JP2864219B2 - Fractional determination of free active matrix metalloproteases - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to the field of medicine and physiology, and relates to a method for the differential determination of free matrix metalloproteases (MMPs), particularly free active MMPs. More specifically, the present invention relates to an MM
The present invention relates to a method for differentially quantifying free active MMPs using each monoclonal antibody that specifically binds to Ps and tissue inhibitors of metalloproteases (TIMPs), which are inhibitors of MMPs.

[0002]

BACKGROUND ART The extracellular matrix is composed of adhesive glycoproteins such as collagen, proteoglycan, elastin, fibronectin and laminin (M
artinez-Hernandez et al. ,
Lab. Invest. , 48, 656-677, 19
83). It is well known that matrix metalloproteases (MMPs) play an important role in the degradation of these matrix components. Known MM
The types of P and their numbering are as follows. Interstitial collagenase (MMP-1), 72 kilodalton (kD a) gelatinase (MMP-2), stromelysin -1 (MMP-3), PUMP -1 (MM
P-7), neutrophil collagenase (MMP-8), 92k
Da gelatinase (MMP-9), stromlysin-
2 (MMP-10), Stromlysin-3 (MMP-
11), macrophage metalloelastase (MMP-
12), collagenase-3 (MMP-13) and membrane type M
MP (MT-MMP ) (H. Birkedal-
Hansen et al. , Oral Biol. M
ed. , 4,197-250, 1993; D. Sh
apiro et al. , J. et al. Bio l. Che
m. , 268, 23824-23829, 1993;
J. M. P. Freje et al. , J. et al. Bio
l. Chem. , 269, 16766-16773, 1
994; Sato et al. , Nature,
370, 61-65, 1994).

[0003] MMPs are synthesized and produced in cells and released as precursors (pro-forms or latent forms) outside the cells as needed. Latent MMPs are composed of a propeptide, an active center region (center region) and a carboxyl terminal region from the amino terminus.
It is not involved in the degradation of matrix components, but is activated by limited degradation in the body by plasmin or MMP-3, or the amino-terminal propeptide is cleaved experimentally by thiol-reactive organomercury compounds. To form active MMPs and decompose matrix components corresponding to each substrate (H. Birk).
edal-Hansen et al. , Oral B
iol. Med. , 4,197-250, 1993).
It is also known that tissue inhibitors of metalloproteases (TIMPs), which are inhibitors of MMPs that specifically inhibit MMPs activity in tissues and body fluids, are present (T. Hayagawa, C.
cell structure. Funct. , 19,109-
114, 1994). Three types of TIMPs are currently reported, TIMP-1, TIMP-2, and TIMP, respectively.
-3. These TIMPs usually bind to active MMPs and are considered to have physiological effects such as tissue repair, tissue destruction inhibition, cancer metastasis suppression, and cell growth promotion. TIMP-1 is a latent MM
At P-9, TIMP-2 binds to latent MMP-2,
It is thought that they control the activation and autolytic activity of each MMP.

[0004]

The measurement of free active MMPs can be a means of knowing the amount of active MMPs directly involved in the decomposition of matrix components among MMPs present in tissues and body fluids. Therefore, by quantifying free active MMPs, it is possible to diagnose or monitor diseases in which MMPs activity is enhanced, such as arthropathy, cancer invasion, metastasis, periodontal disease and pulmonary fibrosis. Becomes However, as a method for measuring the amount of active MMPs, generally, a method based on an enzyme activity for decomposing each substrate is used, but other MMPs and TIMPs are present in tissues and body fluids. The presence and presence of a wide substrate specificity of each MMP made it difficult to separate and quantify MMPs. Zucker et al. (PCT
WO 93/2047) has two types of antibodies, namely each M
Using an antibody against MP and an antibody against each TIMP,
MMP-TIMP complex is measured. In this method, only the inactive MMP-TIMP complex that has already been formed is measured, but the active MMPs in a free state (free active MMPs) directly involved in the decomposition of the matrix component cannot be measured. Further, TIMPs bind to all active MMPs, and furthermore, TIMP-1 or TIMP-1
MP-2 is latent MMP-9 or latent MMP, respectively.
-2 also binds to TIMP-1, TIMP-2 and TIMP-
3 must be quantified, and for MMP-2 and MMP-9, it is necessary to separate and quantify the complex between latent MMPs and the complex.
It is difficult to determine the amount of Ps. Thus, up to now, there is no report on a method for quantifying only active MMPs in a free state. Activated MMP that does not recognize latent MMP
It is thought that active MMPs can be measured by using an antibody specific to s alone, but there is no report that such an antibody was obtained yet.

[0005]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for separating and quantifying the amount of each active MMPs with high sensitivity, high accuracy and quickness using simple procedures and reagents. It is also an object of the present invention to provide a reagent kit used in such a method. The present inventors provide an inhibitor that binds to active MMPs and suppresses the activity thereof,
For example, among TIMPs, α ₂ -macroglobulin, peptide inhibitors, synthetic compounds, and the like, focusing on the fact that TIMPs specifically bind to all the active forms of MMPs, an antibody that specifically binds to each MMP and TIMPs Considering that the combination could provide a simple method for differentially quantifying free active MMPs, as a result of intensive studies, an antibody that specifically binds to each MMP, TIMPs or TIMPs and TIMPs and each TIMP specifically A method for the differential quantification of free active MMPs using a conjugate with the antibody to be used was established. Furthermore, when TIMPs are used for labeling, TIMPs succeeded in directly or indirectly labeling without impairing the binding ability of TIMPs to active MMPs,
By combining s with an antibody that specifically binds to each MMP, a simple method for the quantitative determination of free active MMPs was established. In particular, TIMP-1 directly labeled and each M
When used in combination with an antibody that specifically binds to MP, free active MMP-1, -2, -3, -7,-
8, -10, -11, -12 and -13 and MT-M
MPs can be quantified, and TIs directly labeled
When MP-2 and an antibody that specifically binds to each MMP are used in combination, free active MMP-1, -3,-
7, -8, -9, -10, -11, -12 and -13 average
And MT-MMP can be quantified. Further, when TIMP-1 or TIMP-2 is used for the solid phase, the amount of each free active MMP can be determined in the same manner as described above.

Further, when an antibody that specifically binds to each MMP and each TIMP are used in combination, each TIMP to which a labeled substance is indirectly applied by using a labeled anti-TIMP antibody is used. All free active MMPs, ie, MMP-1, -2, -3,-
7, -8, -9, -10, -11, -12 and -13 average
And MT-MMP can be quantified. The present invention
A component in which a member selected from the group consisting of TIMPs and a member selected from the group consisting of monoclonal antibodies against each MMP are used in combination, and one of the combined components is provided with a label that can be detected directly or indirectly. Another object of the present invention is to provide a method for separating and quantifying free active MMPs in a test sample by using another combination component as a solid-phased component, and a reagent used for the method. Thus, typically, the object of the present invention is to provide a labeled TIMP
s (including TIMPs labeled indirectly with each monoclonal antibody labeled with each TIMP) or a monoclonal antibody against each MMP and a monoclonal antibody or TIMPs against each MMP for a solid phase carrier, An object of the present invention is to provide an excellent method for differentially quantifying free active MMPs in a sample and a reagent kit therefor. It is understood that the present invention includes in its embodiment all the reagents of the reagent kit capable of differentially quantifying such free active MMPs. It is a further object of the present invention to provide a method, a reagent or a diagnostic agent capable of monitoring a disease state such as tissue destruction or cancer metastasis by differentially quantifying free active MMPs using the above-mentioned quantification method. Therefore, various uses of the above reagents in the medical and physiological fields, tissue destruction and cancer metastasis, judgment of the degree of tissue repair, and use of the above reagents as indicators of physiological effects such as promotion of cell proliferation are all within the scope of the present invention. Are understood to be included within that embodiment.

According to an embodiment of the present invention, there is provided, for example, the following quantification method. (1) Labeled TIMPs and monoclonal antibodies that specifically bind to each MMP or (2) TIM
TIMPs labeled with a monoclonal antibody that specifically binds to P and a monoclonal antibody that specifically binds to each MMP were used.
A method for quantifying free active MMPs, wherein MP is used as a standard substance, and a method for quantifying free active MMPs in a test sample, and a reagent used therefor. In the quantification method of the present invention, the monoclonal antibody specifically binding to the MMP used specifically binds to each MMP,
A monoclonal antibody that does not cross react with other MMPs,
In particular, those that recognize the central region or the carboxyl terminal region of each MMP can be mentioned.

