JP2673099B2 - Novel polypeptide - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION [0001] BACKGROUND OF THE INVENTION The present invention relates to an array represented by SEQ ID NO: 1.
Human granulocyte colony stimulating factor having a mino acid sequence (hereinafter
abbreviated as hG-CSF) part of the amino acid of the polypeptide
The acid is replaced by another type of amino acid and / or
Novel poly with an amino acid sequence with partial amino acid deletion
Peptide (hereinafter also referred to as hG-CSF polypeptide derivative
), Encoding the hG-CSF polypeptide derivative
DNA, recombinant plasmid containing the DNA fragment
, A microorganism containing the plasmid, and the microorganism
The present invention relates to a method for producing an hG-CSF polypeptide derivative. [0002] hG-CSF proliferates and differentiates hematopoietic stem cells.
Of polypeptides essential for the formation of various blood cells
One type, mainly promotes the increase of granulocytes, especially neutrophils
It has the effect of doing. Neutrophils are important in the defense of the body's infection
Plays a critical role, but has a short life span,
Must be constantly replenished by proliferation and differentiation
No. In recent years, treatment for proliferative tumors has been
At the same time, to prevent proliferation of neutrophil progenitor cells, patients with cancer
It has a serious side effect of reducing the infection defense function of.
hG-CSF promotes the increase of neutrophils,
The effect of reducing this side effect and preventing and treating infectious diseases
It is expected to have fruit. In addition, hG-CSF
Has a leukemia cell linein vitroActivity to differentiate in
And may be a therapeutic agent for leukemia
It seems to be. HG-CSF polypeptide derivative of the present invention
Shows better hG-CSF activity than known hG-CSF
It is expected to be used as a pharmaceutical. [0003] 2. Description of the Related Art Recombinant DNA technology, which has been rapidly developed in recent years,
Protein factors involved in blood cell proliferation and differentiation
Offspring genes have been isolated one after another. These factors are
Produced by genetic engineering using bacteria and animal cells
ing. hG-CSF was used in human squamous cell carcinoma cells
CDNA was isolated from strain CHU-II and its nucleotide sequence was determined.
And reported its expression in COS cells [Nagata et al .:
Nature319, 415 (1986)]. Also Sousa
(Souza) et al. Isolated cDNA from human bladder cancer cell line 5637
To determine its nucleotide sequence and report its expression in E. coli.
Sousa et al .: Science232, 61 (198
6)]. As shown in SEQ ID NO: 1 and Table 1 below
First, the proteins encoded by the above two cDNAs
Quality amino acid sequence and the
Encoded by cDNA isolated from phage
It is consistent with the amino acid sequence of the protein. [0005] [Table 1]        1 10 20 30 40 50        ACCCCCCTGGGCCCTGCCAGCTCCCTGCCCCAGAGCTTCCTGCTCAAGTGCTTAGAG       ThrProLeuGlyProAlaSerSerLeuProGlnSerPheLeuLeuLysCysLeuGlu         1         60 70 80 90 100 110        CAAGTGAGGAAGATCCAGGGCGATGGCGCAGCGCTCCAGGAGAAGCTGTGTGCCACC        GlnValArgLysIleGlnGlyAspGlyAlaAlaLeuGlnGluLysLeuCysAlaThr           120 130 140 150 160 170        TACAAGCTGTGCCACCCCGAGGAGCTGGTGCTGCTCGGACACTCTCTGGGCATCCCC        TyrLysLeuCysHisProGluGluLeuValLeuLeuGlyHisSerLeuGlyIlePro              180 190 200 210 220        TGGGCTCCCCTGAGCAGCTGCCCCAGCCAGGCCCTGCAGCTGGCAGGCTGCTTG        TrpAlaProLeuSerSerCysProSerGlnAlaLeuGlnLeuAlaGlyCysLeu          230 240 250 260 270 280        AGCCAACTCCATAGCGGCCTTTTCCTCTACCAGGGGCTCCTGCAGGCCCTGGAAGGG        SerGlnLeuHisSerGlyLeuPheLeuTyrGlnGlyLeuLeuGlnAlaLeuGluGly             290 300 310 320 330        ATCTCCCCCGAGTTGGGTCCCACCTTGGACACACTGCAGCTGGACGTCGCCGAC        IleSerProGluLeuGlyProThrLeuAspThrLeuGlnLeuAspValAlaAsp         340 350 360 370 380 390        TTTGCCACCACCATCTGGCAGCAGATGGAAGAACTGGGAATGGCCCCTGCCCTGCAG        PheAlaThrThrIleTrpGlnGlnMetGluGluLeuGlyMetAlaProAlaLeuGln            400 410 420 430 440 450        CCCACCCAGGGTGCCATGCCGGCCTTCGCCTCTGCTTTCCAGCGCCGGGCAGGAGGG        ProThrGlnGlyAlaMetProAlaPheAlaSerAlaPheGlnArgArgAlaGlyGly               460 470 480 490 500        GTCCTAGTTGCCTCCCATCTGCAGAGCTTCCTGGAGGTGTCGTACCGCGTTCTACGC        ValLeuValAlaSerHisLeuGlnSerPheLeuGluValSerTyrArgValLeuArg        510 520        CACCTTGCCCAGCCCTGA        HisLeuAlaGlnPro***                    174 [0006] SUMMARY OF THE INVENTION An object of the present invention is to provide a specific activity
HG-CSF polypep with high stability and high stability in blood
To provide a means for inexpensively mass-producing tide derivatives
It is in. [0007] Means for Solving the Problems The present inventors have set forth the SEQ ID NO.
HG-CSF cDNA shown in 1
Escherichia coli carrying a plasmid incorporating the cDNA
By using a protease
HG-CSF polypep with high specific activity by limited decomposition of
The inventors have found that a tide derivative can be produced and completed the present invention.
Came to According to the present invention, a novel hG-CSF poly
Peptide derivative, D encoding the polypeptide derivative
NA, a recombinant plasmid incorporating the DNA,
Microorganisms containing rasmids and novel h using these microorganisms
A method for producing a G-CSF polypeptide derivative is provided.
The hG-CSF polypeptide derivative of the present invention has SEQ ID NO:
HG-CSF polypeptide having the amino acid sequence represented by 1
Some amino acids in the peptide are replaced by other amino acids
And / or has some amino acids deleted
You. The amino acid to be replaced is an amino acid near the N-terminal
And at least one of the amino acids 1 to 17 from the N-terminus
It is also desirable that the number is one. Amino acid to be deleted is N-terminal
It is an amino acid near the end, and amino acids 1-11 from the N-terminus
It is desirable that it is at least one of the no acids. The recombinant plasmid of the present invention comprises the above hG
The DNA fragment encoding the CSF polypeptide derivative
Incorporated in an appropriate plasmid having a DNA expression function
It is a thing. Derivation of hG-CSF polypeptide of the invention
The DNA fragment encoding the body is shown in SEQ ID NO: 1.
