JP2798660B2 - Method for producing peptides - Google Patents

Description

Description: TECHNICAL FIELD The present invention relates to a method for producing peptides using self-replicating sequence DNA of mammalian cells. [0002] As a method for producing peptides by applying genetic engineering, a method of producing peptides, proteins, etc. using Escherichia coli, Bacillus subtilis, etc. using a plasmid, viral DNA, etc.
There is known a method of making a host produce peptides, proteins, and the like using the above method. However, these are not always satisfactory in terms of plasmid stability, limited cell types used, production efficiency, and the like. The present inventors have isolated a DNA fragment containing an autonomous replicating sequence (ARS) derived from mouse cells, and reported that this fragment was an EcoRI and BglIII digested fragment having about 2500 bases. (Provision 1). The present inventors have examined the properties of this ARS fragment, and found that ARS has specific affinity for the DNA-binding protein of myc-protein, which is the product of c-myc gene, Has found that it binds to the c-myc gene itself and regulates its expression.Based on these findings, it has become possible to isolate and obtain ARS from various mammalian cells using myc-protein etc. Further, they have found that useful peptides, proteins and the like can be efficiently produced using the self-replicating sequence DNA (ARS) of mammalian cells, and completed the present invention. [0005] The present invention relates to the upstream region of the human c-myc gene.
DNA containing HindIII-PstI region
A sequence that has an affinity for the c-myc protein and is extrachromosomal
The present invention relates to a method for producing peptides, which comprises growing a plasmid containing a human cell-derived self-replicating sequence DNA, a promoter and a gene for producing peptides (including a translation initiation codon) capable of self-replication in a cell . ARS (self-replicating sequence) is an origin of replication when a chromosome of a eukaryote self-replicates. This can be obtained as follows. That is, DNA is taken out of a mammalian cell, treated with an appropriate restriction enzyme (preferably a six-base recognition enzyme, for example, HindIII, EcoRI, BamHI) and treated with a DNA fragment of an appropriate size (usually 1000 to 10,000 bp). No, it is mixed with a DNA-binding protein to produce a DNA-protein conjugate. [0008] A DNA-binding protein is a protein that is present in the cell nucleus and controls the functional expression of DNA.
It has an affinity for A and is classified as a non-histone protein. For example, c-myc protein (see Reference 13), v
-myc protein (see Reference 14), N-myc protein (see Reference 15), c-myb protein (see Reference 15), v-myb protein (see Reference 1)
5), c-fos protein (see Reference 15), v-fos protein (see Reference 15), p53 (see Reference 15), and RB gene product (see Reference 16). Can be mentioned. After the formation of the DNA-protein conjugate, the desired DNA can be obtained by applying ordinary protein separation and acquisition means such as an antigen-antibody reaction. That is, DNA-
When it is difficult to separate and obtain the protein-bound substance as it is, an antibody against the DNA-binding protein is bound thereto, and further a substance that specifically binds to the antibody, for example, protein A, is bound. The body is easily formed and precipitates, and separation and acquisition are easy. The antibody may be prepared by a conventional method. For example, the third exon of the N-myc gene (a portion specific to N-myc) is expressed in E. coli, and the produced protein is purified. The mouse is immunized according to the method described above, and the IgG fraction is taken from the antiserum and used. Alternatively, a commercially available product (for example, anti-myc protein antibody: α-myc manufactured by Onko) may be used. As protein A, a cell suspension of Staphylococcus aureus (P7155: Sigma) and a carrier-bound substance (Agarose FPA-1: Cosmo Bio, Sepharose: Pharmacia) are also commercially available. A conjugate of DNA and protein (for example, DNA-
myc protein-antibody-protein A conjugate)
The isolation of the protein may be performed by a conventional method. For example, the protein portion may be isolated by treatment with a reagent such as 2-mercaptoethanol or an enzyme for separating the protein (Proteinase K: Sigma, Proteinase No. 24568: Merck). Decompose and remove it by phenol extraction to obtain DNA (Reference 1)
0). The thus obtained DNA fragment having a specific affinity for the DNA-binding protein is a DNA fragment of ARS.
