JP2713871B2 - Method for synthesizing human inhibin β ▲ A ▼ chain - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION The present invention relates to a method for producing a protein containing an inhibin α-chain or an inhibin β-chain by a recombinant cell culture method. More specifically, the present invention provides a method for obtaining DNA encoding inhibin, and
The present invention relates to a method of using the same, and a method of producing an inhibin mutant using an amino acid sequence of a natural animal or human inhibin or a naturally occurring allele thereof as a starting material.

[0002] Inhibin is a protein produced in the gonads (gonads) and acting at the pituitary level to specifically inhibit the secretion of follicle stimulating hormone (FSH). Regarding the existence of inhibin, McLough (McC
ullagh) [1932, Science
(Science) 76 : 19-20]. There has been great interest in such preferential regulatory effects on gonadotropin (gonadotropin) secretion, and over the past 50 years, a number of researchers have tested testicular extracts, sperm, testicular reticulum, semen plasma and follicular fluid. And attempted to characterize it using various bioassays. In many documents,
Although it has been reported that inhibin-like substances with molecular weights of 5,000-100,000 daltons have been purified, in continuing studies these substances are not homogenous (homogeneous) or have the expected heights of true inhibin. Have been found to have no specific activity and / or do not exhibit the molecular properties of inhibin described herein [de Jong, Inhibin-Factor Artifact]. "Molecula and Cellular Endocrine
r & Cellular Endocrin) "13: 1-10 (197
9); Chees et al., 1984, "FEBS " 1
65 (1): 11-15; Seidah, 198.
4 "FEBS " 175 (2): 349-355; Lilja et al., March 1985, "FEBS.
S. 1982 (1): 181-184; Li et al. (Li) 198.
June 2005 "Proceedings of the National Academy of Sciences (Proc. Nat. A.
cd. Sci. USA) 82 : 4041-4044: Seidah et al., " FEBS " 167 (1): 98-.
102; and Beksac et al., 1984, "Intern. J. Androlo.
gy) "7: 389-397].

A polypeptide having inhibin activity is
Purified from bovine or ovine follicular fluid (PCT 86
/ 00078, published January 3, 1986). This protein has a molecular weight of 56,000 ± based on SDS-PAGE.
Has an apparent molecular weight of 44,000
2 with ± 3,000 and 14,000 ± 2,000
It has been reported that it can dissociate into one subunit.
The amino terminal sequence of each subunit is described.

[0004] Two proteins, each having a molecular weight of about 32,000 daltons and having inhibin activity, have been successfully isolated from follicular fluid of pigs. Heparin-Sepharose affinity chromatography, gel filtration and reversed phase high performance liquid chromatography (RP-HPL
Combination of protein separation methods such as C)
(90% of total protein weight) was purified from porcine inhibin.

[0005] These proteins have been isolated in a substantially homogenous form from material obtained from pigs and have been identified as protein A (Prot).
ein A) and protein B (Protein B). Each protein has a molecular weight of 32,000 daltons (32
K), which have molecular weights of 18,000 and 14,000 daltons and are composed of two polypeptide chains that are linked via disulfide bonds in the protein and exhibit hormonal activity. 1 of both proteins
The amino-terminal amino acid residue sequence of the 8,000 dalton (18K) or alpha (α) chain has the formula:

Embedded image Ser-Thr-Ala-Pro-Leu-Pro-Trp
-Pro-Trp-Ser-Pro-Ala-Ala-Leu-Arg-
Leu-Leu-Gln-Arg-Pro-Pro-Glu-Glu-P
Indicated by ro-Ala-Val. Also, the amino-terminal amino acid residue sequence of the 14,000 dalton (14K) or beta (β) chain of protein A has the formula:

Embedded image Gly-Leu-Glu-X-Asp-Gly-Lys-
Val-Asn-Ile-XX-Lys-Lys-Gln-Phe-
Phe-Val-Ser-Phe-Lys-Asp-Ile-Gly-T
rp-Asn-Asp-Trp-Ile-Ile-Ala and that of protein B has the formula:

Embedded image Gly-Leu-Glu-X-Asp-Gly-Arg-
Thr-Asn-Leu-XX-Arg-Gln-Gln-Phe-
It is represented by Phe-Ile-Asp-Phe-Arg-Leu. Protein A and Protein B have been fully characterized. Each of the 32K proteins exhibits inhibin activity and specifically inhibits basal FSH secretion, but does not inhibit luteinizing hormone (LH) secretion. Each polypeptide chain showed no hormonal activity. After filing the original (parent) application in this regard, inhibin β-chain dimers (dimers)
(Referred to as activin), which has been shown to have an effect of stimulating FSH secretion by rat anterior pituitary cells [Vale et al.
6 Nature "Nature " 321 : 776-779 and Ling et al. (1986) "Nature " 321 : 779.
-782].

[0006] The amino acid sequences of the α and β chains of human inhibin were not known before the present invention. Not only is the availability of large quantities of human follicular fluid necessary to conduct research comparable to that performed on animal inhibin, but also human inhibin and animal inhibin are of similar importance to the extent that similar purification methods are effective. There is no guarantee that they are sufficiently similar. Therefore, there is a need for a method for characterizing the amino acid sequence of human inhibin.

Also, the α- or β-chain of inhibin, preferably containing little or no protein of the species homologous to the questioned inhibin, preferably biologically There is a need for an economical method for producing active inhibin α or β chains. These and other objects will be apparent from the full scope of the invention.

[0008] α-chain and β-chain of the mature inhibin Summary pigs and humans, and to a nucleic acid isolated encoding those prepro form as well as professional type precursor were cloned into a replicable vector. Sequencing of the cDNA encoding inhibin results in a prodomain (p.p.) located at the N-terminus of the mature inhibin chain and, together, expressing a biologically active polypeptide.
rodomain) region was identified. This pro domain region,
Alternatively, prodomain immunogens (immunogens) are useful in monitoring the processing of preproinhibin in transformed cells, or in experiments involving changes in clinical conditions or reproductive physiology in animals.
In the present invention, in order to transform a host with the α-chain nucleic acid or the β-chain nucleic acid, to recombinantly express the mature inhibin α-chain and / or β-chain, and to use them for a diagnostic assay,
The prodomain sequence of the precursor inhibin chain was prepared. More specifically, a nucleic acid encoding the region is ligated to a replicable vector under the control of a promoter, and a host cell is transformed with this vector.
Culturing the host cell, the pro domain from the cultured cells,
Inhibin α-chain and / or β-chain were expressed in recombinant cell culture by a method consisting of recovering activin or inhibin. According to the method of the present invention, inhibin, activin and prodomain can be produced in a biologically active form without any homologous source protein.

The nucleic acids identified in the present invention encode the α, β _A and β _B chains of porcine or human inhibin. Recombinant cells express .alpha..beta _A or .alpha..beta _B inhibin, or, beta-chain heterodimer or homodimers transformed to (which are summarized as activin in the literature) expressing Was done. The expression product of recombinant cells, the β-chain dimer, does not contain the homologous proteins normally associated with the natural state.

[0010] Inhibin or activin or a non-toxic salt thereof and a pharmaceutically acceptable carrier can be mixed and formulated to be administered to mammals including humans in order to control fertility (fertility). Administration of inhibin reduces fertility in female mammals and decreases spermatogenesis in male mammals, and administration of a sufficient amount causes sterility. Inhibin is also useful for diagnosing infertility. Literature has shown that activin can stimulate FSH secretion from pituitary cells,
Useful for fertility induction therapy.

Further, the method of the present invention provides a simple method for producing a mutant having a change in primary amino acid sequence and / or glycosylation from a natural analog of inhibin, activin and prodomain,
A fusion product of an inhibin, activin or prodomain region and an immunogenic peptide can be easily and easily produced.

DESCRIPTION OF THE DRAWINGS FIG . 1 is a schematic diagram of porcine α-chain mRNA. The overlapping cDNA clones used for sequencing are shown above the diagram showing the mRNA structure. The black square at the 3 'end of the lambda clones indicates that these clones were specifically primed (pri
ming). The untranslated sequence is indicated by a straight line, and the coding sequence is indicated by a box. The blank area indicates the coding region of the signal sequence and pro sequence, and the cross-hatched region indicates the 134 amino acid α-chain.
Scale scales nucleotides 5 'of longest cDNA clone
It is expressed from the end.

FIGS. 2 and 3 show the nucleotide sequence and predicted amino acid sequence of the porcine inhibin α-chain precursor. Nucleotide numbers are given on the left and amino acid numbers are given throughout. The underlined amino acid sequence is the sequence used to design a long synthetic DNA probe. This 364 amino acid precursor includes a hydrophobic signal sequence, a pro region, and a mature chain (amino acids 231-
364) is included. Immediately upstream of the NH ₂ terminus of the mature α chain, a proteolytic processing site, Arg-
Arg (shown as black bars). Other putative dibasic processing sites present within the pro region are indicated by white bars (blank bars). Single, potential N-linked glycosylation sites are indicated by cross-hatched bars. AATAA close to the 3 'end of mRNA
Box A is underlined.

FIG. 4 is a schematic diagram showing the porcine β _A subunit mRNA and β _B subunit mRNA, and their coding sequences are boxed. The β _A and β _B subunits (indicated by dashes) are coded towards the 3 ′ end of the coding sequence. The 3 'and 5' untranslated regions are indicated by lines. 5 'of the β _B subunit mRNA
And the length of the 3 'untranslated region is the size of the mRNA (Figure 9),
As well as inductively based on its apparent similarity to β _A mRNA. In the figure, the broken line indicates a hypothetical region of cDNA. CDNA clones primed to overlapping oligo dT and randomly primed clones (λPINβ _A 5s, λPINβ _B 1s,
And λ PINβ _B 2s) are shown. The scale is indicated by the nucleotide number from the 5 'end of the 4.5 kb mRNA.

FIGS. 5, 6, 7 and 8 show the nucleotide sequence and predicted amino acid sequence of the porcine inhibin β subunit precursor. The β _B sequence is a β _A sequence,
They are lined up to the maximum homology. The NH ₂ terminus of the β subunit precursor is indicated by square brackets and arrows. Cysteine residues are shaded, possible processing sites are indicated by white bars, and possible glycosylation sites are boxed by cross-hatching. In both sequences, the intron sequence, an extremely GC-rich region 3 'to the stop codon, is overlined or underlined. The amino acid sequence used to design the oligonucleotide contains AAT
Underlined as AAA polyadenylation signal.
Between the λPIN-β _A 8 and other clones covering this region was a difference of 1 nucleotide. G →
The A change resulted in a change of amino acid 278 from glycine to serine. Immediately upstream of the NH ₂ terminus of the mature β _A subunit, with the prosequence, Arg Arg Arg Arg Arg
Arg (black bar) proteolytic processing site is present. Only the amino acid sequence of the β _A subunit is numbered.

FIG. 9 shows the results of Northern blot analysis of porcine follicle mRNA performed using α, β _A and β _B subunit hybridization probes. a, b, c, d and f lanes are poly A ⁺ m
RNA, e and g lanes indicate total RNA. 2
The positions of the 8S and 18S ribosomal RNAs are indicated. Lanes a, d and e hybridize with the α subunit cDNA probe; lanes d, e and g hybridize with the β _A subunit specific probe; lane c hybridizes with the β _B subunit specific probe. The results are shown below. The α subunit mRNA is about 1.5 kb and the β _A subunit mRNA is about 4.5 kb. a,
The hybridization shown in lanes b and c is m
The determination was performed using probes of approximately equal length and specific activity to determine the relative levels of RNA.

FIG. 10 shows the amino acid sequence of human β-TGF,
It illustrates by comparing the beta _A and beta _B amino acid sequences of the porcine inhibin. The sequence around the cysteine residue is shown. Identical residues are boxed but conservative changes are indicated by an asterisk. In the figure, Inh represents inhibin.

FIG. 11 shows a comparison between the α subunit sequence and the β _A inhibin sequence. In the figure, Inh represents inhibin.

FIG. 12, FIG. 13 and FIG.
FIG. 2 is a schematic diagram showing the construction of a recombinant expression plasmid for porcine inhibin. In the figure, Inh represents inhibin.

FIGS. 15 and 16 show human α-inhibin c.
BRIEF DESCRIPTION OF THE DRAWINGS It is a figure which shows the nucleotide sequence and deduced amino acid sequence of DNA. The pro or inhibin sequence of 335 amino acids was numbered from the hypothetical signal cleavage site.
The signal sequence having 16 amino acids is numbered from -1 to -16. In case of homology with the pig sequence, 12 amino acid residues in the signal sequence are further predicted. In this and other figures, putative dibasic processing sites are indicated by white bars, glycosylation sites are indicated by hatched bars, and amino-terminal mature chain processing sites are indicated by black bars. The poly (A) addition signal sequence is underlined. Cysteine residues are shaded.

FIG. 17 and FIG. 18 are comparison diagrams of human and porcine α-inhibin protein sequences. Gaps were placed to maximize homology, and unidentified locations were marked with an asterisk. The numbers are given for the porcine sequence, which is one amino acid shorter than the human sequence.

