, it must be substantially purified as shown in Examples of the present invention. Further, the soluble peptide is
As described in Examples, silver staining is possible on SDS-polyacrylamide gel.

Further, the soluble peptide of the present invention comprises DIP
-When bound to a thrombin-agarose column, 1 M NaCl, 0.1 mM EDTA, 1 mM
It is preferable that the soluble peptide has a property of eluting with a 0.02 M Tris-HCl buffer (pH 7.5) containing benzamidine hydrochloride and 0.5% (v / v) polidocanol (trade name: Lubrol PX). ,
0.1 M NaCl, 0.5 mM CaCl ₂ , 0.5
A solution prepared by dissolving the soluble peptide in the buffer was brought into contact with a DIP-thrombin-agarose column equilibrated with a 0.02 M Tris-HCl buffer (pH 7.5) containing% (v / v) polidocanol. In this case, it is also preferable that the soluble peptide has a property capable of binding to the column. Further, the peptide of the present invention comprises at least Ala-Pro-Ala-Glu-P
ro-Gln-Pro-Gly-Gly-Ser-Gl
Also preferred is a case characterized by containing n amino acid sequences.

The peptide of the present invention binds to thrombin and has the effect of promoting the activation of protein C by thrombin, and is preferably soluble at least in the absence of a surfactant. 40. A human-derived DNA characterized in that the homology of the amino acid sequence of the soluble peptide is within the amino acid sequence by having the restriction enzyme site shown in the restriction map in FIG.
It is preferable that the homology is completely identical to the amino acid sequence of a peptide which binds to the thrombin which can be encoded and has an action of promoting the activation of protein C by thrombin. This human-derived DNA has a coding region of a 1725 bp nucleotide sequence from the first base of the start codon to the base immediately before the stop codon in the restriction enzyme map of FIG. 40,
Specific examples of the encoded amino acid sequence include:
The amino acid sequence of 1 to 575 of SEQ ID NO: 7 is a preferred example. FIG. 40 shows a part of FIG.

A preferred specific example of the soluble peptide of the present invention is the amino acid sequence of 1-118 of SEQ ID NO: 1, that is, the following formula (I): Val Glu Pro Val Asp Pro Cys Phe Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu ys Glu Asn Gly Gly Phe Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Thr Glu Cys Ile Cys Gly Pro Asp SerAla GlyAg .

Of course, the amino acid sequence represented by the formula (I) is the most preferred example, and even if there is a difference in the above activities, the amino acid sequence of the formula (I)
It is not necessary to bind to the amino acid sequence represented by Also,
In humans, it is usually quite possible to have mutations referred to as polymorphisms. That is, the peptide of the present invention may substantially consist of the amino acid sequence represented by the above formula (I), and may have some deletions, additions, substitutions, etc. as long as the action and function are not inhibited. May also be the amino acid sequence of a homologous variant thereof, and further contain the amino acid sequence of at least one other peptide bound to the N-terminal and / or C-terminal of the amino acid sequence represented by Formula (I). You may.

For example, when the peptide is 1-4 of SEQ ID NO: 3,
A peptide having an amino acid sequence of 98 or an amino acid sequence in which an arbitrary number of amino acids at its N-terminal and / or C-terminal have been deleted, and which has an action of binding to thrombin and promoting the activation of protein C by thrombin. It is also preferred. Further, the peptide consists of the amino acid sequence of 1-272 of SEQ ID NO: 8 or an amino acid sequence in which an arbitrary number of amino acids at its N-terminal and / or C-terminal have been deleted, binds to thrombin, and binds to protein C by thrombin. It is also preferred that the peptide has an action of promoting the activation of the protein. In addition, the peptide consists of the amino acid sequence of 1-236 of SEQ ID NO: 6, or an amino acid sequence in which an arbitrary number of amino acids at its N-terminal and / or C-terminal are deleted, binds to thrombin, and binds to protein C by thrombin. It is also preferred that the peptide has an action of promoting the activation of the protein.

That is, the peptide of the present invention comprises (i) a peptide consisting of the amino acid sequence of 1-498 of SEQ ID NO: 3, and (ii) amino acids of the peptide described in (i) above being deleted, substituted or added. Consisting of an amino acid sequence,
Further, it is also preferable that the peptide be any of soluble peptides having an activity of binding to thrombin and having an action of promoting the activation of protein C by thrombin. For the above-mentioned deletion, substitution or addition of (ii), one or several amino acids are usually assumed, but according to the disclosure shown in the present specification, those skilled in the art understand that the present invention is not particularly limited thereto. Things.

Also, the soluble peptide may comprise (i) the N-terminal and / or the N-terminal of SEQ ID NO: 8 so as to include at least the amino acid sequence of 119 to 236 of SEQ ID NO: 8 in the amino acid sequence of 1-272 of SEQ ID NO: 8. Or a soluble peptide having an action of promoting the activation of protein C by thrombin, which binds to thrombin consisting of an amino acid sequence in which any number of amino acids at the C-terminal may be deleted,
(Ii) the peptide of (i), which has an amino acid sequence in which one or several amino acids have been deleted, substituted or added, binds to thrombin, and has an effect of promoting the activation of protein C by thrombin. And a soluble peptide having the activity. Incidentally, examples of these more specific peptides include (1) the peptides of the above formula (I) and the following peptides (2) to (5).

(2) The following amino acid sequence is added to the N-terminus of the amino acid sequence represented by the formula (I): Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala Ile Pro Gly Ala Pro Arg Cys Glyn Cys Gly Ala Ala Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg Cys Glu Asp Val Asp Asp Cys Ile Leu Glu ro 1-23 of Ser Pro Cys Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn Tyr Asp Leu Val Asp Gly Glu Cys is formed by bonding a peptide (i.e., SEQ ID NO: 6
6 amino acid sequence).

(3) The following amino acid sequences are provided at the N-terminal and C-terminal of the amino acid sequence represented by the formula (I): Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg Cys Glu Asp Val Asp Asp Cys I e Leu Glu Pro Ser Pro Cys Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn Tyr Asp Leu Val Asp Gly Glu Cys and Asp Ser Gly Lys Val Asp Gly Gly Asp Ser Gly Ser Gly Glu Pro Pro Pro Ser Pro Pro Thr Pro Gly Ser Thr Leu Thr Pro Pro Ala Val Gly Leu Val His Ser Gly peptide (namely, 1-27 of SEQ ID NO: 8)
2 amino acid sequence).

(4) The following amino acid sequences are provided at the N-terminal and the C-terminal of the amino acid sequence represented by the formula (I), respectively: Pro Gly Pro Ala Thr Phe Leu Asn Ala Ser Gln Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser Ser Val Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly Val Gly Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys Gly Asp Pro Lys Arg Leu Gly P o Leu Arg Gly Phe Gln Trp Val Thr Gly Asp Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn Gly Ala Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu Ala Thr Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val Lys Ala Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg Pro Leu Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr Tyr Gly Thr Pro Phe Ala Ala Arg Gly Ala Asp P e Gln Ala Leu Pro Val Gly Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu Met Cys Thr Ala Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro Gly Ala Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro G y Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro bound to the Asn Tyr Asp Leu Val Asp Gly Glu Cys and Asp Ser Gly Lys Val Asp Gly Gly Asp Ser Gly Ser Gly Glu Pro Pro Pro Ser Pro Thr Pro Gly Ser Thr Leu Thr Pro Pro Ala Val Gly Leu Val His Ser Gly Peptide (ie, 1-49 of column number 3
8 amino acid sequence).

(5) A peptide consisting of the amino acid sequence of 1 to 462 of SEQ ID NO: 14. Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys Val Glu His Asp Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu Asn Ala Ser Gln Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser Ser Val Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly Val Gly Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys Gly Asp Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp Val Thr Gly Asp Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn Gly Ala Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu Ala Thr Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val Lys Ala Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg Pro Leu Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr Tyr Gly Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala Leu Pro Val Gly Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu Met Cys Thr Ala Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro Gly Ala Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys

The peptide of the present invention may contain the amino acid methionine as the N-terminal amino acid residue. The peptide of the present invention may also have an N-terminal amino acid sequence of, for example, the following formula: Met Leu Gly Val Leu Val
Leu Gly AlaLeu Ala Leu A
It may contain a leader sequence having an amino acid sequence represented by la Gly Leu Gly Phe Pro, or a part thereof.

It is possible to alter some of the structure of the peptide by natural or artificial mutations without significantly altering the activity and solubility of the peptide. The peptide of the present invention binds to thrombin,
A peptide having a structure corresponding to a homologous variant of the peptide having the amino acid sequence (Homologous variant) is also included as long as it has an action of promoting the activation of protein C by thrombin. The peptide of the present invention may or may not contain at least one sugar residue. That is, in the present invention, it is shown that at least the amino acid sequence is a sequence described in the present specification, and is not particularly limited by a sugar residue.

In producing the peptide of the present invention, for example, it is preferable to use a genetic engineering technique by the following method. As a human-derived gene used in this genetic engineering technique, for example, starting from a gene such as TMJ in the restriction map shown in FIG. A peptide having an action of promoting the activation, preferably consisting of a partial sequence of the amino acid sequence of 1 to 575 of SEQ ID NO: 7, and in another preferred embodiment, a peptide which is soluble in the absence of a surfactant. May be changed to a gene encoding the peptide by ordinary gene manipulation techniques. For example, genes encoding various peptides disclosed in the present specification may be used.

Examples of preferred genes in the present invention include the following. For example, the following formula (II) (i.e., the base sequence of 1-354 of SEQ ID NO 4): GTGGAGCCCG TGGACCCGTG CTTCAGAGCC AACTGCGAGT ACCAGTGCCA GCCCCTGAAC CAAACTAGCT ACCTCTGCGT CTGCGCCGAG GGCTTCGCGC CCATTCCCCA CGAGCCGCAC AGGTGCCAGA TGTTTTGCAA CCAGACTGCC TGTCCAGCCG ACTGCGACCC CAACACCCAG GCTAGCTGTG AGTGCCCTGA AGGCTACATC CTGGACGACG GTTTCATCTG CACGGACATC GACGAGTGCG AAAACGGCGG CTTCTGCTCC GGGGTGTGCC ACAACCTCCCCG A DNA containing the base sequence represented by TACCTTC GAGTGCATCT GCGGGCCCGA CTCGGCCCTT GTCCGCCACA TTGGCACCGA CTGT.

According to the degeneracy of the genetic code, at least one base in the base sequence of the gene can be replaced with another type of base without changing the amino acid sequence of the polypeptide produced from the gene. Therefore, the DNA of the present invention
Can also contain a nucleotide sequence altered by substitution based on the degeneracy of the genetic abbreviation. In this case, the amino acid sequence deduced from the nucleotide sequence obtained by the above substitution matches the amino acid sequence defined previously.

The DNA of the present invention may contain the nucleotide sequence represented by the above formula (II) and at least one other nucleotide sequence bonded to its 5 'end and / or 3' end. . Examples of the DNA containing the base sequence represented by the formula (II) and at least one other base sequence include the following DNAs (1) to (5). (1) The above formula (I
I) (ie, 1-354 of SEQ ID NO: 4)
Base sequence).

[0039] (2) formula (II) nucleotide sequence represented by the binding in its 5 'end the following formula: TGCAGCGTGG AGAACGGCGG CTGCGAGCAC GCGTGCAATG CGATCCCTGG GGCTCCCCGC TGCCAGTGCC CAGCCGGCGC CGCCCTGCAG GCAGACGGGC GCTCCTGCAC CGCATCCGCG ACGCAGTCCT GCAACGACCT CTGCGAGCAC TTCTGCGTTC CCAACCCCGA CCAGCCGGGC TCCTACTCGT GCATGTGCGA GACCGGCTAC CGGCTGGCGG CCGACCAACA CCGGTGCGAG GACGTGGATG ACTGCATACT GGAGCCCAGT CCGTGTCCGC AGGCTG DNA obtained by binding a base sequence represented by TGT CAACACACAG GGTGGCTTCG AGTGCCACTG CTACCCCTAAC TACGACCTGG TGGACGGCGA GTGT (that is, the base sequence of 1-708 of SEQ ID NO: 9).

(3) 5 'of the base sequence represented by the formula (II)
End and a 3 'husband terminus s following equation: TGCAGCGTGG AGAACGGCGG CTGCGAGCAC GCGTGCAATG CGATCCCTGG GGCTCCCCGC TGCCAGTGCC CAGCCGGCGC CGCCCTGCAG GCAGACGGGC GCTCCTGCAC CGCATCCGCG ACGCAGTCCT GCAACGACCT CTGCGAGCAC TTCTGCGTTC CCAACCCCGA CCAGCCGGGC TCCTACTCGT GCATGTGCGA GACCGGCTAC CGGCTGGCGG CCGACCAACA CCGGTGCGAG GACGTGGATG ACTGCATACT GGAGCCCAGT CCGTGTCCGC AGCGCTGTGT CAACACACAG GGTGGCTT CG AGTGCCACTG CTACCCTAAC TACGACCTGG TGGACGGCGA GTGT and GACTCCGGCA AGGTGGACGG TGGCGACAGC GGCTCTGGCG AGCCCCCGCC CAGCCCGACG CCCGGCTCCA CCTTGACTCC TCCGGCCGTG GGGCTCGTGC ATTCGGGC with DNA base sequence is bonded represented (i.e., the base sequence of 1-816 of SEQ ID NO: 11).

(4) 5 'of the base sequence represented by the formula (II)
End and a 3 'husband terminus s following equation: GCACCCGCAG AGCCGCAGCC GGGTGGCAGC CAGTGCGTCG AGCACGACTG CTTCGCGCTC TACCCGGGCC CCGCGACCTT CCTCAATGCC AGTCAGATCT GCGACGGACT GCGGGGCCAC CTAATGACAG TGCGCTCCTC GGTGGCTGCC GATGTCATTT CCTTGCTACT GAACGGCGAC GGCGGCGTTG GCCGCCGGCG CCTCTGGATC GGCCTGCAGC TGCCACCCGG CTGCGGCGAC CCCAAGCGCC TCGGGCCCCT GCGCGGCTTC CAGTGGGTTA CGGGAGACAA CAACACCAGC TATAGCAG GT GGGCACGGCT CGACCTCAAT GGGGCTCCCC TCTGCGGCCC GTTGTGCGTC GCTGTCTCCG CTGCTGAGGC CACTGTGCCC AGCGAGCCGA TCTGGGAGGA GCAGCAGTGC GAAGTGAAGG CCGATGGCTT CCTCTGCGAG TTCCACTTCC CAGCCACCTG CAGGCCACTG GCTGTGGAGC CCGGCGCCGC GGCTGCCGCC GTCTCGATCA CCTACGGCAC CCCGTTCGCG GCCCGCGGAG CGGACTTCCA GGCGCTGCCG GTGGGCAGCT CCGCCGCGGT GGCTCCCCTC GGCTTACAGC TAATGTGCAC CGCGCCGCCC GAGCGGTCC AGGGGCACTG GGCCAGGGAG GCGCCGGGCG CTTGGGACTG CAGCGTGGAG AACGGCGGCT GCGAGCACGC GTGCAATGCG ATCCCTGGGG CTCCCCGCTG CCAGTGCCCA GCCGGCGCCG CCCTGCAGGC AGACGGGCGC TCCTGCACCG CATCCGCGAC GCAGTCCTGC AACGACCTCT GCGAGCACTT CTGCGTTCCC AACCCCGACC AGCCGGGCTC CTACTCGTGC ATGTGCGAGA CCGGCTACCG GCTGGCGGCC GACCAACACC GGTGCGAGGA CGTGGATGAC TGCATACTGG AGCCCAGTCC GTG TCCGCAG CGCTGTGTCA ACACACAGGG TGGCTTCGAG TGCCACTGCT ACCCTAACTA CGACCTGGTG GACGGCGAGT GT and GACTCCGGCA AGGTGGACGG TGGCGACAGC GGCTCTGGCG AGCCCCCGCC CAGCCCGACG CCCGGCTCCA CCTTGACTCC TCCGGCCGTG GGGCTCGTGC ATTCGGGC with DNA base sequence is bonded represented (i.e., the base sequence of 1-1494 of SEQ ID NO: 5).

(5) A DNA comprising the nucleotide sequence of 1-1386 of SEQ ID NO: 15. GCACCCGCAG AGCCGCAGCC GGGTGGCAGC CAGTGCGTCG AGCACGACTG CTTCGCGCTC TACCCGGGCC CCGCGACCTT CCTCAATGCC AGTCAGATCT GCGACGGACT GCGGGGCCAC CTAATGACAG TGCGCTCCTC GGTGGCTGCC GATGTCATTT CCTTGCTACT GAACGGCGAC GGCGGCGTTG GCCGCCGGCG CCTCTGGATC GGCCTGCAGC TGCCACCCGG CTGCGGCGAC CCCAAGCGCC TCGGGCCCCT GCGCGGCTTC CAGTGGGTTA CGGGAGACAA CAACACCAGC TATAGCAGGT GGGCACGGCT CGACCTCAAT GGGGCTCCCC TCTGCGGCCC GTTGTGCGTC GCTGTCTCCG CTGCTGAGGC CACTGTGCCC AGCGAGCCGA TCTGGGAGGA GCAGCAGTGC GAAGTGAAGG CCGATGGCTT CCTCTGCGAG TTCCACTTCC CAGCCACCTG CAGGCCACTG GCTGTGGAGC CCGGCGCCGC GGCTGCCGCC GTCTCGATCA CCTACGGCAC CCCGTTCGCG GCCCGCGGAG CGGACTTCCA GGCGCTGCCG GTGGGCAGCT CCGCCGCGGT GGCTCCCCTC GGCTTACAGC TAATGTGCAC CGCGCCGCCC GGAGCGGTCC AGGGGCACTG GGCCAGGGAG GCGCCGGGCG CTTGGGACTG CAGCGTGGAG AACGGCGGCT GCGAGCACGC GTGCAATGCG ATCCCTGGGG CTCCCCGCTG CCAGTGCCCA GCCGGCGCCG CCCTGCAGGC AGACGGGCGC TCCTGCACCG CATCCGCGAC GCAGTCCTGC AACGACCTCT GCGAGCACTT CTGCGTTCCC AACCCCGACC AGCCGGGCTC CTACTCGTGC ATGTGCGAGA CCGGCTACCG GCTGGCGGCC GACCAACACC GGTGCGAGGA CGTGGATGAC TGCATACTGG AGCCCAGTCC GTGTCCGCAG CGCTGTGTCA ACACACAGGG TGGCTTCGAG TGCCACTGCT ACCCTAACTA CGACCTGGTG GACGGCGAGT GTGTGGAGCC CGTGGACCCG TGCTTCAGAG CCAACTGCGA GTACCAGTGC CAGCCCCTGA ACCAAACTAG CTACCTCTGC GTCTGCGCCG AGGGCTTCGC GCCCATTCCC CACGAGCCGC ACAGGTGCCA GATGTTTTGC AACCAGACTG CCTGTCCAGC CGACTGCGAC CCCAACACCC AGGCTAGCTG TGAGTGCCCT GAAGGCTACA TCCTGGACGA CGGTTTCATC TGCACGGACA TCGACGAGTG CGAAAACGGC GGCTTCTGCT CCGGGGTGTG CCACAACCTC CCCGGTACCT TCGAGTGCAT CTGCGGGCCC GACTCGGCCC TTGTCCGCCA CATTGGCACC GACTGT

Human DNA closely related to the present invention
Can be obtained, for example, as follows. (1) Using an antibody obtained from a rabbit, which is specific for a peptide derived from human lung and capable of promoting protein C activation of thrombin, a peptide that binds to the antibody is extracted from a cDNA library prepared from human lung. The encoding cDNA fragment is isolated, and the nucleotide sequence of the isolated cDNA fragment is analyzed. The resulting cDNA fragment encodes a portion of a human lung-derived peptide capable of promoting protein C activation of thrombin. That portion includes the C-terminus but not the N-terminus of the peptide. (2) As described above, the obtained cDNA fragment does not encode the entire amino acid sequence of the peptide derived from human lung, and lacks the nucleotide sequence corresponding to the N-terminal amino acid sequence of the peptide. CD encoding amino acid sequence
The NA fragment is obtained as follows by a usual known primer extension method using the cDNA fragment obtained in the above step (1).

First, the cDNA obtained in the above step (1)
A part of the cDNA fragment corresponding to the N-terminal amino acid sequence of the peptide encoded by the fragment is organically synthesized. Next, using the synthesized DNA as a primer, the 5′-end upstream of the 5 ′ end of the cDNA fragment obtained in the above step (1) from poly (A) ⁺ RNA prepared from human umbilical endothelial cells by a known primer extension method. A cDNA fragment having a nucleotide sequence is obtained. By repeating the above primer extension, a cDNA fragment containing the N-terminal amino acid sequence of the peptide derived from human lung and further encoding the leader sequence described below on the N-terminal side is obtained.