[0008] The inhibitors for MMPs used in the present invention may include inhibitors for MMPs from the MMP gene family, for example, TIMPs.
-1 and TIMP-2 can be inhibitors of MMPs. TIMP-1 is initially an MMP
-1 was called a collagenase inhibitor because it inhibits -1 and later came to be called TIMP because it also inhibits gelatinase and stromlysin, and widely inhibits different collagenases from tadpoles to humans. TIMP-1 is used in many in vitro cultured tissues such as aorta, cartilage, fetal bone, tendon, pulp, gingiva, synovium, uterus, etc., and cultured cells such as fibroblasts, epithelium,
Cells such as endothelium, osteoblasts, cartilage, smooth muscle, platelets, monocytes,
It is recognized that it is produced by macrophages, tumor cells, and the like, and can be obtained from dental pulp-derived cells, human placenta, and the like. For example, Kodama et al. , Col
lagen Rel. Res. , 7,341-35
0, 1987 and J.M. Biochem. 96,395-
404, 1984, and isolated from a culture of bovine pulp-derived cells, such as the root pulp of unpigmented bovine teeth, as described in Kodama et al. , J. et al. Immu
nol. Methods, 127, 103-108, 1
990 can be obtained from human placenta or the like.

It is known that TIMP-2 has a site whose amino acid sequence has homology with TIMP-1. TIMP-2 can be obtained from mouse colon cancer cells, for example, colon 26 cells, human placenta, and the like. For example, Fujimoto et al. , Clin.
Chim. Acta, 220, 31-45, 1993,
It can be obtained from human placenta or the like according to the method described in JP-A-6-300575. TIMP-1 and TIMP-2 can also be obtained by genetic recombination techniques, as described, for example, in Williamson et al. , Bi
ochem. J. , 268, 267-274, 199
0, Boone et al. Proc. Natl.
Acad. Sci. USA, 87, 2800-280
4, 1990. These TIMPs can be prepared by a conventionally known method, for example, salting out such as ammonium sulfate precipitation, gel filtration by Sephadex, ion exchange chromatography, electrophoresis, dialysis, ultrafiltration, affinity chromatography, high-speed chromatography, and the like. It can be used after purification by liquid chromatography or the like. Basically MMP
Inhibitors of SMP can be used without limitation, but preferably include those capable of specifically binding to active MMPs.

The monoclonal antibodies used in the present invention are described by Köhler, G. &
Milstein, C.I. ) (Nature, 256,
495-497, 1975) and the like. The monoclonal antibody used in the present invention can be prepared by the following steps. 1. 1. Preparation of immunogenic antigen 2. Immunization of animals with immunogenic antigens. 3. Preparation of myeloma cells (myeloma cells) 4. Cell fusion between antibody-producing cells and myeloma cells 5. Selection and monocloning of hybridomas (fused cells) Production of monoclonal antibodies

1. Preparation of immunogenic antigens As antigens, for example, Kodama et al. , C
ollagenRel. Res. , 7,341-35
0, 1987 and Kodama et al. , J. et al. Im
munol. Methods, 127, 103-10
8, TIMP- prepared by the method described in 1990
1, Fujimoto et al. , Clin. Ch
im. Acta, 220, 31-45, 1993, TIMP-2 prepared by the method described in JP-A-5-199.
Recombinant T prepared according to the method described in No. 868
IMP-1 (rTIMP-1), Aoki et a
l. , Connective Tissue, 26 , 2
81-290 , 1995. Recombinant TIMP-2 (rTIMP-2) prepared according to the method described in 81-290 , 1995 can be used. Here, any TIMPs that inhibit MMPs activity can be used.

As antigens, for example, Zhange
t al. , Clin. Chim. Acta, 219,
1-14, MMP prepared according to the method described in 1993
-1, Fujimoto et al. , Clin. C
him. Acta, 221, 91-103, 1993
MMP-2, Okadae prepared according to the method described in
t al. , Biochem. J. , 254, 731-
MMP- prepared according to the method described in U.S. Pat.
3, Knauper et al. , Biol. Che
m. Hoppe-Seyler. , 371, 295-3
MMP- prepared by the method described in U.S. Pat.
8, Okada et al. , J. et al. Biol. Che
m. , 267, 21712-21719, 1992, MMP-9, Park et al.
al. , J. et al. Biol. Chem. , 266, 1584
Recombinant MMP-10 prepared according to the method described in -1590, 1991, Pei et al. , J. et al.
Biol. Chem. , 269, 25849-2585
Recombinant MMP-11 prepared according to the method described in 5, 5, 1994, Shapiro et al. , J. et al.
Bio1. Chem. , 268, 23824-2382
9, MMP-12 prepared according to the method described in 1993
And recombinant MMP-12, Freige et
al. , J. et al. Biol. Chem. , 269,167
66-16773, 1994. Recombinant MMP-13 prepared according to the method described in Japanese Patent Application No. 6-33130.
With MT-MMP prepared according to the method described in No. 5,
MMPs prepared according to the methods described in those documents and the documents cited therein, and MMPs obtained by genetic recombination or the like can be used.

Here, the latent type and the active type can be preferably used. Such antigens can be obtained from various raw materials, for example, cultured cells, cultured tissues, and other antigen-producing materials such as transformed cells, by conventionally known methods, for example, salting-out such as ammonium sulfate precipitation, gel filtration by Sephadex, etc., ion-exchange chromatography, and the like. It can be obtained by purification by a chromatography method, electrophoresis method, dialysis, ultrafiltration method, affinity chromatography method, high performance liquid chromatography method and the like. Preferably, polyacrylamide electrophoresis,
Monoclonal antibodies can be an antigen that specifically recognizes the antibody or inhibitor treated with such immobilized Affinity chromatography purification and separation process, such as. Particularly preferred is gelatin-agarose affinity.
Chromatography, heparin-agarose chromatography and the like.

The antigen thus obtained may be further used as an immunogenic conjugate or the like, but can be used as it is for immunizing animals by mixing it with an appropriate adjuvant.
Further, the antigen is obtained by binding the fragmented product to various carrier proteins via an appropriate condensing agent to form a hapten-antigen.
It can be used as an immunogenic conjugate such as a protein to design a monoclonal antibody that can recognize only a specific sequence. For example, Bo
one et al. Proc. Natl. Aca
d. Sci. USA, 87, 2800-2804, 19
90, using a polypeptide obtained by designing and synthesizing a polypeptide having an amino acid sequence predicted from the cDNA sequence of human TIMP-2. A cysteine residue or the like can be added to the designed polypeptide in advance so that the immunogenic conjugate can be easily prepared. Upon binding to carrier proteins, the carrier proteins can first be activated. For such activation, introduction of an activation bonding group may be mentioned.

The activated linking group includes (1) an activated ester or an activated carboxyl group such as a nitrophenyl ester group, a pentafluorophenyl ester group,
(2) activated dithio groups such as 1-benzotriazole ester group and N-succinimide ester group, for example, 2-
And a pyridyldithio group. As carrier proteins, keyhole limpet hemocyanin (K
LH), bovine serum albumin (BSA), ovalbumin, globulin, polypeptides such as polylysine, and bacterial cell components such as BCG.

2. Immunization of Animals with Immunogenic Antigen To immunize animals, for example, Shigeru Muramatsu, et al., Experimental Biology Course 14, Immunobiology, Maruzen Co., Ltd., 1985, Japan Biochemical Society, Seikagaku Experimental Course 5. Immunobiochemical research method, Tokyo Chemical Dojin, 1986, edited by The Japanese Biochemical Society, New Chemistry Experiment Course 12, Molecular Immunology III, antigen / antibody / complement, Tokyo Chemical Dojin, 1992, etc. It can be performed according to it. Adjuvants used with antigens include, for example, Freund's complete adjuvant, Ribi adjuvant, pertussis vaccine, BCG,
Lipid A, liposomes, aluminum hydroxide, silica and the like. Immunization is performed using an animal such as a mouse such as BALB / c. The dose of the antigen is, for example, about 1 to 400 μg / animal for a mouse, which is generally injected intraperitoneally or subcutaneously into a host animal, and thereafter intraperitoneally every 1 to 4 weeks, preferably every 1 to 2 weeks. 2-10 boosters subcutaneously, intravenously or intramuscularly
Repeat about once. BALB as a mouse for immunization
In addition to / c mice, F1 mice of BALB / c mice and other mice can also be used. If necessary, an antibody titer measurement system is prepared, and the antibody titer is measured to confirm the degree of animal immunity.

3. Preparation of myeloma cells (myeloma cells) Infinitely proliferative strains (tumor cell strains) used for cell fusion can be selected from cell lines that do not produce immunoglobulin. For example, P3-NS-1-Ag4-1 ( NS-
1, Eur. J. Immunology, 6, 511-519, 1976), SP2
/ 0-Ag14 (SP2, Nature, 276, 269-270, 197
8), P3-X63-Ag8-U1 derived from mouse myeloma MOPC-21 cell line (P3U1, Current to
pics in Microbiol. and Immunol., 81, 1-7, 1978
), P3-X63-Ag8 (X63, Nature, 256, 49
5-497, 1975), P3-X63-Ag8-653 (6
53, J. Immunol., 123, 1548-1550, 1979). The 8-azaguanine-resistant mouse myeloma cell line is prepared by adding an antibiotic such as penicillin or amikacin, fetal calf serum (FCS), etc. to a cell culture medium such as Dulbecco's MEM medium (DMEM medium) or RPMI-1640 medium. Passaged in a medium supplemented with azaguanine (for example, 5-45 μg / ml),
The required number of cell lines can be prepared by passage in a normal medium 2 to 5 days before cell fusion. The cell strain used was a thawed RPMI-16 after completely thawing the cryopreserved strain at about 37 ° C.
After washing three times or more with a normal medium such as 40 medium, the cells may be cultured in a normal medium to prepare a required number of cell lines.