Of the base sequence of the DNA encoding hG-CSF
A sequence in which at least one of the bases 51 to 51 has been replaced
Are preferred. The hG-CSF shown in SEQ ID NO: 1
The DNA to be encoded includes a message encoding hG-CSF.
Obtained by reverse transcription from recombinant RNA technology from sanger RNA
CDNA (hG-CSF cDNA) or chromosome
DNA encoding hG-CSF obtained from DNA
Which is available. hG-CSF cDNA includes hG-CSF cDNA.
-Anything that codes for CSF
Although it can be used, specifically, pCSF1-2 is used.
Can be. pCSF1-2 was prepared by the present inventor.
The production method is described in Reference Example 1.
Have been. HG-CSF cDNA in pCSF1-2
Shows dideoxy sequencing using M13 phage
(Dideoxy sequence) method [J. Messin
g) et al .: Gene19, 269 (1982)]
And has the base sequence shown in SEQ ID NO: 1. pCSF1
-2 is a plasmid having the restriction map shown in FIG.
E. coli containing it is Escherichia coli ECSF 1-2.
(FEMR BP-1220) as of November 27, 1986
Deposited at the Institute of Biotechnology and Industrial Technology. Encoding hG-CSF polypeptide derivative
Plasmid that incorporates the DNA
Use any plasmid that can express DNA.
I can. Preferably, a suitable promoter, e.g.
For example, a foreign gene can be inserted downstream of the trp and lac promoters.
DNA can be inserted and Shine-Dalga
Sequence (hereinafter abbreviated as SD sequence) and initiation codon (AT
G) was adjusted to an appropriate distance, for example, 6-18 base pairs.
Plasmids can be used. Specific preferred plasmids include pK
YP10 (JP-A-58-110600), pLSA1 (reference example
3), pGEL1 [Sekine et al .: Proceeding of
The National Academy of Science (Proc.
 Natl. Acad. Sci.), USA82, 4306 (1985)], pKY
P26 (JP-A-62-48699), pBR322 [Bolivar
var) et al .: Gene2, 95 (1977)]
Can be HG-CSF polypeptide and its induction
The recombination between the DNA encoding the body and the vector DNA
After digesting both DNAs with restriction enzymes, T4 DNA ligator
Performed using common recombinant DNA techniques that bind with
I can. For binding, use a restriction enzyme
The ends of the converted DNA fragments are ligated with DNA polymerase I.
Embedding reaction using Renault fragment, T4 DNA polymer
Using an embedding or scraping reaction
Processing and DNA linker methods
Can also be done. As hG-CSF cDNA, pCSF1-
2 as a plasmid for integrating the DNA
EL1, pKYP10, pKYP26, pBR322, pLS
A1 and, if necessary, chemically synthesized DNA
HG-CSF poly-, using linkers and site-specific mutations
Recombination incorporating DNA encoding peptide derivatives
An example of constructing a somatic plasmid is described below. As shown in FIG. 1, pCSF1-2
[Approximately 4.5 kilobases (abbreviated as kb)] to ApaI
And BamHI and electrophoresis on low melting point agarose gel
Method (LGT method) [L. Wieslande
r): Analytical biochemistry (Analytica)
l Biochemistry)98, 305 (1979)].
The NA fragment is purified. Next, pLSA1 was converted to BanIII and Bam.
After digestion with HI, a DNA fragment of about 2.8 kb by LGT method
Is purified. Both DNA fragments thus obtained,
The synthetic DNA shown in FIG. 1 was ligated with T4 DNA ligase.
To obtain pCfTA1. Then, as shown in FIG.
After cutting pCfTA1 with BamHI, Klenow was cut.
Convert the protruding ends to blunt ends by treating with a piece,
After further digestion with EcoRI, a DNA fragment of about 2.5 kb was
Purify by GT method. Separately, pCfTA1 is EcoRI
After cutting with and DraI, a DNA fragment of about 1.0 kb was
To purify. The DNA fragment obtained in this manner was
Ligation with DNA ligase yields pCfTB20. Further, as shown in FIG. 3, pCSF1-2 is
After digestion with ApaI and BamHI, a DNA fragment of about 1.5 kb
Is purified by the LGT method. Moreover, pGEL1 is replaced with Hin.
After digestion with dIII, BamHI and PstI, about 1.7 kb
The DNA fragment is purified by the LGT method. On the other hand, pKYP
After digesting 10 with PstI and BanIII, about 1.1 kb of DNA was digested.
The pieces are purified by the LGT method. These three DNA fragments
And the synthetic DNA shown in FIG. 3 by T4 DNA ligase.
Bind to pCfTL23, pCfTL38, pCfTL35,
pCfTL41 was obtained, and these three DNA fragments were
The synthetic DNA shown in No. 4 was ligated by T4 DNA ligase.
Then, pCfTM14, pCfTM17 and pCfTM113 were obtained.
You. Further, as shown in FIG. 5, pCfTA1
After digestion with BanIII and StuI, hG-CSFcDN
A DNA fragment of about 1.3 kb containing A is purified by the LGT method.
You. After pKYP26 was cut with BamHI, the DNA
Prominent by treatment with Limase I Klenow fragment
After converting the ends to blunt ends and further cutting with PstI, L
A DNA fragment of about 1.8 kb is purified by the GT method. On the other hand, p
After cutting GEL1 with BanIII and PstI, about 1.0 kb of D
The NA fragment is purified by the LGT method. Thus obtained
Ligation of three DNA fragments with T4 DNA ligase
To obtain pCfWD1. Further, as shown in FIG. 6, pCfTL38
Was digested with HindIII and BglII, followed by a DNA fragment of about 2.6 kb.
Is purified by the LGT method. Moreover, pCfTL38 is Hi
After digestion with ndIII and DpnI, a DNA fragment of about 300 bp was
Purify by GT method. On the other hand, pCfTB20 was replaced with AvaI
After treatment with Klenow fragment
After cutting with BglII, about 480 bp of DNA was cut.
The pieces are purified by the LGT method. The three DNs thus obtained
A fragment was ligated with T4 DNA ligase to give pC
Obtain fT95K19. Further, as shown in FIG.
After cutting pCfT95K19 with BanIII and BglI,
After digesting a 1.0 kb DNA fragment with BglI alone,
The kb DNA fragment is purified by the LGT method. On the other hand, p
After cutting CfT95K19 with BglI and Sau3A, about 350 b
The p DNA fragment is purified by the LGT method. Thus obtained
6 and the synthetic DN shown in the middle part of FIG.
A was ligated with T4 DNA ligase to obtain pCfAA1.
You. Further, as shown in FIG.
1 was digested with XhoI and BglI, followed by DNA digestion of about 3.0 kb.
The pieces are purified by the LGT method. This DNA fragment and the above p
BglI-Sau3A fragment of CfT95K19 (about 350 bp)
And the synthetic DNA shown in the lower part of FIG. 6 was treated with T4 DNA ligase.