FIGS. 19, 20 and 21 show a human β _A inhibin signal sequence having 28 amino acids (residues -28 to -28).
1) shows the nucleotide sequence of a precursor having a length of 378 amino acids and the deduced amino acid sequence. Basic processing sites in the precursors are indicated by black bars, and potential glycosylation sites are indicated by hatched bars, above the sequence. Cysteine residues are shaded.

FIGS. 22, 23 and 24 show the nucleotide sequence and the deduced amino acid sequence of human β _B inhibin cDNA. This sequence is a cysteine residue
(Position 7) and the β _A sequence (FIGS. 19, 20 and 2).
It is arranged from the cysteine present at residue 7 in 1).
Processing sites for mature inhibin are indicated by black bars, and potential glycosylation sites are indicated by cross-hatched bars. Cysteine residues are shaded.

The polypeptides of the detailed description the present invention is α-chain and β-chain of inhibin,
And their multimeric forms (activin and inhibin), their prepro-forms, their pro-domains, their respective chains and variants in the glycosylation and / or amino acid sequence of each form. Inhibin (including alleles) from human or animal sources inhibits basal FSH but not LH basal secretion from anterior pituitary cells, and activin exhibits the opposite effect [hereinafter ,
"Hormonally active" activin, or "hormonally active" inhibin.

Generally, the amino acid sequence variants are shown in FIG. 2, FIG. 3, FIG. 5, FIG. 6, FIG. 7, FIG. 8, FIG.
9, is substantially homologous to the porcine or human α or β chain sequence shown in FIG. 20, FIG. 21, FIG. 22, FIG. 23 and FIG. Substantially homologous refers to the fact that when two proteins are arranged so that the amino acid residue numbers match as much as possible, about 70% or more of the primary amino acid sequence of the candidate polypeptide corresponds to a porcine or human chain. Means that. To maximize residue identity, amino acid and / or carboxy terminus shifts are introduced, necessary gaps are introduced, and / or residues present as inserts in the candidate polypeptide are deleted. By way of example, see FIGS. 5, 6, 7, 8, 17, and 18 where the β _A and β _B subunits, or the human and porcine α-inhibin sequences, are maximally homologous. In general, variants on the amino acid sequence are shown in FIG. 2, FIG. 3, FIG. 5, FIG. 6, FIG. 7, FIG.
6, about 90% homologous to the corresponding native sequence shown in FIGS. 19, 20, 21, 22, 23 and 24.

It is not hormonally active but (1) can immunologically cross-react with antibodies raised against its natural counterpart (counterpart), or (2) has such a corresponding polypeptide, Variants that can antagonize the binding to cell surface receptors and that include polypeptides that are substantially homologous or not homologous to the mature inhibin chain or prodomain sequence are also within the scope of the invention. It is. Hormonally inactive variants may be produced by recombinant or organic synthesis of the α- or β-chain of the isolated inhibin, especially the fragments, or by introducing changes into the amino acid sequence to produce the molecule. It no longer exhibits the hormonal activity as defined above and is produced.

The phrase immunological cross-reactivity or receptor cross-reactivity refers to the ability of a candidate polypeptide to compete with a hormone-active analog for binding to a polyclonal antiserum raised against the hormone-active analog. Means that it can be inhibited. Such antisera are available from sheep or rabbit S. Inject C and a hormonally active analog, or
Derivatives in complete Freund's adjuvant were given, and S. aureus in incomplete Freund was given. It is prepared as usual by injecting C intraperitoneally with a booster.

Variants that have no hormonal activity but are capable of reacting with antisera to the hormonally active inhibin, activin or prodomain include (a) reagents in diagnostic assays for natural analogs or antibodies thereof (b) When insolubilized by a known method, it is useful as a substance for purifying an anti-one natural homolog antibody from antiserum, and (c) as an immunogen for raising an antibody against a hormonally active homolog.

The present invention relates to a prosequence and / or preprosequence of an inhibin α or β chain precursor, or an immunologically or biologically active fragment thereof, which substantially converts the corresponding mature inhibin chain. Including those not included. These sequences for porcine or human inhibin are shown in FIG. 2, FIG. 3, FIG. 5, FIG. 6, FIG.
This is shown in FIGS. 15, 16, 19, 20, 21, 22, 23 and 24. The prepro sequence of the porcine α subunit precursor is a polypeptide from residue 1 to about 230, and the pro sequence of the β _A subunit is residue 1
To about 308. In the present specification, these sequences are included in the prodomain sequence.

The α and β subunit prodomain sequences are composed of several domains (regions) bordered by proteolytic sites, and in the present invention, these domains can be Synthesized in a form linked to a domain. The beta _A domain basic pig, residues 1 to about 70 (domain I), about 70 to about 110
(Domain II), about 110 to about 180 (domain II
I), about 180 to about 260 (domain IV) and about 27
0 to about 309 (domain V). More specifically, the porcine β _A domain has the formula:

Embedded image GHSAAPDCPSCALATLPKDV
PNSQPEMVEAV, HILNMLHLKKRPD
VTQPVPKAALLNAI, LHVVGKVGENG
YVELEDDIG, AEMNELMEQTSEIT
FAEAGRACKTLRFEISKEKGSDLSVV
ERAEIWLFKVPKANRTTKVSIRLF
QQQ, PQGSADAGEEAEDVGFPEEKS
EVLISEKVVDA, STWHIPVVSSIQ
RLLDQGKSALDIRTACEQCHETGAS
LVLLG and GHSAAPDCPSCALATL
PKDVPNSQPEMVEAVKKHILNMLHL
Contains the domain of KKRPDVTQPVPKAALLNAI. The porcine β _B domain has the same sequence as the homologous β domain, and has the formula:

Embedded image It contains a domain represented by RAAHILLHAVRVSGWLNL. Furthermore, the porcine alpha domain is
formula:

Embedded image GPELDRELVLAKVRALFLDA
LGPPAVTGEGGDPGV and GSEPEEE
DVSQAILFPATGARCGAEPAAGELA
REAEGLFTYVGRPSQQHTHSRQVTS
AQLWFHTGLDRQGMAAANSSGPLLD
LLALSSRGPVAVPMSLGQAPPRWAV
LAASALLPLTHHPLVVLLLRCPLCSC
SARPEATPFLVHTRARPPSGGERA Includes the domain indicated. Typical coupling (combination) domain polypeptide, the beta _A domain II C
And the NH ₂ -terminal end and beta _A domain III is a polypeptide consisting bonded. In addition, these domains may be fused at a proteolytic site as shown in FIG. 2, FIG. 3 or FIG. 5, FIG. 6, FIG. Fused by a peptide (eg, a glutaminyl or histidyl residue) or directly fused, all three cases apply to the production of binding domain polypeptides.

The basic human α chain prodomain mostly residues 30-199 and 1-29, human beta _A prodomain most likely residue 1-30,32-40,43-59,62
-80,83-185 and 186-230, the human β _B
The prodomain is generally at residues 1-13, 15-30, 32
-59, 62-145, 148-195 and 198-
241 respectively, by numbering of FIG. 15, FIG. 16, FIG. 19, FIG. 20, FIG. 21, FIG. 22, FIG. 23 and FIG.
It is. Binding prodomain polypeptides are also included within the scope of the invention, and include, for example, β-residues of about 43-80.
_A prodomain, residues about 1-30 and about 32-145
Β _B prodomain. Preferred human α, β _A and β _B chain prodomains comprise residues about 1-29, about 43-80
And about 1-30.

Intact, isolated prepro or prodomain β _A , β _B or α sequences can best be produced by recombinant cell culture. Individual sub-component (subcomponent) domains are synthesized by conventional means in organic chemistry or by recombinant cell culture. They are then labeled using known methods with a radioisotope or a detectable group such as an enzyme or fluorescence to encode the prepro or pro form of inhibin (including individual domains) or a precursor thereof. Used in immunoassays to detect the level of pre-pro or pro-form inhibin (including domain) in transformants having the DNA in question. This assay is useful to determine whether proteolytic hydrolysis of proinhibin is occurring in the host transformant or in its medium.
This assay also shows that the rate-limiting step in recombinant synthesis is
It is also useful to determine whether translation of the mRNA into the prepro form or processing of the prepro form to mature inhibin. For example, high levels of prepro or proinhibin in cell lysates and relatively low levels of secreted mature inhibin indicate that the host cell is properly transcribing and translating inhibin DNA. Suggests that the precursor is not being processed at a sufficient rate. Therefore, in this case, it is better to exclusively select a host cell other than the host cell for the purpose of improving the transcription efficiency and translation efficiency of the transforming plasmid,
This is done, for example, by selecting another promoter. Prodomain sequences appear to be involved in physiological co-regulation in the reproductive cycle and fertility of animals.

Amino acid sequence variants may (1) be hormonally active, (2) be capable of cross-reacting with mature inhibin or antibodies raised against the prodomain α or β chain sequence, or (3) A sequence capable of cross-reacting with the cell surface receptor for inhibin / activin and having a primary amino acid sequence starting from a natural inhibin or prodomain sequence. These derivatives are usually modified so that the DNA encoding the target DNA encodes a mutant,
It is prepared by inserting, deleting or replacing nucleotides and then expressing the DNA in recombinant cell culture. Polypeptides having up to about 100-150 residues can also be conveniently prepared by in vitro synthesis. Such variants are characterized by having a predetermined property change that is a characteristic that is different from naturally occurring allelic or interspecies variation. A variant may qualitatively exhibit the same biological activity as a naturally occurring analog, or may act antagonistically on such an analog.

Although the site for introducing a sequence change is predetermined, the mutation itself need not be predetermined.
For example, to properly perform a mutation at a residue at a particular position, random mutagenesis is performed on the target codon or region to express the expressed inhibin mutant for the appropriate combination of desired activity. Screen. Methods for inducing substitution mutations at predetermined sites in DNA having a known sequence are well known (eg, M13 primer mutagenesis).

[0035] Mutagenesis is usually carried out at about 1 amino acid residue.
The insertion is performed by insertion of about 10 to about 10 or deletion of about 1 to 30 residues. The deletion or insertion is preferably performed by adjacent pair, ie, deletion of 2 residues or insertion of 2 residues. The final assembly is performed by combining substitutions, deletions, insertions, or a combination thereof. Insertions also include amino or carboxy terminal fusions, for example, additional hydrophobic extension at the carboxy terminus. However,
Preferably, only substitution mutations are made. Mutations in the coding DNA must not cause the coding sequence to be located out of reading frame;
Hybridize, like loops and hairpins, mR
Clearly, it is preferable not to create complementary regions that could form the secondary structure of NA.

D encoding the polypeptide of the present invention
Not all mutations in NA are expressed in the final secretory product. For example, the major substitutional DNA mutants are characterized in that the unique porcine or human α or β chain secretory leader differs by either a deletion or substitution within the leader sequence. In which most or all of the unique leader sequence has been changed to a leader that is more readily recognized by the desired host. For example, to construct a prokaryotic expression vector, the porcine or human α or β chain secretion leader is deleted for a bacterial alkaline phosphatase leader or a thermostable enterotoxin II leader,
For the construction of yeast expression vectors, the leader is replaced with a yeast inverterase leader, α-factor leader or acid phosphatase leader. However, porcine and human secretory leaders are often heterogeneous (heterologous).
Is recognized by higher eukaryotic cells. When the secretory leader is "recognized" by the host, the fusion of the mature inhibin or prodomain and the leader polypeptide fused at the C-terminus is cleaved by the host's signal peptidase to secrete the mature inhibin or prodomain polypeptide. Can be done.

Another major DNA mutant that is not expressed as a final amino acid sequence derivative involves nucleotide substitutions to promote expression, which primarily involves adding 5 nucleotides to the transcribed mRNA. 'Avoid stem-and-loop formation [Dou Boa et al.
(de Boer) EP75,444A] or to provide codons that are more easily transcribed by the selected host (eg, to provide well-known codons that are convenient for expression by E. coli or yeast). is there. These substitutions may or may not encode the substituted amino acid, but preferably do not.

Amino acid sequence variants resulting from insertion and substitution may be those in which one or more amino acid residues have been introduced at predetermined positions in the target inhibin, activin, prodomain or proform inhibin or activin, The protein that has been removed from that location. Most commonly, the insertional variant is an α or β chain,
A fusion wherein a heterologous protein or polypeptide is fused to the amino or carboxy terminus of a prodomain or other inhibin derivative. An immunogenic derivative is obtained by fusing an immunogenic polypeptide to a target sequence, such as a prodomain polypeptide, by in vitro synthesis, or by recombinant cell culture transformed with DNA encoding the fusion. Prepared. Such an immunogenic polypeptide is preferably a bacterial polypeptide comprising trpLE, beta-galactosidase, etc. together with their immunogenic fragments. In addition, NH _{2 of the} protein to be secreted
Heterologous eukaryotic secretory signal upstream of terminal
(Eg, herpesvirus gD signal), or the insertion of a microbial secretion signal, or the insertion of a protease processing sequence. Deletion of an unstable residue such as cysteine is preferable because, for example, the oxidative stability of the α-chain or β-chain is enhanced. The deletion derivative is α
Will produce a chain fragment or a β chain fragment. Such fragments are also included within the scope of the present invention, provided that they are biologically or immunologically active.
For example, fragments comprising beta _B or beta _A residues from about 11 to 45 (according to the numbering from mature Gly1) are included in the present invention range.