[0018] 4. Cell fusion between antibody-producing cells and myeloma cells. An animal, for example, a mouse immunized according to the step described above is spleen removed 2 to 5 days after the final immunization to obtain a spleen cell suspension. In addition to spleen cells, lymph node cells from various parts of the body can be obtained and used for cell fusion. The thus obtained spleen cell suspension and 3 . The myeloma cell line obtained according to the step is placed in a cell culture medium such as a minimum essential medium (MEM medium), a DMEM medium, and an RPMI-1640 medium, and a cell fusion agent such as polyethylene glycol is added. As the cell fusion agent, various other known agents in the art can be used, and such an inactivated Sendai virus (HVJ: H
emagglutinating viruses of
Japan). Preferably, for example, 3
0.5 to 2 ml of 0 to 60% polyethylene glycol
Polyethylene glycol having a molecular weight of 1,000 to 8,000 can be used, and polyethylene glycol having a molecular weight of 1,000 to 4,000 can be more preferably used. It is preferable that the concentration of polyethylene glycol in the fusion medium be, for example, 30 to 60%. If necessary, fusion can be promoted by adding a small amount of, for example, dimethyl sulfoxide. The ratio of spleen cells (lymphocytes) to myeloma cell line used for the fusion may be, for example, 1: 1 to 20: 1, and more preferably 4: 1 to 7: 1. The fusion reaction is performed for 1 to 10 minutes and then RPM
Add a cell culture medium, such as 1-1640 medium. The fusion reaction treatment can be performed plural times. After the fusion reaction, the cells are separated by centrifugation or the like, and then transferred to a selection medium.

5. Selection and Monocloning of Hybridomas (Fused Cells) As a selection medium, for example, an FCS-containing MEM medium containing hypoxanthine, aminopterin and thymidine, R
A medium such as a PMI-1640 medium, a so-called HAT medium can be used. The method of replacing the selective medium is generally such that the volume and the equivalent volume dispensed to the culture plate are added the next day, and then 1 to 3
The HAT medium can be replaced by half each day, but it can also be modified as appropriate. On the 8th to 16th days after the fusion, the medium can be exchanged every 1 to 4 days with a so-called HT medium excluding aminopterin. As a feeder, for example, mouse thymocytes can be used, which may be preferred. Culture supernatants from the culture wells of the hybridoma growth can be analyzed by, for example, radioimmunoassay (RIA), ELISA,
Using a TIMP or each human MMP antigen or its fragment peptide as an antigen, or a labeled anti-mouse antibody using a measurement system such as fluorescence immunoassay (FIA) or a fluorescence-induced cell separation device (FACS) Screening or isolation, for example, by measuring The hybridoma producing the desired antibody is cloned. Cloning can be done by picking up colonies in an agar medium or by limiting dilution. It can be more preferably performed by a limiting dilution method. Cloning is preferably performed multiple times.

6. Production of Monoclonal Antibody The obtained hybridoma strain was prepared using a MEM medium containing FCS,
After culturing in a suitable growth medium such as RPMI-1640 medium, a desired monoclonal antibody can be obtained from the culture supernatant. In order to obtain a large amount of antibodies, ascites of the hybridoma can be mentioned. In this case, each hybridoma is transplanted and grown in the abdominal cavity of a histocompatible animal of the same type as the myeloma cell-derived animal, or, for example, each hybridoma is transplanted and grown in a nude mouse or the like and produced in the ascites of the animal. The obtained monoclonal antibody can be recovered and obtained. Prior to the transplantation of the hybridoma, a mineral oil such as pristane (2,6,10,14-tetramethylpentadecane) may be administered intraperitoneally, and then the hybridoma may be grown and ascites may be collected. Ascites fluid as it is or conventionally known methods such as salting out such as ammonium sulfate precipitation, gel filtration by Sephadex, etc., ion exchange chromatography, electrophoresis, dialysis, ultrafiltration, affinity chromatography And purified by high performance liquid chromatography or the like and used as a monoclonal antibody.
Preferably, the ascites containing the monoclonal antibody can be purified and separated by fractionating with ammonium sulfate and then treating it with an anion exchange gel such as DEAE-Sepharose and an affinity column such as a protein A column. Particularly preferably, affinity chromatography in which an antigen or antigen fragment (for example, a synthetic peptide, a recombinant antigen protein or peptide, a site specifically recognized by an antibody, etc.) is immobilized, and affinity in which protein A is immobilized.
Chromatography.

The monoclonal antibody thus obtained is
Using a commercially available isotype-specific anti-mouse Ig antibody, for example, an isotype-specific rabbit anti-mouse Ig antibody, the type of heavy chain and light chain of the antibody constituent chains can be examined. Monoclonal antibodies are also disclosed in
No. 300575 and Clin. Chim. Acta
(J. Zhang et al., 219, 1-14,
1993), for example, clone 78-12G8 described in the literature (Microfabrication Accession No. FER)
MP-13115), JP-A-6-213888 and Clin. Chim. Act
a (N. Fujimoto et al., 221, 91)
-103, 1993), for example, a monoclonal antibody derived from clone 75-7F7 (Microcosms Accession No. FERM P-13335) described in the literature, Clin. Chim. Acta (N. Fujimoto)
to et al. , 231, 79-88, 1994).
Those prepared by the method described, for example, clone 73-18B3 (raw Engineering Research accession of the literature No. FERM P-1
3695). Preferred monoclonal antibodies that specifically bind to each MMP are those that recognize the latent and active forms of each MMP.

It is also possible to determine the sequence of the antibody obtained in such a large amount, and to prepare an antibody by a gene recombination technique using a base sequence encoding the antibody obtained from the hybridoma strain. Further, these antibodies are treated with an enzyme such as trypsin, papain, pepsin and the like, and optionally reduced to obtain Fab, Fab '
It may be used as an antibody fragment such as (ab ') ₂ . These fragments are CM- or DEAE-
It can be purified by methods such as cellulose chromatography, gel filtration and affinity chromatography. As an antibody to be labeled, an IgG fraction, and further a specific binding portion Fab ′ obtained by digestion and reduction after pepsin can be used. Examples of labels in these cases include:
Enzymes (peroxidase, alkaline phosphatase or β-D-galactosidase etc.) as described below,
There are chemical substances, fluorescent substances and radioisotopes.

In the present invention, a monoclonal antibody specifically binding to each MMP thus obtained and TIMPs
Activated MMP free in the specimen sample by using
And a method for immunologically differentiating and quantifying the same. Further, the thus obtained monoclonal antibody which specifically binds to each MMP and TIMPs or the monoclonal antibody which specifically binds to each TIMP is bound to TMP.
There is provided a method for immunologically differentiating and quantifying each free active MMP in a specimen sample using IMPs in combination. In particular, examples of the monoclonal antibody that specifically recognizes each TIMP include a monoclonal antibody that specifically recognizes TIMP-1 and a monoclonal antibody that specifically recognizes TIMP-2. JP-A-5-244985
Prepared according to the description of the item, obtained antibodies are mentioned,
Mouse anti-TIM with high specificity and high affinity
P-2 IgG (clone 67-4H11, accession number FERM P-12690) or a substance having substantially the same specificity as that of P-2 IgG. Each MMP
Monoclonal antibodies that specifically recognize
A monoclonal antibody that recognizes at least the active form of MP is used, and examples include a monoclonal antibody that specifically recognizes the central region of each MMP and a monoclonal antibody that recognizes the carboxyl terminal region of each MMP. Each TIMP
And the monoclonal antibodies specifically recognizing and labeling each TIMP may be mutually bound before the reaction with the activated MMPs. The bonding is relatively stable, such as cross-linking, and does not relatively affect the reactivity of each TIMP to each MMP. When in a stronger binding form, the problem of dissociation between each TIMP and a monoclonal antibody that specifically recognizes and labels each TIMP in the reaction with latent MMP-2 or latent MMP-9 It is more preferable because there is no such thing. The binding can be appropriately selected and used from the method applied to the immunogenic conjugate, the method used for labeling described below, the method used for immobilization, and the like. Preferable examples include a method using an aldehyde such as formaldehyde as a crosslinking agent, but the method is not limited thereto.