(3) Next, the cDNA fragments obtained in the above steps (1) and (2) are appropriately ligated to open-read 1725 base pairs (hereinafter abbreviated as “bp”) starting from the initiation codon. CDN containing frame
A (hereinafter abbreviated as "cDNA-A"). The nucleotide sequence of this open reading frame is SEQ ID NO: 10
1-1725. In addition, if the nucleotide sequence encoding the leader sequence is excluded and the nucleotide sequence is derived from the N-terminal amino acid sequence of the peptide derived from human lung, the nucleotide sequence is 1 to 1671 of SEQ ID NO: 12. This cDNA-
From A, a cDNA having a nucleotide sequence substantially equivalent to the nucleotide sequence of the above-mentioned DNAs (1) to (5) can be obtained by deleting the following portions by a site-directed mutagenesis method.

(I) In preparing a cDNA containing a nucleotide sequence substantially equivalent to the nucleotide sequence of DNA (4), the portion to be deleted is as follows from the first nucleotide of the start codon in the open reading frame. It is the portion from the 1549th to 1725th bases counted. (Ii) In preparing a cDNA having a nucleotide sequence substantially equivalent to the nucleotide sequence of DNA (5), the portion to be deleted is 1441 counted from the first nucleotide of the start codon in the open reading frame. The portion from the 1st to the 1725th base. (iii) In preparing a cDNA having a nucleotide sequence substantially equivalent to the nucleotide sequence of DNA (3), the portion to be deleted is 55% counted from the first base of the start codon in the open reading frame. The portion from the 732-th base and from the 1549-th base to the 1725-th base.

(Iv) In preparing a cDNA having a nucleotide sequence substantially equivalent to the nucleotide sequence of DNA (2), the portion to be deleted is as follows from the first nucleotide of the start codon in the open reading frame. Counting from 55th to 732th and 1441th from 1
It is the portion up to the 725th base. (v) In preparing a cDNA having a nucleotide sequence substantially equivalent to the nucleotide sequence of DNA (1), the portion to be deleted may be 55% counted from the first base of the start codon in the open reading frame. The portion from the 1086th base and the 1441th to the 1725th base.

The nucleotide sequence of each cDNA thus obtained is analyzed by a known method, and it is confirmed that the nucleotide sequence matches the nucleotide sequences of DNAs (1) to (5). The above DNA of the present invention can also be obtained by organic chemical synthesis. The DNA of the present invention can also be prepared from the precursor DNA without performing the above-mentioned primer extension. The precursor DNA can be obtained from a human chromosomal DNA library by a usual hybridization method using a DNA fragment obtained in the above step (1) or a synthetic DNA prepared based on the base sequence of the DNA fragment as a probe.

As described above, the DNA of the present invention containing the base sequence of the formula (II) is a leader represented by the following formula: Met Leu Gly Val Leu Val Leu Gly Ala Leu Ala Leu Ala Gly Leu Gly Phe Pro The nucleotide sequence encoding the sequence may be contained as a 5'-terminal nucleotide sequence, and the whole or a part of the leader sequence can be deleted usually in expression in cells or the like.

According to the present invention, D
NA is also provided. According to the present invention, the above DNA and its complementary DNA may complementarily bind to each other to form a double-stranded DNA. The DNA of the present invention can also contain a nucleotide sequence encoding a peptide having a structure corresponding to a homologous mutant of any of the aforementioned peptides.

According to the degeneracy of the genetic code, at least one base in the base sequence of the gene can be replaced with another type of base without changing the amino acid sequence of the polypeptide produced from the gene. Therefore, the DN of the present invention
A can also contain a base sequence altered by substitution based on the degeneracy of the genetic code. in this case,
The amino acid sequence deduced from the nucleotide sequence obtained by the above substitution matches the amino acid sequence defined previously. That is, the present invention relates to DNAs encoding the amino acid sequences of the aforementioned various peptides or DNAs complementary thereto.

Further, according to the present invention, there is provided a replicable recombinant DNA comprising the above-mentioned DNA of the present invention and a replicable expression vector. The recombinant DNA comprises
The peptide of the present invention can be expressed in a microorganism or cell transformed thereby. Examples of suitable vectors include plasmids pBR322, pBR32
7, YRp7, pSV2-dhfr (ATCC 371
46), pBPV-1 (9-1) (ATCC 3711)
1) and the like. It is necessary to select an expression vector suitable for a microorganism or cell used as a host.

Further, the present invention also relates to a microorganism or a cell transformed with the above-mentioned replicable recombinant DNA. Examples of microorganisms include Escherichia coli (Esc
strains such as E. coli K12 strain 294 (ATCC 314).
46), E. coli B, E. coli X1776 (ATCC 3153)
7), E. coli C600 and E. coli C600hfl and E. coli W3110 (F-, λ-, prototrophy, ATCC 27375); A strain of the genus Bacillus; Salmonella typhimu;
rium) or Serratia Mercense (Serra)
intestinal bacteria other than Escherichia coli, such as Tia marcesan; various strains of the genus Pseudomonas; and Saccharomyces cerevisiae (Sac).
(Caromyces cerevisiae) and the like. Examples of cells include VERO (ATCC
CCL-81) cells, Chinese hamster ovary (C
HO) cell lines, animal cells such as BHK, COS-7 and MDCK cell lines. As a human cell,
HeLa cells, WI38 and the like.

For example, taking the case of a gene encoding the amino acid sequence of 1 to 575 of SEQ ID NO: 7 as an example,
In vivo, it is expressed on the vascular endothelial cell membrane with the following primary structure (that is, the amino acid sequence of 1 to 557 in SEQ ID NO: 13).

[0055] Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys Val Glu His Asp Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu Asn Ala Ser Gln Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser Ser Val Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly Val Gly Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys Gly Asp Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp Val Thr Gly Asp Asn Asn hr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn Gly Ala Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu Ala Thr Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val Lys Ala Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg Pro Leu Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr Tyr Gly Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala Leu Pro Val Gly Ser Ser Ala Ala Val Alaro Leu Gly Leu Gln Leu Met Cys Thr Ala Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro Gly Ala Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Arg Leula Ala Asp Gln His Arg Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro Ala Aspys Asp Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys Asp Ser Gly Lys Val Asp Gly Gly Asp Ser Gly Ser Gly Glu Pro Pro Pro Ser Pro Thr Pro Gly Ser Thr Leu Thr Pro Pro Ala Val Gly Leu Val His Ser Glyeu Leu Ile Gly Ile Ser Ile Ala Ser Leu Cys Leu Val Val Ala Leu Leu Ala Leu Leu Cys His Leu Arg Lys Lys Gln Gly Ala Ala Arg Ala Lys Met Glu Tyr Lys Cys Ala Ala Pro Ser Lys Glu Val Val Leu Gln His Val Arg Thr Glu Arg Thr Pro Gln Arg Leu

When the above gene is expressed in COS cells, CHO cells or _C127 cells by genetic engineering,
Similarly, since it is expressed and concentrated on the cell membrane and no activity is detected in the culture solution, it is prepared in the presence of a surfactant such as Triton X-100. However, the sequence from the C-terminal of the amino acid sequence of the peptide on and after the 59th position Leu Leu Ile Gly Ile Ser Ile Ala Ser Leu Cys Leu Val Val Ala Leu Leu Al Ay Lau Leu Lys EuLug Glu Tyr Lys Cys Ala Ala Pro Ser Lys Glu Val Val Leu Gln His Val Arg Thr Glu Arg Thr Pro Gln Arg Leu A form that can be detected in a form that can be secreted in the form of a solution that can be secreted by removing the soluble liquid in the culture that can be detected.

The method for producing the peptide of the present invention is the same as described above. The DNA is inserted downstream of a DNA region such as a promoter of a replicable expression vector to obtain a replicable recombinant DNA having the DNA, and the obtained recombinant DNA is used to transform a microorganism or a cell. A transformant containing somatic DNA is obtained. The resulting transformant is isolated from a microorganism or a parent cell of a cultured cell depending on the phenotype given to the recombinant DNA. The resulting transformant is cultured to express the genetic information of the DNA to produce the peptide of the present invention.

In the step (d) of the above-mentioned method for producing the peptide, when the transformant is cultured to produce the peptide, it is determined that no serum is contained or the serum is contained in Table 4 in Example 5 of the present specification. This peptide was shown to increase when cultured in a medium with a reduced content thereof, indicating that this is a useful method. Therefore, when produced by this method, a peptide substantially free of serum-derived protein is obtained, which is extremely excellent as a pharmaceutical composition. Further, as in this embodiment, polidocanol (Lubrol)
When the peptide is purified in the presence of a surfactant such as PX), the resulting pharmaceutical composition of the present invention contains a surfactant.

The DNA of the present invention and the recombinant DNA
It is preferable to use a host-vector system using a prokaryotic cell as a host in order to clone a DNA sequence necessary for constructing E. coli, such as a promoter and an origin of replication.

Examples of prokaryotic cells include strains of Escherichia coli, such as E. coli K12 strain 294 (ATCC).
31446), E. coli B, E. coli X1776 (ATCC 315)
37), E. coli C600 and E. coli C600hfl and
E. coli W3110 (F-, λ-, Prototrophy, ATCC 27375); Bacillus
Strains of the genus Bacillus, such as Bacillus subtilis; Salmonella typhimurium
imurium) or Serratia mercense (Se
intestinal bacteria other than Escherichia coli, such as P. cerevisiae; Pseudomonas
Various strains of the genus Genus; and Saccharomyces cerevisiae
e) and the like.

[0061] Of these bacteria, E. coli K12 strain 294 is most preferred. When the above microorganisms are used as hosts, plasmid vectors suitable for these microorganisms are generally used as expression vectors capable of replicating recombinant DNA. For example, plasmids pBR322 and pBR327 can be used as plasmid vectors for transforming Escherichia coli. Plasmid vectors usually contain an origin of replication, a promoter, a marker gene that gives the recombinant DNA a phenotype useful for selecting cells transformed with the recombinant DNA, and the like.

Examples of the promoter include β-lactamase and lactose promoter, tryptophan promoter and the like. Examples of the marker gene include an ampicillin resistance gene and a tetracycline resistance gene. On the other hand, in order to express the DNA of the present invention to produce the peptide of the present invention, a host-vector system using the above prokaryotic cells as a host and a host using eukaryotic cells such as vertebrate cells as host cells -Vector systems can be used. Examples of eukaryotic cells include cells such as the animal cell lines described above.

In order to express the DNA of the present invention in the aforementioned eukaryotic cells, the recombinant DNA of the present invention generally contains a functional sequence for controlling gene expression, for example, an origin of replication, upstream of the DNA of the present invention. It contains a promoter to be located, a ribosome binding site, a polyadenylation site, and a transcription termination sequence. Such functional sequences that can be used to express the DNA of the present invention in eukaryotic cells can be obtained from viruses and viral substances.

For example, promoters that can be used in the present invention include adenovirus 2, polyoma virus,
It can be obtained from Simian virus 40 (SV40) or the like. In particular, the main late promoter of adenovirus 2 and the early and late promoters of SV40 are preferred.
In addition, a promoter originally present at a position upstream of a gene encoding a peptide derived from human lung, which has an action to promote the activation of protein C of thrombin, is also used in the above-described host-
Any suitable for use in a vector system can be used.

With respect to the origin of replication, foreign sources such as adenovirus, polyoma, SV40, vesicular stomatitis virus (VSV), bovine papilloma virus (BP)
A replication origin derived from a virus such as V) can be used. When a vector having the property of being integrated into a host chromosome is used as an expression vector, the origin of replication of the host chromosome can be used.

The microorganism or cell transformed with the replicable recombinant DNA of the present invention is, as described above, a parental strain that has not been transformed by at least one phenotype given to the recombinant DNA. Sorted from cells. The phenotype can be conferred by inserting at least one marker gene into the recombinant DNA. Alternatively, a marker gene originally possessed by a replicable expression vector can be used. Examples of the marker gene include a drug resistance gene such as neomycin resistance and a gene encoding dihydrofolate reductase (hereinafter referred to as "DHFR"). In this regard, DHF
When the R gene is used as a marker gene, DHFR
There are various types of DHFR, and the host to be used must be selected according to the type of DHFR encoded by the marker gene to be used.

For example, wild-type DH may be used as a marker gene.
When a gene encoding FR is used, D
Preferably, an HFR-deficient strain is used. Since the DHFR-deficient strain requires hypoxanthine, glycine and thymidine, it cannot grow in a medium free of hypoxanthine, glycine and thymidine. However, when a DHFR-deficient strain is transformed with a recombinant DNA containing the DHFR gene, the strain no longer requires hypoxanthine, glycine and thymidine and can grow in a medium free of hypoxanthine, glycine and thymidine. it can. Thus, the transformed cells can be easily selected from the cells that have not been transformed and are determined based on the auxotrophy for hypoxanthine, glycine and thymidine.

On the other hand, when a gene encoding a mutant DHFR having low affinity for methotrexate (MTX) (hereinafter referred to as “MTX-resistant DHFR gene”) is used as a marker gene, the host cell can be treated with normal DHF.
It is only necessary to have a gene encoding R, and it is not necessary that DHFR is deleted. The reason is as follows. Because normal DHFR is inhibited by MTX, host cells containing the gene encoding normal DHFR are
It requires hypoxanthine, glycine and thymidine in the presence of TX.

However, when the host cell is transformed with the recombinant DNA containing the MTX resistant DHFR gene, the transformed cell no longer requires hypoxanthine, glycine and thymidine in the presence of MTX. Thus, transformed cells can be selected from untransformed cells using auxotrophy for hypoxanthine, glycine and thymidine in the presence of MTX as a criterion. In this regard, the majority of eukaryotic cells have M
Because it is TX sensitive, the MTX resistant DHFR gene is convenient to use as a marker gene.

Saccharomyces cerevisiae (Sacch)
Yeasts such as Aromyces cerevisiae) can also be used as hosts for expressing the DNA of the present invention. In order to express the DNA of the present invention in yeast, for example, plasmid YRp
7 can be used. Plasmid YRp7 is trp
1 gene, and this trpl gene can be used as a marker gene.

Examples of promoters for expression vectors for yeast cells include 3-phosphoglycerate kinase or enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, and glucose-6.
-Promoters of genes of enzymes involved in glycolysis such as phosphate isomerase, glucokinase, alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, enzymes involved in nitrogen metabolism, enzymes involved in the use of maltose and lactose And the promoter of the gene. Among these, the promoters of the genes for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, enzymes involved in nitrogen metabolism, glyceraldehyde-3-phosphate dehydrogenase, and enzymes involved in the use of maltose and lactose are Is advantageously controlled by changing the culture conditions of the host.

As the origin of replication, termination codon, and other DNA sequences for controlling transcription and translation in yeast cells, ordinary known DNA sequences suitable for yeast cells can be used. The transformed microorganism or cell can be cultured in a conventional nutrient medium by a known method to express the DNA encoding the peptide of the present invention, thereby producing the peptide of the present invention. After culturing, the peptide of the present invention can be isolated from a culture of the transformant using a known method, for example, column chromatography or the like. It is usually carried out to substantially purify.

The peptide thus obtained may contain at least one type of sugar chain of various types and lengths, or may be a mixture of peptides having a plurality of amino acid sequences. Whether or not the obtained peptide contains a sugar chain depends on the type of host cell used. Further, when the peptide contains a sugar chain, the type and length of the sugar chain also vary depending on the type of host cell used.

It is generally known that a peptide translated from the translation initiation signal ATG undergoes processing when secreted from a host cell to become a mature protein.
The peptide of the present invention may be subjected to such processing. The site where the peptide undergoes processing may vary from host to host or from culture conditions. For example, the peptide of the present invention is the same as the peptide represented by the formula (I),
When produced in a transformed cell in an unprocessed immature form containing a leader sequence consisting of 10 amino acids, the immature form peptide is processed to remove the leader sequence and become a mature form There is. However, as described above, the position at which the immature peptide is processed varies depending on the type of host used and the culture conditions of the host, so that the above-described processing does not always occur.

As described above, the peptide of the present invention having the effect of promoting the activation of protein C by thrombin can be produced by a method using recombinant DNA technology. The peptide of the present invention can also be produced by an ordinary known method, for example, by organic synthesis using a commercially available automatic peptide synthesizer or the like. The peptide of the present invention has an action to promote the activation of protein C by thrombin. Protein C is a vitamin K-dependent protein that plays an important role in the blood coagulation / fibrinolysis mechanism and is activated by the action of thrombin. Active protein C inactivates blood coagulation coenzyme active factor V and active factor VII in vivo and is involved in the production of plasminogen activator having thrombolytic action It is known. [Koji Suzuki, History of Medicine, Vol. 125, pp. 901 (1983)].

The peptide of the present invention promotes the activation of protein C by thrombin to produce a large amount of active protein C having an anticoagulant effect and a thrombolytic effect. Therefore, the peptide of the present invention greatly contributes to anticoagulation and thrombolysis in a living body. As described above, the pharmaceutical composition prepared according to the present invention has an anticoagulant effect, a platelet aggregation inhibitory effect and a thrombolytic effect, and therefore, a pharmaceutical composition for controlling blood coagulation or for controlling platelet aggregation. For example, myocardial infarction, thrombosis, embolism, peripheral vascular occlusion, atherosclerosis, intravascular coagulation (DIC), angina, It can be used for the treatment and prevention of diseases such as transient cerebral ischemic attack and preeclampsia.

In forming a pharmaceutical composition, the peptide of the present invention may be mixed with a carrier that can be used as a drug. That is, a pharmaceutical composition suitable for effective administration to a patient can be prepared by mixing an effective amount of the peptide of the present invention for treating or preventing the above-mentioned diseases with an appropriate amount of a carrier. . Carriers that can be used as drugs include, for example, methylcellulose, carboxymethylcellulose and the like. It is preferable that the pharmaceutical composition of the present invention is a lyophilized preparation. Further, the pharmaceutical composition of the present invention is preferably used as an injection preparation.
Further, it is preferable to use a preparation for intravenous drip infusion.

When used as an injection, the above-mentioned carrier is preferably a carrier that can be administered as a drug and can be made into an injectable solution. Examples of the carrier include sucrose, purified gelatin, albumin, mannitol and the like. , One or more selected from the group consisting of glucose and sodium chloride are exemplified, and it is also preferable to add a pH adjuster of various inorganic salts and the like,
In that case, the combination with the soluble peptide of the present invention is preferable because it is soluble as a whole pharmaceutical composition and can be freeze-dried cleanly. In the present invention, it is also preferable that the carrier is glycerin. The above-mentioned carrier is preferably added at the time of preparing a preparation, but is also allowed to be added at the time of dissolving at the time of use.

The dose of the peptide of the present invention per adult dose varies depending on the age, sex, body weight, symptoms, etc., but is generally about 0.1 to 200 mg, and is once a day or several times as needed. For example, a method for administration by intravascular injection, preferably intravenous drip is exemplified. The present inventors,
It has been confirmed that the peptide of the present invention is extremely useful with few side effects.
In the case of v administration, about 3 mg / Kg did not cause any deaths or harms, and an effective effect was observed. Therefore, the above dose was suggested to be appropriate considering that the human body weight was about 60 to 70 Kg. You.

The second invention of the present invention is a method for producing an antibody against the above-mentioned recombinant peptide. For example, in view of the usefulness of the above-mentioned peptide as a medicine, in the case where these substances are used as a medicine, it is necessary to detect or measure the administered peptide, and it is present on the cell surface in a human body, It is necessary to detect and measure a peptide that binds to thrombin and promotes protein C activation by thrombin. As one of the means, it was necessary to consider preparing antibodies using these substances as antigens. .

Conventionally, attempts have been made to generate antibodies against human-derived peptides. However, since the substance used as the antigen is an extract from a natural product and a membrane protein, it is completely different from other human-derived substances. It is not possible to eliminate the contaminant component, and it is carried out because there is no other method, but it is not always a method for efficient antibody production. On the other hand, according to the present invention, a recombinant peptide substantially free of other human-derived contaminant components can be obtained, and by using this recombinant peptide as an antigen, an extra antibody against human-derived contaminant components can be produced. However, a method for producing an antibody which is much more efficient than the conventional method is disclosed. Of course, it is naturally understood that according to the present invention, a large amount of purified peptide can be easily obtained and can be easily used as an antigen.

As described in Reference Example 2 (5) of the present specification, this antibody can be produced by the method described in Practical Immunology (L. Hudson et al., L. Hudson et al.). Practical Imm
unology) 1st edition; 1976, 2nd edition; 198
Year 0, Blackwell Scientific Publications (Blackwell Scientif)
ic Publications)]. For example, the publication includes In
In the section on initial preparations,
Along with the general description, various elements required for antibody production, for example, various Antigens and the like are disclosed, and the section of Antisera as those antibodies is raised. In the second half, Hybridoma
cell and monoclonal antib
Ody's section is newly created, and by referring to these books, the antibody of the present invention can be easily obtained.