Immunogenic Conjugates of Prodomain Polypeptides, Inhibin and Activin
Can be synthesized by recombinant cell culture as a fusion with an immunogenic polypeptide, such as a viral antigen, such as β-lactamase or herpes gD protein, or by synthesizing the polypeptide in an unfused form. (By recombinant or in vitro synthesis methods) followed by a covalent cross-reaction with an immunogenic polypeptide such as keyhole limpet hemocyanin or STI using a divalent cross-linking agent. Can be synthesized. The immunogenic polypeptide is formulated with a vaccine adjuvant, such as alum or Freund. Methods for preparing proteins in adjuvants and methods for cross-linking are well-known and used by those skilled in the art as vaccination methods for animals. Immunogenic conjugates are useful in producing antibodies against the prodomain region for use in monitoring in inhibin production, or elicit antibodies that can perform physiological regulation in the reproductive system or fertility of an animal. Useful in vivo in vaccination for Usually, various doses of the prodomain or its immunogen are administered to render experimental animals or pigs fertile to monitor the reproductive system and fertility of the animals and to detect the anti-immunogen or immunogen by routine competitive or sandwich immunoassays Assay serum levels of prodomain.

In the substituted derivative, a mutation is induced in the DNA of the target codon, and a different amino acid is encoded by the codon.
The numbers of the residues of the molecule expressed from A are not confused. Substitutions or deletions, for example, replace residues within or near the proteolytic site. Alternatively, it is useful for deleting the residue at that site, or replacing the cysteine with another residue and adding a disulfide bond to eliminate the proteolytic site and increase the stability of the protein of the present invention. is there. Substitutions are useful to facilitate maturation, or synthesis or recovery of the prodomain α or β chain. For example, mature methionine residue inhibin sequence substituted or deleted, deleted prepro sequences, inserts a methionine immediately next to the -1 site of the NH ₂ terminus of the mature NH ₂ terminal residue, other sequences At the N-terminal side of exogenous methionine. In this case, the inhibin derivative is expressed as a fusion with a methynyl residue in the middle, at which point the known means with cyanogen bromide is more cleaved. The mature inhibin derivative released from the fusion is then recovered.

Examples of butahibin derivatives include [Asn
₂₆₆ → Gln] _Inhα (to remove assumptions glycosylation sites), [Cys ₃₂₅ or _{Cys 324 → Δ] Inhα, [} Cys 361
Or Cys ₃₆₃ → Δ] Inhα, [Lys ₃₂₁ or Lys ₃₂₂ →
Δ] Inhβ _A or [Lys ₃₂₂ → His or Ser] Inhβ
_A (to inactivate potential proteolytic sites), [Lys
₃₁₅ → Arg; Val ₃₁₆ → Thr] Inh β _A (to produce a β _A / β _B hybrid), [Cys ₃₈₈ or Cys ₃₈₉ → Δ] In
hβ _A , [Lys ₄₁₁ → Gln] Inhβ _A , [Arg ₃₁₅ → Lys, Th
r ₃₁₆ → Val] Inhβ _B (to produce a β _B / β _A hybrid), [Cys ₃₁₉ or Cys ₃₂₀ → Δ] Inhβ _B [Pro ₃₈₁
Gly ₃₈₂ → Pro Phe Gly] Inhβ _B , and [Arg ₃₉₅
→ Gln] Inhβ _A [where Inh is an abbreviation for inhibin, and the residue numbers of Inhβ _B correspond to the numbers used for Inhβ _A (FIGS. 5, 6, 7 and 8)]].

The position of Etchibeta _A amino acids are the main candidates in performing mutational substitution or deletion (or adjacent amino residue insertion site), residues 293-297,364
-376, and 387-398 (FIGS. 19, 20, and 21). Preferably, the proline, cysteine and glycine residues in these sequences are not modified. A candidate having greater potency than inhibin or activin, or a candidate acting as an inhibin or activin antagonist, is diluted with a solution containing a certain amount of inhibin or activin, and the resulting composition The product is identified by subjecting it to a screening assay consisting of analysis by a rat pituitary cell assay. Measuring candidates that do not show or antagonize the effects of inhibin or activin on competitive immunoreplacement of a polyclonal antibody against the natural hormone with labeled inhibin or activin from the natural hormone. Screen for use in immunoassays to measure inhibin or activin. Examples of putative hβ _A mutant sequences include: Phe ₃₀₂ → Ile or Leu; Gln ₂₉₇ → Asp or Lys; Trp ₃₀₇ → Tyr or Phe; Trp ₃₁₀ → Tyr or Pyr
he; Ile ₃₁₁ → Phe or Val; Tyr ₃₁₇ → Trp or Th
r; His ₃₁₈ → Lys; Ala ₃₁₉ → Ser; Asn ₃₂₀ → Gln, Tyr
Or His; Tyr ₃₂₁ → Thr or Asp, Phe ₃₄₀ → Tyr
(TGF-β / β _A interchain hybrid); His ₃₅₃ → Asp;
His ₃₅₃ → Lys (β _A / β _B hybrid); Phe ₃₅₆ → Ty
r; Val ₃₆₄ → Phe; Val ₃₆₄ → Leu; Tyr ₃₇₅ → Thr; Tyr
₃₇₆ → Trp; Asn ₃₈₉ → Gln, His or Lys; Ile ₃₉₁ →
Leu or Thr; Met ₃₉₀ → Leu or Ser; Val ₃₉₂ → P
he, Glu, Thr or Ile are included. Comparable modifications are made to the human β _B chain. For example, hβ _A is residue 3
And containing phenylalanyl residue 02, the Etchibeta _B,
Arranged in a similar manner to that seen for pig β _B in FIG. 10, this is also a homologous position (position 264, FIG.
2, FIG. 23 and FIG. 24) contain a phenylalanyl residue. As described above, Phe ₃₀₂ of β _A is substituted with an isoleucinyl or leucinyl group, and Phe _{264 of} β _B is also substituted with the same residue.

One of the factors for identifying a polypeptide as an inhibin, activin or inhibin variant is that the antiserum, which can substantially neutralize the hormonal activity of mature inhibin or activin, has The hormonal activity can also be substantially neutralized. However, immunological identity and hormonal activity need not be within the same range. For example, a neutralizing antibody for inhibin may not bind to a candidate protein because the neutralizing antibody does not happen to specifically bind to a site critical for inhibin activity.
Rather, the antibody binds to harmless regions and may exhibit its neutralizing effect by steric hindrance. Thus, the candidate protein mutated in the harmless region no longer binds the neutralizing antibody, but nevertheless,
Inhibin in terms of substantially homology and biological activity.

Observing that properties such as molecular weight and isoelectric point for native or wild-type mature inhibin or activin obtained from tissue sources such as follicular fluid are described only for the native form is important.
Variants encompassed by the above definitions do not exhibit all of the properties of the natural homolog. For example, in inhibin derivatives such as the insertion mutants, deletion mutants or fusion proteins described above, for example, fusions with mature inhibin or proinhibin itself, as well as insertional mutants, are more naturally occurring than mature inhibin. Also have a higher molecular weight, indicating a molecular weight deviated from the established molecular weight for the corresponding native inhibin. On the other hand, deletion mutants of naturally occurring mature inhibin will have a lower molecular weight. Finally, the post-translational processing of preproinhibin chains in heterologous cell lines may not be as faithful as with homologous host cells, so that some mutations may occur at the amino termini of the α and / or β chains. . This mutation is either a residual prosequence in the mature protein, or
In some cases, several residues of the mature protein may be cleaved and lost along with the prosequence. The same is true for preprotein processing in heterologous recombinant cells.

Covalent modifications of inhibin, activin or prodomain are also included within the scope of the invention, including conjugates covalently or aggregated with other chemical moieties. Covalent derivatives are prepared by conjugation to functional moieties of the inhibin amino acid side chain or the group found at the N or C terminus in a manner known to those skilled in the art. For example, these derivatives include carboxy-terminal or O-acyl derivatives of hydroxyl-containing residues, such as aliphatic esters or amides of residues containing carboxy residues such as aspartyl residues, ceryl or alanyl, and amino-terminal amino acids. Or N-acyl derivatives of amino group-containing residues such as lysine and arginine. To form an acyl group, an alkyl moiety (C ₃ to
By forming alkanoyl species to choose from a group of straight-chain comprising alkyl) of C _10, also can be formed aroyl species choose carbocyclic or heterocyclic compound. It is known per se that reactive groups can be used to crosslink proteins through reactive side groups to form an insoluble matrix, such as, for example, m-maleimidobenzoyl-N-hydroxysuccinimide ester. Preferably, it is a bifunctional compound. A preferred derivatization site is a histidine residue.

The covalent or agglutinated derivatives of mature inhibin, activin or prodomain sequences are useful as reagents in immunoassays or for affinity purification. For example, the inhibin or prodomain can be covalently bound to cyanogen bromide-activated Sepharose in a manner known per se to render it insoluble, or adsorbed to a polyolefin surface (with or without glutaraldehyde cross-links) And used for analysis or purification of anti-inhibin antibodies or anti-prodomain antibodies, or cell surface receptors. Also, the inhibin or prodomain sequence is radioiodinated, for example, by the chloramine T method. Labeling, such as by covalent attachment to a rare earth chelate or by attachment to another fluorescent moiety, and performing a diagnostic assay, particularly a competitive immunoassay for inhibin or prodomain levels in biological specimens Used for

DNA encoding the complete α and β chains of inhibin / activin may be chemically synthesized or screened for mRNA reverse transcripts obtained from ovaries, or for screening genomic libraries from any cell. It is obtained by doing. Since DNA must be identified from cDNA or genomic libraries encoding α and β chains for screening, it is more efficient to simply synthesize the desired DNA portion. Also, according to the synthesis method, specific
Genes can be used in vectors containing (unique) restriction sites or otherwise containing restriction sites not present in the native sequence, and D
This is also an advantageous method, since it is possible to take steps to improve the translation efficiency as described above without having to further modify the NA. cD encoding α or β chain
NA does not contain lateral (flanking) DNA encoding non-translational intervening sequences (introns) as well as other proteins that are homologous to their source.

The DNAs encoding the α and β chains are:
(a) obtaining a cDNA library from the ovary of the target animal;
In order to detect clones containing homologous sequences in the DNA library, Southern analysis was carried out using labeled DNAs encoding porcine or human α and β chains or fragments thereof, and (c) The clones obtained were subjected to restriction enzyme analysis and nucleic acid sequencing to identify the full length of the clone, and if no full-length clone was present in the library, appropriate fragments were recovered from various clones. Can also be obtained from non-porcine or non-human sources by ligating at a common restriction site for the clone and assembling a clone encoding the full-length molecule. As shown below, the missing sequences in the library are:
CD identified by library screening
Ovarian synthetic oligodeoxynucleotide complementary to NA
It may be obtained by extending to the 3 'side of mRNA, or a homologous sequence may be obtained from known animal cDNA. This method is particularly useful for assembling pre- or preproinhibin sequences that facilitate processing of preproinhibin from the desired species to mature inhibin.

The porcine and human ovarian cDNA libraries are first labeled with oligonucleotides having a sequence based on the partial amino acid sequence determined by analyzing purified porcine inhibin (in the case of human cDNAs, Probe for DNA encoding inhibin using a cDNA probe). However, once the cDNAs encoding the human and porcine inhibins and the prodomain have been recorded, one of skill in the art, based on this described sequence, must ensure that the remaining human or porcine genes are obtained. Hybridizing probes can be readily prepared.

Nucleotide sequencing of the identified porcine and human cDNA clones revealed the structure of the precursor from the biosynthesis of both forms of inhibin. Interestingly, the two inhibin chains were not obtained from a single, processed precursor. Instead, these two strands are translated from separate mRNAs and subsequently assembled into double-stranded molecules by disulfide cross-linking.

FIG. 2, FIG. 3, FIG. 5, FIG. 6, FIG. 7, FIG. 8, FIG. 15, FIG. 16, FIG.
3 and FIG. 24 are diagrams showing DNAs encoding the polypeptide chains constituting the porcine and human preproinhibin and preproactivin. clearly,
The codons disclosed in these figures may be degenerate and still encode the same amino acid.
2, 3, 5, 6, 7, 8, 15, 1
6, The DNAs of FIGS. 19, 20, 21, 22, 23 and 24 are mutated to encode the amino acid variants of the α and β chains described above. In particular, in order to express the mature strand of interest directly in recombinant culture, the prepro sequence is deleted and an initiation codon is inserted 5 'adjacent to the sequence. This DNA is labeled, for example, with radioactive phosphorus, and
DNA used to screen a cDNA library and encodes other species, as described generally above.
Can identify the α or β chain.