Further, in the present invention, each of the active MMPs in the test sample can be purified using a monoclonal antibody that specifically binds to each MMP and a complex of the antibody and TIMPs that specifically bind to TIMPs. Also provided are methods for immunologically differentiating and quantifying. In particular, a monoclonal antibody that specifically recognizes TIMP-1 or a complex of a monoclonal antibody that specifically recognizes TIMP-2 and TIMPs is used as a labeling reagent, and a monoclonal antibody that specifically binds to each MMP is used as a solid phase. It is preferable to provide a method for immunologically differentiating and quantifying each free active MMP in a sample sample by using the same as a reagent for the quantification. MMPs to which sugars are bound vary in molecular weight due to sugar chains and the like, and also have different measured molecular weights reported by researchers. Therefore, in the present invention, the molecular weight of the active form of MMP is not particularly limited as long as it is to measure the active form of substantially free MMP. MMPs are roughly divided into propeptides (pro
peptide, catalytically active domain (catalyt)
ic domain, hinge region
gion) and a pexin-like domain (pexin-li)
is divided into four regions ke domain), amino-terminal region of the propeptide region is a Pekishin like domain region and carboxyl-terminal region, common that is between them catalytically active domain and a hinge region and the central region is there.

The measurement of the present invention can be carried out by an immunoassay, for example, a competitive immunoassay or a noncompetitive immunoassay, a radioimmunometric assay,
LISA or the like can be used, and the measurement can be performed with or without BF separation. Each TIMP may be directly detectably labeled, or may be indirectly detectably labeled with a detectably labeled monoclonal antibody that specifically binds to each TIMP prior to the assay reaction. Good. On the other hand, antibodies against each MMP are immobilized on a solid phase. In another embodiment, the TIMPs can be immobilized on a solid phase, in which case the antibody to each MMP may be detectably labeled. Incubation is performed to sequentially react the sample with the labeled TIMPs and the immobilized antibody as necessary.
After separating the MPs, the label is measured. The amount of the label measured is proportional to the amount of the antigen, that is, each active MMP. Washing, stirring, shaking, filtration, pre-extraction of antigen, etc. are appropriately adopted in these measurement steps under specific circumstances. Other measurement conditions such as the concentration of a specific reagent, buffer, etc., temperature, or incubation time can be changed according to factors such as the concentration of the antigen in the sample and the properties of the sample. Those skilled in the art can appropriately select the optimum conditions effective for each measurement and perform the measurement using ordinary experimental methods.

As carriers for solid-phase immobilization, many carriers capable of immobilizing antigens or antibodies are known, and in the present invention, they can be appropriately selected and used. As the carrier, various carriers used for an antigen-antibody reaction and the like are known, and in the present invention, of course, any of these known carriers can be used. Particularly preferably used are, for example, glass, for example activated glass, porous glass, silica gel, silica-alumina, alumina,
Inorganic materials such as magnetized iron and magnetized alloys, polyethylene, polypropylene, polyvinyl chloride, polyvinylidene fluoride,
Polyvinyl acetate, polymethacrylate, polystyrene,
Styrene-butadiene copolymer, polyacrylamide,
Crosslinked polyacrylamide, styrene-methacrylate copolymer, polyglycidyl methacrylate, acrolein-ethylene glycol dimethacrylate copolymer, etc.
Crosslinked albumin, collagen, gelatin, dextran, agarose, crosslinked agarose, cellulose, microcrystalline cellulose, carboxymethylcellulose, natural or denatured cellulose such as cellulose acetate, crosslinked dextran, polyamide such as nylon, polyurethane,
Organic polymer substances such as polyepoxy resins, those obtained by emulsion polymerization thereof, cells, erythrocytes, etc., where necessary, functional groups have been introduced with a silane coupling agent or the like. . Further, filter paper, beads, inner walls of test containers, for example, test tubes, titer plates, titer wells, cells made of synthetic materials such as glass cells, synthetic resin cells, glass rods, rods made of synthetic materials, and thicker ends. Alternatively, the surface of a solid material (object) such as a thinned rod, a rod having a round or flat projection at its end, or a thin plate-shaped rod may be used. An antibody can be bound to these carriers, and preferably, each monoclonal antibody that specifically binds to MMP can be bound. The binding between the carrier and those involved in the antigen-antibody reaction is performed by a physical method such as adsorption, a condensing agent, or a chemical method using an activated material, or a mutual method. It can be performed by a method utilizing a chemical binding reaction or the like.

Labels include enzymes, enzyme substrates, enzyme inhibitors, prosthetic molecules, coenzymes, enzyme precursors, apoenzymes, fluorescent substances, dye substances, chemiluminescent compounds,
A luminescent substance, a coloring substance, a magnetic substance, a metal particle such as a gold colloid, and a radioactive substance can be given. Enzymes include dehydrogenases, reductases, oxidoreductases such as oxidases, and transfer enzymes that catalyze transfer of amino groups, carboxyl groups, methyl groups, acyl groups, phosphate groups, and the like, such as ester bonds, Examples include a hydrolase that hydrolyzes a glycosidic bond, an ether bond, a peptide bond, and the like, a lyase, an isomerase, and a ligase. Enzymes can be used for detection by using a plurality of enzymes in combination. For example, enzymatic cycling can be used.

Representative enzyme labels include peroxidase such as horseradish peroxidase and E. coli β-D.
-Galactosidase such as galactosidase; maleate dehydrogenase; glucose-6-phosphate dehydrogenase; glucose oxidase; glucoamylase; acetylcholinesterase; catalase; When using alkaline phosphatase,
Umbelliferone derivatives such as 4-methylumbelliferyl phosphate, phosphorylated phenol derivatives such as nitrophenyl phosphate, enzymatic cycling systems utilizing NADP, luciferin derivatives, and substrates such as dioxetane derivatives are used. It can be measured by fluorescence or luminescence. Luciferin and luciferase systems can also be used. When catalase is used, it reacts with hydrogen peroxide to generate oxygen, and the oxygen can be detected by an electrode or the like. The electrode may be a glass electrode, an ion electrode using a poorly soluble salt film, a liquid film electrode, a polymer film electrode, or the like. The enzyme label can be replaced with a biotin label and an enzyme-labeled avidin (streptavidin). A plurality of different types of labels may be used. In such cases, multiple measurements can be performed continuously or discontinuously,
And it can be possible to do it simultaneously or separately.

In the present invention, 4-hydroxyphenylacetic acid, 1,2-phenylenediamine, tetramethylbenzidine and the like and horseradish peroxidase, umbelliferyl galactoside, nitrophenyl galactoside and the like and β-D-galactosidase are used for signal formation. Combinations of enzyme reagents such as glucose-6-phosphate dehydrogenase can also be used, and quinol compounds such as hydroquinone, hydroxybenzoquinone and hydroxyanthraquinone, thiol compounds such as lipoic acid and glutathione, phenol derivatives, ferrocene derivatives and the like can be used as enzymes. What can be formed by the action of can be used.

Examples of the fluorescent substance or chemiluminescent compound include fluorescein isothiocyanate, for example, rhodamine derivatives such as rhodamine B isothiocyanate and tetramethylrhodamine isothiocyanate, dansyl chloride, dansyl fluoride, fluorescamine, phycobiliprotein, acridinium salt, Luminols such as luminiferin, luciferase and equorin, imidazole, oxalate, rare earth chelate compounds, coumarin derivatives and the like can be mentioned. Labeling can be performed using a reaction between a thiol group and a maleimide group, a reaction between a pyridyl disulfide group and a thiol group, a reaction between an amino group and an aldehyde group, and the like. The method can be applied by appropriately selecting from methods that can be used, and methods modified from those methods. For example, a crosslinking method using NaIO ₄ (for example, 1-
After protecting the amino group with fluoro-2,4-dinitrobenzene or the like, oxidizing with meta-NaIO ₄ , reacting a protein such as an antibody, and then reducing with NaBH ₄ ). . In addition, a condensing agent that can be used for the preparation of the immunogenic complex, a condensing agent that can be used for binding to a carrier, and the like can be used.

Examples of the condensing agent include glutaraldehyde, hexamethylene diisocyanate, hexamethylene diisothiocyanate, N, N'-polymethylenebisiodoacetamide, p-benzoquinone, N, N'-o-
Phenylenedimaleimide, N, N'-ethylenebismaleimide, ethylene glycol bissuccinimidyl succinate, bisdiazobenzidine, 1-ethyl-3- (3
-Dimethylaminopropyl) carbodiimide, succinimidyl 3- (2-pyridyldithio) propionate (SPDP), N-succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), N-sulfosuccinimidyl 4 − (N
-Maleimidomethyl) cyclohexane-1-carboxylate, N-succinimidyl (4-iodoacetyl) aminobenzoate, N-succinimidyl 4-
(1-maleimidophenyl) butyrate, N- (ε-maleimidocaproyloxy) succinimide (EMC
S), iminothiolane, S-acetylmercaptosuccinic anhydride (AMSA), methyl-3- (4'-dithiopyridyl) propionimidate, methyl-4-mercaptobutyrylimidate (MMBI), methyl-3-mercapto Propion imidate, N-succinimidyl-
And S-acetylmercaptoacetate.