Ligation yields pCfAB5 and pCfAB14. Further
As shown in FIG. 7, pCfAB5 was converted to AvaI and Bg
After digestion with II, a DNA fragment of about 2.8 kb was digested with the LGT method.
Purify. In addition, pCfWD1 was converted to BglII and AvaI.
After cleavage, a DNA fragment of about 1.3 kb is purified by the LGT method.
You. The thus obtained DNA fragments were used as T4 DNA ligers.
And obtain pCfBA8. Also, pCfAB14
Was digested with AvaI and BglII and purified by the LGT method.
About 2.8 kb of DNA fragment and Bgl of pCfWD1
II, about 1.3 kb of the AvaI fragment were ligated with T4 DNA ligase.
And pCfBA32 is obtained. Further, also shown in FIG.
, PCfBA8 was added to BanIII, BglII, Xho
After cutting with I, the DNA fragments of about 1.4 kb and about 2.7 kb were subjected to the LGT method.
To purify. The two DNA fragments thus obtained and
The synthetic DNA linker shown in FIG. 7 was replaced with T4 DNA ligase.
And pCfBB101, pCfBC52, pCfB
C59, pCfBD28, pCfBD56, pCfBC42B
1, pCfBC45, pCfBC76, pCfBC77, pC
fBC93, pCfBC95, pCfBC97, pCfBD82
Get. As shown in FIG. 8, pBR322 was cut with PstI.
After cleavage, the protruding end was cut off with T4 DNA polymerase,
The BglII linker was inserted using DNA ligase and
After digestion with EcoRI and BglII, a DNA of about 3.6 kb
The fragment is purified by the LGT method. On the other hand, pCfBB101, p
CfBC52, pCfBC59, pCfBD28, pCfBD
After digesting 56 with EcoRI and BglII, about 1.8 kb DNA
Each fragment is purified by the LGT method. Thus obtained
About 3.6 kb and about 1.8 kb DNA fragments were ligated with T4 DNA ligers, respectively.
By binding to pCfCB101, pCf, respectively.
fCC52, pCfCC59, pCfCD28, pCfCD56
Get. On the other hand, pCfBA8 was replaced with BanIII and BglI.
After digestion with I and XhoI, DNA fragments of about 1.4 kb and about 2.7 kb
Is purified by the LGT method. The two breaks thus obtained
Piece and the synthetic DNA linker shown in FIG.
PCfTNS7 and pCfTAAr
g4S is obtained. In addition, as shown in FIG. 15, pCfTNS
7 was digested with PvuI and XhoI, and a DNA fragment of about 1 kb was obtained.
Is purified by the LGT method. Also, pCfBA32 is converted to Pvu
After digestion with I and XhoI, a DNA fragment of about 3 kb was digested with the LGT method.
To purify. The two fragments obtained in this way are T4D
Ligation with NA ligase yields pCfTN205. As well
Next, pCfTAArg4S is cut with PvuI and XhoI.
Thereafter, a fragment of about 1 kb obtained by purification by the LGT method,
Obtained by cutting pCfBA32 with PvuI and XhoI
A DNA fragment of about 3 kb was ligated with T4 DNA ligase.
Obtain pCfTAArg4. Further, pCfBA8 is replaced with Ba.
After digestion with nIII, BglII and HindIII, about 1.4 kb
The 2.7 kb DNA fragment is purified by the LGT method. Like this
And the synthetic DNA linker shown in FIG.
Was ligated with T4 DNA ligase and pCfTNS30
1. Obtain pCfTNS401. Further, as shown in FIG.
After cutting CfBA8 with XhoI, it is treated with Klenow fragment.
To convert the protruding ends into blunt ends,
After digestion with uI, a DNA fragment of about 3 kb was purified by the LGT method.
To make. Separately, the ATG vector pTrS20 (Reference Example 4)
Is digested with SacI, and treated with Klenow fragment to form protruding ends.
Is converted to a blunt end, and after further digestion with PvuI, LGT
The DNA fragment of about 1 kb is purified by the method. Thus obtained
The two fragments are ligated with T4 DNA ligase and
Obtain fTNS501. FIG. 17 shows an example of using site-specific mutation.
As shown in the figure, pCfBD28 was ligated with BanIII and PstI.
After cleavage, a DNA fragment of about 210 bp is purified by the LGT method.
You. The M13 phage vector M13mp19RFDN
A was digested with AccI and PstI, followed by DNA digestion of about 7.24 kb.
The pieces are purified by the LGT method. The two obtained in this way
The DNA fragment was ligated with T4 DNA ligase and pt19
BD28N is obtained. Then, this pt19BD28N was transferred to E. coli.
Phage obtained by transfection into JM105
More single-stranded pt19BD28N is obtained. Also shown in Figure 17
Thus, M13mp19 RFDNA was converted to HindIII and Ec.
After digestion with oRI, a DNA fragment of about 7.2 kb was digested with the LGT method.
Refine. This DNA fragment of about 7.2 kb and the above obtained
Mixed with single-stranded pt19BD28N, and after denaturation,
Gapped Duplex D by Neal
NA is generated and purified by the LGT method. About
Fig. 17 shows this gapped duplex DNA.
After annealing the synthesized DNA, Klenow fragment and T4
Circularize with DNA ligase. This circularized DNA
Transfected into Escherichia coli strain JM105, site-specific
Pt19BD28NA17 and pt19BD28 into which a mutated mutation was introduced
Obtain NT17. Further, as shown in FIG.
19BD28NA17 and pt19BD27NT17 were converted to AvaI and Xh
After digestion with oI, each DNA fragment of about 110 bp was subjected to the LGT method.
Purify more. On the other hand, pCfBD28 was replaced with XhoI and Bgl.
After digestion with II, an approximately 2.74 kb DNA fragment was purified by the LGT method.
To make. Also cut pCfBD28 with BglII and AvaI.
After cleavage, a DNA fragment of about 1.29 kb is purified by the LGT method.
You. About 110 bp, about 2.74 kb and about 1.29 kb thus obtained
Ligating each DNA fragment with T4 DNA ligase
Thus, pCfBD28 A17 and pCfBD28 T17 were obtained, respectively.
You. The reaction conditions in the above recombination technique are as follows.
Generally, it is as follows. Elimination of DNA by restriction enzymes
The reaction is usually carried out using 0.1 to 20 μg of DNA at 2 to 200 mM (preferably).
Or 10-40 mM) Tris-HCl (pH 6.0-9.5 is preferred).
PH 7.0 to 8.0), 0 to 200 mM NaCl, 2 to 20 mM
MgCl (preferably 5-10 mM)_Two In a reaction solution containing
With 0.1-100 units of restriction enzyme (preferably 1 μg of DNA
1 to 3 units for 20 to 70 ° C (optimum temperature is for
15 minutes to 24 hours
Do. Stop the reaction usually at 55-75 ° C for 5-30 minutes
Phenol or diethylpyrocar
A method to inactivate restriction enzymes with reagents such as Bonate
Can be used. DNA fragments generated by restriction enzyme digestion
Or gapped duplex DNA is purified by L
GT method and polyacrylamide gel electrophoresis [A
A. M. Maxam et al .: Proceeding
Of the national academy of science
 (Proc. Natl. Acad. Sci.), USA74, 560 (1977))
And so on. The binding reaction of the DNA fragment is carried out at 2 to 200 mM (preferably).