Further, when a peptide that binds to thrombin and that promotes protein C activation by thrombin, which is disclosed by the present invention and has an amino acid sequence, is used as an antigen, it binds to thrombin, and It is easily predicted that an antibody that directly recognizes an active site that promotes protein C activation by thrombin can be obtained with high probability, and the features of the present invention can be fully understood. Examples of the peptide having the shorter amino acid sequence include a peptide having the amino acid sequence of 1-498 of SEQ ID NO: 3. More preferably, 1-1 of SEQ ID NO: 1, which is a shorter amino acid sequence
And a peptide consisting of 18 amino acid sequences. Of course, in an antibody prepared using a peptide consisting of the amino acid sequence of 1-498 of SEQ ID NO: 3 as an antigen, it is possible to obtain antibodies for all sites not related to the membrane binding site. Preferred cases are also envisaged because antibodies can be made that recognize and bind to thrombin and recognize sites that are not related to the active site that promotes protein C activation by thrombin.

[0084]

EXAMPLES The present invention will be described in more detail with reference to Examples and Examples to describe the present invention in more detail. However, the scope of the present invention is not limited only to these Examples. Reference Example 1 (Measurement of the effect of promoting protein C activation) The activity of the peptide of the present invention to promote protein C activation was measured using a synthetic substrate Boc-Leu-Ser-Thr-Arg-MC.
A (Boc and MCA are abbreviations of t-butoxycarbonyl group and 4-methylcoumaryl-7-amide, respectively) [A known method for measuring protein C [Y. Ohno, et al., The Journal of Biochemistry (J. Biochem.) 90 volumes, 1387
(1981)]. That is, 5 μl of an aqueous solution containing protein C (final concentration of 0.5 μM) and thrombin (final concentration of 80 nM) was added to 5 μl of an aqueous solution containing the peptide of the present invention (0 to 0.01 A ₂₈₀ / m).
l), and NaCl, CaCl ₂ , serum albumin and Tris-HCl buffer (pH 7.4) were added thereto at final concentrations of 0.15 M, 2.5 mM, 1 mg / ml and 2 mg, respectively.
Added to 0 mM and to a total volume of 30 μl. The resulting mixture was reacted at 37 ° C. for 15 minutes to activate protein C, and then 10 μl of an aqueous solution containing 10 μl of 2 μM antithrombin III and 10 units / ml of heparin was added, followed by heating at 37 ° C. for 15 minutes. To stop the reaction.

The obtained reaction mixture was mixed with the above-mentioned synthetic substrate B.
oc-Leu-Ser-Thr-Arg-MCA [Peptide Research Institute of Protein Research (Peptide)
Institute (Japan)], 250 μl of 20 mM Tris-HCl buffer (pH 7.4) containing 200 μM, and the mixture was reacted at 37 ° C. for 10 minutes.
The reaction was stopped by adding 5 ml, and the released AMC
The concentration of (7-amino-7-methyl-coumarin) was measured at an excitation wavelength of 380 nm and an emission wavelength of 440 nm using a fluorescence spectrophotometer R.
It was measured by F-540 type (manufactured by Shimadzu Corporation, Japan).
The amount of released AMC was determined by comparing the obtained fluorescence intensity with the fluorescence intensity of AMC of a known concentration. Values are expressed as the amount of AMC generated per minute. The value obtained by subtracting the amount of AMC when the aqueous solution not containing the peptide of the present invention is added from the amount of AMC indicates the strength of the sample to promote protein C activation by thrombin.

Here, protein C was obtained from human plasma by the method of Suzuki et al. [Suzuki et al., The Journal.
Of biological chemistry (J. Biol.
Chem. , 258, 1914 (1983 etc.)]. Human thrombin was prepared by the method of Lundblad et al. [Lundblad et al., Biochemical and Biophysical Research Communication (Bi).
ochem. Biophys. Res. Commu
n. 66, 482 (1975)].

[0087] Reference Example 2 (1): human lung cDNA library obtained) lung poly (A) ⁺ bacteriophage .lambda.gt ₁₁ cDNA library prepared from RNA of human, USA, Clontech (Clontech LABORATOR
ies, Inc. , 922 Industrial, A
ve. Palo Alto, CA94303) (catalog number HL1004).

(2): (Protein C by thrombin
Purification of Glycopeptides that Promote Activation) Glycopeptides that promote protein C activation were obtained by extraction from human lung as follows. Approximately 800g of human lung specimen provided by a public hospital with scissors
After shredding to a size of about m square, 1 mM DFP (Diisopropyl fluor) was added to the obtained tissue piece.
500 m cooled to 4 ° C.
l of saline and add A as a Waring blender
Using ce Homogenizer AM-1 (manufactured by Nippon Seiki Co., Ltd., Japan), homogenization was performed at 4 ° C. for 5 minutes. After homogenization, the mixture was cooled in ice for 5 minutes.
The mixture was then homogenized at 4 ° C. for 5 minutes and cooled in ice for 5 minutes. The above homogenization and cooling operations were repeated three more times. The obtained homogenate was 12.0
Centrifuge at 00 g at 4 ° C. for 30 minutes to separate the supernatant and pellet, and collect the pellet. 0.5% to this
(V / v) Triton X-100, 0.25M sucrose, 1m
100 ml of 0.02 M Tris-HCl buffer (pH 7.5) containing M benzamidine hydrochloride and 0.5 mM CaCl ₂
And homogenized 5 times at 4 ° C. for 5 minutes using a Waring blender to obtain a cell extract.

The obtained extract was 35,000 g, 10 ° C.
The supernatant was collected by centrifugation at for 60 minutes. NL Esmon et al. [The Journal of Biological Chemistry (J. Bio)
l. Chem. , 257, 859 (1982)
Year)) and DIP-thrombin [diisopropylphosphorothrombin (diisopro).
Pylphosphoro-thrombin was obtained by the method of P. Cuatrecasas [(The Journal of Biological Chemistry (J. Biol. Chem.), 245, 3
059 (1970)] to produce DIP-thrombin-agarose.

Next, DIP-thrombin-agarose was packed into a column having a size of 2.5 cmφ × 10 cm, and
An IP-thrombin-agarose column was prepared and at room temperature 0.1 M NaCl, 0.5 mM CaCl ₂ , 1 mM
Benzamidine hydrochloride, 0.5% (v / v) Lubrol
The column was equilibrated with a 0.02 M Tris-HCl buffer (pH 7.5) containing PX (manufactured by Hanoi Chemicals, Japan). Next, the above-mentioned extracted supernatant was applied to a column. The column was filled with 0.3 M NaCl, 0.5 mM CaCl ₂ , 1 mM
Benzamidine hydrochloride, 0.5% (v / v) Lubrol
0.02 M Tris-HCl buffer containing PX (pH 7.
After washing in 5), 1 M NaCl, 0.1 mM ED
TA, 1 mM benzamidine hydrochloride 0.5% (v / v) L
0.02 M Tris-HCl buffer containing ubrolPX (p
H7.5), and fractions were collected in 2.0 ml fractions. For each fraction obtained by elution, the ability of thrombin to promote protein C activation was measured by the method described above. At the same time, the absorbance (A ₂₈₀ ) of each fraction at a wavelength of 280 nm was measured using a spectrophotometer UV-240 manufactured by Shimadzu (Japan).

The fraction having the ability to activate protein C was collected, and 0.1 M NaCl, 0.5 mM CaCl ₂ , 0.1 mM NaCl was added.
0.02M with 05% (v / v) Lubrol PX
It was dialyzed against Tris-HCl buffer (pH 7.5). The obtained dialysate was subjected to a second DIP-thrombin-agarose column chromatography. That is, the dialysis solution is 1.5 times
The sample was applied to a DIP-thrombin-agarose column having a size of cmφ × 10 cm, and 0.4 M NaCl, 0.5 mM
After washing with 0.02 M Tris-HCl buffer (pH 7.5) containing CaCl ₂ and 0.1% (v / v) LubrolPX, 0.4 M NaCl and 0.1 mM EDT were further added.
A, containing 0.1% (v / v) Lubrol PX.
Wash with 02 M Tris-HCl buffer (pH 7.5), then 1 M NaCl, 0.5 mM EDTA, 0.1%
(V / v) Elution was performed with a 0.02 M Tris-HCl buffer (pH 7.5) containing Lubrol PX.

The fraction having the ability to activate protein C was collected and further added with 0.1 M NaCl and 0.05% (v / v).
It was dialyzed against 0.02 M Tris-HCl buffer (pH 7.5) containing Lubrol PX. The obtained dialysate was subjected to a third DIP-thrombin-agarose column chromatography. The column size, washing conditions and elution conditions were exactly the same as those for the second DIP-thrombin-agarose column chromatography. The fractions obtained by elution were collected by 2 ml. The fraction having the ability to activate protein C was collected and 0.1%
M NaCl, 0.05% (v / v) Lubrol P
After dialysis against a 0.02M Tris-HCl buffer solution containing X (pH 7.5), the mixture was subjected to a fourth DIP-thrombin-agarose column chromatography of 0.9 cmφ × 8 cm. 0.35 M NaCl, 0.5 mM C
After washing with a 0.02 M Tris-HCl buffer (pH 7.5) containing aCl ₂ and 0.1% (v / v) Lubrol PX, 1 M NaCl, 0.5 mM EDTA, 0.1%
(V / v) Elution was performed with a 0.02 M Tris-HCl buffer (pH 7.5) containing Lubrol PX. Fractions obtained by elution were collected in 1.9 ml portions.

FIG. 1 shows the elution pattern of the fourth DIP-thrombin-agarose column chromatography.
Shown in Fraction numbers 48 to 56 were collected. From the absorbance of the fraction purified in this way, the molecular extinction coefficient of the obtained purified product was determined to be 10.0 (E ^1% _{1 cm}
280 nm = 10.0), and the amount of the purified product was calculated based on the definition and found to be about 500 μg. The obtained purified fraction was subjected to polyacrylamide gel concentration 5
SDS-polyacrylamide gel electrophoresis using a gradient of 〜１０10% was performed at a voltage of 50 V for 2 hours, and the band was observed by silver staining. Only a single band was confirmed.

Further, about 10 μg of this purified protein was added to 20
0 mM NaCl and 0.1% (v / v) Lubro
50 mM Tris-HCl buffer (pH 7.
5) After dialysis, ConA Sepharose (Pharmacia, Cat. No. 17-044) equilibrated with the same buffer
When the sample was applied to the column (0) (resin amount: about 1 ml) and washed sufficiently with the same buffer, this protein was adsorbed on ConA Sepharose and was not eluted in the washing solution. Then 0.5M methyl-α-D-mannopyranoside (Met
hyl-α-D-mannopyranoside)
The protein was eluted by passing through the same buffer as described above except that it contained (Sigma, U.S.A., catalog number M-6882). Therefore, this protein was found to be a so-called glycopeptide containing sugar.

(3): (Analysis of Amino Acid Sequence of Glycopeptide Promoting Protein C Activation of Thrombin) The amino acid sequence of this glycopeptide was analyzed as follows. 0.1% (v / v) of purified glycopeptide
16% aqueous solution of sodium lauryl sulfate (SDS) at room temperature
The sample is dialyzed for a time to prepare a sample for amino acid sequence analysis. Using an amino acid sequencing analyzer (Model 470A) manufactured by Applied Biosystems (USA),
According to the method of RM Hewick et al. [The Journal of Biological Chemistry (J. Biol. Chem.) 256, 7990 (1981)], Edman analysis was performed sequentially from the N-terminal side. Was. The released phenylthiohydantoin amino acid was analyzed using a high performance liquid chromatography apparatus (SP8100) manufactured by Spectrophysics (USA) and a Zorbax ODS column manufactured by DuPont (USA) to determine the amino acid sequence. As a result, a part of the amino acid sequence was clarified, and it was found that up to the eleventh from the N-terminal had the following amino acid sequence. Ala-Pro-Ala-Glu-Pro-Gln-P
ro-Gly-Gly-Ser-Gln

(4): (Preparation of DNA Probe Encoding N-Terminal Amino Acid Sequence) A DNA probe encoding the N-terminal amino acid sequence of a glycopeptide that promotes the activation of protein C by thrombin is obtained from the aforementioned N-terminal amino acid sequence. Considering the frequency of use of bases encoding amino acids in human-derived genes, [Nucleic Acid Res., Vol. 9, R4
3 (1981)] as a base sequence encoding an amino acid sequence from the N-terminus, 5'CTGGGG AGCCG
CCGGGG CTGGG GCTCG GCGGGG
The 33mer of GC3 'was also described by Otsuka et al. [E. Ohtsuka, et al.,
Deoxyinosine ("I") according to The Journal of Biological Chemistry (J. Biol. Chem.) 260, 2605 (1985)].
Is used in place of thymidylic acid) as a nucleotide sequence encoding an amino acid sequence from the N-terminus: (1) 5 ′ GCIC IGCIG AACCI CAGCC IGG3 ′ (2) 5 ′ GCICC IGCIG AGCCI CAACC IGG3 ′ (3) 5 'GCICC IGCIG AGCCI CAGCC IGG3' (4) 5 'GCIC IGCIG AACCI CAACC IGG3' 4 types of 23mer were manufactured by Applied Biosystems, USA.
It was synthesized with a type 80A DNA synthesizer, purified according to the manufacturer's manual, and described in an experimental manual [Maniatis EF, et al., Molecular Cloning (Molecular Clonin).
g), p. 122 (1982)].
T ₄ DNA kinase, and .gamma. ³² were labeled with P-ATP.

(5): (Protein C by thrombin
Rabbit antibody against a glycopeptide having an action of promoting the activation of protein C of thrombin has a function of promoting the activation of protein C by thrombin purified as described above. Using a glycopeptide derived from a certain human lung,
Book [El Hudson et al. (L. hudson et a
l. ), Practical Immunology (Practi)
cal Immunology), for example, page 9 (197)
6 years), Blackwell Scientific Publications (Blackwell Scienti)
fic Publications)].

This antibody was used for protein C by thrombin.
It was confirmed as follows that it reacts with a glycopeptide derived from human lung which has an activity of promoting activation. That is, about 10 ng of the purified protein obtained by the method described in Reference Example 2- (2) is spotted on a nitrocellulose filter. After air-drying well, this antibody was reacted as a primary antibody with a protein on a nitrocellulose filter, and then a biotinylated anti-rabbit IgG prepared by goat (Zymet Laboratories, USA, Catalog No. 62-1)
840) as a secondary antibody, and then avidin / biotinylated horseradish peroxidase (Amersham Japan, Japan, catalog number RPN.105).
When the color was developed by the method of 1), a black-brown spot was obtained.

(6): (Collection and culture of human umbilical cord endothelial cells) Human umbilical cord endothelial cells were prepared by the method of Mano et al.
Mano, et al. ), Experin Encia (E
xperientia), volume 39, page 1144 (1
983)]] and collected from a vein obtained from a fresh human umbilical cord provided by a private hospital and cultured.

Reference Example 3 (Acquisition of Recombinant DNA) (1): (Preparation of poly (A) ⁺ RNA)
Chargin (Chirgwin, JM et a)
l. ), Biochemistry (Biochemistry)
y), Vol. 18, poly (A) ⁺ RNA was prepared according to pp. 5294 (1979)].

(2): (Screening from human lung cDNA library) A cDNA library (manufactured by Clonetech, USA) obtained by incorporating cDNA prepared from human lung poly (A) ⁺ RNA into bacteriophage λgt11 was used. Infected with E. coli Y1090 (Clontech, USA) according to the manual, and transplanted to an LB medium plate so as to have about 100,000 plaques per 15 cm diameter plate. After culturing at 42 ° C for 3.5 hours, 10 mM IPTG (isopropy
l-β-D-thiogalactopyranosi
de) and then dried on a nitrocellulose filter (BA85 membrane filter, Schleicher and Shell, Germany) placed on the plate,
Incubate at 37 ° C for 3.5 hours to convert the peptide to I
Induced expression with PTG and transfer on nitrocellulose filter.

Reference Example 2- (5) in which the nitrocellulose filter was used to promote the activation of protein C of thrombin prepared in rabbits according to the manual.
After reacting the antibody against the glycopeptide obtained in the above as a primary antibody, and then reacting a biotinylated anti-rabbit IgG (manufactured by Zymed Laboratories, USA, catalog No. 62-1840) prepared with goat as a secondary antibody, avidin -Color was developed with biotinylated horseradish-derived peroxidase (Amersham Japan, Japan, catalog number RPN.1051) to isolate a positive clone. Recombinant c possessed by this positive clone
The cDNA fragment contained in DNA / λgt11 was converted to TM13
It was called.

(3): (Hybridization with DNA probe encoding N-terminal amino acid sequence) The DNA fragment TM13 obtained in Reference Example 3- (2) is the N-terminal amino acid prepared in Reference Example 2- (4). An experimental report [Silhavy et al., Experiments with Gene Fusions] determined whether or not to hybridize with a DNA probe encoding a sequence.
ents With Gene Fusions), 1
91 (1984), Cold Spring Harbor Laboratory
or Laboratory)]. D
It was found that the NA fragment TM13 did not hybridize with any of the DNA probes encoding the N-terminal amino acid sequence.

(4): (Base sequence of TM13) DNA contained in the clone obtained in Reference Example 3- (2)
The nucleotide sequence of fragment TM13 was determined by the method of Sanger et al. (Sanger, F., et al., Proceeding of National Academy of
Science USA (Proc. Natl. Ac
ad. Sci. USA), 74, 5463 (197)
7 years). The results are shown in FIGS.

(5): (Screening of Human Lung cDNA Library Using DNA Fragment TM13 as Probe) DNA fragment TM13 was digested with restriction enzymes KpnI and PvuII.
To obtain a DNA fragment of about 440 base pairs, which was labeled with ³² P by the nick translation method. This DN
Plasmid hybridization was performed from a human lung cDNA library using the A fragment as a probe to screen for positive clones. That is, the DNA of clone TM13 was digested with KpnI and PvuII, separated by polyacrylamide gel electrophoresis, extracted and purified according to a conventional method to obtain about 500 ng of a purified fragment of about 440 bp. This DNA was labeled with α- ³² P-dCTP using a nick translation kit (catalog number N.5000) manufactured by Amersham Japan (Japan) according to the attached user manual.

The DNA fragment labeled with ³² P was used as a probe in an experimental manual [Maniatis et al.,
Molecular cloning (Molecular C
loaning), p. 320 (1982), cold
Spring Harbor Laboratory (Cold Sp
plaque hybridization of a human lung cDNA library was performed in accordance with the following method. Isolate positive clones,
When the recombinant contained in the clone was analyzed with various restriction enzymes, the obtained recombinant was found to have a nucleotide sequence of about 2,400 bp which seems to encode the N-terminal nucleotide sequence of the peptide relative to TM13. It was found that the DNA fragment was integrated. This DNA fragment was designated as TM137.

(6): (Base sequence of DNA fragment TM137) The base sequence of DNA fragment TM137 obtained in (5) was determined in the same manner as in the method described in Reference Example 3- (4). The results are shown in FIGS. From these results, it can be seen that the DNA fragment TM
137 did not contain the nucleotide sequence encoding the N-terminal amino acid sequence described in Reference Example 2- (3).

(7): (Primer extension) In the base sequence of the DNA fragment obtained in Reference Example 3- (4), three types of synthetic DNA were used based on the N-terminal sequence of DNA fragment TM13. It was created in the same manner as described in 2- (4), and was named HTM131, HTM132, and HTM133. In designing the synthetic DNA, a base sequence that hybridizes with mRNA prepared from human umbilical cord endothelial cells was used. The base sequence of each synthetic DNA is as follows, and the corresponding DNA
The position in the A fragment TM13 is shown in FIG. 2, and the position in the TM137 is shown in FIG.

HTM131: 5'GACGCAGAGGTAGCTAGTTTT 3 '(20mer) HTM132: 5'AACATCTGGCCACCTG 3' (15mer) HTM133: 5'GACAGGCAGTCTGGTTTGCAA 3 '(20mer)
Using poly (A) ⁺ RNA prepared from human umbilical cord endothelial cells obtained by the method described in (1), a so-called primer extension (Primer Extension) was used.
on) to synthesize a further 5 'upstream portion of the DNA fragment TM137.

That is, about 1 μg / μl of poly (A) ⁺
About 27 ng / μl of HTM133 solution 2 in 5 μl of RNA
After adding 0 μl and heating at 65 ° C. for 20 minutes, the mixture was cooled to room temperature over about 1 hour. Thereafter, using a cDNA synthesis system (manufactured by Amersham Japan Co., Ltd., Japan, catalog number RPN1256), according to the manual, c
DNA was synthesized. However, instead of the oligo (dT) primer included in the cDNA synthesis system, HTM13
3 was carried out.