According to the measurement method of the present invention, a substance to be measured is prepared by binding TIMP or antibody bound to a carrier to an antibody reagent labeled with an enzyme or a TIM labeled with an enzyme.
The reaction can be carried out sequentially with the P reagent, or they can be carried out simultaneously. The order in which the reagents are added depends on the type of carrier system chosen. When sensitized plastic beads or the like are used, the sensitized plastic beads or the like are first put together with an analyte sample containing a substance to be measured in an appropriate test tube, and then labeled with an enzyme or the like. The measurement can be performed by adding the prepared monoclonal antibody reagent or TIMP reagent. In the quantification method of the present invention, an immunological measurement method is used, and in this case, as a solid support, polystyrene, polycarbonate, polypropylene or polyvinyl balls, microplates, which well adsorb proteins such as antibodies, and microplates Various materials and forms such as, a stick, a fine particle or a test tube can be arbitrarily selected and used.
The measurement can be performed in an appropriate buffer system so as to maintain the optimum pH, for example, about pH 4 to 9. Particularly suitable buffers include, for example, acetate buffers, citrate buffers, phosphate buffers, Tris buffers, triethanolamine buffers, borate buffers, glycine buffers, carbonate buffers, Tris-HCl. Buffers and the like can be mentioned. Buffering agents can be used by mixing them at an arbitrary ratio. Preferably, the antibody-antigen reaction is performed at a temperature between about 0 ° C and 60 ° C.

The incubation of an antibody reagent labeled with an enzyme or the like, a TIMP reagent labeled with an enzyme or the like, an antibody reagent bound to a carrier and a TIMP reagent bound to a carrier, and a substance to be measured are equilibrium. The reaction can be stopped after a limited incubation treatment by separating the solid and liquid phases much earlier than the equilibrium of the antibody-antigen reaction is achieved. The extent of the presence of a label, such as an enzyme, in any of the solid phases can be measured. The measurement operation can be performed using an automated measurement device, and a luminescence detector, a photo detector, or the like is used to detect a display signal generated by the conversion of a substrate by the action of an enzyme and to perform measurement. You can also.

Antibody-antigen reaction and activated MMPs and TIM
In the reaction with Ps, an appropriate means is used to stabilize the reagents to be used, the substance to be measured, and the label such as an enzyme, or to stabilize the antibody antigen reaction and the reaction itself between active MMPs and TIMPs. Can be taken. In addition, proteins, stabilizers, surfactants, chelating agents, etc. should be added to the incubation solution to remove non-specific reactions and reduce inhibitory effects, or to activate measurement reactions. Can be added. It may be subjected to a blocking treatment to prevent non-specific binding reactions commonly used in the art or known to those skilled in the art. , Collagen, gelatin and the like. These methods can be used without any particular limitation as long as the purpose is to prevent a non-specific binding reaction. As the sample to be measured by the measurement method of the present invention, any form of solution or colloid solution may be used, but preferably a biological fluid sample, such as blood, plasma, serum, synovial fluid, cerebrospinal fluid, saliva , Amniotic fluid, urine, other body fluids, cell culture solutions, tissue culture solutions, tissue homogenates and the like. Particularly preferred are plasma, serum, synovial fluid, saliva, cell culture, tissue culture, tissue homogenate and the like. According to the present invention, free active MMPs in body fluids of patients or animals such as arthropathy, cancer, metastatic cancer, periodontal disease, etc. are quantified using the quantification method according to the present invention. By doing so, it can be applied to diagnosis or monitoring of the above disease groups.

[0035]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but it should be understood that the present invention is not limited to the examples and includes various embodiments. Example 1 Preparation of TIMPs TIMP-1 was obtained by culturing the root pulp of bovine unerupted teeth in a minimum essential Eagle's medium (Nissui Pharmaceutical) and purifying it by column chromatography from a culture of bovine pulp-derived cells. See, for example, Kodama et al. , Colla
gen Rel. Res. , 7,341-350,1
Prepared from various materials according to the method of 987. Also TI
MP-2 is described in Fujimoto et al. (Cli
n. Chim. Acta, 220, 31-45, 199
3 and JP-A-6-300575).
Prepared from various materials. For example, the placenta is minced and then stirred in a buffer, and the obtained supernatant is mixed with an anti-TIMP-2 monoclonal antibody (for example, clone No. 67-4H11 disclosed in Japanese Patent Application Laid-Open No. H5-244985).
The mixture is processed by chromatography on a 4B column, and if necessary, ultrafiltration, gel filtration, for example, Ultragel
Purified human TIMP treated with AcA54 (LKB)
-2 was prepared.

Recombinant TIMP-1 (rTIMP)
-1) is oligo (dT) from the total RNA fraction obtained from human normal gingival fibroblasts (human Gin-1 cells) and the like.
-Using a cellulose column to separate the poly A ⁺ mRNA fraction, using this as a template to prepare a cDNA using reverse transcriptase, and using Docherty et al. , Natu
re, 318, 66-69, 1985, etc.
A PCR primer was prepared with reference to the sequence of the IMP-1 cDNA, and this PCR primer (primer TIF1:
5'-ATGGCCCCCTTTGAGCCCCTG-
3 'and primer TIR1: 5'-CAGGATTC
AGGCTATCTG-3 ′) to amplify the TIMP gene by the PCR method, and integrate the obtained DNA fragment into a vector such as plasmid PEX or pMEMneo;
It can be obtained by expressing in E. coli, CHO cells and the like. rTIMP-1 was obtained according to the method described in JP-A-5-199868. The prepared rTIMP-1 is
About 3 by SDS-PAGE (12% homogeneous gel, reducing conditions)
0 kDa was observed as a single band, and Western blotting (peroxidase-labeled mouse anti-TIMP)
-1 monoclonal antibody)
a was observed as a single band. rT
IMP-1 human fibroblasts (CCD-41SK cells)
Inhibitory activity against derived MMP-1 is, IC ₅₀ of approximately 1 × 1
It was ^0-9M .

Further, the recombinant TIMP-2 (rTI
MP-2) was obtained by separating a poly A ⁺ mRNA fraction from the total RNA fraction obtained from human Gin-1 cells or the like using an oligo (dT) -cellulose column, using this as a template, oligo dT (15 to 18) as primers and cDNA was prepared using reverse transcriptase, and Boone et a
l. , Proc. Natl. Acad. Sci. US
A, 87, 2800-2804, 1990, etc. Primer T2F7 prepared with reference to the sequence of TIMP-2 cDNA; AAAGTCGACCATGGGCGC
CGCGGCCCGCACCCT and primer T2R
5; TTAAGATCTGTCGACTTAAGGAT
The TIMP-2 gene can be amplified by PCR using CCTCGATATCGAGGAATTCTTGC, and the obtained DNA fragment can be inserted into a vector such as plasmid pKG and expressed in CHO cells or the like.
rTIMP-2 is available from Aoki et al. (Connective).
Tissue, 26 , 281-290 , 1995 ). The resulting product was subjected to chromatography on a Sepharose 4B column bound to an anti-TIMP-2 monoclonal antibody, followed by ultrafiltration, gel filtration, and the like, as necessary, to prepare purified rTIMP-2. Prepared r
TIMP-2 was obtained by SDS-PAGE (12% homogeneous gel,
(Reducing conditions), a single band of about 24 kDa was observed at the same molecular weight position as native TIMP-2 prepared from placenta. Anti-human TI with different epitopes
MP-2 monoclonal antibody (Japanese Unexamined Patent Publication No.
As a result of performing Western blotting according to the publication, a single band was recognized at a position of about 24 kDa. MMP-1 derived from CCD-41SK cells
Inhibitory activity, _{IC 50} of about 1.1 × ^{10 -9} M for
Met. In addition, as a result of N-terminal and C-terminal structural analysis, it was suggested that the obtained rTIMP-2 was the same substance as natural TIMP-2. Here, any TIMPs that inhibit MMPs activity can be used, but artificially created rTIMPs were used.

Example 2 Preparation of Labeled TIMPs Usually, a low-molecular radioisotope, a chemical substance or a fluorescent substance is used as a protein label in order to avoid impairing the activity of the protein itself.
Here, a method of labeling TIMP with a high molecular enzyme which is likely to impair the activity of the protein itself is shown. (A) Preparation of rTIMPs- or IgG-peroxidase (HRP) complex 1) Preparation of SH group-labeled rTIMP or SH group-labeled IgG
Dialyze against 1M phosphate buffer (pH 6.5) and add 1 ml for each rTIMP contained in 1 ml of the solution.
A 00-fold molar amount of AMSA was added as a dimethylformamide solution, and the mixture was incubated at 30 ° C. for 30 minutes. Next, 100 μM of 0.1 M Tris-HCl buffer (pH 7.0)
l, 0.1 M ethylenediaminetetraacetate (EDTA, p
H6.0) 10 μl, 1 M hydroxylamine solution (p
H7.0) 100 μl was added and left at 30 ° C. for 5 minutes.
The mixture was subjected to gel filtration with Sephadex G-25 equilibrated with a 0.1 M phosphate buffer (pH 6.0), and SH-labeled rTIM was used.
P-1, SH-labeled rTIMP-2 or SH-labeled I
gG was obtained.