Preferably 10-40 mM) Tris-HCl (pH 6.1-9.5,
Preferably pH 7.0-8.0), 2-20 mM (preferably 5-10
mM) MgCl_Two , 0.1 to 10 mM (preferably 0.5 to 2.0 m
M) ATP, 1-50 mM (preferably 5-10 mM)
T4 DNA ligase in a reaction solution containing osleitol
1 to 37 ° C (preferably 3 to 20 ° C) using 0.3 to 10 units
For 15 minutes to 72 hours (preferably 2 to 20 hours). Recombinant plasmid produced by the ligation reaction
DNA may be used, if necessary, by the transformation method of Cohen et al.
・ S.N. Cohen et al .: Procedure
Gu of the National Academy of Saye
(Proc. Natl. Acad. Sci.) USA69, 2110 (197
2)] to introduce into E. coli. By the binding reaction
The resulting recombinant M13 phage RF DNA may be
Known transfection method [Yoshiyuki Kuchino et al .: Protein
・ Nucleic acids and enzymes29, 294 (1984)].
105 strains [J. Messing et al .: Gene (G
ene)33, 103 (1985)]. Recombinant plasmid DNA and recombination
Of M13 phage RF DNA from E. coli
Isolation was performed according to the method of Barnboim et al. [H.
H. C. Birnboim et al .: Nucleic Acids
・ Research (Nucleic AcidsRes.)7, 1513 (1979)]
And so on. One from recombinant M13 phage
Isolation of strand DNA is performed by a known method [Yoshiyuki Kuchino et al.
Acids and enzymes29, 294 (1984)]. Plasmid DNA is converted into 1 to 10 kinds of restriction enzymes
After digestion with agarose gel electrophoresis or polyacrylic
Examine the cleavage site by amide gel electrophoresis. Furthermore D
If you need to determine the base sequence of NA, use M13 fur
Dideoxy sequence using di
ence) method [J. Messing et al .: Gene
(Gene)19, 269 (1982)]. Under the above conditions, the recombinant plasmid D
NA can be manufactured. HG-CSF po of the present invention
Lipid derivatives can be produced as follows. Sand
E. coli using a plasmid (for example, pCfBD28)
K-12HB101 was transformed and ampicillin resistance (A
p^rPlasmid (for example,
E. coli having pCfBD28) is selected. Plasmid
(For example, pCfBD28) is cultured in a medium.
To induce hG-CSF polypeptide in culture
Body can be generated. [0031] The medium used here is the growth of E. coli.
Suitable for the production of hG-CSF polypeptide derivatives
Any synthetic or natural medium can be used.
As a carbon source, glucose, fructose, lactose
, Glycerol, mannitol, sorbitol, etc.
However, as a nitrogen source, NH_FourCl, (NH_Four )_TwoSO_Four, Mosquito
Zamino acid, yeast extract, polypeptone, meat extract, tapir
Totripton, Corn Steep Liquor, etc.
Another source of nutrients is K_TwoHPO_Four, KH _TwoPO_Four , Na
Cl, MgSO_Four , Vitamin B₁ , MgCl_Two Is used
Can be used. The culture is aerated at pH 5.5 to 8.5 at a temperature of 18 to 40 ° C.
It is performed by stirring culture. 5 to 90 hours in culture
As the hG-CSF polypeptide derivative accumulates,
Bacterial cells are collected from the object, the bacterial cells are crushed by ultrasonic treatment,
Centrifuge to obtain cell residue. Marston from this cell residue
F. A. O. Marston et al .: BIO / TECHNOLOGY2, 8
00 (1984)] to produce a hG-CSF polypeptide derivative.
Extraction / purification / solubilization / regeneration
The vesicles are treated and the number of colonies formed in soft agar is used as an index.
HG-CSF polypeptide derivative by a modified assay
Quantification of The measurement of G-CSF activity in the present invention is as follows.
Do as below. 8-12 week old C3H / He male mice
(Shizuoka Experimental Animal Cooperative) sterile bone marrow cells from femur
Α with 10% fetal bovine serum (FBS)
−Minimum Essential Medium (Flow Laboratories, hereinafter
Lower α-MEM medium). These cells (about 5
× 10⁷ Nylon wool (Nylon w)
ool) (Wako Pure Chemical, NylonFiber 146-04231)
Immersed in ram (0.3g), 5% CO_Two Incubator
Incubate at 37 ° C for 90 minutes. Then preheat to 37 ° C
The α-MEM medium is passed through the column,
Obtain non-adsorbed bone marrow cells. This cell is called α
-Wash once with MEM medium and adjust to a predetermined concentration. Next, the method of Okabe et al. [Okabe T. et al.,
 Cancer Research44, 4503-4506 (1986)]
The ability to form bone marrow hematopoietic stem cell colonies is measured. That is,
0.2 ml of α-MEM, 0.4 ml of FBS and each diluted in two steps
To a mixture of 0.2 ml of the sample, add the bone marrow cells prepared by the above method.
Vesicle (2 × 10⁶ 0.2 ml (piece / ml). 42 ℃
0.6% agar (Difco, Agar Purified # 0560)
−01) Mix an equal volume (1.0 ml) of the solution, and add 0.5 ml
Seed into a luti dish (Nunc, # 143982)
(5 × 10^Four Pieces / dish, n = 3). 5% CO_Two Incube
After culturing at 37 ° C for 7 days in a
Number of colonies counted with a microscope (Olympus X40)
I do. After colony counting, carefully place on a slide glass.
Out, fix with acetone / formalin mixture for 30 seconds,
The method of bota et al. (Kubota K., et al., Exp. Hematology.
8339-344 (1980)].
Then, each colony is identified. The titer of each sample was determined for the colony formation test.
It is calculated as follows from the counting result in the two-step dilution.
Intact G-CSF roller used as a standard
The activity that gives half the maximum value of knee formation is defined as 50 units
The dilution rate of each sample and the activity per ml
Multiply by 20 to obtain the titer (unit). Specific activity
Sex is indicated by the titer (unit / mg) per unit protein (mg)
I do. The N-terminal side of the hG-CSF polypeptide
HG-CSF polypeptide derivative lacking amino acid is an enzyme
It can also be produced by an elementary decomposition method. The derivative is
Enzymatic degradation using natural hG-CSF as raw material
Can be produced, but natural hG-CSF is an enzyme
Since the reactivity to (protease) is low,
Using modified hG-CSF with enhanced reactivity to
To produce derivatives with high activity in high yield
Can be. As a raw material, hG-CSF polypep
Modified h in which the N-terminal amino acid of the tide is substituted as shown in Table 2.