A is included. That is, the fact that the DNA binding protein and ARS have a very strong affinity is a very important fact that the present inventors have brought out. The ARS-containing DNA fragment can be used as an ARS alone or an ARS-containing DNA fragment of an appropriate length, if necessary.
Techniques such as DNA processing and screening for producing useful substances such as peptides using this operation and this ARS can be understood by ordinary knowledge in this field if general techniques are used with reference to Examples and the like. Will easily be understood and implemented. [0015] In addition, ARS may differ slightly in nucleotide sequence depending on the species of the animal from which the cell is derived, or due to the species of the cell, or even if the same cell is the ARS at another site in the same cell. It is thought enough.
Therefore, ARS cannot be used unless it is completely identical to the base sequence of ARS isolated as described above, and it is not necessary to substitute or remove some bases or add bases. Whether it is possible and suitable for efficient production of the target substance can be confirmed by ordinary level tests and studies with reference to the description of the present specification. In the present invention, ARS which can be isolated or used includes mouse, rat, guinea pig, cow,
Examples include those derived from mammalian cells such as horses, sheep, goats, rabbits, monkeys, chimpanzees, and humans. Particularly, those derived from mouse or human cells with advanced cell culture techniques may be appropriate. it can. The cell used as a raw material for obtaining ARS-containing DNA is not particularly limited, but it is convenient to use a cell that produces a large amount of a DNA-binding protein. Examples thereof include c-myc protein, v-myc protein, N-myc protein, c-myb protein, v-myb protein, c-fos protein, v-fos protein, p53, and RB gene product. Cells, such as human HL-60 cells, human IMR cells, human Raji cells, mouse FM3
A cells and the like. For the construction of the ARS-containing plasmid of the present invention suitable for the production of peptides, a conventional gene recombination technique may be used (see Reference 7). In addition, generally known mammalian cells and techniques can also be used for introducing plasmids into cells, types of cells to be used, and cell propagation methods, and methods to be improved in the future and application of cultured cells, culture media, etc. Could also be possible. (See references 8 to 10). The following is a further description of some of the general methods. Examples of usable promoters include various promoters derived from cells such as a thymidine kinase promoter and an immunoglobulin promoter, or SV40.
Promoters of viruses that infect mammalian cells, such as the T antigen promoter, early promoter, and herpes virus thymidine kinase promoter. Normal ATG can be used for the translation initiation codon. Examples of peptides to be produced include insulin, growth hormone, interferons, tumor necrosis factor, lymphokines such as interleukins, peptides such as various enzymes, proteins and glycoproteins which can be used as medicaments. be able to. Examples of genes for producing peptides include DNA encoding the amino acid sequence of the above-mentioned peptides and nuclear DN.
A sequence in which a poly A signal for terminating translation is arranged downstream of A on the 3 'side can be mentioned. For the production of the plasmid of the present invention, a DNA fragment, a promoter, a translation initiation codon and a gene for producing peptides having an appropriate base pair number and having a cleavage site by a commonly used restriction enzyme are appropriately prepared. They are joined so as to form an array, and further ARS is added to make them circular. The direction and position of the ARS need not be particularly limited. The resulting plasmid can be introduced into various mammalian cells by transfection using calcium phosphate, microinjection method, liposome method, protoplast fusion method and the like to prepare transformed cells. Examples of cultured cells include mouse NS-1
And FM3A, human HL-60, U937, Daudi and Raji. By growing this transformed cell, the desired peptides can be produced. In this case, it is one of the features of the present invention that the cell from which the ARS is derived and the cell into which the plasmid is introduced need not be the same. For culturing the transformed cells, a usual method for culturing the cells used, for example, DM containing a suitable amount of calf serum is used.