2) Preparation of Maleimide-Labeled HRP HRP was dissolved in a 0.1 M phosphate buffer (pH 7.0) so as to have a concentration of 12 mg / ml, and 25 times the amount of EMCS in the HRP was dissolved in dimethyl. It was added as a formamide solution and reacted at 30 ° C. for 30 minutes. The reaction solution was subjected to gel filtration with Sephadex G-25 equilibrated with a 0.1 M phosphate buffer (pH 6.0), and the maleimide-labeled HR was used.
The P fraction was collected.

3) rTIMP-HRP or IgG-
Preparation of HRP complex The SH-labeled rTIMP-1, SH-labeled rTIMP-2 or SH-labeled IgG prepared in 1) above was mixed with 3 moles, 3 moles or 3 moles of maleimide-labeled HRP obtained in 2) above, respectively. 5 mol was added and the mixture was allowed to stand at 4 ° C. for 24 hours. These mixtures were mixed with a 0.1 M Tris-HCl buffer (p
H7.0) or 0.1 M phosphate buffer (pH 7.0).
Gel filtration was performed on an Ultrogel AcA 44 column equilibrated in 0), and rTIMP-1-HRP, rTIMP
-2-HRP or IgG-HRP complex fractions were respectively collected. Obtained labeled rTIMP-1 and labeled r
The degree of HRP labeling of TIMP-2 was examined by colorimetry using HRP activity as an index. By increasing the amount of maleimide-labeled HRP obtained in the above 2) to react,
Although the amount of bound HRP was found to increase, rT
HRP per mole of IMP-1 or rTIMP-2
Were determined to be more preferable as reagents used in the following measurements, respectively.

(B) Preparation of rTIMP-IgG-HRP When rTIMP is labeled with HRP, rTIMP can be indirectly labeled with HRP via a substance that specifically binds to rTIMP. As the substance that specifically binds to rTIMP, a monoclonal antibody that specifically binds to TIMP was used here. Monoclonal antibodies prepared using human TIMP-2 polypeptide or natural TIMP-2 as an immunogen can be used. Boone
et al. Proc. Natl. Acad. Sc
i. USA, 87, 2800-2804, 1990. Three polypeptides, for example, P-1;
RIQC, P-2; DTLSTTQKKSLNHRYQ
QC and P-3; YRGAAPPKQEFLDIEDC
And immunizing a mouse using these as an immunogen. Using a monoclonal antibody obtained from a hybridoma clone prepared by a cell fusion method using spleen cells from the immunized mouse, reacting maleimide-labeled HRP with anti-TIMP-
2 monoclonal antibody-HRP can be obtained. As such an antibody, an antibody capable of inhibiting latent MMP-2 from binding to TIMP-2 is preferably used. Antibodies that recognize the carboxyl-terminal region of TIMP-2 can be used.

Thus, a monoclonal antibody against the polypeptide in the carboxyl terminal region of TIMP-2 was prepared according to the description in Japanese Patent Application Laid-Open No. H5-244985.
MP-2 IgG (clone 67-4H11, accession number of FERM P-12690) was selected, and HRP was labeled using the same as described in the above (a). RTIMP-2 was added to this IgG-HRP (100 μg) solution.
20 μg was added, and the reaction was allowed to stand at 10 ° C. for 3 hours. Formaldehyde was further added to this mixture to a final concentration of 4% (fixation reaction), and the mixture was reacted at room temperature for 2 hours.
The anti-TIMP-2 IgG used (clone 67-4H
11) an antibody that recognizes the carboxyl terminal region of the TIMP-2, TIMP-2- Anti-T by latent MMP-2
It has been found that the binding of IMP-2 IgG is dissociated (N. Fujimoto et al., Cli).
n. Chim. Acta, 220, 31-45, 199
3).

The above-mentioned fixation reaction was carried out in such a manner that the formed immune complex (rTIMP-2-IgG-HRP) was converted to latent MMP-
2 to prevent dissociation, at room temperature, 0.5 to
After performing the reaction for 6 hours, the best conditions were 2 hours for the reaction. After the fixing reaction, formaldehyde was removed with Sephadex G-25. This complex was not dissociated by latent MMP-2, confirming that rTIMP-2 and IgG were fixed. The rTIMP-
2-IgG-HRP is a latent MM of rTIMP-2.
Since the binding region to P-2 was blocked with anti-TIMP-2 IgG, it was shown not to react with latent MMP-2. That is, the above rTIMP-2-IgG-HRP
Reacts with all active MMPs,
It was possible to separate P-2 from active MMP-2. rTI
RTIMP-1-IgG-HRP was also prepared in the same manner as described above, except that MP-2 was replaced with rTIMP-1. The anti-human TIMP-1 monoclonal antibody was obtained by immunizing a mouse with the purified TIMP-1 obtained as described in Example 1 as an immunogen, and using a spleen cell from the immunized mouse by a cell fusion method using a hybridoma clone. can get. Kod
ama et al. , Collagen Rel.
Res. , 7, 341-350, 1987.

Example 3 Selection of Monoclonal Antibody The anti-human MMP-1 monoclonal antibody was prepared using human proMM
A mouse is immunized with P-1 as an immunogen, and is obtained from a hybridoma clone created by a cell fusion method using splenocytes from the immunized mouse. Purified human pro-MMP-1 was obtained from human normal dermal fibroblast CCD-41SK (ATCC N
o. CRL1505) containing 10% FCS minimum essential E
The cell culture supernatant obtained by culturing the cells in an agle medium and, if necessary, stimulating the cells with interleukin 1α, was concentrated by ultrafiltration (TOYO filter paper UP-76), and heparin Sepharose CL-6B column (Pharmacia Fi).
ne Chemicals), Sephacryl-S-20
0 (Pharmacia Fine Chemical)
s), Green A Actigel-ALD column (Steel
and purified by chromatography. Among the obtained anti-human MMP-1 monoclonal antibodies, an antibody that recognizes at least active MMP-1 can be used. An anti-human MMP-1 monoclonal antibody is disclosed in JP-A-6-300575 and Clin. C
him. Among the monoclonal antibodies described in Acta, 219, 1-14, 1993, clone 78-12G8
The antibody from (Microtechnical accession number FERM P-13115) was selected. This antibody recognizes latent and active MMP-1, and has the property that no change in its immunoreactivity is recognized by a chelating agent such as EDTA.

The anti-human MMP-2 monoclonal antibody is
CCD-41SK cells were treated in the same manner as in the case of human pro-MMP-1, and from the resulting cell culture supernatant, gelatin agarose, anti-TIMP-2 IgG-bound Sepharose,
Human pro-MMP- purified by chromatography using anti-fibronectin IgG-bound Sepharose or the like
A mouse is immunized with 2 as an immunogen, and is obtained from a hybridoma clone created by a cell fusion method using spleen cells from the immunized mouse. Among the obtained anti-human MMP-2 monoclonal antibodies, an antibody that recognizes at least active MMP-2 can be used. The anti-human MMP-2 monoclonal antibody is disclosed in JP-A-6-213888 and F
ujimoto et al. , Clin. Chim.
Acta, 221, 91-103, 1993, clone 75- having high affinity.
An antibody from 7F7 (Microfabrication Accession No. FERM P-13335) was used. This antibody recognizes the carboxyl-terminal region of MMP-2 and has latent and active forms of MMP-2.
Is an antibody that recognizes

The anti-human MMP-7 monoclonal antibody is
From the culture of human rectal cancer cell-derived CaR-1 cells,
Biol. Chem. , 261, 14245-1425
5, 1986 and J.M. Biol. Chem. , 267,
Okada described in 21712-21719, 1992
et al. Human MMP-7 purified according to the method of
And a DEAE-cellulose column, Green
A Dymatrix gel (Amicon) column, zinc chelate Sepharose (Pharmacia)
) Column, Ultrogel AcA44 (IBF Bio)
and BALB / c female mice were immunized using the obtained human pro-MMP-7 as an antigen.
(SP2 / 0-Ag14), hybridomas are selected and cloned. Anti-human MM
Among the P-7 monoclonal antibodies, clone 125-2
0H11 (Seikaken Laboratories accession number FERM P-1473
5) is an antibody that recognizes active MMP-7.

The anti-human MMP-9 monoclonal antibody is
Human fibrosarcoma cells (HT-1080 cells) are cultured, and if necessary, tumor necrosis factor
A cell culture supernatant obtained by stimulating cells with -α is purified by ultrafiltration, chromatography on a gelatin agarose column, Sepharose 4B conjugated with anti-TIMP-1 monoclonal antibody, Sepharose 4B conjugated with anti-fibronectin antibody, etc. Mice are immunized using the obtained human pro-MMP-9 as an immunogen, and obtained from a hybridoma clone prepared by a cell fusion method using splenocytes from the immunized mice. Among the obtained anti-human MMP-9 monoclonal antibodies, an antibody that recognizes at least active MMP-9 can be used. Anti-human MMP-9 monoclonal antibodies are described in Fujimoto et al. , Cli
n. Chim. Acta, 231, 79-88, 199
Among the monoclonal antibody according to 4, strong clone 73-18B3 (raw Engineering Research accession number of affinity FERM P-
13695). This antibody recognizes the central region of MMP-9 and recognizes latent and active MMP-9. MMP-
3, -8, -10, -11, -12 and -13 and M
Each monoclonal antibody against T-MMP can be prepared and an appropriate clone selected and used.