The covalent labeling of the DNA is carried out in a manner known per se using a detectable group such as a fluorescent group, a radioactive atom or a chemiluminescent group. Then
The labeled DNA is used for usual hybridization analysis (assay). Such assays are used for in vitro diagnostics, such as to identify vectors and transformants, or to detect mRNA in tissue samples, as described in the Examples below.

Long sequences are desirably synthesized in host cells transformed with vectors containing, for example, DNA encoding the inhibin or prodomain sequences. Vectors are used to prepare large amounts of DNA for subsequent processing (cloning vectors), or to express these chains (expression vectors),
It is used to amplify the DNA encoding the strand. An expression vector is a replicable DNA construct in which DNAs encoding the α or β chains are operably linked to appropriate control sequences that can affect their expression in a suitable host. Cloning vectors need not contain expression control sequences. In general, the control sequence includes a transcription promoter, an optional operator sequence for controlling transcription, and a sequence encoding an appropriate mRNA ribosome binding site.
(For prokaryotic expression), and sequences to control transcription and translation termination. The vector is
It must contain a selection gene in order to stably express the desired polypeptide and / or facilitate the selection of transformants. However, the selection gene for maintaining the expression of the α and / or β chains can be supplied from another vector by a co-transformation method using a eukaryotic host cell.

Vectors include plasmids, viruses (including phages), and integratable DNA fragments.
(Ie, those that can be integrated into the genome of the host by recombination). The vectors described herein for use in eukaryotic expression of α and / or β chains contain a plasmid sequence for cloning in a microorganism, in which the plasmid is It replicates autonomously independently of the host genome, but is thought to integrate the DNA into the genome of eukaryotic host cells upon transformation. Also useful are bacillus vectors, which can be integrated into the genome by homologous recombination in bacteria. However, other forms of vectors having other equivalent functions, now known or which will be known in the future, can also be used in the present invention.

Suitable vectors generally contain a replicon (origin of replication, in the case of non-integrative vectors) and control sequences derived from a species compatible with the intended expression host. A transformed host cell is
DN encoding inhibin α and / or β chains
A cell transformed or transfected with a vector containing A. The transformed host cells contain the cloned DNA and, when transformed with an expression vector, express the α and / or β chains.
The expressed polypeptide may be selected from the host cell of choice, as well as the appropriate processing signals in the expressed protein.
(Homologous or heterologous signal sequences), depending on the presence of the protein or is secreted into the periplasmic space.

DNA regions are operably linked when they are functionally related to each other.
y linked). For example, DNA for a presequence or secretory leader is operably linked to DNA for the polypeptide if it is expressed as a preprotein that contributes to the secretion of the polypeptide; Operably linked to the coding sequence if it controls transcription of the coding sequence; the ribosome binding site is located at a position that allows translation of the coding sequence to which it is attached. If present, it is operably linked to the coding sequence. Generally, operably linked means that the DNAs being linked are contiguous (contiguous) and, in the case of a secretory leader sequence, contiguous and within a decoding phase Means that.

Suitable host cells are prokaryotic cells, yeast cells or higher eukaryotic cells. Prokaryotes include gram negative or gram positive microorganisms, such as E. coli and Bacillus (Bacilli). Higher eukaryotic cells include established (established) cell lines of mammalian origin, as described below. A preferred host cell is E. coli 294 (ATCC 31,446), but other prokaryotes, such as E. coli B, E. coli X1776 (ATCC 3
1,537), Escherichia coli 294 (ATCC 31,446), Escherichia coli W3110 (ATCC 27,325), Pseudomonas sp.

In general, expression vectors for host cells include an origin of replication (the origin of replication when extrachromosomal amplification is desired, as in cloning, is of bacterial origin).
A promoter located upstream of the inhibin coding region, with a ribosome binding site (a ribosome binding sequence or Shine-Dalgarno sequence is only required for prokaryotic expression), an RNA splice site (inhibin DNA A genomic DNA containing one or more introns), a polyadenylation site,
As well as a transcription termination sequence. One of skill in the art will recognize that certain of the above sequences are not required for expression in certain hosts. In the case of an expression vector used for a microorganism, an origin of replication that can be recognized by a desired host, a promoter that can function in the host, and a phenotypic selectable gene (e.g., encoding a protein that confers antibiotic resistance) Only genes or genes that encode proteins that meet the requirements of autotrophic organisms are required.Inhibin DNA is usually obtained from plasmid pBR322 [Bolivar] obtained from E. coli species.
var) et al., 1977, "Gene (Gene)" 2: is cloned in E. coli using 95. pBR322 contains genes for ampicillin and tetracycline resistance, which provide a means to easily identify transformed cells.

Expression vectors, unlike cloning vectors, must contain a promoter that can be recognized by the host organism. This generally means that the promoter is homologous to the desired host. The most commonly used promoters for recombinant DNA constructs include the β-lactamase (penicillinase) and lactose promoter systems ([Chan
g) et al., 1978 “Nature”, 275 : 615; and Goeddel et al., 1979 “Nature” 2
81 : 544], tryptophan (trp) promoter system
[Goeddel et al., 1980, "Nucleic Acids Res." 8 : 4.
057 and EPO Application Publication No. 36,776] and ta
c promoter [H. Doe Boel) H. De Boer) et al.
"Proceedings of the National Academy of Sciences (Proc. Nat'l. Acad.
Sci) U.S.A. " 80 : 21-25 (1983)]. These are the most commonly used, but other known microbial promoters may be used. Publicly available,
They can be ligated functionally with the DNA encoding the inhibin in a plasmid vector [Siebenlist et al., 1980, "Cells".
(Cell) " 20 : 269]. Promoters used in prokaryotic expression systems must also contain a Shine-Dalgarno (SD) sequence operably linked to inhibin.
(SD is positioned to facilitate translation). This generally means that the promoter and S. aureus are located upstream of the second codon of the bacterial structural gene. D. Sequences, meaning that they have been substituted for the sequence of preproinhibin on the 5 'side of the mature α and / or β chains.

In addition to prokaryotes, eukaryotes such as yeast cultures
Live microorganisms can also be transformed with inhibin-encoding vectors.
Can be done. Among the lower eukaryotic host microorganisms,
Saccharomyces cereviciae or
Ordinary baker's yeast is most commonly used. But that
Many other strains are commonly available and can be used in the present invention. yeast
Vectors are usually cloned from a 2 micron yeast plasmid.
Origin or autonomously replicating sequence (ARS), promoter,
DNA encoding α and / or β chains;
Sequences for liadenylation and termination of transcription, and selection
Contains alternative gene sequences. Suitable for expression in yeast
The plasmid is YR_p7[Stinchcom
b) et al., 1979, "Nature"282: 39: King
Kingsman et al., 1979, "Gene".7: 14
1: Tschemper et al., 1980, "Gene"
10: 157]. This plasmid already contains the trp1 gene.
The gene is a mutant strain of yeast, such as
ATCC No. 44076 or PEP4-1 [Jaw
Jones, 1977, "Genetex" 85: 1
2] must have the ability to grow in tryptophan
The selection marker. This yeast host cell genome
Transformants are tryptophan because they have trp1 disorder
Growth in the absence of E. coli is effective in detecting transformants
A fruitful environment can be obtained.

Suitable promoter sequences for yeast vectors include promoters for: metallothionein, 3-phosphoglycerate kinase [Hitzeman et al.
980 "Journal of Biological Chemistry" 255 : 2073] or enolase, glyceraldehyde-3-phosphate dehydrogenase,
Hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase,
Other glycolytic enzymes such as pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, glucokinase [Hess et al., 1968, "
Journal of Advances in Enzyme Reg. " 7 : 149: and Holland et al., 1978," Biochemistry " 17 : 4900]. Suitable vectors and promoters for expression are R. hitzman
(R. Hitzeman) et al. In EP 73,657A.

Other yeast promoters that also have the advantage that transcription is controlled by growth conditions include alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, a reducing enzyme associated with nitrogen metabolism, the above-mentioned metallothionein, and glycerol. Aldehyde-3-
Promoter regions for phosphate dehydrogenase and enzymes conferring maltose and lactose utilization are included. To construct an appropriate expression plasmid, the termination sequences associated with these genes are ligated 3 'to the inhibin or derivative coding sequence in the expression vector to provide for termination and polyadenylation of the mRNA.

In cell cultures from multicellular organisms, expression of the hormonally active inhibin or activin only occurs in such cells, and microbial expression indicates that most of the immunological cross-reactivity is expressed. As it is conceivable, it is a preferred host in the present invention. In principle, whether in vertebrate or invertebrate culture,
Any higher eukaryotic cell culture can be used. recently,
Propagating such cells in cell culture is a routine procedure [tissue culture (Tissue
Culture) Academic Press, edited by Krus and Patterson, (1973)].

Suitable host cells for expressing the α or β chains in higher eukaryotes include: S
Monkey kidney CVI line transformed with V40 (COS-
7, ATCC CRL 1651); Baby hamster kidney cells (BHK, ATCC CRL10); Chinese hamster ovary cells-DHFR [Uraub (Urlau
b) and Chassin, PNAS (USA) 7
7 4216 (1980)]; mouse Sertoli cells [T
M4, Mother, J.M. P. Biol. Reprod. 23 : 243-251 (198).
0)]; monkey kidney cells (CVI ATCC CCL70); African green monkey kidney cells (VERO-76, ATCC
CRL-1587); human cervical cancer cells (HELA, A
TCC CCL2); canine kidney cells (MDCK, ATCC
CCL34); Buffalo rat kidney cells (BRL 3
A, ATCC CRL1442); human lung cells (W13
8, ATCC CCL75); human hepatocytes (HepG2H
B8065); mouse mammary tumor (MMT060652, AT
CC CCL51); rat liver tumor cells [HTC, M1,
54, Bauman et al., Journal of Cellular Biology (J. Cell. Biol.) 85 : 1-8.
(1980)]; and TRI cells [Mother J. et al. P. Anals N. et al. Y. Annals NY Aca
d. Sci. ) 383 : 44-68 (1982)].

[0065] Transcriptional and translational control sequences for expression vectors used in vertebrate cells are preferably supplied from viral sources. For example, commonly used promoters are polyoma, adenovirus 2, and most preferably simian virus 40 (SV
40). The early (early) and late promoters are particularly useful because both are readily obtained from the SV40 virus as a fragment that also contains the replication origin of the virus [Fiers et al., 19
78, "Nature" 273 : 113], also using smaller or larger fragments of SV40, as long as they contain an approximately 250 bp sequence from the HindIII site to the BglI site present within the viral origin of replication. Can be. In addition, genomic promoters, control and / or signal sequences naturally associated with the α or β chains can also be used, provided that such control sequences are compatible with the host cell,
It is also often preferred.

The origin of replication may be, for example, SV40 or other viral sources (eg, polyoma, adenovirus, V
(SV, BPV, etc.) by assembling the vector to include an exogenous source such as an origin of replication derived from the host cell, or by the chromosome replication machinery of the host cell. If the vector integrates into the host cell chromosome, often
The latter mechanism is sufficient.

DNA encoding a selectable marker without using a vector containing a viral origin of replication
Mammalian cells can also be transformed by a co-transformation method using the DNA encoding α and / or β chain. Examples of suitable selectable markers include dihydrofolate reductase (DHEFR) or thymizin
e) Kinases can be mentioned. Such markers are proteins and are generally transformed cells (i.e., cells that are adapted to take up exogenous DNA).
Is an enzyme that allows the identification of Usually, the identification is that the transformants can survive in a medium that is toxic to the cells, or a medium in which the cells cannot obtain essential nutrients, unless the cells have taken up the marker protein.
It is based on that.

In selecting a mammalian host cell suitable for transfection with a vector containing DNA sequences encoding both inhibin and DHFR, it is appropriate to select a host according to the type of DHFR protein used. is there. When using a wild-type DHFR protein, it is preferable to select a DHFR-deficient host cell, so that it is an essential nutrient that cannot be used in the absence of DHFR. DH as a marker for selecting successful transfection in ^- Pipo xanthine, selective medium lacking glycine, and thymidine (hgt)
FR coding sequences can be used. In this case, the preferred host cell is the Chinese hamster ovary (CHO) cell line that lacks DHFR activity, which is described in Urlaub and Chasin [198.
0, "Proceedings of the National Akademyi of Science Is" (USA) 77: 42
16] and grown.

DNA encoding DHFR protein with low binding affinity for methotrexate (MTX)
When is used as a control sequence, it is not necessary to use DHFR-resistant cells. Since the mutant DHFR is MTX resistant, a medium containing MTX can be used as a means of selection if the host cells themselves are MTX sensitive. The majority of eukaryotic cells capable of absorbing MTX appear to be methotrexate sensitive. Such useful cell lines are CHO-based, CHOKI (ATC
C No. CCL61). Transformants are first selected for neomycin resistance (transfection is performed with the DNA encoding the neomycin resistance conferring gene), and then MTX amplification of α and / or β chain expression is selected as appropriate. Preferably
[Kim et al., "Cell" 42 : 129-138.
(1985) and EP 160,457A].