The synthesized cDNA was prepared according to the manual [Maniatis et al., Molecular Cloning, p. 241 (1982), Cold Spring Harbor Laboratory].
Laboratory)], pBR322 (ATC) with a C tail at both ends and a G tail at both ends.
C 37017), and after heating at 65 ° C. for 5 minutes, 57
C. After heating for 2 hours at room temperature and slowly returning to room temperature, E. coli K12MC1061 (obtained from Beckman City of Hope Medical Institute, USA)
Was transformed. Specifically, E. coli K12MC1061
Strain colonies were cultured in LB medium until the absorbance at 550 nm reached 0.3. 50 ml of the culture
And collect 25 mM 10 mM RbCl in 10 mM
3- (N-morpholino) propane-sulfonic acid (MO
PS) (pH 7.0) solution, then 50 mM
25 ml of 0.1 ml containing CaCl ₂ , 10 mM RbCl.
Resuspended in 1M MOPS (pH 6.5).

The resulting suspension was ice-cooled for 30 minutes, centrifuged, the supernatant was removed, 30 μl of DMSO and 50 mM
The suspension was suspended in a mixture of 2.0 ml of 0.1 M MOPS (pH 6.5) containing CaCl ₂ and 10 mM RbCl. The suspension was dispensed in 200 μl portions, and 10 μl of the above plasmid DNA solution was added to each. The mixture was ice-cooled for 30 minutes, and then heat-shocked at 44 ° C. for 60 seconds.
1 LB medium was added. After culturing this solution at 37 ° C. for 1 hour, each solution was centrifuged and the supernatant was removed to obtain a cell pellet. An LB medium was added to the cell pellet, and stirred to form a suspension. The suspension was spread on an LB agar plate containing 5 μg / ml of tetracycline and cultured at 37 ° C. overnight. CDNA obtained in this way
From the bank, HTM131 and HTM13 labeled with ³² P at the 5 ′ end according to the method described in Reference Example 2- (4)
2 was used as a probe, and colony hybridization was performed in the same manner as in Reference Example 3- (3).

Approximately 70,
000 transformants were screened for HTM13
Six clones were obtained which reacted with both the 1 and HTM132 probes. From these 6 clones, an experimental book [Maniatis et al., Molecular Cloning (Molecular Clonin)] was used.
g), p. 366 (1982), Cold Spring Harbor Laboratory (Cold Spring)
Harbor Laboratory)], prepared plasmid DNA (referred to as “pTMP5”), cleaved with various restriction enzymes, and analyzed by electrophoresis. And a DNA fragment of about 900 bp in size and a vector. This DNA fragment is
It was named MP5.

(8): (Hybridization of DNA fragment TMP5 with DNA probe encoding N-terminal amino acid sequence) In the same manner as in the method described in Reference Example 3- (3), DNA fragment TMP5 has the N-terminal amino acid sequence. Was hybridized with a DNA probe encoding the DNA probe. It was found that the DNA fragment TMP5 did not hybridize with any of the N-terminal DNA probes, that is, did not encode the N-terminal amino acid sequence portion.

(9): (Base sequence of DNA fragment TMP5) The base sequence of DNA fragment TMP5 was determined in the same manner as in the method described in Reference Example 3- (4). The results are shown in FIGS.

(10): (Second primer extension) HTM134, HTM based on the nucleotide sequence of DNA fragment TMP5 in the same manner as described in Reference Example 3- (7).
135, three 20mer synthetic DNAs of HTM136
Create FIG. 8 shows the positions in the DNA fragment TMP5 corresponding to these synthetic DNAs. Reference Example 3- (7)
The primer extension was performed using HTM136 as a primer and HTM134 and HTM135 as probes in the same manner as described in the above section. About 50,0
From the 00 transformants, HTM134 and HTM1
One transformant hybridizing with No. 35 was obtained. The DNA fragment contained in the recombinant carried by this transformant was named TMP26.

(11): (Hybridization of DNA fragment TMP26 with DNA probe encoding N-terminal amino acid sequence) It was examined whether it hybridized with the DNA probe encoding the sequence. As a result, the DNA fragment TMP26 was a DNA encoding the 33-mer N-terminal amino acid sequence synthesized in Reference Example 2- (4).
Hybridized with the probe and a mixed probe of four 25-mer probes. That is, the DNA fragment TM
P26 was found to encode the N-terminal amino acid sequence portion.

(12): (Base sequence of DNA fragment TMP26) The base sequence of DNA fragment TMP26 was determined in the same manner as in the method described in Reference Example 3- (4). DNA fragment TMP
FIG. 10 shows the nucleotide sequence of about 540 bases from the 26 carboxyl terminus.

(13): (DNA fragment TMP26, TM
Conjugation of P5 and TMP137) Four DNA fragments (TM13, TM137, TMP) obtained in Reference Examples 3- (1) to (12) and determined in base sequence
5 and TMP26) in their base sequences and a simple restriction map are shown in FIG. As shown in FIG. 11, the first ATG upstream of the nucleotide sequence encoding the N-terminal amino acid sequence contained in the DNA fragment TMP26
When the open reading frame was further assembled, it was found that it consisted of 1,725 bp which passed through DNA fragments TMP26 and TMP5 and continued halfway through TM137. Each D
DNA fragment TMP26 to obtain a DNA fragment encoding an open reading frame spanning the NA fragment,
TMP5 and TM137 were spliced together in the usual manner as follows.

(13-1) (DNA fragment TM137 and T
First, DNA fragment TM137 inserted into the EcoRI site of λgt11 was isolated, and plasmid pUC18 was used.
(Pharmacia, Sweden, Catalog No. 27
-4949-01) to obtain plasmid pUC18TM137. Next, the plasmid p
UC18TM137 is replaced with restriction enzymes HincII and EcoRI.
And separated by 4% (v / v) polyacrylamide gel electrophoresis.
MAX-YIELDR) using about 2,300 bp of D
The NA fragment was recovered and purified by ethanol precipitation.

On the other hand, the TMP obtained in Reference Example 3- (7)
5 into plasmid pBR322
After complete digestion of TMP5 with DdeI, the cut ends were placed in E. coli. coli DNA polymerase (Klenow P
ol fragment) and made about 800 bp of D
The NA fragment was recovered, and this DNA fragment was
The plasmid was inserted into the aI site to obtain a plasmid pUC18TMP5. Next, this plasmid pUC18TMP5 was completely digested with restriction enzymes BamHI and HincII to obtain about 600
A bp BamHI-HincII fragment was obtained. The DNA fragment of about 2,300 bp prepared from the plasmid pUC18TM137 and the plasmid pUC1
A DNA fragment of about 600 bp prepared from 8TMP5 was inserted into a vector prepared by digesting plasmid pUC18 with BamHI and EcoRI, and plasmid pUC18 was inserted into plasmid pUC18.
TMJ1 was obtained. This step is shown in FIG.

(13-2) (DNA fragments TMJ1 and TMJ1)
Placing plasmid pUC18TMJ1 with restriction enzymes DdeI, K
After digestion with pnI and BamHI, fragments of about 950 bp and about 1,500 bp were recovered. On the other hand, DNA fragment TMP26 was ligated to plasmid pUC13 (Pharmacia, Sweden, catalog number 27-4954-0).
Plasmid p was inserted into the restriction enzyme PstI site of 1).
UC13TMP26 was obtained. This was digested to completion with BbeI, the cut ends were blunted using T ₄ DNA polymerase, to obtain a more complete digestion to DNA fragment of about 170bp with the restriction enzyme Bgl II. Furthermore, the plasmid pUC13TMP26 was completely digested with BglII and DdeI to obtain a DNA fragment of about 280 bp.

Next, about 170 bp, about 280 bp,
Approximately 950 bp DNA fragment was spliced together using T ₄ DNA ligase and digested with the restriction enzyme KpnI.
Purified and isolated by 1.3% low melting point agarose gel electrophoresis at 4 ° C. for 2 hours at a voltage of approximately 1,400 bp DN.
A fragment was obtained. Separately, plasmid pUC18 was replaced with Sph
After complete digestion with I.I. After making the cut ends blunt with E. coli DNA polymerase, the vector was prepared by complete digestion with BamHI. The above-mentioned DNA fragments of about 1,400 bp and about 1,500 bp were
₄ Insert with DNA ligase and insert plasmid pUC
18TMJ2 was obtained. This step is shown in FIG.

Reference Example 4 (Screening of Target Gene from Human Chromosome) Screening of a target gene from a human chromosome library was carried out as follows. phage vector E
The human chromosome library in MBL-3 is available from Clontech Laboratories, USA.
es, Inc. 922 Industrial Ave.
Palo Alto, CA94303) (catalog number HL1006). Screening was carried out from this library using the DNA fragment TM13 obtained in Reference Example 3- (2) as a probe in the same manner as in Reference Example 3- (5). One clone was obtained. This chromosome clone was completely digested with the restriction enzyme BamHI to obtain 1.0%
Agarose gel electrophoresis was carried out, and an experimental book [Maniatis et al., Molecular Cloning, Molecular Cloning, p. 382 (1982), Cold Spring Harbor Laboratory (Cold Spring Harbor L).
laboratory)] and Southern blot hybridizations were performed using the same probe.

As a result, a strong positive band was obtained for a DNA fragment of about 4,000 bp. The fragment was isolated by a conventional method and subcloned into the BamHI site of plasmid pUC18. When the nucleotide sequence of this approximately 4,000 bp DNA was determined, it was found that the nucleotide sequence completely matched the nucleotide sequence of the DNA fragment inserted into the plasmid pUC18TMJ2 prepared in Reference Example 3- (13-2).

Example 1 (Plasmids pSV2TMJ2, pSV2TMD1,
SV2TMD2, pSV2TMD4 and pSV2TM
(1) Construction of plasmid pSV2TMJ2 Plasmid pSV2-dhfr (ATCC 3714
6) was completely digested with HindIII and BglII to obtain SV4.
A vector having an initial transcription promoter of 0 and a transcription terminator of SV40 was obtained. Next, Reference Example 2- (13-
Plasmid pUC18TMJ2 prepared in 2) was replaced with Hin
After partial digestion with dIII and complete digestion with BamHI, a DNA fragment of about 2,900 bp was isolated. This DNA fragment was designated as TMJ2. This 2,900 bp DNA fragment and the vector prepared as described above were spliced together using T ₄ DNA ligase to obtain plasmid pSV2TMJ2. The steps for constructing plasmid pSV2TMJ2 are shown in FIG. The obtained plasmid pSV2TMJ2 has been deposited with the American Type Culture Collection (ATCC) under the deposit number 67283 under the provisions of the Budapest Treaty.

(2) Construction of plasmid pSV2TMD1 (a) Preparation of DNA fragment TMD1 Plasmid pSV2TMJ2 obtained in the above step (1)
Was completely digested with NcoI, and the cut end was replaced with E. coli. coli
The ends were made blunt using DNA polymerase. Then H
Complete digestion with indIII gave a DNA fragment of about 1,900 bp. The obtained DNA fragment was designated as TMJ3. On the other hand, a vector was prepared by digesting phage M-13mp19 (manufactured by Takara Shuzo, Japan, catalog number 3119) with HindIII and HincII. The DNA fragment TMD3 was inserted into this vector and the recombinant plasmid M-13mp was inserted.
19TMJ3 was obtained. Separately, a DNA probe for deletion having the following base sequence [hereinafter referred to as “deleter (del)
5'-GGAGGCCGCTCAGCCCGAATGCACG-3 '(25 mer). The synthetic deleter was designated TMD.

The deleter TM prepared as described above
D, using method-in-enzymology (Met
hod in Enzymology), Vol. 100,
468 (1983), Academic Press (Ac
The part consisting of 177 bases of the recombinant plasmid M-13mp19TMJ13 obtained as described above was deleted by site-directed mutagenesis according to the method described in Ademic Press). That is, 25 pmol of the deleter TMD and 10 pmol of the M13 primer M3
(Universal primer manufactured by Takara Shuzo, Catalog No. 3831) after the 5 'end of the phosphorylated using of T ₄ kinase, recombinant plasmid M13m of 0.5pmol
Add single strand DNA of p19TMJ3 and add 9
After heating at 5 ° C. for 5 minutes, it was cooled to room temperature.

Next, 5 units of E.C. coli DNA polymerase 1 (Klenow Fragment), and 10 units T ₄ DNA ligase was added to the mixture 37
The recombinant plasmid was produced in the mixture by incubating at 30 ° C for 30 minutes. The resulting mixture was added to E. coli JM105 (Pharmacia, Sweden, catalog number 27-1550). The E. coli was thereby transfected with the recombinant plasmid. The plaque on the agar medium formed by culturing overnight at 37 ° C. was transferred to a nitrocellulose filter, heated at 80 ° C. for 2 hours, and prehybridized. Prehybridization is 6 × S
ET [0.9 M NaCl, 180 mM Tris buffer (pH 8.0), 6 mM EDTA], 5 × Denha
rts' [0.1% (w / v) ficoll (Ficol)
l), 0.1% (w / v) polyvinylpyrrolidone, 0.1%
1% (w / v), bovine serum albumin (BSA)],
0.1% SDS, 100 μg / ml denatured salmon sperm DNA
The solution was heated in a solution containing at 55 ° C. for 2 hours.

Next, denatured salmon sperm DNA in the above solution
The hybridization reaction was carried out at 55 ° C. for 2 hours using a solution to which TMD labeled with ³² P was added instead. Next, the nitrocellulose filter was washed with 6 × SSC (0.9 M salt, 0.09 M aqueous solution of trisodium citrate). After washing twice at room temperature for 5 minutes, the temperature was gradually increased to 55 ° C., 65 ° C., and 75 ° C., and each was washed twice for 5 minutes. X-ray film XAR-5 (manufactured by Eastman Kodak Company, USA) was brought into close contact with the obtained nitrocellulose filter, and -8
After exposure at 0 ° C. overnight, several tens of black spots were detected on the X-ray film which were strongly exposed.

Each spot corresponds to a clone infected with the recombinant plasmid. Among them, 6 clones were selected, and the recombinant plasmid of each clone was isolated and subjected to restriction enzyme analysis and nucleotide sequence analysis.
It was found that the recombinant plasmids possessed by these clones had the same restriction site and the same nucleotide sequence. The resulting recombinant plasmid was designated as M13-TMD1. Further, the recombinant plasmid M13-TMD
No. 1 was found to have a DNA fragment containing the initiation codon (ATG) and a nucleotide sequence downstream thereof containing a nucleotide sequence encoding the peptide of the present invention consisting of 498 amino acids. The DNA fragment contained in the recombinant plasmid M13-TMD1 was called TMD1. FIG. 15 shows that the recombinant plasmid M-13mp19TMJ3 hybridizes with the deleter-TMD and a part of the DNA region corresponding to the DNA fragment TMJ3 is deleted.

(B) Construction of Plasmid pSV2TMD1 Recombinant plasmid M13-TMD1 prepared in Example 1- (2)-(a) was completely digested with HindIII and BamHI to obtain an approximately 1,900 bp DNA fragment of TMD1. Released. On the other hand, plasmid pSV2-dhfr (A
TCC 37146) was completely digested with HindIII and BglII to obtain a vector. This vector and the DNA fragment TMD1 were joined using T ₄ DNA ligase,
The plasmid pSV2TMD1 was obtained.

(3) Construction of plasmid pSV2TMD2 (a) Preparation of DNA fragment TMD2 The following base sequence: 5'-CTCCACGCTGCAGG
Example except using GGAACCCCAGG-3 'The deleter over TMd ₂ with (25mer) as deletion DNA probes instead of deleter over TMD 1-
By repeating a method substantially similar to (2)-(a), T
Recombinant plasmid M containing a DNA fragment designated MD2
13-TMD2 was obtained. The DNA fragment TMD2 has a structure in which 678 bp of DNA has been deleted from the 5 'end of the DNA fragment TMD1 obtained in Example 1- (2)-(a). This DNA fragment TMD2 has an initiation codon (ATG)
And a base sequence including a base sequence encoding the peptide of the present invention consisting of 272 amino acids downstream thereof. Figure 16 two sets recombinant plasmid M13-TMD1 and a deleter over TMd ₂ is hybridized, showing the place where a part of the DNA region corresponding to the DNA fragment TMD1 is deleted.

(B) Construction of plasmid pSV2TMD2 The recombinant plasmid M13-TMD2 prepared in Example 1- (3)-(a) was completely digested with HindIII and BamHI to isolate an approximately 1,200 bp DNA fragment of TMD2. did. On the other hand, plasmid pSV2-dhfr (AT
CC 37146) was completely digested with HindIII and BglII to obtain a vector. This vector and DNA fragment T
Seaming and MD2 using T ₄ DNA ligase to obtain a plasmid PSV2TMD2.

(4) Preparation of plasmid pSV2TMD4 (a) Preparation of DNA fragment TMD3 Plasmid pSV2TMJ2 obtained in the above step (1)
Was completely digested with NcoI, and the cut end was replaced with E. coli. coli
The ends were made blunt using DNA polymerase. Then H
Complete digestion with indIII gave a DNA fragment of about 1,900 bp. The obtained DNA fragment was designated as TMJ3. On the other hand, a vector was prepared by digestion with HindIII and HincII of phage M-13mp19 (manufactured by Takara Shuzo, Japan, catalog number 3119). The DNA fragment TMJ3 was inserted into this vector and the recombinant plasmid M-13mp was inserted.
19TMJ3 was obtained. Separately, a deleter having the following nucleotide sequence was organically synthesized: 5′-GGAGGCCGCTCAACAGTCCGTGGCCA-3 ′ (25 mer). Synthesis deleter chromatography was designated TMd _3.

The deleter TM thus produced
using the d _3, methods in Enzymology (Me
food in Enzymology), 100th
Volume, p. 468 (1983), the 285 bp portion of the recombinant plasmid M-13mp19TMJ3 obtained as described above was deleted by site-directed mutagenesis according to the method described in Academic Press. . That is, 25 pmol of the deleter TMd ₃ and 10 pmol of the M13 primer M
3 (universal primer manufactured by Takara Shuzo, Catalog No. 3831) after the 5 'end of the phosphorylated using of T ₄ kinase, 0.5 pmol of recombinant plasmids M13m
Add single strand DNA of p19TMJ3 and add 9
After heating at 5 ° C. for 5 minutes, it was cooled to room temperature.

Then, 5 units of E. coli DNA polymerase 1 (Klenow Fragment) and 1
Incubated with the mixture of T ₄ DNA ligase 0 units in addition to the mixture 37 ° C. for 30 minutes to produce a recombinant plasmid. The obtained mixture was used for E. coli (E.
E. coli) JM105 (Pharmacia, Sweden, Catalog No. 27-1550). Thereby, E. coli was transfected with the recombinant plasmid. The plaque on the agar medium formed by culturing overnight at 37 ° C. was transferred to a nitrocellulose filter, and
After heating at 2 ° C. for 2 hours, prehybridization was performed. Prehybridization was performed using 6 × SET [0.
9 M NaCl, 180 mM Tris buffer (pH 8.
0), 6 mM EDTA], 5 × Denhards'
[0.1% (w / v) Ficoll,
0.1% (w / v) polyvinylpyrrolidone, 0.1%
(W / v) bovine serum albumin (BSA)], 0.1%
SDS was performed by heating at 55 ° C. for 2 hours in a solution containing 100 μg / ml denatured salmon sperm DNA.

Next, a hybridization reaction was carried out at 55 ° C. for 2 hours using a solution in which TMd ₃ labeled with ³² P was added instead of the denatured salmon sperm DNA in the above solution. Next, the nitrocellulose filter was washed with 6 × SSC (0.9 M salt, 0.09 M aqueous solution of trisodium citrate). After washing twice at room temperature for 5 minutes, the temperature was gradually increased to 55 ° C., 65 ° C., and 75 ° C., and each was washed twice for 5 minutes. X-ray film XAR-5 (Eastman Kodak, USA)
The nitrocellulose filter obtained was adhered to-
After exposure at 80 ° C. overnight, several tens of black spots which were strongly exposed on the X-ray film were detected. Each spot corresponds to a clone infected with the recombinant plasmid. Among them, 6 clones were selected, and recombinant plasmids of each clone were isolated and analyzed for control enzyme and nucleotide sequence. Recombinant plasmids of these clones had restriction sites and nucleotide sequences. Each was found to be identical.

The obtained recombinant plasmid was ligated with M13-T
It was called MD3. Further, the recombinant plasmid M13-
TMD3 has an initiation codon (ATG) and 46 downstream of it.
It was found to have a DNA fragment containing the nucleotide sequence encoding the peptide consisting of two amino acids (the nucleotide sequence of 1-1386 of SEQ ID NO: 15). The DNA fragment contained in the recombinant plasmid M13-TMD3 was
No. 3. FIG. 17 shows the recombinant plasmid M-13mp.
Hybridized with 19TMJ3 and deleter over TMd ₃ indicates the place where a part of the DNA region corresponding to the DNA fragment TMJ3 is deleted.