Example 4 Preparation of Active MMPs Active MMP-1 was prepared from human dermal fibroblast (CCD-4).
1SK) Latent MMP-1 purified from the culture supernatant was added to 0.
1M sodium chloride, 10mM calcium chloride containing 50
mM Tris-HCl buffer (pH 7.5) (buffer A), aminophenyl mercuric acetate (APMA) was added to a final concentration of 1 mM,
Incubation for 2 hours (J. Zhang et.
al. , Clin. Chim. Acta, 219, 1
-14, 1993). It was confirmed by SDS-PAGE (12.5% gel, in the presence of 2-mercaptoethanol) that human latent MMP-1 was completely activated to active MMP-1.

Active MMP-2 was obtained by dissolving latent MMP-2 purified from the culture supernatant of CCD-41SK in the above buffer A and incubating with 1 mM APMA at 37 ° C. for 30 minutes (N.M. Fujimoto
et al. , Clin. Chim. Acta, 22
1, 91-103, 1993). It was confirmed on SDS-PAGE that latent MMP-2 was activated by activated MMP-2. Activated MMP-7 was treated with a zinc chelate Sepharose (Pharmacia) column during the preparation of human pro-MMP-7 described in Example 3.
mM CaCl ₂ , 0.05% Brij 35, 0.02
When eluted with a concentration gradient of NaCl dissolved in a 25 mM sodium cacodylate buffer (pH 6.5) containing 25% NaN ₃ , elution was obtained with the same buffer containing 0.15 M NaCl.

Activated MMP-9 was obtained from human fibrosarcoma cells H
Latent MMP-9 purified from T1080 culture supernatant was dissolved in buffer A and incubated with 1 mM APMA at 37 ° C for 24 hours (Y. Okad).
a et al. , J. et al. Biol. Chem. , 26
7, 21712-21719, 1993). SDS-P
It was confirmed that latent MMP-9 was activated to active MMP-9 on AGE. MMP-3 (Y. Okada)
et al. , Biochem. J. , 254,731
−741, 1988), MMP-8 (V. Knappe)
r et al. , Biol. Chem. Hoppe-
Seeyler. , 371, 295-304, 199
0), MMP-10 (AJ Park et a)
l. , J. et al. Biol. Chem. , 266, 1584-
1590, 1991), MMP-11 (D. Pei)
et al. , J. et al. Biol. Chem. , 269,2
5849-25855, 1994), MMP-12
(SD Shapro et al., J. Bio.
l. Chem. , 268, 23824-23829, 1
993), MMP-13 (JMP Freige)
et al. , J. et al. Biol. Chem. , 269,1
6766-16773, 1994) and MT-MMP (Japanese Patent Application No. 6-331305) can be prepared in the same manner by preparing each active MMP.

Example 5 Method for Quantifying Active MMPs (a) Preparation of Monoclonal Antibody-Binding Carrier Immunoassay 4,209-327,1
No. 983, Ishikawa et al. Mouse anti-human MMPs IgG (clone N
o. 78-12G8, 75-7F7 or 73-18
B3) were each dissolved in a 0.1 M phosphate buffer (pH 7.5) to prepare a concentration of 100 μg / ml. The monoclonal antibody solution was added to a 96-well microplate at 100 μl per well, and left at 4 ° C. for 24 hours. Next, the monoclonal antibody solution was removed, and 2 mM each with 10 mM phosphate buffer (pH 7.0) containing 0.1 M sodium chloride.
After washing twice, 1% BSA, 0.1 M sodium chloride, 1
It was immersed in 50 mM Tris-HCl buffer (pH 7.4, buffer B) containing 0 mM calcium chloride and stored at 4 ° C.

(B) Quantitative method of active MMPs: Among the MMPs, all MMPs except MMP-2 and MMP-9 have a common property that their latent forms do not bind to TIMPs and only free active forms bind to TIMPs. , They are all quantified on the same principle. Therefore, a method for quantifying active MMP-1 was described as a representative example in the Examples. Regarding MMP-2 or MMP-9, TIMP-2 or TIMP,
Since -1 binds, a quantification method using TIMP-1 to which a label is directly added or TIMP-2 to which a label is indirectly added for discrimination from its latent form is described.

1) Method for Quantifying Active MMP-1 Using the active MMP-1 described in Example 4 as a standard, a known concentration of active MMP-1 or free active MMP-1 was used.
Sample No. 1 was transferred to a 96-well vinyl plate (Falcon
20 μl each. Next, the rTIMP-1-HRP complex prepared in Example 2 (a) was diluted with buffer B to a concentration of 5 μg / ml, or Example 2 (b)
-2-anti-TIMP-2 IgG prepared in section
-Buffer B so that the HRP complex becomes 18 μg / ml.
And added to the above vinyl plate in an amount of 100 μl each, followed by mixing. This mixed solution was prepared using the anti-M prepared in the above (a).
100 μl was added to a plate bound with MP-1 antibody (clone No. 78-12G8), reacted at room temperature for 2 hours, and washed three times with physiological saline. Next, 100 μl of 2 mg / ml o-phenylenediamine dissolved in 0.1 M citrate-phosphate buffer (pH 4.9) containing 0.02% hydrogen peroxide was added to each well, and reacted at room temperature for 20 minutes. Sulfuric acid 1
The reaction was stopped by adding 00 μl. The absorbance (A ₄₉₂ ) of this reaction mixture at 492 nm was measured using a microplate reader (MPR-A4, Tosoh), and a calibration curve was prepared (FIG. 1). rTIMP-1-HR
The sensitivity of the quantification system using the P complex was the standard 0 ng / ml value + 2S. D. To 5 ng / ml (84 pg / assay)
Activated MMP-1 standard solution 20-640 ng / ml
(0.33 to 10.7 ng / assay), linearity was observed. The sensitivity of the quantification method using the rTIMP-2-IgG-HRP complex is 1.3 ng / ml (22 pg
/ Assay), activated MMP-1 standard solution 4-330 n
Linearity was observed in the range of g / ml (67-5500 pg / assay). In addition, in the quantification method using the rTIMP-2-HRP complex, almost the same result as the quantification method using the rTIMP-1-HRP complex was obtained.

2) Method for Quantifying Active MMP-2 Using the active MMP-2 described in Example 4 as a standard, a known concentration of active MMP-2 or free active MMP-2 was used.
20 μl of each sample containing No. 2 was added to a 96-well vinyl plate. Next, rTIMP-1 prepared in Example 2 (a)
The HRP complex was diluted with buffer B to a concentration of 5 μg / ml, and 100 μl of each was added to the vinyl plate and mixed. This mixture was added to the mouse anti-MMP-2 antibody (clone No. 75-7F7) binding plate prepared in (a) above, and the following operation was performed in the same manner as in 1) above. The calibration curve is shown in FIG. The sensitivity of this assay is standard 0
ng / ml value + 2S. D. To 34 ng / ml (0.5
7 ng / assay), with a linearity of 34-930 ng.
/ Ml (0.57-15.5 ng / assay).

3) Method for Quantifying Active MMP-9 Using the active MMP-9 described in Example 4 as a standard, a known concentration of active MMP-9 or free active MMP-9 was used.
Samples containing 9 were each added to a 96-well vinyl plate in an amount of 20 μl. Next, rTIMP-2 prepared in Example 2 (b)
-Dilute the IgG-HRP complex with buffer B to 18 µg / ml and add 100 µg each to the vinyl plate.
l was added and mixed. This mixed solution was prepared using the mouse anti-human MMP-9 antibody prepared in the above section (a) (clone No. 73).
-18B3) In addition to 100 μl of the binding plate, the following operation was performed in the same manner as in the above 1). The calibration curve is shown in FIG.
The sensitivity of this measurement system is standard 0 ng / ml value + 2S. D. To 5 ng / ml (84 pg / assay) with a linearity of 10-320 ng / ml (0.17-5.3 ng).
/ Assay). MMP-
3, -7, -8, -10, -11, -12 and -13 average
In addition , also for MT-MMP , each active MMP is separately quantified.

Example 6 Activity in Human Synovial Fluid and Human Serum
Of rheumatoid arthritis in which tissue destruction is progressing as a specimen
(RA) and osteoarthritis (O
A) Serum of RA patient using synovial fluid of patient and human serum
MMP-2 (N. Fu
jimoto et al. , Clin. Chim. Ac
ta, 221, 91-103, 1993)5
(B) rTIMP-1-HRP and
And free active MMP-2 using anti-MMP-2 antibody
It was measured. Free activity in OA patient synovial fluid and human serum
Type MMP-2 concentrations were all below the sensitivity of this assay.
Was. On the other hand, in synovial fluid of RA patients with progressive tissue destruction
The concentration of free active MMP-2 was slightly lower than the sensitivity.
However, free active form M in the synovial fluid and human serum of OA patients
It was significantly higher than the MP-2 concentration (FIG. 4). OA patients
Active MMP-2 was not detected in synovial fluid and human serum.
However, free TIMPs were present in these samples.
Active MMPs in the free state
Does not exist. As an example, active MMP-
2 Clinical application of quantitative method was shown, but other tissue
From patients with diseases such as destruction, inflammation or cancer metastasis.
Vesicle, tissue homogenate, synovial fluid, blood or urine
The amount of active MMPs in the free state was determined by this assay.
Separate quantification is possible.