5 using EM (Dulbecco's modified Eagle's medium)
% Carbon dioxide in the presence of 37 ° C., or growth in the animal intraperitoneal cavity (see References 8 to 10). When the produced peptides are released in the medium, they are subjected to a usual fractionation method, for example, centrifugation, gel filtration or the like. It can be isolated by a general method using a fractionation method or from ascites. Hereinafter, the present invention will be further described with reference to Examples, but it should not be construed that the invention is limited thereto. Example 1 1) Having mouse ARS and mitidine kinase gene
(See FIG. 1) Plasmid pMU65 (Reference 1) was treated with EcoRI and BglII, and a DNA fragment having about 2500 base pairs was isolated. This fragment was inserted into the EcoRI-BglII region of plasmid pKSV10 (Pharmacia) to prepare plasmid pARS65. The plasmid pAGO (Reference 2) was treated with BamHI to isolate a fragment containing a thymidine kinase gene derived from herpes virus. This fragment was inserted into the BamHI site of the plasmid pARS65,
Plasmid p65-tk was produced. This plasmid was grown in Escherichia coli (E. coli K12 C600) (Deposit No. FERM P-8863). 2) Mouse ARS and SV40T antigen
Preparation of plasmid having gene (see FIG. 2) Plasmid pMTIOD (Reference 3) was prepared using BamHI and Pvu
Treated with II, the SV40 T antigen gene with the early promoter was isolated. A BamHI linker (Takara Shuzo) was bound to the PvuII site of the gene. The obtained fragment was inserted into the BamHI site of plasmid pARS65,
The plasmid p65-T was obtained. 3) Expression of protein (thymidine kinase) The plasmid p obtained by 1) according to the liposome method (Reference 4)
65-tk was transformed into FM3A ^tk- cells. For transformation, 20 mM Tris buffer (pH 7.5) containing 50 mM EDTA was used, and liposomes were prepared using phosphatidylserine according to a known method (Reference 5). After transformation, cells were transformed with 10% calf serum-containing D
The cells were cultured at 37 ° C. in the presence of 5% carbon dioxide using MEM. Two days later, the medium was changed to HAT medium. Transformed cells, ie, FM3A ^{tk +} cells, appeared after about one week. Two weeks later, each colony was isolated and cultured in a HAT medium until the number of cells reached about 10 ⁷ . During this time, the number of times of doubling has passed. When transformation of 1,000 cells was attempted by this method, about 300 to 400 transformed cells were obtained. Therefore, it was confirmed that p65-tk was growing in FM3A ^tk- cells and that the thymidine kinase gene was expressed. 4) Examination of copy number From the above 10 ⁷ cells, low molecular weight DNA was extracted by the Hirt method (Reference 6). To confirm that the plasmid has replicated in the transformed cells,
A was treated with the restriction enzyme DpnI. ^P65 -t introduced into FM3A ^tk- cells
The adenine portion of k is methylated, but those replicated in the cells are unmethylated. Since DpnI selectively cuts only methylated DNA, the plasmid replicated in the cell is not cut, but only the plasmid that has entered the cell is cut into a plurality of DNA fragments. Therefore, plasmids replicated in cells can be easily distinguished by electrophoresis. After DpnI treatment, DNA was separated by agarose gel electrophoresis (Reference 7), and this was subjected to Southern blotting (Reference 11). That is, p65-t labeled with ³² P
Hybridization was performed using k as a probe, and then autoradiography was performed using an X-ray sensitive film to detect a band that hybridized with the probe.
It was confirmed that -tk replicated as extrachromosomal DNA. The number of copies per cell can be calculated from the photosensitivity by 10
0-200. This plasmid harbors cells with HAT
Even when the medium was replaced with DMEM containing 10% calf serum, the culture was replicated stably, and no modification on the DNA was observed. Further, it was confirmed that this plasmid was stably present in the cells even after 150 times of doubling. 5) For various cells of plasmid pARS65
The cloned pARS-65 was transfected into mouse NS-1 cells, human HL-60 cells and human U937 cells, respectively, according to the above method, and contained 10% calf serum.