G-CSF (a), (b), (c) and (d) are preferably used.
(a), (b), (c) and (d) show the bases having the corresponding nucleotide sequences.
Rasmid pCfBC59 (NC59), pCfBD28 (ND
28), pCfBC95 (NC95) and pCfTAArg
4S (Arg4S) -bearing strains are cultured and
It can be obtained by purification and isolation by a known method. The enzymes include serine protease and thiol
Endoprotease such as cholesterol protease
Can be. Specifically, for example, subtilisin A, subu
Cilicin BPN ', Subtilisin Carlsberg, Zub
Chilicin Novo, Proteinase K, Nagase, Thermola
Isin, endoproteinase Arg-C, trypsi
And α-chymotrypsin. The enzyme is raw
3.4 × 10 for 1 mg of feed substance^-6~ 8.5 × 10^-3Unit ratio
Used in. [0039] [Table 2] In the enzymatic reaction, the starting material is used in a Tris-HCl buffer solution.
Alternatively, dissolve in an aqueous solution such as a phosphate buffer and
In addition, it is performed at 10-37 ° C. for 30 minutes to 3 days. In the present invention
The total amount of protein and the amount of protein
Measure. M. Bradoff for total protein measurement
The Method of Eord [MM Bradford: Analytical Buy
Chemistry (Anal. Biochem.)72, 248 (1976)]
Performed by The protein content was determined by the method of Laemmli [U. K. Laemml
i: Nature227, 680 (1970)]
After performing DS-polyacrylamide gel electrophoresis,
Measured with a Roman scanner (CS-930 Shimadzu Corporation)
You. N-terminal amino acid sequence of peptide obtained after enzymatic cleavage
The column is an automatic amino acid sequence analyzer “Gas-Phase
In Sequencer Model 470A "(Applied
Biosystems) and Spectra Physics (Sp
ectra-Physics) high performance liquid chromatography suite
Measure by combination. [0042] Examples of the present invention will be described below. Embodiment 1 FIG. Construction of hG-CSF expression plasmid pCfTA1 (FIG. 1)
Reference :): pCSF1-2 DNA obtained in Reference Example 1
2 μg of 10 mM Tris-HCl (pH 7.5), 7 mM Mg
Cl_Two , 6 mM 2-mercaptoethanol and 100 mM N
A total of 20 μl solution containing aCl (hereinafter “Y-100 buffer”)
Liquid ") and the restriction enzyme ApaI [Boehringer
-Manufactured by Boehringer Mannheim] and Ba
mHI (manufactured by Takara Shuzo Co., Ltd.
Add as much as 10 units each at Takara Shuzo Co., Ltd., 37 ° C
For 4 hours. From this reaction solution by the LGT method
0.4 μg of a 1.5 kb DNA fragment was purified and recovered. Plasmid separately prepared by the method of Reference Example 3
Dissolve 12 μg of pLSA in 20 μl of Y-100 buffer and restrict
Enzyme BanIII (manufactured by Toyobo Co., Ltd.) and BamHI each 1
0 units were added and the reaction was carried out at 37 ° C. for 4 hours. This reaction solution
0.8 g of a 2.8 kb DNA fragment was purified by LGT method from
Collected. On the other hand, the N-terminal of the mature hG-CSF polypeptide
The first to fifth amino acids [threonine¹ (ACA
Or ACT), proline^Two (CCA or CCT),
Leucine^Three (CTA), glycine^Four (GGC), Proli
N^Five (CCC)] and the codons required for expression
That a start codon (ATG) must be added,
SD downstream of tryptophan promoter (Ptrp)
-The distance between the sequence and the ATG is of an appropriate length between 6 and 18 bp
For the reasons such as the need to
Anker was synthesized. [0044] Embedded image First, single-stranded DNAs, 26 mer and 20 mer, were
Triester method [R. Crea et al .: Professional
Seeding of the National Academy
Science (Proc. Natl. Acad. Sci.), USA75,
5765 (1978)]. 26mer, 20mer
2 μg of 50 mM Tris-HCl (pH 7.5), 10 mM Mg
Cl_Two 5 mM dithiothreitol, 0.1 mM EDTA
And a buffer containing 1 mM ATP (hereinafter referred to as "T
4 Kinase Buffer "), dissolved in 40 μl, T4
30 units of polynucleotide kinase (Takara Shuzo)
And a phosphorylation reaction was carried out at 37 ° C. for 60 minutes. ApaI derived from pCSF1-2 obtained above
-0.4 μg of BamHI fragment (1.5 kb) and pLSA1-derived
0.2 μg of a BanIII-BamHI fragment (2.8 kb) and 20 mM
Tris-HCl (pH 7.6), 10 mM MgCl_Two , 10mM
Buffer containing dithiothreitol and 1 mM ATP
(Hereinafter, this buffer is abbreviated as “T4 ligase buffer”)
Dissolve in 25 μl and add the DNA linker
Was added at 0.1 μg. Further add T4 DNA library to this mixed solution.
Add 6 units of gauze (Takara Shuzo: same below), 4 ℃,
The binding reaction was performed for 18 hours. Using the resulting mixture of recombinant plasmids
Escherichia coli strain HB101 [Bolivar et al .: Gene
 (Gene)2, 75 (1977)] using the method of Cohen et al.
N. Cohen et al .: Proceedings
Of the National Academy of Sciences
(Proc. Natl. Acad. Sci.) USA,69, 2110 (1972))
(Hereinafter, this method is used for transformation of E. coli)
Transform, Ap^rColonies were obtained. Of this colony
Known methods from cultured cells [H.C.
(H. C. Birnboim) et al .: Nucleic Acid Lisa
-(Nucleic Acids Res.)7, 1513 (1979)] (below
Use this method for isolation of plasmid DNA)
Plasmid DNA was recovered. Structure of the obtained plasmid
Construction is BanIII, RsaI, PstI, HindIII, B
After digestion with glII, confirm by agarose gel electrophoresis.
Was. This plasmid is called pCfTA1. pCfTA
The base sequences near BanIII and HindIII of No. 1 are as follows.
Diodeoxy with M13 phage
・ Confirmed by the sequence method. [0048] Embedded image Example 2. Deletion of part of the 3'-untranslated region of hG-CSF cDNA
Construction of plasmid pCfTB20 (see FIG. 2):
HG-CSF-expressed plasmid pCfT obtained in Example 1
Dissolve 2 μg of A1 (4.3 kb) in 20 μl of Y-100 buffer,
Add 4 units of BamHI restriction enzyme and digest at 37 ° C for 4 hours
The reaction was carried out. Phenol-chloroform equivalent mixture
Extraction (hereinafter abbreviated as phenol-chloroform extraction)
After that, 1.8 μg of the DNA fragment was precipitated by ethanol precipitation.
Was recovered. This DNA fragment was treated with 50 mM Tris-HCl.