[0057]

According to the present invention, immunological measurement of each free active MMP can be achieved by using a monoclonal antibody capable of specifically recognizing each MMP and each TIMP. In particular, by using a monoclonal antibody recognizing active MMP in a test sample and each TIMP,
Each free active MMP can be measured, and as a result, the active MMP can be quantified with high sensitivity and accuracy, and quickly. By being able to achieve the immunological measurement of MMP in this way, it is possible to accurately and rapidly activate each active MMP that is considered to play an important role also in inflammatory diseases such as rheumatoid arthritis, cancer and neoplastic diseases. The method is useful as a diagnostic agent for inflammatory diseases such as rheumatoid arthritis, neoplastic diseases, metastatic cancer, etc.

[Brief description of the drawings]

FIG. 1 is a diagram showing a standard curve of activated MMP-1.

FIG. 2 is a view showing a standard curve of activated MMP-2.

FIG. 3 is a view showing a standard curve of activated MMP-9.

FIG. 4 is a graph showing the amount of free active MMP-2 in synovial fluid or human serum of RA patients and OA patients.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI // (C12P 21/08 C12R 1:91) (72) Inventor Hideaki Tokai 530 Chokeiji Temple, Takaoka City, Toyama Prefecture Inside Fuji Pharmaceutical Industry Co., Ltd. (72) Inventor Akira Shinagawa 530 Chokeiji Temple, Takaoka City, Toyama Prefecture Inside Fuji Pharmaceutical Industry Co., Ltd. (72) Inventor Shinichi Yoshida 530 Chokeiji Temple Takaoka City, Toyama Prefecture Inside Fuji Pharmaceutical Industry Co., Ltd. 530 Chokeiji, Takaoka City Inside Fuji Pharmaceutical Industry Co., Ltd. (56) References JP-A-4-504418 (JP, A) JP-A-6-300577 (JP, A) JP-A-6-213888 (JP, A) JP-A-4-183397 (JP, A) JP-A-5-34353 (JP, A) JP-A-5-244985 (JP, A) (58) Fields investigated (Int. Cl. ⁶ , DB name) G01N 33 / 53 G01N 33/573 G01N 33/577

Claims (16)

(57) [Claims] 1. A free activated matrix metalloprotein.
In separating and quantifying ases, it is necessary to: (i) use a small amount of
Specific to at least central region or carboxyl terminal region
Binding monoclonal antibodies and matrix meta
And (ii) an inhibitor of the matrix metalloprotease.
Are inhibitors of matrix metalloproteases
Specifically binds to at least the carboxyl-terminal region of
Monoclonal antibody and a labeled substance
Complex of Monoclonal Antibody with the Inhibitor
And (iii) the immune complex comprises the inhibitor and a small amount thereof.
At least one that specifically binds to the carboxyl-terminal region
Cross-linking to prevent dissociation of immune complex with clonal antibody
That the immobilization operation has been performed by joining
Characterized free active matrix metalloproteins
A method for separating and quantifying zeolites. 2. The method according to claim 1 , wherein tissue inhibitor of metalloprotease-1 or tissue inhibitor of metalloprotease-2 is used as the matrix metalloprotease inhibitor. 3. A crosslinking agent wherein formaldehyde is used as a crosslinking agent.
2. The method according to claim 1, wherein
2. The method according to 2. 4. An antibody which specifically binds to an inhibitor of a matrix metalloprotease, wherein the antibody specifically binds to a tissue inhibitor of metalloprotease-1 or tissue inhibitor of metalloprotease-2.
The method according to claim 1 , wherein an antibody that specifically binds to is used. 5. An antibody recognizing a central region or a carboxyl terminal region of each matrix metalloprotease molecule as a monoclonal antibody that specifically binds tissue inhibitor of metalloprotease-1 as an inhibitor of matrix metalloprotease and a monoclonal antibody that specifically binds to each matrix metalloprotease. using method of claim 1, wherein the measuring free of active matrix metalloproteinase. 6. An antibody recognizing a central region or a carboxyl terminal region of each matrix metalloprotease molecule as a monoclonal antibody which specifically binds tissue inhibitor of metalloprotease-1 as an inhibitor of matrix metalloprotease and a monoclonal antibody which specifically binds to each matrix metalloprotease. Using free active matrix metalloprotease-1, -2,-
3, -7, -8, -9, -10, -11, -12 and-
13. The method according to claim 5 , wherein a substance selected from the group consisting of 13 and free activated membrane-type matrix metalloprotease is measured. 7. An antibody recognizing a central region or a carboxyl terminal region of each matrix metalloprotease molecule as a matrix metalloprotease inhibitor, a tissue inhibitor of metalloprotease-2 as a matrix metalloprotease inhibitor, and a monoclonal antibody specifically binding to each matrix metalloprotease molecule. using method of claim 1, wherein the measuring free of active matrix metalloproteinase. 8. An antibody recognizing a central region or a carboxyl-terminal region of each matrix metalloprotease molecule as a matrix metalloprotease inhibitor, a tissue inhibitor of metalloprotease-2 as a matrix metalloprotease inhibitor, and a monoclonal antibody specifically binding to each matrix metalloprotease molecule. Using free active matrix metalloprotease-1, -2,-
3, -7, -8, -9, -10, -11, -12 and-
8. The method according to claim 7 , wherein a substance selected from the group consisting of 13 and free activated membrane matrix metalloprotease is measured. 9. (i) Each matrix metalloprotein
At least the central region or carboxyl terminus in the ze molecule
Monoclonal antibodies and antibodies that specifically bind to
Combines inhibitors of Tricks metalloprotease
Using Te Align, Inhibi of (ii) the matrix metalloproteinase
Are inhibitors of matrix metalloproteases
Specifically binds to at least the carboxyl-terminal region of
Monoclonal antibody and a labeled substance
Complex of Monoclonal Antibody with the Inhibitor
And (iii) the immune complex comprises the inhibitor and a small amount thereof.
At least one that specifically binds to the carboxyl-terminal region
Cross-linking to prevent dissociation of immune complex with clonal antibody
That the immobilization operation has been performed by joining
Characterized free active matrix metalloproteins
Reagent set for fractionation and quantification of zemos. 10. Tissue inhibitor of metalloprotease-1 or tissue inhibitor as a matrix metalloprotease inhibitor
10. The reagent set according to claim 9 , wherein the reagent set uses metalloprotease-2. 11. A crosslinking agent wherein formaldehyde is used as a crosslinking agent.
10. The method according to claim 9, wherein the step is performed using a hide.
Is a reagent set described in 10. 12. An antibody that specifically binds to an inhibitor of a matrix metalloprotease,
Inhibitor of metalloprotease-1 or tissue Inhibitor of metalloprotease-
10. The reagent set according to claim 9, wherein an antibody that specifically binds to No. 2 is used. 13. A matrix metalloprotease a.
Tissue inhibitor of meta as inhibitor
Proteinase-1 with each matrix metalloprotein
Monoclonal antibody that specifically binds to
The central region of each matrix metalloprotease molecule or
Uses an antibody that recognizes the carboxyl-terminal region.
The reagent set according to claim 9, characterized in that: 14. A matrix metalloprotease a.
Tissue inhibitor of meta as inhibitor
Proteinase-1 with each matrix metalloprotein
Monoclonal antibody that specifically binds to
The central region of each matrix metalloprotease molecule or
Uses an antibody that recognizes the carboxyl-terminal region,
Activated matrix metalloprotease-1, -2,-
3, -7, -8, -9, -10, -11, -12 and-
13 and free activated membrane matrix metalloprotein
Measuring a substance selected from the group consisting of
The reagent set according to claim 13, wherein 15. A matrix metalloprotease a.
Tissue inhibitor of meta as inhibitor
Loprotease-2 is added to each matrix metalloprotein.
Monoclonal antibody that specifically binds to
The central region of each matrix metalloprotease molecule or
Uses an antibody that recognizes the carboxyl-terminal region,
Measuring activated matrix metalloprotease
The reagent set according to claim 9, wherein: 16. A matrix metalloprotease a.
Tissue inhibitor of meta as inhibitor
Loprotease-2 is added to each matrix metalloprotein.
Monoclonal antibody that specifically binds to
The central region of each matrix metalloprotease molecule or
Uses an antibody that recognizes the carboxyl-terminal region,
Activated matrix metalloprotease-1, -2,-
3, -7, -8, -9, -10, -11, -12 and-
13 and free activated membrane matrix metalloprotein
Measuring a substance selected from the group consisting of
The reagent set according to claim 15, wherein