Other preferred methods for application to the synthesis of α and / or β chains in recombinant vertebrate cell cultures include MJ. Getthing et al., "Nature" 2
93 : 620-625 (1981); Manti
i) et al., "Nature" 281 : 40-46; Levinson et al., EP 117,060A and 11
7,058A and the like.

In recombinant cell culture, the inhibin α-chain
It is expressed together with or separately from any of the β-chain molecules. Similarly, host cells are transformed with DNA encoding either or both of the mature β chains. Based on their similarity to TGF-β, upon expression in recombinant culture, the mature β-chain can form a homodimer or β _A / β _B heterodimer. These structures are not inhibins and therefore
It is referred to herein as β-chain dimer or activin. These are useful as a source of β-chain in the production of active inhibin, or gel electrophoresis for detecting the conversion of β-chain synthesized by α- and β-chain simultaneous conversion into β-chain dimer. It can be used as a standard in electrophoresis. This is not a hypothetical problem, as seen in Example 4. Of course, as mentioned above, dimers are also useful in regulating reproduction.

The β-chain heterodimer or homodimer denatures (unfolds) individual chains in vitro.
After that, it is separated by oxidative disulfide bond with the α-chain according to a generally known method. However, for the preparation of mature inhibin, it is preferred to transform and transform a recombinant host with DNA encoding both the α and β chains. As a result, since the hormone-active molecule is directly bound in the living body of the host cell, it is not necessary to bond the two chains by in vitro treatment. α and β
Preferably, the strands are located in the same vector, under the control of the same promoter, but this is not required.

Certain β-chain amino acid sequence variants identified in the screen do not bind to the pituitary cell surface receptor or consequently do not exhibit hormonal activity. When such mutants are expressed as homodimers in recombinant cell culture, they are useful in activin immunoassays if they have immunological epitopes that are cross-reactive with the native beta chain. . In addition, such variants are co-expressed with DNA encoding a hormonally active β chain, resulting in a hybrid containing a unique β chain and a mutant β chain. In this case, the mutant acts to stabilize the structure of the unique β chain. This form of the β-chain heterodimer, like the homodimer, is useful in activin immunoassays. It can also function as an activin antagonist.

Further, in order to produce a β-chain / TGF-β hybrid, activin / inhibin β-chain was
Coexpressed with β. Vectors expressing TGF-β and methods for expressing them are known [for example, Derink et al.
(Derynck), human transforming growth factor-β complementary DNA sequence, and expression in normal and transformed cells (Human
Transforming Growth Factor-β Compoundmentar
y DNA Sequence and Expression in Normal
and Transformed Cells) "Nature" 316 :
701-705 (1985)]. Delink (Derynck)
As described, co-transformation of mammalian cells with a vector carrying the TGF-β gene, together with the activin / inhibin β _A or β _B chains,
The chain / TGF-β hybrid dimer will be secreted at some rate. This hybrid is useful for preparing or immunoassaying TGF-β / β chain immunogens.

The inhibin, activin or prodomain sequence is recovered from the transformed cells by a method known per se. If the polypeptide is expressed as a refractor in recombinant bacteria, the desired polypeptide is recovered and the desired polypeptide is regenerated as usual. Alternatively, transformed cells secreting activin or inhibin,
The supernatant is separated from the cells, preferably by simply centrifuging the cell culture of the mammalian cells. Then, generally, heparin-Sepharose affinity chromatography,
Gel filtration, and at least one (preferably several)
Inhibin is purified by a continuous purification method including a RP-HPLC (reverse phase high performance liquid chromatography) step under various conditions in a stationary phase and / or a mobile phase. Prodomain sequences produced by in vitro synthesis are purified as usual.

[0076] Preferred prodomain polypeptides for use in the present invention are recovered from the culture of the transformed recombinant cells so as to synthesize the appropriate α and / or β chains for the desired prodomain. In particular, their recovery involves first separating the culture medium polypeptide on a unique electrophoresis gel, cutting out the band of the expected molecular weight, and further purifying the eluted polypeptide, for example by FPLC or HPLC, The upper homogenous isolated polypeptide is recovered by subjecting it to amino acid sequencing. Next, using the purified (purified) pro-domain polypeptide to produce an antibody in, for example, a rabbit, and using it for immunoaffinity purification, recovery of the pro-domain will be simplified.

To purify the isolated porcine hormonally active inhibin, the clarified culture supernatant or cell lysate is first purified by heparin-Sepharose affinity chromatography and then by Sephacryl S-200. Gel filtration through a gel followed by four successive RP-HPLC runs using various mobile phase gradients and / or derivatized silica gel supports is preferred. Preferably, a relatively less hydrophobic stationary phase is preferably carried out in the C ₃ -C ₈ column, C ₃ -C ₅
Therefore, it is particularly preferable to use a phenyl column.
The solute specificity of the mobile phase can be appropriately adjusted by changing the concentration of the organic component, particularly acetonitrile. One RP-
Although the HPLC fractionation is considerably higher in purity than the gel filtration material, RP-HPLC purification is usually performed two or more times, preferably four times, after continuous treatment by heparin-Sepharose chromatography and gel filtration. . It has been found that this method is equally applicable to the purification of human inhibin from recombinant cell culture.

The first step of the purification is heparin-Sepharose affinity chromatography, in which the protein is adsorbed to the Sepharose-bound heparin moiety under the conditions applied, and the adsorbed inhibin is eluted with 1M NaCl. I do. At this stage,
At this stage, the crude extract purification process is greatly accelerated, since it is possible to process a considerably large amount of the crude extract fairly quickly and to recover a large amount of protein whose total inhibin activity is at least equal to 90% of the crude extract. Is done.

In order to detect inhibin activity in various column fractions, about 0.01% to 0.1% in a volume ratio was collected, and human serum albumin 100 in 100 μl of water was collected.
After adding μg, the solvent was distilled off in a Speed-Vac concentrator (concentrator) [Savant, Hicksville, NY]. The residue was treated with 3 ml of HDM
Redissolve in 1% fetal calf serum in EM and mix with Millex
ex) -GS 0.22 μm filter [Millipore
e) Corporation, Bedford, MA], replicated and analyzed. In order to speed up the bioassay in the purification process, F
Only the basal inhibition of SH secretion was measured and the area of the chromatogram where the inhibin protein was expected to migrate was plotted.

To perform the heparin-Sepharose affinity chromatography, the cell debris was collected on a Beckman J2-21 centrifuge (Beckman Instruments Inc., Palo Alto, Calif.).
The mixture was sedimented by centrifugation at 10,000 rpm for 30 minutes using an A20 rotor. In an Ehrenmeyer flask, 0.01 M of Tris HCl (pH 7) containing 0.1 M of NaCl was added to 1/2 of the supernatant, and diluted to 10 times the original volume.
Rabbit 4 channel peristaltic pump [Rainin Instrument Co. In
c. Emeryville, CA] by Heparin-Sepharose [Pharmacia Fine Chemicals
Fine Chemicals), Piscataway, N.M. J. ] Into a column (3.5 x 9 cm) at a rate of 40 ml / h per column, a Silastic tube (0.76 m
(mID). After all the liquid has been pumped into the heparin-Sepharose column, 8
All of the columns were simultaneously washed in the same manner with 0.01 M Tris HCl, pH 7, containing 0.1 M NaCl. The adsorbed protein having inhibin activity was removed by simultaneously washing the eight columns with 0.01 M Tris HCl (pH 7) containing 1 M NaCl as described above, and the washings were collected in fractions. Inhibin activity was monitored by an in vitro bioassay as described above. For purification of the remaining extract, the column was regenerated by washing with 2M NaCl in 0.01M Tris HCl (pH 7) and 0.01M Tris H containing 0.1M NaCl.
Equilibrated again with Cl.

Next, the obtained substance is fractionated by gel filtration, and proteins are usually separated according to the molecular weight. The fractions with inhibin activity extracted by the heparin-Sepharose column were pooled and the molecular weight (Mr) cutoff was 3,3.
Spectrapor No. 500 of a cylinder (diameter 28.6 mm). 3 Membrane tubing [Spectrum Medical Industries (Spe
dialysis against 30% acetic acid in ctrum Medical Industries, Inc., Los Angeles, Calif. overnight to remove NaCl. As described above, the retentate was centrifuged to remove a white precipitate, and the supernatant was subjected to a 5 × 100 cm Sephacryl S-200 fine (Superfine) column [Pharmacia Fine Chemicals].
(Pharmacia Fine Chemicals) Piscataway,
N. J. Divide into equal portions to apply to]. Each column is eluted with 20 ml of 30% acetic acid for 22 minutes and the fractions from the column are monitored by UV absorption at 280 nm and bioassay.

The bioassay positive proteins from the S-200 column are pooled and lyophilized. This freeze-dried product was dissolved in 0.2N acetic acid (1 ml / ml) and
HA (Millex-HA) 0.45 μm filter [Millipore
(Millipore) Corp. , Bedford, MA]. The filtrate was applied to a 1 × 25 cm Vydac 5 μm particle size C4 column [The Separations Group.
He Seperias Group Hesperi
a), apply directly to CA] and develop with a gradient of TEAP buffer. In the TEAP system, buffer A consists of 0.25N triethylammonium phosphate (pH 3) and buffer B consists of 80% acetonitrile in buffer A. After applying all filtrate, UV
Wash column with aqueous buffer A until absorption reaches baseline. Fractions showing inhibin activity were analyzed with a Spectroflow 757 UV detector [Kratos Analytical Instruments (Kratos Analytical Instruments).
Instruments), Ramsey, N.W. J. ], Soltec (S
oltec) 220 recorder [Soltec Corp. Sun Valley, CA] and Redirac 2112
Fraction collector [LKB Instruments I
nc. , Gathersburg, MD] with Beckman 2
32 Gradient Liquid Chromatography System [Beckman Instruments Inc.
c. Berkeley, CA]. Zones showing inhibin activity are detected by bioassay.

If desired, a further two-step RP-HPLC
By performing, purified inhibin protein comprising beta _B chains, obtained inhibin containing no beta _A species. The first stage uses a 1 × 25 cm Vydac 5 μm-particle size C4 column and trifluoroacetic acid (TFA) buffer,
The second stage uses a 1 × 25 cm Vydac 5 μm particle size phenyl column and TEAP buffer system. TF
In system A, buffer A contains 1 ml of trifluoroacetic acid in 999 ml of water and buffer B contains 1 ml of trifluoroacetic acid in 199 ml of water and 800 ml of acetonitrile. The two inhibin species are eluted separately. 0.4 of accumulated inhibin from several batches
6 × 25cm Aquapore RF-300 1
Concentration was performed by RP-HPLC using a 0 μm particle size column [Brownlee Labs, Santa Clara, Calif.] And a TFA buffer system. However, DNs that normally encode only the β _A or β _B chains
About the cell culture supernatant obtained from the transformant by A,
This purification step is not used.

The inhibin, activin, prodomain sequence or variants thereof may be pharmaceutically acceptable non-toxic salts, such as acid addition salts, metal complexes,
For example, it is administered in the form of zinc, iron, and the like, which are also considered salts for the purposes of the present invention. Examples of such acid addition salts include hydrochloride, hydrobromide, sulfate,
Examples include phosphate, maleate, acetate, citrate, benzoate, succinate, malate, ascorbate, and tartrate. It is suitable for intravenous administration as a solution such as isotonic saline or phosphate buffer.

[0085] The polypeptides of the present invention should be administered under the guidance of a physician, and usually include in a pharmaceutical composition an effective amount of the peptide and a conventional, pharmaceutically acceptable carrier. ing. Dosage will vary depending on the particular purpose of the administration of the protein; dose levels for regular administration of inhibin for male sterility range from about 0.1 to about 1 m.
g / kg (body weight).

Inhibin, activin, prodomain sequences and their derivatives are implantable (implantable)
Alternatively, it may be desirable to administer the drug from a sustained release product that can adhere to the skin. Suitable systems include, for example, copolymers of L-glutamic acid and gamma-ethyl-L-glutamate [U. Sidman et al., 1983, "Biopolymers" 22 (1): 547-556]. ,
Poly (2-hydroxyethyl-methacrylate) [R. Langer et al., 1981, "J. Biomed. Mater. Res." 15 :
167-277 and R.I. Langer et al., 1982,
"Chem. Tech." 12 : 98-10.
5], ethylene vinyl acetate (R. Langer et al., Supra), or poly-D-(-)-3-hydroxybutyric acid (E
P133,988A). Such products are used for implantation under the skin or in contact with the skin or mucous membranes.

For ease of description of the examples, frequently used methods are abbreviated as short jargon. Plasmids are represented by a lower case p preceded and / or followed by capital letters and / or numbers. The starting plasmids of the present invention are either commercially available or generally available from non-restricted facilities, or can be assembled from plasmids or DNA thus obtained according to known methods. In addition, other equivalent plasmids are known to those of skill in the art and will be apparent to one of ordinary skill in the art.