The cells were cultured at 37 ° C. in the presence of 5% carbon dioxide using RPMI 1640 medium. Forty hours later, extrachromosomal low molecular weight DNA was analyzed according to the method described in 4) above. As a result, about 500 copies in NS-1 cells, about 10,000 copies in HL-60 and U
It was confirmed that about 100 copies of pARS-65 replicated in 937 cells. Thus, it was confirmed that pARS-65 replicates in cells of species other than mouse, suggesting that p65-tk also has the replication ability. Example 2 1) Isolation of ARS from human cells (see FIG. 3) DNA of human HL-60 cells was extracted by SDS-Proteinase K method (Reference 7), and HindII was extracted.
Treated with I. Myc from the obtained DNA fragment
In order to extract a DNA fragment having affinity for a protein, the following operation was carried out according to a known method (Reference 12). That is, the DNA fragment was mixed with HL-60 nuclear extract (having a large amount of myc protein), and
The reaction was performed for 0 minutes to generate a DNA-myc protein conjugate. Next, an antibody against the myc protein (α my
c, product of Onco) and DNA-myc protein-α
The myc complex was formed. Further, an aqueous solution of Staphylococcus aureus containing protein A that specifically binds to α myc was added, and DNA-myc protein-α was added.
The myc-protein A complex was formed. The complex precipitates and is separated and
After washing with Tris buffer (pH 7.5) containing 1% SDS and 0.1 M sodium chloride, 7 mM containing 1% SDS
A 2-mercaptoethanol aqueous solution was added and the mixture was added at 30 ° C for 30
The reaction was allowed to proceed for a minute to release the DNA. 15,000 reaction mixture
After centrifugation at xg for 5 minutes, the supernatant was isolated. This is extracted with phenol to obtain the desired DNA fragment.
It was inserted into the HindIII site of UC19 (Pharmacia). When the number of base pairs of the obtained DNA fragment was examined by agarose gel electrophoresis, about 200
Met. The obtained plasmid was propagated in E. coli K12 C600 (Deposit No. FERMP-8864, deposited by MRI). The above HL-60 nuclear extract was prepared as follows. That is, a culture solution of HL60 cells (5 × 10
^The cells were collected by centrifugation of 1 L ( ⁵ / ml) and washed with phosphate buffered saline. This is further diluted with a hypotonic aqueous solution (20 mM
HEPES, pH 7.5, 5 mM potassium chloride, 0.5 mM magnesium chloride, 0.5 mM dithiothreitol, 0.2
mM sucrose). This was suspended in 5 ml of a hypotonic aqueous solution (the above aqueous solution from which sucrose was removed), and 10
Let stand for minutes. This was moved up and down 40 times with a dounce homogenizer, and then centrifuged at 3000 × g for 10 minutes to obtain a precipitate. Since this precipitate is a nucleus,
Aqueous solution (5 mM HEPES, pH 7.5, 10%
Sucrose) and temporarily stored in liquid nitrogen. This was slowly dissolved at 0 ° C., and a 5 M aqueous sodium chloride solution was added to a final concentration of 0.1 M, followed by treatment at 0 ° C. for 5 minutes. This was centrifuged at 15,000 × g for 20 minutes, and the supernatant was obtained as a nuclear extract. The plasmid grown in the above E. coli K12 C600 was isolated (Reference 7) and treated with HindIII. The plasmid was not digested with HindIII. This plasmid was named pHLmyc. Plasmid pUC19 contains B in addition to HindIII.
Because it has restriction enzyme cleavage sites such as amHI and NarI,
The above plasmid was treated with BamHI and NarI, and a DNA fragment having a small molecular weight was isolated from the two generated fragments. Using this fragment as a template to prepare a probe labeled with ³² P and examining Southern hybridization with DNA of HL-60 cells (Reference 11), it was found that the probe hybridized with HL-60 cell DNA. The fragment having a NarI site and a BamHI site at both ends (NarI-BamHI fragment) is H
It was confirmed that the DNA contained DNA derived from L-60 cells. The number of base pairs of the NarI-BamHI fragment was examined by agarose gel electrophoresis.