(PH7.8), 7mM MgCl_Two And 6 mM mercaptoe
A buffer solution containing ethanol (hereinafter referred to as "Klenow buffer")
Dissolve in 20 μl, dATP, dTT
Add P, dCTP and dGTP to 1 mM each.
And 4 units of DNA polymerase I and Klenow
Add a piece (Takara Shuzo);
The protruding ends were converted to blunt ends. Phenol
After extraction with chloroform, the DNA was cut by ethanol precipitation.
1.6 μg pieces were collected. The DNA fragment was mixed with Y-100 buffer 20
Dissolve in μl, add 10 units of EcoRI, 37 ° C, 4 hours
A cleavage reaction was performed. This reaction solution was used for 2.
5 kb DNA fragment (BamHI (Blunt) -EcoRI digestion)
1) 1 μg was obtained. Separately, 12 μg of pCfTA was added to 20 μl of Y-10.
0 buffer, add 10 units of EcoRI, and add
After performing the time cleavage reaction, the NaCl concentration becomes 150 mM.
NaCl, 10 units of DraI, and 37
Cleavage reaction was performed at 4 ° C. for 4 hours. Agarose gel electrophoresis
After confirming complete degradation in, hG-CSF cDNA was
1.0 kb DNA fragment (EcoRI-DraI fragment)
0.2 μg was purified and collected by the LGT method. The BamHI (Blunt) -Eco obtained above
0.2 μg of RI fragment (2.5 kb) and EcoRI-DraI fragment
(1.0kb) Dissolve 0.2μg in 25μl of T4 ligase buffer
Then, 6 units of T4 DNA ligase was added to the mixture, and 4
The binding reaction was performed at 18 ° C. for 18 hours. The obtained recombinant plus
E. coli HB101 strain is transformed with the mixture of mids,
Ap^rColonies were obtained. From the cultured cells of this colony
Plasmid DNA was recovered. Structure of the obtained plasmid
After cutting with HindIII and PstI, agarose
Was confirmed by electrophoresis. This plasmid is called pCfT
Called B20. Example 3. Polypeptide in which the N-terminal amino acid of hG-CSF has been substituted
Which encode the plasmids pCfTL23, pCfTL38,
Construction of pCfTL35 and pCfTL41 (see Fig. 3): Reference
PCSF1-2 (4.5 kb) 3 μ obtained by the method of Example 1
g in 60 μl Y-100 buffer and the restriction enzyme ApaI
(Manufactured by Boehringer Mannheim) and the restriction enzyme BamH
I. Add 8 units each and perform cleavage reaction at 37 ° C for 3 hours.
went. HG-CSF residue was obtained from this reaction solution by the LGT method.
A DNA fragment of about 1.5 kb containing most of the gene (ApaI-
BamHI fragment) of about 0.4 μg was obtained. On the other hand, pGEL1 [Sekine et al .: Proceedy
Of the National Academy of Sai
Ance. (Proc. Natl. Acad. Sci.) USA82, 4306 (198
5)] (from a culture of E. coli IGEL1 FERM BP-629,
(3.4kb) 2μg in Y-100 buffer 40μl
Melted, restriction enzymes HindIII, BamHI and Ps
Add 4 units each of tI and perform cleavage reaction at 37 ° C for 3 hours.
went. From this reaction solution, the lipoprotein was analyzed by LGT method.
Approximately 1.7 kb DNA fragment (P
About 0.5 μg of the (stI-BamHI fragment) was obtained. Separately, the method described in JP-A-58-110600
3 μg of pKYP10 prepared in the above to 60 μl of Y-100 buffer
Melted, restriction enzyme BanIII (manufactured by Toyobo Co., Ltd.) and restriction enzyme
Add 6 units each of elementary PstI and cut at 37 ° C for 3 hours
The reaction was carried out. From this reaction solution, tryptic was obtained by the LGT method.
Approximately 1.1 kb DN containing fan promoter (Ptrp)
About 0.5 μg of the A fragment (BanIII-PstI fragment) was obtained. On the other hand, the amino acid at the N-terminal of mature hG-CSF
The acid Thr is replaced with Ser, Cys, Arg or Gly.
Start codon required for expression
(ATG) must be added, and Ptrp
The distance between the downstream SD sequence and ATG should be between 6 and 18 bp.
For reasons such as the need to make it the appropriate length,
A DNA linker was synthesized. [0056] Embedded image First, single-stranded DNA, 26-mer and 20-mer
It was synthesized by the usual triester method. 26-mer and 2
20 pmoles of each 0-mer was added to 40 μl of T4 kinase buffer.
Dissolved in T4 polynucleotide kinase (Takara Shuzo Co., Ltd.)
And phosphorylation at 37 ° C for 60 minutes
Was. Next, ApaI-B derived from pCSF1-2 obtained above
0.3 μg of the amHI fragment (about 1.5 kb) and pGEL1-derived
0.2 μg of PstI-BamHI fragment (about 1.7 kb) and
The BanIII-PstI fragment of the current vector pKYP10 (about
1.1 kb) Dissolve 0.2 μg in a total volume of 30 μl T4 ligase buffer
However, about 1 pmol of the above DNA linker was added to this mixture.
added. Add 6 units of T4 DNA liger to this mixture.
Zease was added and the binding reaction was performed at 4 ° C. for 18 hours. Use reaction mixture containing recombinant plasmid
E. coli C600SF8 strain (FERM BP-1070) [Cameron
(Cameron) et al: The Proceeding of the National
Null Academies of Science (Proc. Natl. Ac
ad. Sci.), USA72, 3416 (1975)].
p^rColonies were obtained. Plasmid from this transformant
DNA was separated and purified according to a known method. The plus
The structure of the mid DNA is PstI, EcoRI, BanIII
After confirming by polyacrylamide gel electrophoresis
did. These plasmids were converted to pCf as shown in FIG.
TL23, pCfTL38, pCfTL35, pCfTL41
Call. HG-CSF derivative gene in the above plasmid
The sequences near the N-terminus are: [0059] Embedded image Dedeoxy-C using M13 phage
It was confirmed by the quenching method. HG-C encoded by pCfTL23
SF derivative (this derivative is hG-CSF [Gly¹ ]
) Is that the N-terminal Thr of mature hG-CSF is changed to Gly.
The substitution was confirmed. Similarly, pCfTL38
HG-CSF derivative (the derivative is represented by h
G-CSF [Ser¹ ] To Ser, pCfT
HG-CSF derivative encoded by L35 (this derivative
To hG-CSF [Cys¹ ]) To Cys, pC
hG-CSF derivative encoded by fTL41 (this
The derivative was converted to hG-CSF [Arg¹ ]) To Arg
It was confirmed that each N-terminal amino acid was substituted.
Was. Example 4. replacing the N-terminal and third amino acids of hG-CSF
A plasmid pCfTM14 which encodes a polypeptide
Construction of pCfTM17 and pCfTM113 (see Fig. 4)
): PCSF1-2 obtained by the method of Reference Example 1 (4.