“Digestion” of DNA refers to the process of removing DNA from the DN.
Refers to catalytic cleavage with an enzyme that acts only at a certain position of A. Such an enzyme is called a restriction enzyme, and a site specific to the enzyme is called a restriction site (site).
A "partial" digestion is an incomplete digestion by restriction enzymes that is performed under conditions that cleave some, but not all, portions of the DNA substrate for a particular endonuclease. The various restriction enzymes used in the present invention are commercially available, and their reaction conditions, cofactors, and other requirements were used according to the instructions of the enzyme supplier. Restriction enzymes are represented by a capital letter indicating the microorganism from which each restriction enzyme was first obtained, followed by other letters, and usually abbreviated numbers. Generally, unless otherwise specified, about 1 μg of plasmid or DNA fragment is used with about 1 unit of enzyme in about 20 μl of buffer. Appropriate buffers and substrate amounts for particular enzymes are specified by the manufacturer. Usually, the incubation time is 1 hour at 37 ° C., but may be varied according to the supplier's instructions. After incubation, proteins are extracted with phenol and chloroform and the digested nucleic acids are recovered from the aqueous fraction by ethanol precipitation. Occasionally, after restriction enzyme digestion, the two restriction cleavage ends of the DNA fragment "circulate" or form a closed loop, making it difficult for other DNA fragments to be inserted into the restriction site. In order to prevent
The phosphate at the 5 'end may be hydrolyzed with bacterial alkaline phosphatase. Unless otherwise indicated, digestion of plasmids does not involve dephosphorylation of the 5 'end. Dephosphorylation methods and reagents follow standard methods
[T. T. Maniatis et al., 1982, Molecular Cloning pp. 1
33-134].

DN obtained by digestion with restriction enzymes
"Recovery" or "isolation" of the A fragment refers to the separation of this digest by polyacrylamide gel electrophoresis,
This means that the desired fragment is identified by comparing the mobility of the fragment with that of a marker DNA fragment of known molecular weight, the portion containing the fragment is removed, and the DNA is separated from the gel. This method is generally known. For example, R. R. Lawn et al., 198
1. “Nucleic Acids Research” 9 : 6103
-6114 and D.I. D. Goeddel et al., 19
80 “Nucleic Acids Research” 8 : 405
See FIG.

"Southern analysis" refers to DNA in digestion
Determining the presence of the DNA sequence in the sequence or DNA-containing composition.
This is a method of confirming by hybridization with a known, labeled oligonucleotide or DNA fragment. In this specification, unless otherwise noted, the term “Southern analysis” refers to E. coli. The method of E. Southern [1975 "Journal of Molecular Biology (J. Mol. Biol.)" 98 : 503-51.
7], the digest is separated on 1% agarose, denatured and transferred onto nitrocellulose. Maniatis et al. [1978, "Cells" 15 : 687-70.
1].

"Transformation" refers to the introduction of DNA into an organism, and as a result, the DNA is replicated as an extrachromosomal component or integrated within a chromosome. Unless otherwise specified, the transformation method of Escherichia coli in the present invention is mandelic (Mandel) et al CaCl ₂ method (19
70, "Journal of Molecular Biology" 53 : 154).

"Ligation" refers to the process of forming a phosphodiester bond between two double-stranded nucleic acid fragments (T. Maniatis et al., Supra, p. 14).
6). Unless otherwise indicated, ligation uses known buffers and conditions, and approximately equimolar amounts of D to be ligated.
T ₄ DNA ligase per 0.5 μg of NA fragment
("Ligase") Performed using 10 units.

"Preparing" DNA from transformants means isolating plasmid DNA from microorganism culture. Unless otherwise specified, the alkaline / SDS method of Maniatis et al. (Ibid., P. 90) is employed.

"Oligonucleotides" are short single- or double-stranded polydeoxynucleotides that have been chemically synthesized by known methods and then purified on polyacrylamide gels.

The cited documents are all shown in the list of documents at the end for reference.

Hereinafter, the present invention will be described in detail with reference to examples.

Example 1 Cloned inhibin α-subunit cDNA
The identification of clones containing sequences encoding a subunit of isolated porcine inhibin, some prior examples [Anderson, etc. (Anderson et al.), Proceedings
Of National Academy of Sciences
(Proc. Nat. Acad. Sci. USA), 80 : 6836.
-6842 (1983) and Ullrich et al.
l.), Nature, 309 : 418-425.
(1984)] based on the method using a "long probe". Briefly, c-produced at λgt10 and using oligo-dT as primer
A highly complex cDNA library, obtained from porcine ovarian mRNA by DNA synthesis,
-Screened with single-stranded synthetic oligodeoxynucleotides of 64 bases in length directed to the N-terminal amino acid sequence of the strand. It was found that the library should be prepared from fresh ovarian tissue because the mRNA of the inhibin chain is clearly unstable. Approximately 1 in 2000 plaques crossed with this probe, and several hybridized cloned cDNAs were sequenced to confirm correct probe identification. This analysis revealed that not all of the characterized cDNAs contained sufficient sequence information to predict the complete structure of the α-chain precursor protein. Instead of analyzing more clones from the same cDNA library, 3 'on the ovarian mRNA of a synthetic oligonucleotide complementary to the sequenced region encoding α-precursor residues 60-64 (Figure 1). A second library was created by side extension. This library was screened with appropriate restriction fragments from previously analyzed cDNAs, resulting in several isolates specifying the rest of the DNA sequence encoding the N-terminal region of the α-precursor. . The integrity of this coding sequence was determined using porcine α-
The chain peptide sequence was designated and determined by the presence of a long reading frame beginning with a methionine codon (preceded by an in-frame stop codon followed by a hydrophobic sequence with the characteristics of a signal peptide). The complete sequences of this precursor protein and its cDNA are shown in FIGS. The complete protein containing the signal peptide consists of 364 amino acids and has an M of ４０40K.
r values, of which 134 at the C-terminal side (Mr ~ 14.5
K) constitutes the porcine inhibin α-chain. There are several Arg-Arg sequences in the pro region of the precursor, one of which is directly in front of the α-subunit. We believe that the latter pair of base residues is the processing site for proteolytic α-peptide release.
With this putative precursor sequence, two N-linked glycosylation sites are predicted, one of which is predicted to be within the alpha chain proper.

In addition to the coding region, this cDNA sequence
A 3'-untranslated sequence of 67 nucleotides (containing the canonical AATAAA polyadenylation signal), and a 5'-untranslated region (the exact length of this region is currently unknown).

The details of this method are as follows. Polyadenylated mRNA was prepared from freshly frozen porcine ovaries [Kaplan et al., Journal of Biochemistry (J. Bioche).
m. ), 183 : 181-184]. The Eco RI adapter used is the sequence:

Embedded image Except that it has 5′-AATTCACTCGAGACGC-3 ′ 3′-GTGAGCTCTGCG-5′P, Wood et al.
l., Nature, 312 : 330-337 (1
984)], the oligo-dT of × 6 × 10 ⁶ clones in λgt10 from 5 μg of poly A + mRNA.
Primer-treated cDNA library [Huin et al.
(Huynh et al.), DNA cloning Techniques, Clover (DC).
lover), 1984].

Approximately 1 × 10 ⁶ unamplified cDNA clones were isolated from 5α-subunit oligonucleotides based on the amino acid sequences underlined in FIGS.

Embedded image 5′-ACCGCCCCTTTGCTCTG
GCCTTGGTCCCCCTGCTGCTCTGAGA
Screening was performed with CTGCTGCAGAGACCTCCTGAGG-3 ′. Crosses were performed in 5 × SSC, 40% formamide at 37 ° C. using a phosphorylated ³² P-labeled probe. Approximately 500 clones with positive crosses were obtained, of which 12 were purified and tested for insert size. Five of these Eco RI
Total enlistment (λPIN-α2, -α5A, -α5, -α9,
-Α10) with an M13 derivative [Messing et a
l.), Nucleic Acids Research (Nucl. Acid)
s. Res. ), 9 : 309-321 (1981)] and cloned into Sanger et al. [Sanger et al., Proc. Nat.
Acad. Sci. USA, 74 : 5463-5467 (19
77)]. The specifically primed library was converted to poly A +
5 μg of mRNA to oligonucleotide:

Embedded image Primed with 5′-CCCCACAGCATGTCTT-3 ′ (complementary to nucleotides 248-263), then prepared by cloning into λgt10. About 2 × out of 1 × 10 ⁶ clones obtained
10 ⁵ clones were prepared from 5 ′ 1 prepared from λPIN-α2.
Screened with 00 bp Eco RI- Bam HI fragment. Twelve of the 170 clones positive for the obtained crosses were purified and two clones (λPIN-S
12s, -S4s) were sequenced by the dideoxy method. The complete nucleotide sequence of the α-subunit cDNA was obtained by subcloning various restriction fragments from different λ isolates into M13 phage derivatives. E. FIG. The compact was lysed by using a mixture of deoxyinosine in combination with a single-stranded binding protein of E. coli (Pharmacia).

The cloned inhibin β-subunit
Isolation of cDNA The cDNA sequence encoding the precursor of the inhibin β-subunit was obtained from the same cDNA library used for the α-subunit. Overlapping cDNA clones were first screened with a single, long synthetic oligodeoxynucleotide probe based on two N-terminal β-subunit sequences, and then
Act as a "walk" probe in both 5 'and 3' directions,
It was isolated by screening with the appropriate restriction fragment from the characterized cDNA clone (FIG. 4).

More specifically, about 2 × 10 ⁵ oligo-dT primer-treated ovarian cDNA clones were
5′-end labeled β _A oligonucleotide based on the amino acid sequence of residues 321 to 339:

Embedded image 5′-AAGAAGCAGTTCTTTTGT
GTCCTTCAAGGACATTGGCTGGAAT
Screened with GACTGGATCATGC-3 '. Those crossing is positive five obtained, three of which, beta _A coding sequence (RamudaPIN-
β _A 2, _{-β A} 4, proved to contain -β _A 8).
213 bp Eco RI-Pst from the 3 ′ end derived from λ PINβ _A 2
Using the fragment (nucleotides 1679-1892) and the 5 'end 154 bp Eco RI- Hind III (nucleotides 158-297), 2 × 10 ⁵ clones and 2 × 10 ⁵
10 ⁶ oligo-dT primer treated cDNA clones were screened. In addition to the 16 clones analyzed in detail, two were found to have a larger 5 'end.
_{(λPIN-β A 5S, -β} A 22), and one clone, λPIN-β _A 21 contained the entire 3'-untranslated region. The porcine inhibin β _B subunit cDNA clone was a 2 × 10 ⁵ clone from the specifically primed library, with the NH ₂ −
Based terminal sequence beta _B oligonucleotides:

Embedded image 5′-GGCCTGGAGTTGTGATGG
GAGAACCAACCTGTCCTGCCGCCAG
GAATTTTTTCATCGATTTCAGGCT-
Isolated by screening at 3 '. For clones that showed positive, additional oligonucleotides
Inosine probe:

Embedded image [Where I represents inosine in the sequence]
(This covers all possibilities in the non-coding strand for the amino acid sequence: QQFFIDF).

The two clones (λ PINβ _B -1S, -2
S) was isolated and sequenced and confirmed to encode the β _B subunit. 230bp of the Eco RI- Sma (nucleotides 21-251) fragment λPINβ _B -
I and used as a hybridization probe for 2 × 1
0 ⁶ oligo -dT primed cDNA clones were screened. Two positive ones were obtained
(λPINβ _B -3,4). The nucleotide sequence of these overlapping clones was used to generate the sequence shown. All sequences have specific fragments M13
It was obtained by subcloning into a phage vector [Messing etc., supra]. All the Eco RI restriction sites described above are contained in the cDNA adapter fragment and do not imply sequences present in the cDNA.

Very few clones from the oligo-dT primed library (4 out of 2 × 10 ⁵ )
We noticed that only one hybridized with the synthetic probe for the β-subunit of inhibin A. Most of these have been proven to be correct by DNA sequence analysis, but none contain a complete 3'-untranslated region as judged by the absence of a polyA homopolymer at its 3 'end. The absence of the tail of polyA indicated the presence of structural regions and / or extremely long 3'-untranslated sequences in this piece of mRNA indicating that it was difficult to replicate by the polymerase used for library construction. . A larger amount (up to 10-fold) of the inhibin β _A subunit coding sequence was unexpectedly generated by specifically priming the α-subunit
Found in the NA library. This library was screened with a synthetic probe for the β-chain of inhibin A, based on the later proven theory that the α precursor mRNA would also encode the β subunit. . The very large amount of inhibin β _A cDNA in this library was later added to the corresponding m
Traces were made to the accidental complementation of this specific α-chain primer to a region in the 3′-untranslated portion of the RNA.