It was 300. The pUC19 HindIII site and NarI site are 131 base pairs apart, and the HindIII site and BamHI site are 3
Five base pairs apart, and the PstI site and the BamHI site are 25 base pairs apart. Furthermore, the plasmid pHLmyc requires PstI
The site was retained. Therefore, the plasmid pHLmy
The number of base pairs of DNA derived from HL-60 cells in c was estimated to be about 120. As a result of elucidating the base sequence, 99 bases were confirmed in the HindIII site of the polylinker, and the sequence is shown in Table 1 below. Table 1 GTATGATACAGATCGTGGAGA ATACGTAGCCCTCGTCACCAT TGAGCAGGTACGTTGTACTGGG AAGAGACACCTGCTCTGACAC TGCACGACGTGCAGCCATC . Based on this, it is considered that 12 to 59 or 17 to 74 of the above 99 bases are the base sequences of the most important self-replicating sequence (ARS). 2) Plasmid pHLmyc has ARS
The HL-60 cells with pHLmyc with confirmation liposome method was transformed in to, and then was examined copy number according to the above method was about 10,000 per cell. 3) A program having human ARS and c-myc
Preparation and Expression of Rasmid ( see FIG. 4) Plasmid pmyc (manufactured by Onko Inc., containing myc structural gene and Rous sarcomavirus long terminal repeat promoter (LTR)) was treated with BamHI, HindIII and EcoRI, and myc structural gene and LTR Was isolated. This was inserted into the EcoRI-BamHI region of pHLmyc to prepare a plasmid pARSmyc. Human U937 cells were transformed with this plasmid by the liposome method, and cultured at 37 ° C. in the presence of 5% carbon dioxide using RPMI1640 medium containing 10% calf serum. Three days later, the mRNA level of the myc gene in the cells was examined using the Northern hybridization method (Reference 7), and the mRNA of U937 cells without pARS was examined.
When compared with the amount of the gene, it was about 100 times. Therefore, the mc gene of the plasmid pARSmyc
The RNA was considered to be transcribed. Example 3 1) Subcloning of human c-myc gene Human c-myc gene (Mol. Cell Bio1, 5 , 414-418)
(1985)) in the upstream region of HindIII-KpnI region (about 12
00 bp) and the HindIII-PstI region (about 200 bp)
Was subcloned into pUC18 and pUC19, respectively. Plasmids of the clones were each cloned into pmyc
(HK) and pmyc (HP). 2) HindIII-KpnI fragment and HindI
A gel shift assay is a method that has been widely used in recent years as a method for examining the binding between a DNA and a protein that binds a II-PstI fragment to a c-myc protein . This binds the isotope-labeled DNA to the protein,
It is as simple as running the gel on a polyacrylamide gel, and the DNA-protein complex utilizes the fact that the movement of DNA is delayed in the gel (see Reference 17). HL producing large amounts of c-myc protein
A nuclear extract was taken from −60 cells and used as a c-myc protein source. The HindIII-KpnI fragment and HindIII-PstI fragment of the c-myc gene were mixed with a nuclear extract, incubated at 30 ° C. for 15 minutes, and then run on a 5% polyacrylamide gel. On the other hand, those obtained by reacting the above-mentioned extract with the c-myc antibody first were treated similarly with each fragment. As a result, both fragments bound to the protein,
Those treated with the c-myc antibody in advance were inhibited. From this, it was found that the HindIII-PstI fragment (about 200 nucleotides) has a c-myc protein binding site. Pmyc (HK) was converted to HindIII and KpnI.