5 kb) 3 μg was dissolved in 60 μl of Y-100 buffer, and ApaI
And BamHI were added in 8 units each, and the mixture was added at 37 ° C for 3 hours.
A cleavage reaction was performed. HG was obtained from this reaction solution by the LGT method.
A DNA fragment of about 1.5 kb containing most of the CSF gene
(ApaI-BamHI fragment) about 0.4 μg was obtained. On the other hand, 2 μg of pGEL1 (3.4 kb) was added to Y-
Dissolve in 40 µl of 100 buffer solution, and use restriction enzymes HindIII, Ba.
Add 4 units of mHI and 4 units of PstI at 37 ° C.
The cleavage reaction was performed for 3 hours. From this reaction solution, the LGT method was used.
About 1.7 kb including lipoprotein-derived terminator
About 0.5 μg of the DNA fragment (PstI-BamHI fragment)
Obtained. Separately, the method described in JP-A-58-110600
3 μg of pKYP10 prepared in the above to 60 μl of Y-100 buffer
Melted, 6 units each for restriction enzymes BanIII and PstI
And a cleavage reaction was carried out at 37 ° C. for 3 hours. This reaction solution
Approximately 1.1 kb DNA fragment containing Ptrp by LGT method
(BanIII-PstI fragment) About 0.5 μg was obtained. on the other hand,
Thr, which is the N-terminal amino acid of mature hG-CSF, is converted into S
er, the third amino acid Leu is replaced with Gly, Se
Replace with any of r, Cys or Arg and express
Start codon (ATG) required for
And the distance between the ATG and the SD sequence downstream of Ptrp
Should be of an appropriate length between 6 and 18 bp
For any reason, the following DNA linkers were synthesized. [0064] Embedded image First, single-stranded DNA, 26-mer and 20-mer
Was synthesized by the usual triester method. 26-mer and
20 μmol each of the 20-mer and 40 μl of T4 kinase buffer
Dissolve in the buffer and add 6 units of T4 polynucleotide kinase
In addition, a phosphorylation reaction was performed at 37 ° C. for 60 minutes. Then above
ApaI-BamHI fragment derived from pCSF1-2 obtained in
(About 1.5 kb) 0.3 μg and PstI-B derived from pGEL1
AmHI fragment (about 1.7 kb) 0.2 μg and expression vector
BanIII-PstI fragment of pKYP10 (about 1.1 kb) 0.1.
Dissolve 2 μg in 30 μl T4 ligase buffer and mix
About 1 pmol of the above DNA linker was added to the mixture. this
Add 6 units of T4 DNA ligase to the mixture and add 4 units.
The binding reaction was performed at 18 ° C. for 18 hours. Use reaction mixture containing recombinant plasmid
E. coli C600SF8 (FERM BP-1070) strain
Transformed by the method of^rColonies were obtained.
From this transformant, plasmid DNA was prepared according to a known method.
Was separated and purified. The structure of the plasmid DNA is Pst
After cutting with I, EcoRI and BanIII, polyacrylamide
It was confirmed by Dogel electrophoresis. These plasmids
As shown in FIG. 4, pCfTM14, pCfTM17,
Called pCfTM113. HG-CS in the above plasmid
The sequences near the N-terminus of the F derivative gene are: [0067] Embedded imageIt was confirmed that the
It was confirmed by the oxy-sequence method. pCfTM14
(The derivative is represented by hG-CSF
[Ser¹, Cys^Three] Is the mature hG-CSF
N-terminal Thr is Ser and L is the third amino acid.
It was confirmed that eu was substituted with Cys. Likewise
Derivative encoded by pCfTM17 (this derivative is referred to as h
G-CSF [Ser¹, Arg ^Three ]) Is the N-terminal
Thr is Ser, the third Leu is Arg, pCf
Derivatives encoded by TM113 (this derivative is designated as hG-
CSF [Ser¹, Ser^Three ] Is the N-terminal Th
r is replaced by Ser and the third Leu is replaced by Ser
It was confirmed that. Example 5. (1) Construction of recombinant plasmid pCfWD1 (see FIG. 5)
5) 50 μg of pCfTA1 obtained by the method of Example 1
Dissolve in μl of Y-100 buffer and add restriction enzyme StuI10
And 10 units of restriction enzyme BanIII (Toyobo Co., Ltd.)
Then, a digestion reaction was performed at 37 ° C. for 1 hour. LG from reaction solution
Approximately 1.3 kb of DN containing hG-CSF cDNA by T method
About 0.5 μg of the A fragment (BanIII-StuI fragment) was obtained.
Separately, 3 μg of pKYP26 produced by the method of Reference Example 2 was added to 5
Dissolve in 0 μl of Y-100 buffer and add 6 units of BamHI.
The digestion reaction was performed at 30 ° C. for 1 hour. 10mM Tris-HCl (pH7.5), 1m
Add an equal amount of phenol saturated with M EDTA and shake vigorously.
After stirring, centrifuge at low speed (3300 rpm, 10 minutes;
The aqueous layer was collected. Add an equal volume of chloroform,
After vigorous stirring, collect the aqueous layer by low-speed centrifugation.
Was. Add 1/10 volume of 3M sodium acetate and add 2.5 volumes
Ethanol was added, and the mixture was allowed to stand at -20 ° C for 1 hour. Cooling centrifuge
The precipitate was collected by a separation method (4 ° C., 11000 rpm, 10 minutes). This
Was dissolved in 30 μl of Klenow buffer, and dATP,
Reduce dTTP, dCTP, and dGTP to 100 μM each.
And the DNA polymerase I Klenow fragment
Two units were added and reacted at 17 ° C. for 15 minutes. Treat at 68 ° C for 10 minutes
To inactivate the DNA polymerase I Klenow fragment
After that, NaCl was added to 100 mM, and the restriction enzyme P was added.
5 units of stI was added and digestion reaction was performed at 37 ° C. for 1 hour. Anti
From the reaction solution, using the LGT method,
1.8 kb DNA fragment [BamHI (Blunt) -PstI digestion]
Piece) of about 0.6 μg. Separately, pGEL1 4μ
g was dissolved in 40 μl of Y-100 buffer, and restriction enzyme BanI was used.
II (manufactured by Toyobo Co., Ltd.) 10 units and PstI 10 units, 37 ° C
Perform digestion reaction for 1 hour at room temperature.
Approximately 1 kb DNA fragment containing a putophane promoter
(BanIII-PstI fragment) 0.4 μg was obtained. BanIII derived from pCfTA1 obtained above
-0.2 µg of StuI fragment (about 1.3 kb), derived from pKYP26
BamHI (Blunt) -PstI fragment (about 1.8 kb) of about 0.1
μg, the BanIII-PstI fragment derived from pGEL1 (about
1 kb) about 0.1 μg to 30 μl of T4 DNA ligase buffer
And add 4 units of T4 DNA ligase at 4 ° C.
The binding reaction was performed for 18 hours. Escherichia coli HB101 strain was transformed with the reaction solution.