(B) Preparation of DNA fragment TMD4 Using the technique of site-directed mutagenesis, the releaser TMd ₃
Instead Example 1- (3) - Example except for using deleter over TMd ₂ obtained in (a) 1- (4) -
In a substantially similar manner to (a), a part of the recombinant plasmid M13-TMD3 obtained as described above is deleted,
A recombinant plasmid M13-TMD4 containing a DNA fragment called TMD4 was obtained. The DNA fragment TMD4 has a structure in which 678 bp of DNA has been deleted from the 5 'end of the DNA fragment TMD3 obtained in Example 1- (4)-(a). This DNA fragment TMD4 has an initiation codon (ATG)
And a base sequence including a base sequence encoding the peptide of the present invention consisting of 236 amino acids downstream thereof. Figure 18 two sets recombinant plasmid M13-TMD3 with the deleter over TMd ₂ is hybridize, indicating the place where a part of the DNA region corresponding to the DNA fragment TMD3 is deleted.

(C) Construction of plasmid pSV2TMD4 The recombinant plasmid M13-TMD4 prepared in Example 1- (4)-(b) was completely digested with HindIII and BamHI to isolate about 1,100 bp DNA fragment of TMD4. did. On the other hand, plasmid pSV2-dhfr (ATC
C 37146) was completely digested with HindIII and BglII to obtain a vector. This vector and DNA fragment TM
Seaming and D4 using T ₄ DNA ligase to obtain a plasmid PSV2TMD4.

(5) Construction of plasmid pSV2TMD5 (a) Preparation of DNA fragment TMD5 The following base sequence: 5'-CACGGGCTCCACGG
GGAACCCCAGG-3 'but using deleter over TMd ₄ having (25mer) as deletion DNA probes instead of deleter over TMd ₂ is Example 1
By substantially repeating the same method as (4)-(b), T
Recombinant plasmid M containing a DNA fragment designated MD5
13-TMD5 was obtained. DNA fragment TMD5 was prepared in Example 1.
5 ′ of DNA fragment TMD3 obtained in (4)-(a)
It has a structure in which 1,032 bp DNA has been deleted from the terminal. This DNA fragment TMD5 has an initiation codon (ATG)
And a base sequence including a base sequence encoding the peptide of the present invention consisting of 118 amino acids downstream thereof. Figure 19 two sets recombinant plasmid M13-TMD3 with the deleter over TMd ₄ is hybridized, showing the place where a part of the DNA region corresponding to the DNA fragment TMD3 is deleted.

(B) Construction of plasmid pSV2TMD5 The recombinant plasmid M13-TMD5 prepared in Example 1- (5)-(a) was completely digested with HindIII and BamHI to isolate a DNA fragment of about 740 bp of TMD5. . On the other hand, plasmid pSV2-dhfr (ATCC
37146) was completely digested with HindIII and BglII to obtain a vector. This vector and DNA fragment TMD
5 was joined using T ₄ DNA ligase to obtain a plasmid pSV2TMD5.

Example 2 (Transformation of COS-1 cells with plasmid pSV2TMD5) COS-1 cells (ATCC CRL165
Dulbecco's minimum essential medium (hereinafter abbreviated as "MEM") supplemented with 10% (v / v) fetal bovine serum (hereinafter abbreviated as "FCS") in an incubator (US, Flow) Laboratory (Flow Laboratories)
37 ° C. using the catalog No. 10-331)
And cultured in a 5% CO 2 incubator until the logarithmic growth phase is reached, using 0.1% trypsin and 0.02% EDT.
A. The cells adhered and grown on the incubator using A were separated from the incubator and added to Hanks Balanced Salt Solution [Flow Laboratories, USA, Catalog No. 17-101-22] at about 1 × 10 ⁷ cells / ml.
To a concentration of 1.

The plasmid p obtained in Example 1- (5)
SV2TMD5 was suspended in 1 mM Tris-HCl buffer (pH 8.0) to a concentration of about 2 μg / μl. About 10μg
5 μl of the resulting plasmid suspension containing the plasmid pSV2TMD5 was placed in a 1.5 ml Eppendorf tube and the C.I.
200 μl of a cell suspension of OS-1 cells was added and left at 0 ° C. for 10 minutes. The suspension in the test tube was prepared according to U.S.A. E. FIG.
P. The cell was transferred to a cuvette of a cell fusion device FPH1001 manufactured by SYSTEM, and an electric pulse was applied twice at 40 ksec at 1.2 kV. Thereafter, the suspension was transferred again to the original Eppendorf type test tube, left at 0 ° C. for 5 minutes,
Dulbecco's MEM with 10% (v / v) FCS
was transferred to a 10 cm diameter tissue culture plate as follows. That is, Dulbecco's MEM containing a small amount of 10% (v / v) FCS was added to the suspension, and the mixture was transferred to a tissue culture plate. The tubes were then washed several times with the remaining Dulbecco's MEM and the wash was added to the same plate. Thereafter, the plate was incubated at 37% in the presence of 5% CO _2.
C. for 24 hours.

(Confirmation of Action to Promote Activation of Protein C by Thrombin) After completion of the culture, the medium in the plate was
The cells were replaced with Dulbecco's MEM containing no CS and cultured for 48 hours. 5 μl of the culture supernatant was collected, and this was used as a sample to measure the effect of promoting protein C activation by the method described in Reference Example 1. Further, cells for one tissue culture plate having a diameter of 10 cm were transferred to a US Coaster (Coaster).
r) Cell Scraper (Cell Scrape)
r) Scrape and collect using (catalog number 3010) and collect by centrifugation at 800 rpm for 10 minutes. Using this pellet as a sample, the effect of promoting the activation of protein C was measured by the method described in Reference Example 1. As a control, plasmid pSV2-d
Culture supernatants and cell pellets of hfr-transformed COS-1 cells were used as samples. Table 1 shows the results
Shown in The values of the absorbance shown in the table are obtained by converting the absorbance of the sample into the value of one tissue culture plate.

[0147]

[Table 1]

Example 3 (Transformation of COS-1 Cells with Plasmid pSV2TMD4 and Measurement of the Promoting Effect of Peptide Produced by the Transformed Cells on Protein C Activation by Thrombin) The operation was performed to measure the promoting effect of thrombin on the activation of protein C by the peptide produced by the cells transformed with the plasmid pSV2TMD4. Table 2 shows the results. The values of the absorbance shown in the table are obtained by converting the absorbance of the sample into the value of one tissue culture plate.

[0149]

[Table 2]

Example 4 (Transformation of COS-1 Cells with Plasmid pSV2TMD2 and Measurement of Promoting Effect of Peptide Produced by Transformed Cells on Protein C Activation by Thrombin) The operation was performed to measure the promoting effect of thrombin on the activation of protein C by the peptide produced by the cells transformed with the plasmid pSV2TMD2. Table 3 shows the results. The values of the absorbance shown in the table are obtained by converting the absorbance of the sample into the value of one tissue culture plate.

[0151]

[Table 3]

Example 5 (Transformation of COS-1 Cells by Plasmid pSV2TMD1 and Measurement of Promoting Effect of Peptide Produced by Transformed Cells on Protein C Activation by Thrombin) The same procedure as in Example 2 was carried out except that plasmid pSV2TMD1 was used. The operation was performed to measure the promoting effect of thrombin on the activation of protein C by the peptide produced by the cells transformed with the plasmid pSV2TMD1. Table 4 shows the results. The values of the absorbance shown in the table are obtained by converting the absorbance of the sample into the value of one tissue culture plate.

[0153]

[Table 4]

Example 6 (Transformation of COS-1 Cells by Plasmid pSV2TMJ2 and Measurement of Promoting Effect of Peptide Produced by Transformed Cells on Activation of Protein C by Thrombin) The operation was performed to measure the promoting effect of thrombin on the activation of protein C by the peptide produced by the cells transformed with the plasmid pSV2TMJ2. As a result, the cell pellet sample exhibited a strong protein C activation promoting action, and the amount of generated protein C was about 300 ng.
Met. On the other hand, this activity was not detected in cells transformed with the plasmid pSV2-dhfr used as a control.

Example 7 (Transformation of CHO Cells with Plasmid pSV2TMD5 and Expression in Transformed Cells) About 4 μg of plasmid pSV-2-neo (ATCC 37150) and about 20 μg of Example 1- (5) were used. Plasmid p
SV2TMD5 was mixed and ethanol precipitated. After air-drying the precipitate, the precipitate was dissolved in 450 μl of TE (pH 7.9, 1 mM Tris-HCl buffer, 0.1 mM EDTA), and dissolved in 50 μl of TE.
0 μl of 2 × HBS (50 mM HEPES, 280 m
M NaCl, 1.5 mM Na ₂ HPO ₄ , pH7.
12) was added. Then 50 μl of 2.5 M CaCl
₂ was added dropwise and left at room temperature for 10 minutes.

On the other hand, 10% (v / v) FCS and 1 v / v
v% penicillin-streptomycin (Flow, USA)
(Laboratory, catalog number 16-700-49)
Using a Ham's F-12 culture medium (manufactured by Flow Laboratories, Inc., catalog number 10-421-20) containing about 5 × 10 ² cells per plate in a tissue culture plate having a diameter of 6 cm. The CHO-KI strain (ATCC CCLD61) was cultured overnight, the medium was replaced with a fresh medium, and the cells were further cultured for 3 hours. This CHO-K
The plasmid DNA solution obtained by dropping the above CaCl ₂ on I was overlaid and cultured at 37 ° C. for about 8 hours. 5 ml of PBS
(-) (Catalyst No. 28-103-05, manufactured by Flow Laboratories, USA), and washed twice.
After washing with 5 ml of the above-mentioned medium, fresh medium is added to the medium for about 1 hour.
The cells were further cultured for 6 hours.

The cells adhered to the plate were peeled off using a 0.25% trypsin, 0.02% EDTA solution, spread on four tissue culture plates having a diameter of 10 cm, and cultured. 2
After 4 hours, the medium was changed to a selective medium. The composition of the selection medium is such that Geneticin C-418 (manufactured by GIBCO, USA, catalog number 8) is added to the above-mentioned medium so as to have a concentration of 400 μg / ml.
60-1811). The cells were cultured for about 2 weeks while changing the medium every 3 to 4 days, and the transformed cells were cloned.

The clones of the cells obtained by this operation were grown to confluence in tissue culture plates each having a diameter of 10 cm. On the way, the FCS concentration of the medium was increased to 10
The culture was switched to a medium reduced from 1% to 1%. Take 50 μl of the culture solution cultured in this FCS-containing selection medium,
When the effect of promoting protein C activation was measured by the method described in Reference Example 1 using this, a strong activity of promoting protein C activation was observed. On the other hand, in the cells transformed only with the plasmid pSV2-neo used as a control, this activity was not detected.

Example 8 (Transformation of CHO Cells by Plasmid pSV2TMD4 and Measurement of Promoting Effect of Peptide Produced by Transformed Cells on Protein C Activation by Thrombin) The same operation as in Example 7 was carried out except that plasmid pSV2TMD4 was used. Then, the action of promoting the protein C activation by thrombin of the peptide produced by the cells transformed with the plasmid pSV2TMD4 was measured, and a strong action of protein C activation was observed. On the other hand, in the cells transformed only with the plasmid pSV2-neo used as a control, this activity was not detected.

Example 9 (Transformation of CHO Cells by Plasmid pSV2TMD2 and Measurement of Promoting Effect of Thrombin on Protein C Activation of Peptide Produced by Transformed Cells) The same operation as in Example 7 was carried out except that plasmid pSV2TMD2 was used. Then, the action of the peptide produced by the cells transformed with the plasmid pSV2TMD2 to promote protein C activation by thrombin was measured, and a strong protein C activation promoting action was observed. On the other hand, in the cells transformed only with the plasmid pSV2-neo used as a control, this activity was not detected.

Example 10 Transformation of CHO Cells with Plasmid pSV2TMD1 and Measurement of Promoting Effect of Thrombin on Protein C Activation of Peptide Produced by Transformed Cells The same operation as in Example 7 was carried out except that plasmid pSV2TMD1 was used. Then, the action of promoting the protein C activation by thrombin of the peptide produced by the cells transformed with the plasmid pSV2TMD1 was measured, and a strong action of promoting protein C activation was observed. On the other hand, in the cells transformed only with the plasmid pSV2-neo used as a control, this activity was not detected.

Example 11 (Measurement of Transformation of CHO Cells by Plasmid pSV2TMJ2 and Measurement of Promoting Effect of Peptide Produced by Transformed Cells on Activation of Protein C by Thrombin)
Plasmid pSV-2-neo (ATCC 3715)
0) and about 20 μg of the plasmid pSV2TMJ2 prepared in Example 1 were mixed and precipitated with ethanol. After air-drying the precipitate, it was dissolved in 450 μl of TE (pH 7.9, 1 mM Tris-HCl buffer, 0.1 mM EDTA), and
00 μl of 2 × HBS (50 mM HEPES, 280
mM NaCl, 1.5 mM Na2HPO4, pH
7.12) was added. Then 50 μl of 2.5 M Ca
Cl ₂ was added dropwise and left at room temperature for 10 minutes.

On the other hand, 10% (v / v) FCS and 1 v / v
v% penicillin-streptomycin (Flow, USA)
(Laboratory, catalog number 16-700-49)
Using a Ham's F-12 culture medium (manufactured by Flow Laboratories, Inc., catalog number 10-421-20) containing about 5 × 10 ² cells per plate in a tissue culture plate having a diameter of 6 cm. The CHO-KI strain (ATCC CCLD61) was cultured overnight, the medium was replaced with a fresh medium, and the cells were further cultured for 3 hours. This CHO-K
The plasmid DNA solution obtained by dropping the above CaCl ₂ on I was overlaid and cultured at 37 ° C. for about 8 hours. 5 ml of PBS
(-) (Catalyst No. 28-103-05, manufactured by Flow Laboratories, USA), and washed twice.
After washing with 5 ml of the above-mentioned medium, fresh medium is added to the medium for about 1 hour.
The cells were further cultured for 6 hours.

The cells adhered to the plate were peeled off using a 0.25% trypsin, 0.02% EDTA solution, spread on four tissue culture plates having a diameter of 10 cm, and cultured. 2
After 4 hours, the medium was changed to a selective medium. The composition of the selection medium is such that Geneticin C-418 (manufactured by GIBCO, USA, catalog number 8) is added to the above-mentioned medium so as to have a concentration of 400 μg / ml.
60-1811). The cells were cultured for about 2 weeks while changing the medium every 3 to 4 days, and the transformed cells were cloned. The clones of the cells obtained by this operation were grown on tissue culture plates each having a diameter of 10 cm until they became confluent. On the way,
The culture was switched to a medium in which the FCS concentration of the medium was reduced from 10% to 1%.

[0165] The effect of thrombin on the promotion of protein C activation of a peptide produced by cells transformed with plasmid pSV2TMJ2 was measured using a cell pellet as a sample. On the other hand, this activity was not detected in the cells transformed with only the plasmid pSV2-neo used as a control and the culture supernatant thereof.

Example 12 (Transformation of C ₁₂₇ I Cells with Plasmid pSV2TMD5 and Measurement of the Promoting Effect of Thrombin on Protein C Activation of Peptides Produced by the Transformed Cells) Plasmid pSV2TMD5 prepared in Example 1- (5) after was completely digested with HindIII, the cut ends were blunted using DNA polymerase, by the action of T ₄ DNA ligase, HindIII of plasmid pSV2TMD5
The plasmid pSV2TMD5-1 lacking the site was obtained. Next, this plasmid pSV2TMD5-1 was transferred to Pv
Complete digestion with uII and BamHI yielded a DNA fragment of about 1,700 bp. This is called Hi of plasmid pUC18.
Plasmid pUCTMD5-1 was obtained by insertion into a vector completely digested with ncII and BamHI.

On the other hand, plasmid pBR322 (ATCC
37017) to the method of Kobasrubias et al. [L. Covasrubias et al.
l), Gene, 13, 25, (1981)
Year), plasmid pBR327 was prepared. The resulting plasmid pBR327 was transformed with BamHI and Hind.
The plasmid pUCTMD5-1 was added to a DNA fragment of about 2960 bp obtained by digestion with BamHI and Hind.
A DNA fragment of about 2600 bp obtained by complete digestion with III was inserted to obtain a plasmid pBRTMD5-1. This plasmid pBRTMD5-1 was completely digested with HindIII and plasmid pBPV-1 (9-1) (ATC
In the footsteps C 37111) and fragment obtained by complete digestion with HindIII using T ₄ DNA ligase to obtain plasmid pdBPVTMD5-1 for C ₁₂₇ cell expression. The above steps are shown in FIGS.

Next, according to the method described in Example 7, pd
C ₁₂₇ I cell with BPVTMD5-1 (ATCC CRL
1616). 10% FCS and 1 v / v% penicillin-streptomycin (manufactured by Flor Laboratories, USA, catalog number 16-700
When the cells were cultured in Dulbecco's MEM containing about 49 weeks for about 3 weeks, 6 cells forming a focus were obtained.
m of tissue culture plates until confluent. Thereafter, the medium was replaced with a medium not containing FCS and cultured. 50 μl of culture solution cultured for 1 day in this medium
The activity of promoting protein C activation was measured by the method described in Reference Example 1 and a strong activity was observed. On the other hand, in the cells transformed only with the plasmid pBV-1 (9-1) used as a control, this activity was not detected.

Example 13 (Transformation of C ₁₂₇ I cells by plasmid pSV2TMD4 and measurement of the promoting effect of peptide produced by the transformed cells on protein C activation by thrombin) Plasmid pSV2TMD4 prepared in Example 1- (4) after was completely digested with HindIII, the cut ends were blunted using DNA polymerase, by the action of T ₄ DNA ligase, HindIII of plasmid pSV2TMD4
The plasmid pSV2TMD4-1 lacking the site was obtained. Next, this plasmid pSV2TMD4-1 was transferred to Pv
Complete digestion with uII and BamHI yielded an approximately 2100 bp fragment. This was inserted into a vector that was completely digested with HincII and BamHI of plasmid pUC18 to obtain plasmid pUCTMD4-1.

On the other hand, plasmid pBR322 (ATCC
37017) to the method of Kobasrubias et al. [L. Covasrubias et al.
al), Gene, 13, 25, (1981)
Year), plasmid pBR327 was prepared. The resulting plasmid pBR327 was transformed with BamHI and Hind.
The DNA fragment of about 2,960 bp obtained by digestion with III
Plasmid pUCTMD4-1 was transformed with BamHI and Hin.
A DNA fragment of about 3,000 bp obtained by complete digestion with dIII was inserted to obtain a plasmid pBRTMD4-1. This plasmid pBRTMD4-1 was completely digested with HindIII and plasmid pBPV-1 (9-1) (A
TCC 37111) and a fragment obtained by complete digestion with HindIII were joined using T ₄ DNA ligase to give C ₁₂₇
The plasmid pdBPVTMD4-1 for cell expression was obtained. The above steps are shown in FIGS.

Next, Example 7 was performed using pdBPVTMD4-1.
C ₁₂₇ I cells (ATCC CRL) according to the method described in
1616). 10% FCS and 1 v / v% penicillin-streptomycin (US,
Manufactured by Flow Laboratories, catalog number 16-700
-49), the cells were cultured for about 3 weeks in Dulbecco's MEM. As a result, six cells forming a focus were obtained.
The cells were grown to confluence on cm tissue culture plates. Thereafter, the medium was replaced with a medium not containing FCS and cultured. Culture medium 50μ cultured for 1 day in this medium
1 was used to measure the promoting effect of protein C activation by the method described in Reference Example 1, and a strong activity was observed. On the other hand, in the cells transformed only with the plasmid pBPV- (9-1) used as a control, this activity was not detected.

Example 14 Transformation of C ₁₂₇ I Cells with Plasmid pSV2TMD2 and Measurement of the Promoting Effect of Thrombin on Protein C Activation of Peptides Produced by the Transformed Cells Plasmid pSV2TMD2 prepared in Example 1- (3) after was completely digested with HindIII, the cut ends were blunted using DNA polymerase, by the action of T ₄ DNA ligase, HindIII of plasmid pSV2TMD2
A plasmid pSV2TMD2-1 lacking the site was obtained. Next, this plasmid pSV2TMD2-1 was transferred to Pv
Complete digestion with uII and BamHI yielded a DNA fragment of about 2,200 bp. This is called Hi of plasmid pUC18.
Plasmid pUCTMD2-1 was obtained by insertion into a vector completely digested with ncII and BamHI.