Then, pmyc (HP) was treated with HindIII and PstI, respectively, to form DNA fragments. These were mixed with c-myc protein, treated with an antibody, treated with protein A, and treated in the same manner as in Example 2. Proteolytic and deproteinizing treatments for HindIII-KpnI fragment and HindIII-PstI
The fragment was obtained. The nucleotide sequence of this HindIII-PstI fragment was determined by the dideoxy method. This is shown in Table 2 below. [0062] [Table 2] _{1 10 20 AAGCTTGTTT GGCCGTTTTA 21 GGGTTTGTTG GAATTTTTTT} 41 TTCGTCTATG TACTTGTGAA 61 TTATTTCACG TTTGCCATTA 81 CCGGTTCTCC ATAGGGTGAT 101 GTTCATTAGC AGGGGTGATA 121 GGTTAATTTT CACATCTCTT 141 ATGCGGTTGA ATAGTCACCT 161 CTGAACCAAT TTTTCCTCCA 181 GTAACTCCTC TTTCTTCGGA 201 210 CCTTCTGCAG [0063] EXAMPLE 4 Various cell nuclear DNAs in the same manner as in Example 2,
Various plasmids were obtained using proteins and antibodies. Table 3 shows the relationship between the plasmid name and its raw material. [Table 3] Plasmid DNA / processing enzyme DNA binding protein source Antibody (protein) pIMR-N IMR32 DNA / HindIII IMR32 nuclear extract Anti-N-myc protein antibody (N-myc protein) pRJ-53 RajiDNA / HindIII Raji nucleus Extract Anti-P53 antibody (p53 protein) pHLmyc HL60 DNA / HindIII HL60 nuclear extract Anti-c-myc protein antibody As described above (c-myc protein) Proof of ARS pmyc (HK), pmyc (HK), pIMR-
N and pRJ-53 were each introduced into cells by the liposome method in the same manner as in 3) below in Example 1, and the copy number was examined.
Table 4 shows plasmid names, cells used, and copy numbers. [Table 4] Plasmid Used cells Copy number pmyc (HK) Human HL60 1000-5000 pmyc (HK) Human HL60 1000-5000 pIMR-N Human IMR-32 1000-5000 pRJ-53 Human Raji 1000 According to the present invention, the plasmid is efficiently replicated by the action of ARS in various mammalian cells, that is, the gene product production efficiency is high since the number of copies per plasmid cell is large. The present invention is a method for producing peptides which is excellent in genetic engineering. Reference 1 Mol. Cell. Biol., 5 , 563-568
(1985) Literature 2 Proc. Natl. Acad. Sci. USA, 76 , 3755 (197
9) Reference 3 J. Virology, 48 , 481-491 (1981) Reference 4 Science, 215 , 166 (1982) Reference 5 Proc. Natl. Acad. Sci. USA, 75 , 4194 (197)
8) Reference 6 J. Mol. Bio., 93 , 503-517 (1975) Reference 7 T. Maniatis et al, Molecular Cloning, Cold
Spring Harbor Laboratory (1982) Reference 8 Munemura Edition Cell Culture Manual Kodansha (1982) Reference 9 K. Habel et al., Foundamental Technique in
Virology, Academic Press, NY (1969) Reference 10 Kruse & Patterson, Tissue Culture, Acade
mic Press, NY (1973) Literature 11 J. Mol. Biol., 26 , 365-369 (1967) Literature 12 Mol. Cell Biol., 3 , 1958-1966 (1983) Literature 13 Science, 225 , 718-720 ( 1984) Reference 14 Nature, 296 , 262-264 (1982) Reference 15 Annu. Rev. Biochem., 52 , 301-310 (1983) Reference 16 Science 235 , 1394-1399 (1987) Reference 17 Nucleic Acid Res., 9 , 3047-3060 (1981)

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic diagram showing construction of a plasmid p65-tk having a mouse ARS and a thymidine kinase gene. FIG. 2 is a schematic diagram showing construction of a plasmid p65-T having a mouse ARS and an SV40T antigen gene. Schematic diagram of construction of plasmid pHLmyc having human ARS [Figure 4] Schematic diagram of construction of plasmid pARSmyc having human ARS and c-myc gene [Fig. 5] Presumed secondary structure of self-replicating sequence (ARS) [Fig. Another putative secondary structure of the replicated sequence (ARS)

Claims (1)

(57) [Claims] HindII in the upstream region of the human c-myc gene
A DNA sequence containing an I-PstI region, wherein c-my
Extracellular self-replicating human cell with affinity for c protein
A method for producing peptides, which comprises growing a plasmid containing a cell-derived self-replicating sequence DNA, a promoter and a gene for producing peptides (including a translation initiation codon) in cells.