In our library, a cloned cDNA encoding the β subunit of inhibin B
Only four NAs were found. Sequence information obtained from these clones did not reveal the complete structure of the corresponding precursor protein and its cDNA. The predicted protein structure and cDNA sequence of the precursor of the β subunit are compared in FIGS. 5, 6, 7 and 8. Inhibin β _A subunit cDN
The nucleotide sequence of A is 3.6 kb in length,
An open reading frame for a protein consisting of 425 amino acids (Mr-46K) [C-
The terminal 116 residues are the β subunit proper (Mr-13
K)]. This leading
The frame starts with methionine, followed by a sequence encoding a characteristic signal peptide, whose true length is 2
It is believed to be 9 residues. Preceding this encoded β subunit is a series of five arginines,
It is presumed that the protein is proteolytically cleaved from the precursor at this position. Like the α subunit precursor,
This β-precursor contains several additional base residue pairs, where it is believed that a previously unknown biologically active peptide substance is released. Also, the professional area (As
n, residue 165) contains one site capable of N-linked glycosylation.

This putative protein sequence of the β subunit of inhibin B shows a high degree of homology with the β _A subunit sequence. The 71 amino acid residues are identical and most changes are conservative.
To a lesser extent, sequence homology is also found in the pro regions of both β subunit precursors. Interestingly, although not extremely rich sequences purine rarely seen in coding regions, the inhibin beta _A is in the cDNA encoding the precursor present, encodes a homologous beta _B precursor It is an unusual amino acid sequence that is not found in a given cDNA. This means that when protein sequences are aligned for maximum homology, the inhibin β
_This results in a defect of 22 amino acid residues derived from the _B precursor. Also,
This alignment also creates a perfect match at the cysteine position of both precursors (FIGS. 5, 6, 7, and 8).
See).

Northern Component of α and β Chain Precursor mRNA
Analysis All and polyadenylated RNAs of the ovaries were analyzed by the Northern method using the sequenced cDNA as a probe to determine the β _B of the heterodimeric inhibin molecule.
And the size and relative abundance of mRNA encoding peptide subunits α and β were evaluated. Polyadenylated mRNA (2 μg: lanes a, b, c
And f; 8 μg: lane d) and total RNA (10 μg: lanes e and g) were electrophoresed on formaldehyde 1.2% agarose gel and plotted on nitrocellulose filters. The ³² P-labeled cDNA fragments listed below were used as hybridization probes under stringent conditions.
Lane a: 240 bp Eco from α subunit cDNA
RI- Sma I (nucleotides 134-371); b: 154 bp Eco RI- Hind I from β _A subunit cDNA
II (nucleotides 158-297); C: 230 bp Eco RI- Sma (nucleotides 21-251) from β _B subunit cDNA; d and e: Eco of λ PIN-α2
RI inserts; f and _{g: λPIN-β A 5 Eco} RI insert of. The filter was washed at 60 ° C. for 2 hours with 3 changes of 0.1 × SSC and 0.1% SDS.

As shown by the results obtained from the cDNA cloning, the analysis revealed that the α and β mRNAs were of different sizes and quantities.
(FIG. 9). From the intensity of each band, α precursor mRNA
Is the amount of at least 10 times or more compared with the mRNA of the beta _A precursor, and is estimated to be greater amount about 20 times or more compared with the mRNA of the beta _B precursor.

Using ribosomal RNA as a size standard, this single species, the α-precursor mRNA, is ~ 1500 nucleotides in length, which is of a size that closely matches the cloned cDNA sequence. (FIGS. 2 and 3). The β _A precursor mRNA sequence is represented by two major species, ~ 4.5 and ~ 7.2 kb in length. Total RNA
The higher intensities of both species in polyadenylated RNA as compared to, suggest that this 4.5 kb species is not representative of 28S RNA hybridizing to the cDNA probe. Therefore, the β precursor cDNA sequence shown in FIGS. 5, 6, 7 and 8 is considered to represent a 4.5 kb mRNA, and the 5 ′ untranslated region of the β _A mRNA contains about 90%.
Suggests 0 nucleotides in length. This β _B
The precursor is encoded by more than one mRNA, about 4.5 kb in size, and is present at about half the level of the two β _A mRNAs. Since the two β mRNAs are closely related, both mRNAs have the same structure, and thus the β _B mRNA is likely to have long 5 ′ and 3 ′ untranslated regions.
(same region as shown for β _A mRNA). Choosing different polyadenylation signals could explain the presence of the 7.2 kb species.

Homology with transforming growth factor-β The complete α and β inhibin subunits were 7
And 9 cysteine residues. Alignment of the cysteine residues reveals that the two subunits share a similar cysteine distribution and that some sequence homology exists around this residue (FIGS. 10 and 11). Yes, one subunit of both types
Suggest that they are derived from two precursor genes. Surprisingly, considerable homology was found between this β chain and the recently determined primary structure of human TGF-β. FIG.
0 and underlined in FIG. 11, both peptides are approximately equal in length (inhibin β _A subunit: 1
16; β _B subunit: 115; TGFS: 116 residues),
They show a strikingly similar distribution of their nine cysteine residues. Using this cysteine "scaffold" for permutation, the [beta] _A and TGF- [beta] sequences have 31 additional residues at the same position and show slight differences at nine homologous sites. The height of the same homology is seen in the comparison of beta _B and beta-TGF. Certain blanks have been introduced to better align (FIGS. 10 and 11). Although the overall homology is 35%, a certain portion (porcine inhibin β _A chain residues 11-45
And TGF residues 15-49), and its homology is extremely high considering species differences. Interestingly, this homology extends beyond the stop codon for protein synthesis in each cDNA.
Thus, the TGF-β cDNA and both inhibin β subunits contain extremely G and C rich sequences in this region, and they have unusually long 5 ′ and 3 ′ untranslated regions. .

Since there is almost absolute homology between human and murine β-TGF, the inhibin β-TGF
This suggestion that the subunit is the porcine equivalent of human TGF-β can be discounted. These findings strongly indicate that both the inhibin subunit and TGF-β have a common ancestor and belong to one gene family. All three peptides originate from similarly sized precursors (Mr-40K) (they are C
-Occupies about 110 terminal residues and is released by proteolytic cleavage at the arginine pair). They form homo- or heterodimers, and the subunits in the biologically active complex are linked by disulfide bridges.
However, the region containing the β subunit and unusual residues in front of the TGF peptide shows considerable, albeit limited, sequence relatedness, while TGF-β and β
There is little sequence homology between the subunits in the pro part of their precursors.

Example 2 Recombinant Synthesis of Porcine Inhibin The plasmid used for the recombinant synthesis of porcine inhibin was pS
A _{VE-P α B A Inh-} DHFR. The construction method of this plasmid is shown in FIGS. 12, 13 and 14, and was carried out as follows. pHBS348-E (EP0
0736656A) was partially digested with Eco RI. Coli D
The DNA was blunted with NA polymerase I (Klenow fragment) and four dNTPs, ligated, and the ligation mixture was added to E. coli. Coli 294 (ATTC31446) for transformation. The transformed culture was plated on ampicillin medium plates to select for resistant colonies. Plasmids were screened for deletion of the Eco RI site in front of the SV40 early promoter. The plasmid having this deletion site was called pHBS348-EI.
Called I.

The pHBS348-EII was replaced with EcoRI and
After digestion with Eco RI, two fragments, SV
40 early promoter, pmL-Amp ^r sequence and HBsA
fragment I containing the g3 'untranslated region, and H
Fragment 2 containing the BsAg (hepatitis B antigen) coding sequence was obtained.

The λPINβ _A 5s containing the coding region for the porcine inhibin β _A subunit was transformed with EcoRI and Sma.
Was digested with I, it was recovered fragment 1335bp containing beta _A coding region (Fragment 3) polyacrylamide gel electrophoresis. Fragment I collected by agarose gel electrophoresis was ligated to Fragment 3,
This ligation mixture is Coli strain 294 (ATC
C 31446) for transformation. Plating the transformed culture on an ampicillin medium plate,
Resistant colonies were selected. Plasmid DNA was prepared from the transformants and restriction analysis confirmed the presence of the correct DNA fragment. This plasmid is called pSVE-pβ
_A Inh.

PHBS348-E (EP 007656)
A) was partially digested with Eco RI and Coli DNA polymerase I (Klenow fragment) and four types of dNT
Synthetic oligonucleotides blunted with P and containing a Sal I recognition site:

Ligated to 5'-GGTCGGACC-3 '. The transformed culture was plated on ampicillin medium plates to select for resistant colonies. Plasmids were screened for the presence of an extra Sal I restriction site. Plasmid DNA was prepared from this construct (pHBS348-ESalI).

Λ PINα-12s and λ PIN α-2
Was digested with Eco RI and Bam HI. 104 bp Eco R from λ PIN α-12s containing 5 ′ coding region
1246 bp Ec from λ PINα-2 containing the I- Bam HI fragment and the central portion and
o RI- Bam HI was collected and ligated together. The ligation mixture was digested with Eco RI, the enzyme was heat denatured, and the mixture was digested with Eco RI digested pUC9 (BR
L). Recombinants were selected and confirmed by restriction analysis. DNA was prepared from the correct plasmid (pPINα).

[0117] The pPINα containing the complete coding region of the porcine α- inhibin was digested with Nco I and Eco RI, the presence of four dNTP, filled with Pol (I) K, 128
A 0 bp fragment (fragment 4) was recovered by gel electrophoresis. pHBS348-ESalI was replaced with SstII and
Digested with Hind III and Pol (I) K in the presence of 4d NTP
And the fragment 5 containing the PML-Ampr region, the SV40 early promoter and the HBsAg 3 ′ untranslated region was recovered by gel electrophoresis. Fragments 4 and 5 were ligated together and the ligation mixture was used to Coli 294 (ATCC 31446)
Was transformed. Recombinants were selected by growth on ampicillin medium plates. PSV
It is called E-PαInh.

The pHBS348-ESalI was replaced with SalI and
After digestion with Hind III, fragment 6 containing pML-Ampr and the SV40 early promoter was recovered by gel electrophoresis. pFDII (EP 117,060A) was converted to Sa
was digested with l I and Hind III, it was recovered fragment 7 containing the normal mouse DHFR gene fused to HBsAg 'untranslated region. Fragments 6 and 7 were ligated and E. coli was ligated with this ligation mixture. E. coli strain 294 (ATCC 31446) was transformed. The transformed culture was plated on ampicillin medium plates to select for resistant colonies. Plasmid DNA was prepared from the transformants and restriction analysis confirmed the presence of the correct DNA fragment. This construct was constructed using pFDII-
Called SalI.

PSVE-PαInh was digested with SalI and H
Fragment 8 containing the α-inhibin coding region fused to the BsAg 3 ′ untranslated region and the SV40 early promoter was recovered. Replace pFDII-SalI with SalI
To recover the fragment 9 containing the mouse DHFR coding region linked to the HBsAg 3 'untranslated region and the SV40 early promoter. pSVE-β _A I
was linearized by Sal I digested nh, fragments 8 and 9
And three-component ligation. This ligation mixture was used to Coli strain 294 (ATCC 3144)
6) was transformed. The transformed culture was plated on ampicillin medium plates to select for resistant colonies. Transformants were screened for the presence of fragments 8 and 9 in the correct orientation so that transcription from the three SV40 early promoters proceeded in the same direction. This final plasmid is called pSVE
-Pαβ _A Inh-DHFR.

Plasmid pSVE-Pαβ _A Inh-DHF
R in DHFR-deficient CHO cells [Urlaub and Chasin, Proceedings.
Of National Academy of Science (P
NAS, 77 , 4216-4220 (1980)]. However, all of the DHFR ^-
Mammalian host cells are suitable for use with this plasmid. Alternatively, when co-transforming host cells with a plasmid encoding neomycin resistance, all mammalian host cells can be used, wherein the transformants are identified by their ability to grow on media containing neomycin. Is done.

The transfected CHO cells were selected by culturing them in a 15HGT ^- medium. The cells were grown to confluence in 15 cm diameter plates. Then, the cells were cultured in a serum-free medium for 48 hours before the cells were collected. After adding 100 mg of human serum albumin, 50 ml of the supernatant medium was lyophilized. The residue was purified with 1% fetal calf serum in HDMEM [Gibco Laboratories (GI)
BCO Laboratories), Santa Clara, Calif.] Solution and a Millex-GS 0.22 mM filter [Millex-GS, Millipore Co.
rp. ), Bedford, MA] and assayed in pairs.

The hormone-like activity of inhibin in the transformant supernatant was measured by an in vitro bioassay using rat anterior pituitary monolayer culture [Vale et al.
e, W. et al.), Endclinology (Endocrinolog
y), 91 , 562-572 (1972)]. Briefly, female rat anterior pituitary at 21 days of age was collected, enzymatically dispersed, and on day 1 24-well tissue culture plates.
[Falcon Plastic, Oxn
ard, CA] and 10% fetal bovine serum in HDMEM
Plated in solution (described above). On the second day, the medium was replaced with a 1% fetal bovine serum solution in HDMEM, a transformant medium sample was added, and the incubation was continued for another 48 hours.
The monolayer medium was then collected and the LH and FSH contents were determined by radioimmunoassay (RIA) using material obtained from the "NIADDKD Pituitary Hormone Program". In this assay, CH containing inhibin was used.
O cell cultures inhibit basal FSH release, but not LH, as compared to control pituitary cells fed incubation medium alone. The amount of porcine inhibin detected in the transformant supernatant was 20 ng / ml, showing a curve corresponding to the dose-response curve obtained with pure porcine ovarian inhibin.