On the other hand, plasmid pBR322 (ATCC
37017) to the method of Kobasrubias et al. [L. Covasrubias et al.
l), Gene, 13, 25, (1981)
Year), plasmid pBR327 was prepared. The resulting plasmid pBR327 was transformed with BamHI and Hin.
Plasmid pUCTMD2-1 was added to a DNA fragment of about 2,960 bp obtained by digestion with dIII and BamHI and Ham.
Approximately 3,070 bp of DN obtained by complete digestion with indIII
The A fragment was inserted to obtain plasmid pBRTMD2-1. This plasmid pBRTMD2-1 was replaced with HindIII.
Digested with plasmid pBPV-1 (9-
1) Using a fragment obtained by completely digesting (ATCC 37111) with HindIII and T ₄ DNA ligase, C ₁₂₇
The plasmid pdBPVTMD2-1 for cell expression was obtained. The above steps are shown in FIGS.

Next, Example 7 was conducted using pdBPVTMD2-1.
C ₁₂₇ I cells (ATCC CRL) according to the method described in
1616). 10% FCS and 1 v / v% penicillin-streptomycin (manufactured by Flor Laboratories, USA, catalog number 16-700-
When the cells were cultured in Dulbecco's MEM containing about 49 weeks for about 3 weeks, 6 cells forming a focus were obtained.
m of tissue culture plates until confluent. Thereafter, the medium was replaced with a medium not containing FCS and cultured. 50 μl of culture solution cultured for 1 day in this medium
The activity of promoting protein C activation was measured by the method described in Reference Example 1 and a strong activity was observed. On the other hand, in the cells transformed only with the plasmid pBPV-1 (9-1) used as a control, this activity was not detected.

Example 15 (Transformation of C ₁₂₇ I Cells by Plasmid pSV2TMD1 and Measurement of the Effect of Thrombin on the Activation of Protein C by Peptide Produced by the Transformed Cells) Plasmid pSV2TMD1 prepared in Example 1- (2) after was completely digested with HindIII, the cut ends were blunted using DNA polymerase, by the action of T ₄ DNA ligase, HindIII of plasmid pSV2TMD1
The plasmid pSV2TMD1-1 from which the site was deleted was obtained. Next, this plasmid pSV2TMD1-1 was
Complete digestion with uII and BamHI yielded a DNA fragment of about 3,100 bp. This is called Hi of plasmid pUC18.
Plasmid pUCTMD1-1 was obtained by insertion into a vector completely digested with ncII and BamHI.

On the other hand, plasmid pBR322 (ATCC
37017) to the method of Kobasrubias et al. [L. Covasrubias et al.
l), Gene, 13, 25, (1981)
Year), plasmid pBR327 was prepared. The resulting plasmid pBR327 was transformed with BamHI and Hind.
The DNA fragment of about 2,960 bp obtained by digestion with III
Plasmid pUCTMD1-1 was replaced with BamHI and Hind.
The DNA fragment obtained by complete digestion with dIII was inserted to obtain plasmid pBRTMD1-1. This plasmid pBR
TMD1-1 was completely digested with HindIII and plasmid pBPV-1 (9-1) (ATCC37111).
The and the fragment obtained by completely digested with HindIII T ₄ DNA
By using ligase, plasmid pdBPVTMD1-1 for expression of C ₁₂₇ cells was obtained. The above steps are shown in FIG.
27 are shown in FIG.

Next, pBPTVTMD1-1 was used in Example 7
C ₁₂₇ I cells (ATCC CRL) according to the method described in
1616). 10% FCS and 1 v / v% penicillin-streptomycin (US,
Manufactured by Flow Laboratories, catalog number 16-700
-49), the cells were cultured for about 3 weeks in Dulbecco's MEM. As a result, six cells forming a focus were obtained.
The cells were grown to confluence on a cm cell plate. Thereafter, the medium was replaced with a medium not containing FCS and cultured. Culture medium 50μ cultured for 1 day in this medium
1 was used to measure the promoting effect of protein C activation by the method described in Reference Example 1, and a strong activity was observed. On the other hand, in the cells transformed only with the plasmid pBPV-1 (9-1) used as a control, this activity was not detected.

Example 16 (Transformation of C ₁₂₇ I Cells by Plasmid pSV2TMJ2 and Measurement of the Promoting Effect of Thrombin on Protein C Activation of Peptides Produced by the Transformed Cells) Plasmid pSV27MJ2 prepared in Example 1- (1) after was completely digested with HindIII, the cut ends were blunted using DNA polymerase, by the action of T ₄ DNA ligase, HindIII of plasmid pSV2TMJ2
The plasmid pSV2TMJ2-1 lacking the site was obtained. Next, this plasmid pSV2TMJ2-1 was replaced with Pv
Complete digestion with uII and BamHI yielded a DNA fragment of about 4,100 bp. This is called Hi of plasmid pUC18.
Plasmid pUCTMJ2-1 was obtained by insertion into a vector completely digested with ncII and BamHI.

On the other hand, plasmid pBR322 (ATCC
37017) to the method of Kobasrubias et al. [L. Covasrubias et al.
l), Gene, 13, 25, (1981)
Year), plasmid pBR327 was prepared. The resulting plasmid pBR327 was transformed with BamHI and Hind.
The DNA fragment of about 2,960 bp obtained by digestion with III
Plasmid pUCTMJ2-1 was replaced with BamHI and Hind.
The DNA fragment obtained by complete digestion with dIII was inserted to obtain plasmid pBRTMJ2-1. This plasmid pBR
TMJ2-1 was completely digested with HindIII and plasmid pBPV-1 (9-1) (ATCC37111).
The and the fragment obtained by completely digested with HindIII T ₄ DNA
Ligation using ligase yields plasmid pdBPVTMJ2-1 for C ₁₂₇ cell expression. The above steps are shown in FIG.
29 to FIG.

Next, Example 7 was performed using pdBPVTMJ2-1.
C ₁₂₇ I cells (ATCC CRL) according to the method described in
1616). 10% FCS and 1 (v / v%) penicillin-streptomycin (manufactured by Flor Laboratories, USA, catalog number 16-7)
When the cells were cultured in Dulbecco's MEM containing about 00-49) for about 3 weeks, 6 cells forming foci were obtained. Each cell was cloned and each cell was confluent on a tissue cell plate having a diameter of 10 cm until the cells became confluent. Grew. Thereafter, the medium was replaced with a medium not containing FCS and cultured. After culturing for 1 day in this medium, the pellet of the cultured cells was scraped and used to prepare Reference Example 1
When the effect of promoting protein C activation was measured by the method described in (1), strong activity was observed. On the other hand, this activity was not detected in cells transformed only with the plasmid pBPV-1 (9-1) used as a control.

Example 17 (Protein C by thrombin from the culture solution of the present invention)
Purification of Peptide Having Action to Promote Activation of Plasmid pSV2-n Cultured by the Method described in Example 7
CHO cells transformed with eo and the plasmid pSV2TMD5 were cultured on 25 tissue culture plates having a diameter of 10 cm. The medium was replaced with fresh medium four times every other day. Collect all this culture (about 100 ml),
After adjusting to pH 7.5, it was prepared by column chromatography of DIP-thrombin-agarose. That is, NL Esmon et al. [The Journal of Biological Chemistry (J. Biol. Chem), 257, 859,
(1982)].
Thrombin [diisopropyl phosphorothrombin (di
isopropylphosphorothrombi
n)] was replaced by Peak Otrecasas (P. Cuatrec).
asa) [The Journal of Biological Chemistry (J. Biol. Chem), 24
5, p. 359 (1970)] to prepare DIP-thrombin-agarose.

Next, DIP-thrombin-agarose was packed in a column having a size of 2.5 cmφ × 10 cm, and
Prepare an IP-thrombin-agarose column and add 0.1 M NaCl, 0.5 mM CaCl ₂ , 1 mM at room temperature
Benzamidine hydrochloride, 0.5% (v / v) Lubrol
The column was equilibrated with 0.02 M Tris-HCl buffer (pH 7.5) containing PX (manufactured by Hanoi Chemicals, Japan). Next, the above supernatant was applied to a column. 0.3 column
M NaCl, 0.5 mM CaCl ₂ , 1 mM benzamidine hydrochloride, 0.5% (v / v) Lubrol PX
After washing with 0.02 M Tris-HCl buffer (pH 7.5) containing 1 M NaCl, 0.1 mM EDTA, 1 m
M benzamidine hydrochloride, 0.5% (v / v) Lubro
0.02 M Tris-HCl buffer (pH 7.
Elution was performed in 5), and 2.0 ml fractions were collected.
For each fraction obtained by the elution, the promoting effect of protein C activation was measured by the method described above. At the same time, Shimadzu (Japan) spectrophotometer UV-
Using 240, the absorbance (A ₂₈₀ ) of each fraction at a wavelength of 280 nm was measured. The active fractions were collected and 0.1 M NaCl, 0.5 mM CaCl ₂ ,
0.02 M Tris-HCl buffer containing 0.5% (v / v) Lubrol PX (Hansui Chemicals, Japan) (pH
Dialysis was performed at 7.5). The obtained dialysate is used for the second DIP
-Thrombin-agarose column chromatography.

That is, the dialysate was passed through a DIP-thrombin-agarose column having a size of 1.5 cmφ × 10 cm to obtain 0.4 M NaCl, 0.5 mM CaCl ₂ ,
0.02 with 0.1% (v / v) Lubrol PX
After washing with M Tris-HCl buffer (pH 7.5), the solution was further washed with 0.4 M NaCl, 0.1 mM EDTA, 0.1%
(V / v) Wash with 0.02 M Tris buffer (pH 7.5) containing Lubrol PX, then 1 M NaC
1, 0.5 mM EDTA, 0.1% (v / v) Lub
PX with 0.02 M Tris-HCl buffer (pH
Eluted at 7.5). The active fraction was collected and the purified product was -8
Stored frozen at 0 ° C. The molecular extinction coefficient of this purified product is adjusted to 10.0 (E ^1%
_{(1 cm} · 280 nm = 10.0), and the amount of the purified product was calculated based on the definition. The result was about 4.7 μg.
In addition, this purified product was subjected to polyacrylamide gel concentration 5-10.
% By SDS-polyacrylamide gel electrophoresis using a gradient and observing the band by silver staining, only a single band was confirmed.

Example 18 Example 17 except that the plasmid pSV2TMD4 was used.
A purified product of the peptide of the present invention is obtained
The absorbance at 280 nm long was measured. This refined product
Follow the molecular extinction coefficient of a typical protein
10.0 (E^1% _1cm・ 280nm = 10.0)
Then, the amount of purified product was calculated based on it and found to be about 4.5
μg. In addition, this purified product is polyacrylamide gel
SDS-poly with gradient of 5-10%
Perform acrylamide gel electrophoresis.
Observation of the band revealed only a single band.

Example 19 Example 17 except that the plasmid pSV2TMD2 was used.
A purified product of the peptide of the present invention is obtained
The absorbance at 280 nm long was measured. This refined product
Follow the molecular extinction coefficient of a typical protein
10.0 (E^1% _1cm・ 280nm = 10.0)
Then, the amount of purified product was calculated based on it and found to be about 4μg
Met. In addition, this purified product was
SDS-Polyac using a gradient of 5-10%
Perform lilamide gel electrophoresis and band by silver staining.
As a result, only a single band was confirmed.

Example 20 Example 17 except that the plasmid pSV2TMD1 was used.
A purified product of the peptide of the present invention is obtained
The absorbance at 280 nm long was measured. This refined product
Follow the molecular extinction coefficient of a typical protein
10.0 (E^1% _1cm・ 280nm = 10.0)
Then, based on that, the amount of purified product was calculated to be about 3μg
Met. In addition, this refined product was polyacrylamide concentration 5
SDS-polyacryl with -10% gradient
Perform amide gel electrophoresis and observe bands by silver staining.
As a result, only a single band was confirmed.

Example 21 In the same manner as described in Example 11, the plasmid pSV2TM
C2 transformed with J2 and plasmid pSV2-neo
HO cells were cultured using 25 tissue culture plates having a diameter of 10 cm. After the culture, the culture supernatant was centrifuged at 800 rpm for 10 minutes to collect the cells. 0.5% (v / v) Triton X-100 was added to the obtained cell pellet.
0.25M sucrose, 1mM benzamidine hydrochloride, 0.5m
0.02 M Tris-HCl buffer containing M CaCl ₂ (p
H7.5) was suspended in 100 ml and homogenized 5 times at 4 ° C. for 5 minutes using a Waring blender to obtain a cell extract. The obtained extract was centrifuged at 35,000 g at 10 ° C. for 60 minutes, and the supernatant was collected. From the supernatant, a purified product of the peptide of the present invention was obtained in the same manner as in Example 17, and the absorbance at a wavelength of 280 nm was measured. The molecular extinction coefficient of this purified product is determined to be 10.0 (E ^1% _{1 cm} · 280 nm =
10.0), and the amount of purified product was calculated based on the result, and it was about 3 μg. In addition, this purified product was prepared by using S with a gradient of polyacrylamide concentration of 5-10%.
When DS-polyacrylamide gel electrophoresis was performed and the band was observed by silver staining, only a single band was confirmed.

Example 22 (Confirmation of Action to Promote Protein C Activation by Thrombin) The action of the purified peptide of the present invention to promote protein C activation was evaluated by the following method. That is, 0.1M
NaCl, 3.6 mM CaCl ₂ , 10 mg / ml
50 μg / ml of protein C, 5 n in 0.02 M Tris-HCl buffer (pH 7.5) containing bovine serum albumin
M thrombin and 5 nM of the purified peptide of the present invention were added and reacted at 37 ° C. 300 μg / m for reaction
1 antithrombin III (manufactured by Sigma, USA) and 5 m
The reaction was stopped by adding M EDTA, and the amount of activated protein C produced was measured by the method using the above-mentioned synthetic substrate. The results are shown in FIGS. 30 to 34. In the case where the peptide of the present invention was not added (B), the generation of activated protein C was not observed (dotted line), but in the case where the peptide of the present invention was added (A In (), the amount of activated protein C generated with the reaction time increased (solid line).

Example 23 (Confirmation of anticoagulant action) It was found that the peptide of the present invention inhibits the conversion of fibrinogen to fibrin by thrombin and substantially inhibits blood coagulation in Heinrich.
Coagulometer KC-1 from Amerung (Germany)
It was determined by measuring the blood clotting time using 0. That is, in a 0.05 M Tris-HCl buffer (pH 7.5) containing 5 mM CaCl ₂ and 0.1 M NaCl, the solution was added.
0 μg of fibrinogen (Fraction I, manufactured by Sigma, USA) was added, 0-50 nM of the purified peptide of the present invention was added thereto, and then 10 nM thrombin was added so that the total volume was 0.4 ml. It was measured. The results are shown in FIGS. It was confirmed that the blood coagulation time was prolonged as the amount of the purified peptide added increased as compared with thrombin.

Example 24 (Confirmation of Platelet Aggregation Inhibitory Effect) The peptide of the present invention substantially inhibits the platelet aggregation effect of thrombin by SI
The evaluation was performed using a platelet aggregometer manufactured by ENCO (USA). That is, 300,000 cells / μl of platelet liquid (Platelet Rich Plasma)
a, P. R. P. If 1 unit of thrombin (about 0.4 μg) is added to 250 μl, platelets will aggregate. Did not get up.

[0191]

APPLICATION EXAMPLES Hereinafter, application examples of various soluble peptides obtained in each of the above Examples will be described with application examples, but the present invention is not limited by these application examples. Application Example 1 Purified peptide of the present invention 10 mg Purified gelatin 20 mg Mannitol 100 mg Sodium chloride 7.8 mg Sodium phosphate (1 and 2) 15.4 mg The above components were dissolved in 2 ml of distilled water for injection, and the usual formulation conditions were used. To prepare a near neutral formulation for injection. That is, the lysate was placed in a sterile vial, pre-frozen at −35 ° C. for 2 hours, dried at −35 ° C. at a vacuum of 0.075 Torr for 35 hours, and then dried at 30 ° C. and a vacuum of 0.03 Torr.
For 5 hours to produce injection vials. The obtained composition is dissolved in physiological saline or 500 ml of glucose injection solution immediately before administration, and the solution is used for intravenous drip infusion.

Application Example 2 Purified peptide of the present invention 2.5 mg Albumin 5 mg Mannitol 25 mg Sodium chloride 1.95 mg Sodium phosphate (1 and 2) 3.85 mg The above components were dissolved in 2 ml of distilled water for injection. A near neutral injection formulation was prepared under normal formulation conditions. That is, the lysate was placed in a sterile vial, pre-frozen at −35 ° C. for 2 hours, dried at −35 ° C. at a vacuum of 0.075 Torr for 35 hours, and then dried at 30 ° C. and a vacuum of 0.03 Torr.
For 5 hours to produce injection vials. The obtained composition is dissolved in physiological saline or 500 ml of glucose injection solution immediately before administration, and the solution is used for intravenous drip infusion.

[0193]

The peptide of the present invention has an anticoagulant effect,
It is a very useful substance that has both platelet aggregation inhibitory action and thrombolytic action and has few side effects as a therapeutic drug for cardiovascular diseases and the like. Further, the peptide of the present invention can be used as an agent for preventing thrombus formation by binding to a medical artificial material such as an artificial blood vessel, an artificial organ, or a catheter, for example, in addition to such medical uses.

Free Text for Sequences Other information of SEQ ID NO: 1 is a partial amino acid sequence of human thrombomodulin. Other information of SEQ ID NO: 2 is a partial amino acid sequence of human thrombomodulin. Partial amino acid sequence of human thrombomodulin Other information of SEQ ID NO: 4 is partial nucleotide sequence of human thrombomodulin gene Other information of SEQ ID NO: 5 is partial nucleotide sequence of human thrombomodulin gene Other information of SEQ ID NO: 6 The information is a partial amino acid sequence of human thrombomodulin. The other information of SEQ ID NO: 7 is the full length amino acid sequence of human thrombomodulin. The other information of SEQ ID NO: 8 is a partial amino acid sequence of human thrombomodulin.

Other information of SEQ ID NO: 9 is a partial base sequence of human thrombomodulin gene. Other information of SEQ ID NO: 10 is a base sequence of human thrombomodulin gene. Other information of SEQ ID NO: 11 is a partial sequence of human thrombomodulin gene. Other information of SEQ ID NO: 12 is a nucleotide sequence encoding a mature human thrombomodulin. Other information of SEQ ID NO: 13 is an amino acid sequence of a mature human thrombomodulin. Other information of SEQ ID NO: 14 is a mature human thrombomodulin. Partial amino acid sequence of thrombomodulin The other information of SEQ ID NO: 15 is the partial base sequence of the mature human thrombomodulin gene.

[0196]

[Sequence List] <110> Asahi Kasei Corporation <120> Method for producing peptide that promotes protein C activation and its antibody <130> P981117A <140> November 17, 1998 <160> 15 <210> 1 <211> 118 <212> PRT <213> Artificial Sequence <220><223> Partial amino acid sequence of human thrombomodulin <400> 1 Val Glu Pro Val Asp Pro Cys Phe Arg Ala Asn Cys Glu Tyr Gln Cys 15 10 15 Gln Pro Leu Asn Gln Thr Ser Tyr Leu Cys Val Cys Ala Glu Gly Phe 20 25 30 Ala Pro Ile Pro His Glu Pro His Arg Cys Gln Met Phe Cys Asn Gln 35 40 45 Thr Ala Cys Pro Ala Asp Cys Asp Pro Asn Thr Gln Ala Ser Cys Glu 50 55 60 Cys Pro Glu Gly Tyr Ile Leu Asp Asp Gly Phe Ile Cys Thr Asp Ile 65 70 75 80 Asp Glu Cys Glu Asn Gly Gly Ply Cys Ser Gly Val Cys His Asn Leu 85 90 95 Pro Gly Thr Phe Glu Cys Ile Cys Gly Pro Asp Ser Ala Leu Val Arg 100 105 110 His Ile Gly Thr Asp Cys 115

<210> 2 <211> 59 <212> PRT <213> Artificial Sequence <220><223> Partial Amino Acid Sequence of Human Thrombomodulin <400> 2 Sequence Leu Leu Ile Gly Ile Ser Ile Ala Ser Leu Cys Leu Val Val Ala Leu 1 5 10 15 Leu Ala Leu Leu Cys His Leu Arg Lys Lys Gln Gly Ala Ala Arg Ala 20 25 30 Lys Met Glu Tyr Lys Cys Ala Ala Pro Ser Lys Glu Val Val Leu Gln 35 40 45 His Val Arg Thr Glu Arg Thr Pro Gln Arg Leu 50 55

<210> 3 <211> 498 <212> PRT <213> Artificial Sequence <220><223> Partial amino acid sequence of human thrombomodulin <400> 3 Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys Val Glu His Asp 1 5 10 15 Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu Asn Ala Ser Gln 20 25 30 Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser Ser Val 35 40 45 Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly Val Gly 50 55 60 Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys Gly Asp 65 70 75 80 Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp Val Thr Gly Asp 85 90 95 Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn Gly Ala 100 105 110 Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu Ala Thr 115 120 125 Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val Lys Ala 130 135 140 Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg Pro Leu 145 150 155 160 Ala V al Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr Tyr Gly 165 170 175 Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala Leu Pro Val Gly 180 185 190 Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu Met Cys Thr Ala 195 200 205 Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro Gly Ala 210 215 220 Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala 225 230 235 240 Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln 245 250 255 Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp 260 265 270 270 Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr 275 280 285 Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg 290 295 300 Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln 305 310 315 320 Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn 325 330 335 Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe 340 345 350 Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr 355 360 365 Leu Cys V al Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His 370 375 380 Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp 385 390 395 400 400 Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp 405 410 415 Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe 420 425 430 Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys 435 440 445 Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys Asp Ser 450 455 460 Gly Lys Val Asp Gly Gly Asp Ser Gly Ser Gly Glu Pro Pro Pro Ser 465 470 475 480 Pro Thr Pro Gly Ser Thr Leu Thr Pro Pro Ala Val Gly Leu Val His 485 490 495 Ser Gly

<210> 4 <211> 354 <212> DNA <213> Artificial Sequence <220><223> Partial base sequence of human thrombomodulin gene <400> 4 gtg gag ccc gtg gac ccg tgc ttc aga gcc aac tgc gag tac cag tgc 48 cag ccc ctg aac caa act agc tac ctc tgc gtc tgc gcc gag ggc ttc 96 gcg ccc att ccc cac gag ccg cac agg tgc cag atg ttt tgc aac cag 144 act gcc ccc gc acc cag gct agc tgt gag 192 tgc cct gaa ggc tac atc ctg gac gac ggt ttc atc tgc acg gac atc 240 gac gag tgc gaa aac ggc ggc ttc tgc tcc ggg gtg tgc cac aac gtc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc ccc gac tcg gcc ctt gtc cgc 336 cac att ggc acc gac tgt 354

<210> 5 <211> 1494 <212> DNA <213> Artificial Sequence <220><223> Partial base sequence of human thrombomodulin gene <400> 5 gca ccc gca gag ccg cag ccg ggt ggc agc cag tgc gtc gag cac gac 48 tgc ttc gcg ctc tac ccg ggc ccc gcg acc ttc ctc aat gcc agt cag 96 atc tgc gac gga ctg cgg ggc cac cta atg aca gtg cgc tcc tcg gtg gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gcc ggc gac ggc ggc gtt ggc 192 cgc cgg cgc ctc tgg atc ggc ctg cag ctg cca ccc ggc tgc ggc gac 240 ccc aag cgc ctc ggg ccc ctg cgc ggc ttc cag tgg gtt ag gac gac ag gac gag ag gac ag gac gag ag ag ag cgg ctc gac ctc aat ggg gct 336 ccc ctc tgc ggc ccg ttg tgc gtc gct gtc tcc gct gct gag gcc act 384 gtg ccc agc gag ccg atc tgg gag gag cag cag tgc gag gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gtg ag ttc cca gcc acc tgc agg cca ctg 480 gct gtg gag ccc ggc gcc gcg gct gcc gcc gtc tcg atc acc tac ggc 528 acc ccg ttc gcg gcc cgc gga gcg gac ttc cag gcg ctg ccg gtg ggc 576 agc tcc gcc gcg gtg gct ccc ctc ggc tta cag cta atg tgc acc gcg 624 ccg ccc gga gc gg gg gg gc gg gc gg gc gg gg gc gg gg gc gg gc gg gc gg gc gg gc gg gc gg gc gg gc gg gc gg gc gc gg gc gg gc gc gc gc gc gg gc gg gc gg gc gg gc gg gc gg gc gc gc gg tgg gac tgc agc gtg gag aac ggc ggc tgc gag cac gcg tgc aat gcg 720 atc cct ggg gct ccc cgc tgc cag tgc cca gcc ggc gcc gcc ctg cag 768 gca gac ggg cgc tcc tgc acc gca gcc accc 816 ctc tgc gag cac ttc tgc gtt ccc aac ccc gac cag ccg ggc tcc tac 864 tcg tgc atg tgc gag acc ggc tac cgg ctg gcg gcc gac caa cac cgg 912 tgc gag gac gtg gat gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc cg cag 960 cgc tgt gtc aac aca cag ggt ggc ttc gag tgc cac tgc tac cct aac 1008 tac gac ctg gtg gac ggc gag tgt gtg gag ccc gtg gac ccg tgc ttc 1056 aga gc ag tgc gc aac tgc gc aac tgc gc aac tgc gc aac tgc gag aac tgc gac ag agc tac 1104 ctc tgc gtc tgc gcc gag ggc ttc gcg ccc att ccc cac gag ccg cac 1152 agg tgc cag atg ttt tgc aac cag act gcc tgt cca gcc gac tgc gac 1200 ccc aac acc cag gct agc gt c tac atc ctg gac 1248 gac ggt ttc atc tgc acg gac atc gac gag tgc gaa aac ggc ggc ttc 1296 tgc tcc ggg gtg tgc cac aac ctc ccc ggt acc ttc gag tgc atc tgc ccgccc gcc ccc gcccc ggc acc gac tgt gac tcc 1392 ggc aag gtg gac ggt ggc gac agc ggc tct ggc gag ccc ccg ccc agc 1440 ccg acg ccc ggc tcc acc ttg act cct ccg gcc gtg ggg ctc gtg cat 1488 tc

<210> 6 <211> 236 <212> PRT <213> Artificial Sequence <220><223> Partial amino acid sequence of human thrombomodulin <400> 6 Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala Ile Pro 1 5 10 15 Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln Ala Asp 20 25 30 Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp Leu Cys 35 40 45 Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr Ser Cys 50 55 60 Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg Cys Glu 65 70 75 80 Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln Arg Cys 85 90 95 Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn Tyr Asp 100 105 110 Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe Arg Ala 115 120 125 Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr Leu Cys 130 135 140 Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His Arg Cys 145 150 155 160 Gln M et Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp Pro Asn 165 170 175 Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp Asp Gly 180 185 190 Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe Cys Ser 195 200 205 Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys Gly Pro 210 215 220 Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys 225 230 235

<210> 7 <211> 575 <212> PRT <213> Artificial Sequence <220><223> Full-length amino acid sequence of human thrombomodulin <400> 7 Met Leu Gly Val Leu Val Leu Gly Ala Leu Ala Leu Ala Gly Leu Gly 1 5 10 15 Phe Pro Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys Val Glu 20 25 30 His Asp Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu Asn Ala 35 40 45 Ser Gln Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser 50 55 60 Ser Val Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly 65 70 75 80 Val Gly Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys 85 90 95 Gly Asp Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp Val Thr 100 105 110 Gly Asp Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn 115 120 125 Gly Ala Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu 130 135 140 Ala Thr Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val 145 150 155 160 Lys Ala Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg 165 170 175 Pro Leu Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr 180 185 190 Tyr Gly Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala Leu Pro 195 200 205 Val Gly Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu Met Cys 210 215 220 Thr Ala Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro 225 230 235 240 Gly Ala Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys 245 250 255 Asn Ala Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala 260 265 270 270 Leu Gln Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys 275 280 285 Asn Asp Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly 290 295 300 Ser Tyr Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln 305 310 315 320 His Arg Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys 325 330 335 Pro Gln Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr 340 345 350 Pro Asn Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro 355 360 365 Cys Phe Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr 370 375 380 Ser Tyr Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu 385 390 395 400 Pro His Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp 405 410 415 Cys Asp Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile 420 425 430 Leu Asp Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly 435 440 445 Gly Phe Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys 450 455 460 Ile Cys Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys 465 470 475 480 Asp Ser Gly Lys Val Asp Gly Gly Asp Ser Gly Ser Gly Glu Pro Pro 485 490 495 Pro Ser Pro Thr Pro Gly Ser Thr Leu Thr Pro Pro Ala Val Gly Leu 500 505 510 Val His Ser Gly Leu Leu Ile Gly Ile Ser Ile Ala Ser Leu Cys Leu 515 520 525 Val Val Ala Leu Leu Ala Leu Leu Cys His Leu Arg Lys Lys Gln Gly 530 535 540 Ala Ala Arg Ala Lys Met Glu Tyr Lys Cys Ala Ala Pro Ser Lys Glu 545 550 555 560 Val Val Leu Gln His Val Arg Thr Glu Arg Thr Pro Gln Arg Leu 565 570 575

<210> 8 <211> 272 <212> PRT <213> Artificial Sequence <220><223> Partial amino acid sequence of human thrombomodulin <400> 8 Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala Ile Pro 1 5 10 15 Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln Ala Asp 20 25 30 Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp Leu Cys 35 40 45 Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr Ser Cys 50 55 60 Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg Cys Glu 65 70 75 80 Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln Arg Cys 85 90 95 Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn Tyr Asp 100 105 110 Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe Arg Ala 115 120 125 Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr Leu Cys 130 135 140 Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His Arg Cys 145 150 155 160 Gln M et Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp Pro Asn 165 170 175 Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp Asp Gly 180 185 190 Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe Cys Ser 195 200 205 Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys Gly Pro 210 215 220 Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys Asp Ser Gly Lys 225 230 235 240 Val Asp Gly Gly Asp Ser Gly Ser Gly Glu Pro Pro Pro Ser Pro Thr 245 250 255 Pro Gly Ser Thr Leu Thr Pro Pro Ala Val Gly Leu Val His Ser Gly 260 265 270

<210> 9 <211> 708 <212> DNA <213> Artificial Sequence <220><223> Partial base sequence of human thrombomodulin gene <400> 9 tgc agc gtg gag aac ggc ggc tgc gag cac gcg tgc aat gcg atc cct 48 ggg gct ccc cgc tgc cag tgc cca gcc ggc gcc gcc ctg cag gca gac 96 ggg cgc tcc tgc acc gca tcc gcg acg cag tcc tgc aac gac ctc tgc 144 gag cac ccc gc cc gcc cc gcc ccg ggc tcc tac tcg tgc 192 atg tgc gag acc ggc tac cgg ctg gcg gcc gac caa cac cgg tgc gag 240 gac gtg gat gac tgc ata ctg gag ccc agt ccg tgt ccg cag cgc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc ag cac tgc tac cct aac tac gac 336 ctg gtg gac ggc gag tgt gtg gag ccc gtg gac ccg tgc ttc aga gcc 384 aac tgc gag tac cag tgc cag ccc ctg aac caa act agc tac gg cc gc cc gc cc gc cg cc gc cc gc cc gc cc gc cc gc cg cc gc cg cc gc cc gc gc att ccc cac gag ccg cac agg tgc 480 cag atg ttt tgc aac cag act gcc tgt cca gcc gac tgc gac ccc aac 528 acc ca g gct agc tgt gag tgc cct gaa ggc tac atc ctg gac gac ggt 576 ttc atc tgc acg gac atc gac gag tgc gaa aac ggc ggc ttc tgc tcc 624 ggg gtg tgc cac aac ctc ccc ggt acct gac tcg gcc ctt gtc cgc cac att ggc acc gac tgt 708

<210> 10 <211> 1725 <212> DNA <213> Artificial Sequence <220> <223> Base sequence of human thrombomodulin gene <400> 10 atg ctt ggg gtc ctg gtc ctt ggc gcg ctg gcc ctg gcc ggc ctg ggg 48 ttc ccc gca ccc gca gag ccg cag ccg ggt ggc agc cag tgc gtc gag 96 cac gac tgc ttc gcg ctc tac ccg ggc ccc gcg acc ttc ctc aat gcc 144 agt cag atc gc cg gc cg gc cg gc cg gc cg gc cc gc cg gc cg gc cg gc cg gc cg gc cg gtg cgc tcc 192 tcg gtg gct gcc gat gtc att tcc ttg cta ctg aac ggc gac ggc ggc 240 gtt ggc cgc cgg cgc ctc tgg atc ggc ctg cag ctg cca ccc ggc tgc 288 ggc gac ccc aag cgc ctc ggg ccc ctg cgc ggc ttc cag tgg gtt acg 336 gga gac aac aac acc agc tat agc agg tgg gca cgg ctc gac ctc aat 384 ggg gct ccc ctc tgc ggc ccg ttg tgc gtc gct gtc tcc gct gct gag 432 gcc gc gg gcc gc gc gc gc gc gc gc gc gct cag cag tgc gaa gtg 480 aag gcc gat ggc ttc ctc tgc gag ttc cac ttc cca gcc acc tgc agg 528 cca ctg g ct gtg gag ccc ggc gcc gcg gct gcc gcc gtc tcg atc acc 576 tac ggc acc ccg ttc gcg gcc cgc gga gcg gac ttc cag gcg ctg ccg 624 gtg ggc agc tcc gcc gc gc gc gc gc gc cc gc gc gc gc gc gc gc gc gc gc g cg cc gc gc g ctg gcg ccg ccc gga gcg gtc cag ggg cac tgg gcc agg gag gcg ccg 720 ggc gct tgg gac tgc agc gtg gag aac ggc ggc tgc gag cac gcg tgc 768 aat gcg atc cct ggg gct ccc gcc tcc gcc ctg cag gca gac ggg cgc tcc tgc acc gca tcc gcg acg cag tcc tgc 864 aac gac ctc tgc gag cac ttc tgc gtt ccc aac ccc gac cag ccg ggc 912 tcc tac tcg tgc atg tgc gg gc gg gc gg gc gg gc gg gc gg gc gc acc 960 cac cgg tgc gag gac gtg gat gac tgc ata ctg gag ccc agt ccg tgt 1008 ccg cag cgc tgt gtc aac aca cag ggt ggc ttc gag tgc cac tgc tac 1056 cct aac tac gac gtg gg gc gtg gg gc gtg gg gc gtg gg gc gtg gtg ccg 1104 tgc ttc aga gcc aac tgc gag tac cag tgc cag ccc ctg aac caa act 1152 agc tac ctc tgc gtc tgc gcc gag ggc ttc gcg ccc att ccc cac gag 1200 ccg cac agg tgc cag atg tgc cag atg tgc cag atg tgc cag atg tgc cag atg cca gcc gac 1248 tgc gac ccc aac acc cag gct agc tgt gag tgc cct gaa ggc tac atc 1296 ctg gac gac ggt ttc atc tgc acg gac atc gac gag tgc gaa aac ggc 1344 ggc ttc cgc gc gc ttc cgc gc ttc cgc gc acc ttc gag tgc 1392 atc tgc ggg ccc gac tcg gcc ctt gtc cgc cac att ggc acc gac tgt 1440 gac tcc ggc aag gtg gac ggt ggc gac agc ggc tct ggc gag ccc ccg cc cg ccc gcc cg ccc gcc ccg gcc gtg ggg ctc 1536 gtg cat tcg ggc ttg ctc ata ggc atc tcc atc gcg agc ctg tgc ctg 1584 gtg gtg gcg ctt ttg gcg ctc ctc tgc cac ctg cg ag ag ag gag ag ag ag ag ag ag ag ag ag ag ag ag ag gcg gcc cct tcc aag gag 1680 gta gtg ctg cag cac gtg cgg acc gag cgg acg ccg cag aga ctc 1725

<210> 11 <211> 816 <212> DNA <213> Artificial Sequence <220><223> Partial base sequence of human thrombomodulin gene <400> 11 tgc agc gtg gag aac ggc ggc tgc gag cac gcg tgc aat gcg atc cct 48 ggg gct ccc cgc tgc cag tgc cca gcc ggc gcc gcc ctg cag gca gac 96 ggg cgc tcc tgc acc gca tcc gcg acg cag tcc tgc aac gac ctc tgc 144 gag cac ccc gc cc gcc cc gcc ccg ggc tcc tac tcg tgc 192 atg tgc gag acc ggc tac cgg ctg gcg gcc gac caa cac cgg tgc gag 240 gac gtg gat gac tgc ata ctg gag ccc agt ccg tgt ccg cag cgc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc ag cac tgc tac cct aac tac gac 336 ctg gtg gac ggc gag tgt gtg gag ccc gtg gac ccg tgc ttc aga gcc 384 aac tgc gag tac cag tgc cag ccc ctg aac caa act agc tac gg cc gc cc gc cc gc cg cc gc cc gc cc gc cc gc cc gc cg cc gc cg cc gc cc gc gc att ccc cac gag ccg cac agg tgc 480 cag atg ttt tgc aac cag act gcc tgt cca gcc gac tgc gac ccc aac 528 acc cag gct agc tgt gag tgc cct gaa ggc tac atc ctg gac gac ggt 576 ttc atc tgc acg gac atc gac gag tgc gaa aac ggc ggc ttc tgc tcc 624 ggg gtg tgc cac gc tc gc gc gc gc gc gc 672 gac tcg gcc ctt gtc cgc cac att ggc acc gac tgt gac tcc GGc aag 720 ggc 816

<210> 12 <211> 1670 <212> DNA <213> Artificial Sequence <220><223> Base sequence encoding mature human thrombomodulin <400> 12 gca ccc gca gag ccg cag ccg ggt ggc agc cag tgc gtc gag cac gac 48 tgc ttc gcg ctc tac ccg ggc ccc gcg acc ttc ctc aat gcc agt cag 96 atc tgc gac gga ctg cgg ggc cac cta atg aca gtg cgc tcc tcg gtg gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gcc ggc gac ggc ggc gtt ggc 192 cgc cgg cgc ctc tgg atc ggc ctg cag ctg cca ccc ggc tgc ggc gac 240 ccc aag cgc ctc ggg ccc ctg cgc ggc ttc cag tgg gtt ag gac gac ag gac gag ag gac ag gac gag ag ag ag cgg ctc gac ctc aat ggg gct 336 ccc ctc tgc ggc ccg ttg tgc gtc gct gtc tcc gct gct gag gcc act 384 gtg ccc agc gag ccg atc tgg gag gag cag cag tgc gag gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gtg ag ttc cca gcc acc tgc agg cca ctg 480 gct gtg gag ccc ggc gcc gcg gct gcc gcc gtc tcg atc acc tac ggc 528 acc ccg ttc gcg gcc cgc gga gcg gac ttc cag gcg ctg ccg gtg ggc 576 agc tcc gcc gcg gtg gct ccc ctc ggc tta cag cta atg tgc acc gcg gc gc gg gc gg gc gg gc gg gc gc gg gc gg gc gg gc gg gc gc gg gc gc gg gc gc gc gg gcc ccg ggc gct 672 tgg gac tgc agc gtg gag aac ggc ggc tgc gag cac gcg tgc aat gcg 720 atc cct ggg gct ccc cgc tgc cag tgc cca gcc ggc gcc gcc ctg cag 768 gca gcc gcc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gc gcc tcc tgc aac gac 816 ctc tgc gag cac ttc tgc gtt ccc aac ccc gac cag ccg ggc tcc tac 864 tcg tgc atg tgc gag acc ggc tac cgg ctg gcg gcc gac caa cac cgg 912 tgc gag gac gac gac gac gac gac gac gac gac gac gac gac gac gac gac gag gac gac gag gac gag gag gag gac gac gac gag gag gac gac gag gag gag gac gac gag agt ccg tgt ccg cag 960 cgc tgt gtc aac aca cag ggt ggc ttc gag tgc cac tgc tac cct aac 1008 tac gac ctg gtg gac ggc gag tgt gtg gag ccc gtg gac ccg tgc tg gc ttc gc ttc gac cc ctg aac caa act agc tac 1104 ctc tgc gtc tgc gcc gag ggc ttc gcg ccc att ccc cac gag ccg cac 1152 agg tgc cag atg ttt tgc aac cag act gcc tgt cca gcc gac tgc gac 1200gcc gac acc tgc cct gaa ggc tac atc ctg gac 1248 gac ggt ttc atc tgc acg gac atc gac gag tgc gaa aac ggc ggc ttc 1296 tgc tcc ggg gtg tgc cac aac ctc ccc ggt acc ttc gg tcc gc cc gc cc gc gc gc cc gc cc gc cc gc gc cc gc gc gc gc gc cgc cac att ggc acc gac tgt gac tcc 1392 ggc aag gtg gac ggt ggc gac agc ggc tct ggc gag ccc ccg ccc agc 1440 ccg acg ccc ggc tcc acc ttg act cct ccg gcc gtg ggg ctc gt cg gg gg gg gg gg cg atc tcc atc gcg agc ctg tgc ctg gtg gtg 1536 gcg ctt ttg gcg ctc ctc tgc cac ctg cgc aag aag cag ggc gcc gcc 1584 agg gcc aag atg gag tac aag tgc gc gg cg gc gg cg gc gc gg cg gc gg cg gc gg cg gcc cg cg gc gc gg cg gcc acc gag cgg acg ccg cag aga ctc 1671