The immunological cross-reactivity is assayed by a sandwich radioimmunoassay. Rabbits are immunized by dermal administration of pig inhibin to rabbits in complete Freund's adjuvant to raise rabbit antiserum to purified porcine follicular inhibin. The presence of anti-inhibin in the antiserum is determined by incubating the antiserum with purified porcine inhibin and assaying for the formation of immune complexes by conventional methods, eg, gel filtration. A part of this antiserum was
The anti-rabbit IgG is applied to a pre-coated polystyrene test tube. The recombinant culture supernatant or extract is diluted with phosphate buffered saline, added to the above coated test tubes, incubated overnight, and washed. Another portion of rabbit antiserum is added to the tube, incubated and washed. Radioiodinated goat anti-rabbit IgG was added to the test tube,
Incubate and wash away unbound goat antiserum. As is evident from the number of binding in vitro (which is higher than that of controls from extracts from non-transformed host cells or controls incubated with culture medium), the inhibin produced by this recombination was a rabbit antiserum. Cross-react with

Example 3 Construction of Human Inhibin Vector and Recombinant Cell Culture
The discovery that expression complete porcine and human beta _A chain of human inhibin are the same in -I, expression of human inhibin .alpha..beta _A is easy. That is, the construction of a vector for expressing human inhibin is performed using porcine β
Containing the cDNA encoding the _A, it can be carried out from the plasmid pSVE-beta _A of Example 1.

Human ovary prepared from 10 μg of ovarian mRNA
The λgt10 library of cDNAs was prepared using α, β _A and β _B
Southern analysis was performed using radio-phosphate labeled porcine cDNA encoding the strand. λHINα-2 is human α
It was confirmed to contain the coding region of the inhibin chain. The percentage of hybridized clones in the case of human α-inhibin is significantly lower than that found for porcine α-inhibin, at one position out of 100,000 human clones crossed with the 685 bp Sma I fragment of porcine cDNA for αInh. is there. β-chain clones are also rare, β _B
Clone is present at about 3 times the amount of β _A (clone 1000,
Out of 000, 1 and 3 respectively). Not all beta chain clones are full length. These were supplemented with a primer-treated cDNA library and assembled as described above for normal porcine cDNA.
The λ insert was recovered by Eco RI digestion.

[0126] The plasmid pHINα-2 Nco I and
Digested with Sma I and analyzed by gel electrophoresis with 1049 bp
The fragment (fragment 10) was recovered. pPinα
(Example 2) was digested with Eco RI and Pvu II. 98
The bp fragment (fragment 11) was recovered by gel electrophoresis. Fragments 10 and 11 were converted to Adapter I:

Embedded image 5′-CTGCTCCTCTTGCTGTTT
GGCCCCACGGAGGTGGCATGGCTGC
CAGGGCCCGGAGGCTGGACC-3 ′ was ligated in combination with adapter II, which is the complement of adapter I. The resulting 1208 bp fragment (fragment 12) was treated with 4d NTP and Klenow fragment of Pol (I), Hind III and Sa
and restricted with c II and ligated into pHBS348-ESalI which had been blunt-ended as described in Example 1. Alternatively, the upstream (i.e., the first 21 residues of the porcine sequence) of Hpa II site with recovered fragment encoding, Eco the PPinarufa RI and Hpa II
Digested. The adapters used in this alternative are shown below:

5 'CGGAGCTCGACC 3' 3 'CTCGAGCTGGG 5' Plasmid p with correctly oriented fragment 12
SVE-HαInh was identified by the sequence clause of the transformant. Thus, this construct (pSVE-HaInh) contains the first 24 residues of the pig signal sequence, with the remainder being preprohuman inhibin. Plasmid pSV
The E-Hα chain Inh was digested with SalI . The fragment containing the SV40 promoter and human inhibin sequence was ligated to fragment 9 and SalI digested pSVE-β _A
Ligated to Inh (Example 2). pSVE-hαβ _A In
This final plasmid, designated h-DHFR1, is called DHFR
Transfected into deleted CHO cells and selected as described in Example 2. The supernatant of this culture contained hormonally active human inhibin.

Example 4 Construction of Human Inhibin Vector and Recombinant Cell Culture
Expression embodiment of Human Inhibin in -II, except using the pro sequence of human inhibin beta _B instead of porcine beta _B prepro region is the same as in Example 3.

The lambda gt10 library of Example 3 is
As described in Example 3, λHINα2 was replaced with λHIN
Produced with β _A -5 and -14. Using the latter two phages, 311 bp Ec of λHINβ _A- 5 was used.
o RI- Hind III fragment (fragment 13) of λHINβ _A -14 1101bp Hind III- Hpa I
Ligated to the fragment (Fragment 14), and the mixture was ligated in Eco RI-Sma I digested mp18 vector (Biolabs), it was constructed beta _A coding cDNA full length. Clones were screened for an appropriately sized insert and selected. To make it double-stranded, the mp18 vector containing the correct insert was
Was treated with polymerase (I) and the four dNTPs, then digested with Xba I (which cleaves in the mp18 polylinker sequence), DNA polymerase I and four dNT
Plunted and digested with Eco RI. 1320bp
The fragment (Fragment 15), in Example 2 Eco
It was ligated to RI- Eco RV fragment 1. This ligation mixture was used to transform E. coli. E. coli 294 cells were transformed. Clones were screened by Southern hybridization and confirmed by restriction analysis. hInhβ _A
This clone containing the coding sequence was called pSVE-humβ
_A Inh. _A plasmid containing the human βA coding sequence and the human α-inhibin sequence together with the DHFR gene was constructed as outlined above with plasmid pSVE.
-Humβ _A Inh, pSVE-HαInh and pFDIISal
Build from I. That is, human α-inhibin and D
PFDIISalI and pSVE containing the HFR gene
The Sal fragments from -HαInh Sal I digested p
And ligated with SVE-humβ _A Inh, to identify clones containing all three genes. pSVE-humαβ _A I
This plasmid, designated nh-DHFR2, is called DHFR ^- C
The cells were transfected into HO cells, cultured in ght ^- medium, and selected. Twenty-four clones were picked and grown in confluence in ght ^- medium for 2 days under normal conditions for CHO cells, left undisturbed for another 2 days, and the culture medium was then replaced with the rat pituitary cells described above. Assays were used for inhibin and activin activity. Four clones were found to secrete significant amounts of human .alpha..beta _A inhibin (hαβ _A -8,12,14
And 18). The level in the culture medium of each clone was 125, 125, 200 and 250 ng / ml, respectively.
Met. Another clone (hαβ _A -11), as long as the measured for this clone by the absence and biological activity of α-chain immunoreactivity in the culture medium, but do not produce inhibin that may be detected at all, as beta _A beta _A homodimer Activin was produced. Clone hαβ _A- 16 secreted only the α chain and lacked activin or inhibin activity.

Example 5 Recombinant Expression of Human Activin Veil et al. (Same as Vale et al.) And Ring et al.
As reported by T. al., the same), homo- and heterodimers of β-chain A and / or B have the opposite effect of inhibin in the pituitary gland and induce rather than inhibit FSH. These proteins are collectively referred to as activins, which are prepared in α and β chain co-transformants as described in Example 4.
However, when the first transfection is performed on a vector or vectors that do not contain an α-chain gene, screening for suitable transformants may be somewhat less. Suitable vectors are readily constructed by excision of the α chain gene from the above vectors. Plasmid pSVE-humβ _A Inh from Example 4
Is digested with Sal I and ligated to fragment 9 (Example 2) containing the DHFR gene. This ligation mixture was used to transform E. coli. E. coli 294 cells were transfected and colonies were selected based on the fact that they hybridized with the β-chain DNA but not with the α-chain sequence. Clone pSVE-humβ _A In from which α-chain DNA has been deleted
h-DHFR was identified. This clone was transfected into DHFR ^- CHO cells as described above. It was confirmed that the transformant secreted activin into the culture medium. Similarly, the β _B coding sequence (reconstructed by ligating the DNA encoding the first 34 amino acids of human β _A to the remaining coding sequence of the human β _B chain)
Is easily constructed, and pSVE-h
Heterodimers were obtained by co-transfection with umβ _A Inh-DHFR. Further, in order to obtain a .alpha..beta _B inhibin having inhibin .alpha..beta _A shaped substantially non-urban physicians biological activity in vitro bioassay using the reconstructed human beta _B gene into the plasmids.

The present invention has been described in terms of its preferred embodiments, which are the best embodiments known to the present inventor, but which contain various changes and modifications which will be apparent to those of ordinary skill in the art. It should be understood that this can be done without departing from the scope of the invention as set forth in the claims herein.

[Brief description of the drawings]

FIG. 1 is a schematic diagram showing porcine α-chain mRNA.

FIG. 2 is a schematic diagram showing the nucleotide sequence and predicted amino acid sequence of a porcine inhibin α-chain precursor.

FIG. 3 is a schematic diagram showing the nucleotide sequence and predicted amino acid sequence of a porcine inhibin α-chain precursor.

FIG. 4. Porcine β _A subunit mRNA and porcine β _B
It is a schematic diagram which shows a subunit mRNA.

FIG. 5 is a schematic diagram showing the nucleotide sequence and predicted amino acid sequence of a porcine inhibin β subunit precursor.

FIG. 6 is a schematic diagram showing the nucleotide sequence and predicted amino acid sequence of a porcine inhibin β subunit precursor.

FIG. 7 is a schematic diagram showing the nucleotide sequence and predicted amino acid sequence of a porcine inhibin β subunit precursor.

FIG. 8 is a schematic diagram showing the nucleotide sequence and predicted amino acid sequence of a porcine inhibin β subunit precursor.

FIG. 9 is a mimetic diagram showing the results of analysis of porcine ovarian mRNA by Northern blot analysis.

10 is a schematic diagram showing by comparison the amino acid sequence of the amino acid sequence and porcine inhibin beta _A and beta _B of the human beta-TGF.

FIG. 11 is a schematic diagram showing the α subunit sequence and the β _A inhibin sequence in comparison.

FIG. 12 is a schematic diagram showing the construction of a typical recombinant expression plasmid for porcine inhibin.

FIG. 13 is a schematic diagram showing the construction of a typical recombinant expression plasmid for porcine inhibin.

FIG. 14 is a schematic diagram showing the construction of a typical recombinant expression plasmid for porcine inhibin.

FIG. 15 is a schematic diagram showing the nucleotide sequence and deduced amino acid sequence of human α-inhibin cDNA.

FIG. 16 is a schematic diagram showing the nucleotide sequence and deduced amino acid sequence of human α-inhibin cDNA.

FIG. 17: Human α-inhibin protein sequence and porcine α
FIG. 3 is a schematic diagram showing a comparison with an inhibin protein sequence.

FIG. 18. Human α-inhibin protein sequence and porcine α
FIG. 3 is a schematic diagram showing a comparison with an inhibin protein sequence.

19 is a schematic diagram showing the amino acid sequence of the nucleotide sequence and deduced human beta _A inhibin signal sequence.

FIG. 20 is a schematic diagram showing a nucleotide sequence and a deduced amino acid sequence of a human β _A inhibin signal sequence.

FIG. 21 is a schematic diagram showing a nucleotide sequence and a deduced amino acid sequence of a human β _A inhibin signal sequence.

FIG. 22 is a schematic diagram showing the nucleotide sequence and deduced amino acid sequence of human β _B inhibin cDNA.

FIG. 23 is a schematic diagram showing the nucleotide sequence and deduced amino acid sequence of human β _B inhibin cDNA.

FIG. 24 is a schematic diagram showing the nucleotide sequence and deduced amino acid sequence of human β _B inhibin cDNA.

Claims (1)

(57) [Claims] At least the formula Embedded image Embedded image Culturing a eukaryotic host cell transformed with a vector containing a nucleic acid encoding a human inhibin β _A chain polypeptide having the sequence of residues 283-398 of the sequence shown in Includes human inhibin β _A
A method for producing a chain polypeptide. 2. 2. The method of claim 1, further comprising recovering the polypeptide from the culture. 3. (Amino acid residues of the sequence of reduction. 72 of 74 283-398) (all amino acid residues of the sequences of 72 to reduction 74), mature prepro form of the polypeptide is human inhibin beta _A chain polypeptide or pro 2. The method according to claim 1, which has an amino acid sequence of the type (amino acid residues 1-398 of the sequence of Chemical Formulas 72 to 74). 4. The method according to any one of claims 1, 2, or 3, wherein the nucleic acid encoding the inhibin β _A chain is operably linked to a promoter recognized by a host cell. 5. 5. The method according to claim 4, wherein the promoter is a viral promoter. 6. The method according to claim 5, wherein the promoter is an SV40 promoter.