<210> 13 <211> 557 <212> PRT <213> Artificial Sequence <220><223> Amino acid sequence of mature human thrombomodulin <400> 13 Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys Val Glu His Asp 1 5 10 15 Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu Asn Ala Ser Gln 20 25 30 Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser Ser Val 35 40 45 Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly Val Gly 50 55 60 Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys Gly Asp 65 70 75 80 Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp Val Thr Gly Asp 85 90 95 Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn Gly Ala 100 105 110 Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu Ala Thr 115 120 125 Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val Lys Ala 130 135 140 Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg Pro Leu 145 150 155 160 Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr Tyr Gly 165 170 175 Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala Leu Pro Val Gly 180 185 190 Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu Met Cys Thr Ala 195 200 205 Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro Gly Ala 210 215 220 Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala 225 230 235 240 Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln 245 250 255 Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp 260 265 270 Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr 275 280 285 Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg 290 295 300 Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln 305 310 315 320 Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn 325 330 335 Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe 340 345 350 Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr 355 360 365 Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His 370 375 380 Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp 385 390 395 400 400 Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp 405 410 415 Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe 420 425 430 Cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys 435 440 445 Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys Asp Ser 450 455 460 Gly Lys Val Asp Gly Gly Asp Ser Gly Ser Gly Glu Pro Pro Ser 465 470 475 475 480 Pro Thr Pro Gly Ser Thr Leu Thr Pro Pro Ala Val Gly Leu Val His 485 490 495 Ser Gly Leu Leu Ile Gly Ile Ser Ile Ala Ser Leu Cys Leu Val Val 500 505 510 Ala Leu Leu Ala Leu Leu Cys His Leu Arg Lys Lys Gln Gly Ala Ala 515 520 525 Arg Ala Lys Met Glu Tyr Lys Cys Ala Ala Pro Ser Lys Glu Val Val 530 535 540 Leu Gln His Val Arg Thr Glu Arg Thr Pro Gln Arg Leu 545 550 555

<210> 14 <211> 462 <212> PRT <213> Artificial Sequence <220><223> Partial amino acid sequence of mature human thrombomodulin <400> 14 Ala Pro Ala Glu Pro Gln Pro Gly Gly Ser Gln Cys Val Glu His Asp 1 5 10 15 Cys Phe Ala Leu Tyr Pro Gly Pro Ala Thr Phe Leu Asn Ala Ser Gln 20 25 30 Ile Cys Asp Gly Leu Arg Gly His Leu Met Thr Val Arg Ser Ser Val 35 40 45 Ala Ala Asp Val Ile Ser Leu Leu Leu Asn Gly Asp Gly Gly Val Gly 50 55 60 Arg Arg Arg Leu Trp Ile Gly Leu Gln Leu Pro Pro Gly Cys Gly Asp 65 70 75 80 Pro Lys Arg Leu Gly Pro Leu Arg Gly Phe Gln Trp Val Thr Gly Asp 85 90 95 Asn Asn Thr Ser Tyr Ser Arg Trp Ala Arg Leu Asp Leu Asn Gly Ala 100 105 110 Pro Leu Cys Gly Pro Leu Cys Val Ala Val Ser Ala Ala Glu Ala Thr 115 120 125 Val Pro Ser Glu Pro Ile Trp Glu Glu Gln Gln Cys Glu Val Lys Ala 130 135 140 Asp Gly Phe Leu Cys Glu Phe His Phe Pro Ala Thr Cys Arg Pro Leu 145 150 155 160 Ala Val Glu Pro Gly Ala Ala Ala Ala Ala Val Ser Ile Thr Tyr Gly 165 170 175 Thr Pro Phe Ala Ala Arg Gly Ala Asp Phe Gln Ala Leu Pro Val Gly 180 185 190 Ser Ser Ala Ala Val Ala Pro Leu Gly Leu Gln Leu Met Cys Thr Ala 195 200 205 Pro Pro Gly Ala Val Gln Gly His Trp Ala Arg Glu Ala Pro Gly Ala 210 215 220 Trp Asp Cys Ser Val Glu Asn Gly Gly Cys Glu His Ala Cys Asn Ala 225 230 235 240 Ile Pro Gly Ala Pro Arg Cys Gln Cys Pro Ala Gly Ala Ala Leu Gln 245 250 255 Ala Asp Gly Arg Ser Cys Thr Ala Ser Ala Thr Gln Ser Cys Asn Asp 260 265 270 Leu Cys Glu His Phe Cys Val Pro Asn Pro Asp Gln Pro Gly Ser Tyr 275 280 285 Ser Cys Met Cys Glu Thr Gly Tyr Arg Leu Ala Ala Asp Gln His Arg 290 295 300 Cys Glu Asp Val Asp Asp Cys Ile Leu Glu Pro Ser Pro Cys Pro Gln 305 310 315 320 Arg Cys Val Asn Thr Gln Gly Gly Phe Glu Cys His Cys Tyr Pro Asn 325 330 335 Tyr Asp Leu Val Asp Gly Glu Cys Val Glu Pro Val Asp Pro Cys Phe 340 345 350 Arg Ala Asn Cys Glu Tyr Gln Cys Gln Pro Leu Asn Gln Thr Ser Tyr 355 360 365 Leu Cys Val Cys Ala Glu Gly Phe Ala Pro Ile Pro His Glu Pro His 370 375 380 Arg Cys Gln Met Phe Cys Asn Gln Thr Ala Cys Pro Ala Asp Cys Asp 385 390 395 400 400 Pro Asn Thr Gln Ala Ser Cys Glu Cys Pro Glu Gly Tyr Ile Leu Asp 405 410 415 Asp Gly Phe Ile Cys Thr Asp Ile Asp Glu Cys Glu Asn Gly Gly Phe 420 425 430 cys Ser Gly Val Cys His Asn Leu Pro Gly Thr Phe Glu Cys Ile Cys 435 440 445 Gly Pro Asp Ser Ala Leu Val Arg His Ile Gly Thr Asp Cys 450 455 460

<210> 15 <211> 1386 <212> DNA <213> Artificial Sequence <220><223> Partial Nucleotide Sequence of Mature Human Thrombomodulin Gene <400> 15 cctcaatgcc agtcagatct gcgacggact gcggggccac 120 ctaatgacag tgcgctcctc ggtggctgcc gatgtcattt ccttgctact gaacggcgac 180 ggcggcgttg gccgccggcg cctctggatc ggcctgcagc tgccacccgg ctgcggcgac 240 cccaagcgcc tcgggcccct gcgcggcttc cagtgggtta cgggagacaa caacaccagc 300 tatagcaggt gggcacggct cgacctcaat ggggctcccc tctgcggccc gttgtgcgtc 360 gctgtctccg ctgctgaggc cactgtgccc agcgagccga tctgggagga gcagcagtgc 420 gaagtgaagg ccgatggctt cctctgcgag ttccacttcc cagccacctg caggccactg 480 gctgtggagc ccggcgccgc ggctgccgcc gtctcgatca cctacggcac cccgttcgcg 540 gcccgcggag cggacttcca ggcgctgccg gtgggcagct ccgccgcggt ggctcccctc 600 ggcttacagc taatgtgcac cgcgccg ccc ggagcggtcc aggggcactg ggccagggag 660 gcgccgggcg cttgggactg cagcgtggag aacggcggct gcgagcacgc gtgcaatgcg 720 atccctgggg ctccccgctg ccagtgccca gccggcgccg ccctgcaggc agacgggcgc 780 tcctgcaccg catccgcgac gcagtcctgc aacgacctct gcgagcactt ctgcgttccc 840 aaccccgacc agccgggctc ctactcgtgc atgtgcgaga ccggctaccg gctggcggcc 900 gaccaacacc ggtgcgagga cgtggatgac tgcatactgg agcccagtcc gtgtccgcag 960 cgctgtgtca acacacaggg tggcttcgag tgccactgct accctaacta cgacctggtg 1020 gacggcgagt gtgtggagcc cgtggacccg tgcttcagag ccaactgcga gtaccagtgc 1080 cagcccctga accaaactag ctacctctgc gtctgcgccg agggcttcgc gcccattccc 1140 cacgagccgc acaggtgcca gatgttttgc aaccagactg cctgtccagc cgactgcgac 1200 cccaacaccc aggctagctg tgagtgccct gaaggctaca tcctggacga cggtttcatc 1260 tgcacggaca tcgacgagtg cgaaaacggc ggcttctgct ccggggtgtg ccacaacctc 1320 cccggtacct tcgagtgcat ctgcgggccc gactcggccc ttgtccgcca cattggcacc 1380 gactgt 1386

[Brief description of the drawings]

FIG. 1 shows the results of subjecting a peptide obtained by purifying from human lung, which has the activity of promoting protein C activation by thrombin, to a fourth DIP-thrombin-agarose column chromatography in Reference Example 2. It is a graph.

FIG. 2 shows a DNA fragment TM obtained in Reference Example 3- (2).
13 shows the base sequence of No. 13.

FIG. 3 shows a DN obtained in Reference Example 3- (2) following FIG. 2;
1 shows the nucleotide sequence of A fragment TM13.

FIG. 4 shows a DNA fragment TM obtained in Reference Example 3- (5).
137 shows the base sequence of 137.

FIG. 5 shows a DN obtained in Reference Example 3- (5) following FIG.
1 shows the nucleotide sequence of A fragment TM137.

FIG. 6 shows DN obtained in Reference Example 3- (5) following FIG.
1 shows the nucleotide sequence of A fragment TM137.

FIG. 7 shows DN obtained in Reference Example 3- (5) following FIG.
1 shows the nucleotide sequence of A fragment TM137.

FIG. 8 shows a DNA fragment TM obtained in Reference Example 3- (7).
It shows the nucleotide sequence of P5.

FIG. 9 shows a DN obtained in Reference Example 3- (7) following FIG.
1 shows the nucleotide sequence of the A fragment TMP5.

FIG. 10 shows a DNA fragment TMP26 base sequence obtained in Reference Example 3- (10).

FIG. 11 shows DNA fragments TMP13, TM137 and TMP.
5 and TMP26 and Reference Examples 3- (13-1) and 3-
DNA fragments TMJ1 and TMJ2 obtained in (13-2)
1 shows the corresponding relationship between the restriction enzyme maps and the base sequences of these DNA fragments, and shows that the overlapping portions of the DNA fragments in the vertical direction have a common base sequence. In the figure, the hatched part of the restriction enzyme map of the DNA fragment TMJ2 includes a possible open reading frame including the oblique line, and the base sequence of the present invention is present in the oblique line.

FIG. 12 is a flow chart showing the construction of plasmid pUC18TMJ1 containing TMJ1 and TMP5 bound thereto.

FIG. 13 is a flow chart showing construction of plasmid pUC18TMJ2 containing TMJ1 and TMP26 bound thereto.

FIG. 14 shows that TMJ2 was used as an expression vector for animal cell hosts.
Plasmid pSV2TMJ was inserted by inserting MJ2.
3 is a flowchart showing the construction of the second embodiment.

FIG. 15 shows that the releaser TMD hybridized complementarily to the recombinant plasmid M-13mp19TMJ3 obtained in Example 1- (2)-(a), in which the releaser hybridized to the plasmid. This shows the base sequence around the portion and the amino acid sequence encoded thereby.

FIG. 16 shows that the recombinant plasmid pSV2TMD1 obtained in Example 1- (2)-(b) was replaced with the releaser TMd _2.
Shows the nucleotide sequence in which the hybridizer complementarily hybridizes, and the nucleotide sequence around the portion where the releaser hybridizes to the plasmid and the amino acid sequence encoded thereby.

[17] Example 1- (2) - deleter over TMd ₃ in the recombinant plasmid M-13mp19TMJ3 obtained in (a) is intended to indicate a place where hybridized complementary, hybridized deleter over within plasmid This shows the base sequence around the part shown in the figure and the amino acid sequence encoded thereby.

FIG. 18 shows that the recombinant plasmid M13-TMD3 obtained in Example 1- (4)-(a) has deleter TMd ₂
Shows the nucleotide sequence in which the hybridizer complementarily hybridizes, and the nucleotide sequence around the portion where the releaser hybridizes to the plasmid and the amino acid sequence encoded thereby.

FIG. 19 shows that the recombinant plasmid M13-TMD3 obtained in Example 1- (4)-(a) has a deleter TMd ₄
Shows the nucleotide sequence in which the hybridizer complementarily hybridizes, and the nucleotide sequence around the portion where the releaser hybridizes to the plasmid and the amino acid sequence encoded thereby.

FIG. 20 is a flowchart showing the construction of plasmid pdBPVTMD5-1, which is a replicable recombinant DNA of the present invention.

FIG. 21 is a flowchart showing the construction of plasmid pdBPVTMD5-1, which is a replicable recombinant DNA, continued from FIG. 20.

FIG. 22 is a flow chart showing the construction of plasmid pdBPVTMD4-1, which is a replicable recombinant DNA of the present invention.

FIG. 23 is a flowchart showing the construction of plasmid pdBPVTMD4-1, which is a replicable recombinant DNA, following FIG. 22.

FIG. 24 is a flowchart showing the construction of a plasmid pdBPVTMD2-1 which is a replicable recombinant DNA of the present invention.

FIG. 25 is a flowchart showing the construction of plasmid pdBPVTMD2-1, which is a replicable recombinant DNA, following FIG. 24.

FIG. 26 is a flow chart showing the construction of plasmid pdBPVTMD1-1, which is a replicable recombinant DNA of the present invention.

FIG. 27 is a flowchart showing the construction of plasmid pdBPVTMD1-1 which is a replicable recombinant DNA following FIG. 24.

FIG. 28 is a flowchart showing the construction of plasmid pdBPVTMJ2-1, which is a replicable recombinant DNA of the present invention.

FIG. 29 is a flowchart showing the construction of plasmid pdBPVTMJ2-1, which is a replicable recombinant DNA, following FIG. 27.

FIG. 30 shows the results of culturing and purifying cells transformed with plasmid pSV2TMD5, the amount of activated protein C produced by the reaction of protein C with thrombin, and the reaction time in the presence and absence of the obtained peptide. 6 is a graph showing the relationship of FIG.

FIG. 31 shows the results of culturing and purifying cells transformed with the plasmid pSV2TMD4, the amount of activated protein C generated by the reaction of protein C with thrombin, and the reaction time in the presence and absence of the obtained peptide. 6 is a graph showing the relationship of FIG.

FIG. 32 shows the results of culturing and purifying cells transformed with the plasmid pSV2TMD2, the amount of activated protein C produced by the reaction of protein C with thrombin, and the reaction time in the presence and absence of the obtained peptide. 6 is a graph showing the relationship of FIG.

FIG. 33 shows that cells transformed with plasmid pSV2TMD1 were cultured and purified, and the amount and reaction time of activated protein C produced by the reaction of protein C with thrombin in the presence and absence of the obtained peptide. 3 is a graph showing the relationship of

FIG. 34 shows that the cells transformed with the plasmid pSV2TMJ2 were cultured and purified, and the amount and reaction time of activated protein C produced by the reaction of protein C with thrombin in the presence and absence of the obtained peptide. 6 is a graph showing the relationship of.

FIG. 35 is a graph showing the relationship between the clotting time of blood obtained by culturing and purifying cells transformed with plasmid pSV2TMD5 and adding the obtained peptide and the amount of the purified peptide of the present invention added.

FIG. 36 is a graph showing the relationship between the coagulation time of blood obtained by culturing and purifying cells transformed with plasmid pSV2TMD4 and adding the obtained peptide and the amount of the purified peptide of the present invention added.

FIG. 37 is a graph showing the relationship between the clotting time of blood obtained by culturing and purifying cells transformed with the plasmid pSV2TMD2 and the obtained peptide and the amount of the purified peptide of the present invention added.

FIG. 38 is a graph showing the relationship between the clotting time of blood obtained by culturing and purifying cells transformed with the plasmid pSV2TMD1 and adding the obtained peptide, and the amount of the purified peptide of the present invention added.

FIG. 39 is a graph showing the relationship between the coagulation time of blood obtained by culturing and purifying cells transformed with plasmid pSV2TMJ2 and adding the obtained peptide and the amount of the purified peptide of the present invention added.

FIG. 40 is a restriction map of a DNA fragment TMJ2.
In the figure, the portion containing the hatched portion and the oblique line portion is a possible open reading frame, and the base sequence encoding the peptide of the present invention is present in the oblique line portion.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification code FI A61P 7/02 C12N 15/00 ZNAA C12N 5/10 5/00 B (C12P 21/02 C12R 1:91) (31) Priority Claim No. 62-305876 (32) Priority date December 4, 1987 (1987.12.4) (33) Country claiming priority Japan (JP) (31) Claim number claiming priority No. 62-305876 305877 (32) Priority date December 4, 1987 (1987.12.4) (33) Priority claiming country Japan (JP) (31) Priority claim number Japanese Patent Application No. 62-305878 (32) Priority date Showa December 4, 1987 (1987.2.4) (33) Priority Country Japan (JP) (58) Fields Investigated (Int. Cl. ⁷ , DB Name) C12N 15/09 ZNA BIOSIS (DIALOG) GenBank / EMBL / DDBJ WPI / L (QUESTEL)

Claims (4)

(57) [Claims] 1. A substantially purified , substantially free of human-derived contaminant component, which binds to thrombin and has an action of promoting the activation of protein C by thrombin ;
A method for producing a recombinant peptide that is soluble at least in the absence of a surfactant , the peptide comprising : ( i) the amino acid sequence of 1-498 of SEQ ID NO: 3
A soluble peptide , ( ii) an amino acid having the amino acid sequence of 1-498 of SEQ ID NO: 3.
From amino acid sequence in which no acid has been deleted, substituted or added
And binds to thrombin,
Has the activity of promoting the activation of tein C
Soluble peptide is any peptide, DN containing a nucleotide sequence encoding: (a) the peptide
A is ligated to a replicable expression vector to obtain a replicable recombinant DNA containing the DNA and the replicable expression vector, and (b) a microorganism or a human with the replicable recombinant DNA. (C) selecting the transformant from the parent cell of the microorganism or cell, and (d) culturing the transformant to transform the animal cell. The DN on the body
Expressing A to produce the peptide, and (e) isolating the peptide from a cultured transformant. 2. (a) A DNA containing a base sequence encoding the amino acid sequence of 1 to 575 of SEQ ID NO: 7 is ligated to a replicable expression vector, and the DNA and the replicable expression vector are combined. Reproducible recombinant DNA containing
(B) transforming a microorganism or a non-human cell with the replicable recombinant DNA to form a transformant; and (c) transforming the transformant with the microorganism or a non-human animal cell. (D) culturing the transformant, and adding the DN to the transformant.
A is expressed to produce a recombinant peptide having an action of binding to thrombin and promoting the activation of protein C by thrombin; (e) isolating the peptide from the cultured transformant;
Preparing a recombinant peptide substantially free of human-derived contaminants, which binds to thrombin and has an action to promote the activation of protein C by thrombin; (f) transferring the recombinant peptide to an animal other than human A method for producing the antibody, comprising obtaining an antibody that binds to the recombinant peptide by immunization. 3. (a) A DNA containing a nucleotide sequence encoding the amino acid sequence of 1-498 of SEQ ID NO: 3 is ligated to a replicable expression vector, and the DNA and the replicable expression vector are combined. Reproducible recombinant DNA containing
(B) transforming a microorganism or a non-human animal cell with the replicable recombinant DNA to form a transformant; and (c) transforming the transformant from a parent cell of the microorganism or cell. (D) culturing the transformant, and adding the DN to the transformant.
A is expressed to produce a soluble peptide that binds to thrombin and has the effect of promoting the activation of protein C by thrombin. (E) Isolating the soluble peptide from the cultured transformant, Preparing a recombinant soluble peptide substantially free of contaminants that binds to thrombin and has the effect of promoting the activation of protein C by thrombin; (f) immunizing non-human animals with the soluble recombinant peptide; And obtaining an antibody that binds to the recombinant soluble peptide. (A) ligating a DNA containing a nucleotide sequence encoding the amino acid sequence of 1-118 of SEQ ID NO: 1 to a replicable expression vector, and combining the DNA with the replicable expression vector; (B) transforming a microorganism or an animal cell other than human with the replicable recombinant DNA to form a transformant; and (c) transforming the transformant. (D) culturing the transformant, and adding the DN to the transformant.
A is expressed to produce a soluble peptide that binds to thrombin and has the effect of promoting the activation of protein C by thrombin. (E) Isolating the soluble peptide from the cultured transformant, Preparing a recombinant soluble peptide substantially free of contaminants that binds to thrombin and has the effect of promoting the activation of protein C by thrombin; (f) immunizing non-human animals with the soluble recombinant peptide; And obtaining an antibody that binds to the recombinant soluble peptide.