Convert, Ap^rFrom the colony, and
Recovery of plasmid DNA by the method of Bernvoim et al.
Then, pCfWD1 shown in FIG. 5 was obtained. (2) Construction of pCfT95K19 (see FIG. 6):
5 μg of pCfTL38 obtained by the method of Example 3 was added to 50 μl of
Dissolve in Y-100 buffer, and use the restriction enzymes HindIII and Bgl
10 units of II was added and the digestion reaction was carried out at 37 ° C. for 1 hour.
Tryptophan promoter from reaction solution by LGT method
-Containing about 2.6 kb DNA fragment (HindIII-BglII
Fragment) about 0.7 μg was obtained. Separately, pCfTL38, 100 μg
Dissolve it in 1.5 ml of Y-100 buffer and add the restriction enzyme BamHI.
Add 80 units of HindIII each and digest at 6 ℃ for 6 hours
Was done. HG-CSFcD from the reaction solution by LGT method
The DNA fragment containing NA is recovered and ELUTIP^TM-D
(Schleicher & Schuell). This DNA
The fragment was treated with 10 mM Tris-HCl (pH 7.5), 7 mM MgC.
l_Two, 150mM NaCl, 6mM 2-mercaptoethanol
(Hereinafter referred to as "Y-150 buffer") 90
Dissolve in μl of solution, and use the restriction enzyme DpnI (Boehringer
Add 3 units (Mannheim) and perform digestion reaction at 37 ℃ for 15 minutes.
Was. From the reaction solution by polyacrylamide gel electrophoresis, h
A DNA fragment of about 300 bp containing G-CSF cDNA (Hi
ndIII-DpnI fragment) about 1 μg was obtained. Separately, pCfTB20 1 obtained by the method of Example 2
0 μg was dissolved in 100 μl of Y-100 buffer, and restriction enzyme A was used.
10 units of vaI were added, and a digestion reaction was performed at 37 ° C. for 1 hour.
Phenol-chloroform extraction and ethanol precipitation
The DNA was recovered, dissolved in 30 μl of Klenow buffer, and D
Add 2 units of NA polymerase I. Klenow fragment, 17 ℃
For 30 minutes. Treat at 68 ° C for 10 minutes
Inactivate the Merase I Klenow fragment and add NaCl to 100m
And add 10 units of restriction enzyme BglII to 37 ° C.
For 1 hour. From the reaction solution, lp by LGT method
A DNA fragment of about 480 bp containing a p-terminator portion [A
vaI (Blunt) -BglII] of about 0.3 μg was obtained. Hind derived from pCfTL38 obtained above
 III-BglII fragment (about 2.6 kb) about 0.1 μg, pCfT
A HindIII-DpnI fragment (about 300 bp) derived from L38 about 0.
2 μg, AvaI (Blunt) -BglII derived from pCfTB20
About 0.15 μg of the fragment (about 480 bp) was added to 30 μl of T4 DNA ligator.
Dissolve in lysate buffer and add 4 units of T4 DNA ligase.
The binding reaction was performed at 4 ° C. for 18 hours. Using the reaction solution
E. coli HB101 strain was transformed with Ap^rThe colony
And obtained from the colonies according to the method of Burnboim et al.
The plasmid DNA was recovered, and pCfT95K shown in FIG.
I got 19. (3) Construction of pCfAA1 (see FIG. 6): Previous
5 μg of pCfT95K19 obtained in the above section was added to 50 μl of Y-100 buffer.
Dissolve in the buffer, BanIII (Toyobo Co., Ltd.) 7 units
And 2 units of BglI (Nippon Gene) at 37 ° C
The digestion reaction was performed for 1 hour. From the reaction solution,
Approximately 1 kb DNA containing the liptophan promoter part
About 00.6 μg of the fragment (BanIII-BglI fragment)
A DNA fragment of about 1.8 kb containing the p terminator (B
(glI-BglI fragment) about 1 μg was obtained. Separately, 15 μg of pCfT95K19 was added to 15 μg.
Dissolved in 0 μl of Y-100 buffer and added with restriction enzyme BglI (day
Add 37 units of Sau3A and 6 units at 37 ° C
For 1 hour. From the reaction solution to polyacrylic
The hG-CSF cDNA portion was obtained by midgel electrophoresis.
A DNA fragment of about 350 bp (BglI-Sau3A digestion)
Fragment) about 0.3 μg was obtained. Separately from this, the following DNA linker was added.
Done. [0079] Embedded image First, single-stranded DNA, 39-mer and 41-mer
Was synthesized by the usual triester method. 39-mer and
20 pmoles of each of the T4 kinase and the 41-mer in a total volume of 40 μl
T4 polynucleotide kinase (Treasure)
Sake Brewing Company) 6 units added, phosphorylation reaction at 37 ℃ for 60 minutes
Was done. Next, Ban derived from pCfT95K19 obtained above was used.
III-BglI fragment (about 1 kb) 0.1 μg, BglI-Bg
0.05 μg of 11 fragment (about 1.8 kb), BglI-Sau3A
0.1 μg of the fragment (about 350 bp) was added to T4 DNA ligase buffer 25
μl, and add the above DNA linker to this mixture for about 2 μl.
Picomolar was added. Add 6 units of T4 DNA ligase
The binding reaction was performed at 4 ° C. for 18 hours. The reaction solution was used to transform E. coli HB101.
Convert, Ap^rFrom the colony, and
Recovery of plasmid DNA by the method of Bernvoim et al.
Then, pCfAA1 shown in FIG. 6 was obtained. The deideoki
DNA linker part of pCfAA1 by the sequencing method
When the base sequence was determined for
The third base of the codon encoding Leu is A
It has been found. In this pCfAA1, hG-CSF
14 amino acids from the 10th Pro to the 23rd Lys
The coding DNA portion has been deleted. Also, hG-C
A mutation that changes the sixth Ala of SF to Asn was introduced.
And a new XhoI site is created. (4) Construction of pCfAB5 (see FIG. 6): Previous
3 μg of pCfAA1 obtained in Section 3 was added to 30 μl of Y-100 buffer.
Dissolve in liquid, add 5 units of restriction enzyme XhoI, and add 1 at 37 ℃.
A time digestion reaction was performed. X by agarose gel electrophoresis
After confirming that the hoI digestion is complete,
Add 1 unit of restriction enzyme BglI (Nippon Gene Co., Ltd.)
A partial digestion reaction was performed at 25 ° C for 25 minutes. LGT method from reaction solution
Tryptophan promoter part and lpp
A DNA fragment of about 3 kb containing the terminator part (Xho
I-BglI fragment) about 1 μg was obtained. Apart from this, below
The DNA linkers described above were synthesized. [0083] Embedded image This linker DNA is hG of pCfAA1.
-10th hG-CSF deleted in CSF cDNA
Encodes 14 amino acids from Pro to 23rd Lys
It contains a DNA portion that First, single-stranded DNA, 27
-Mer, 25-mer (2 types) and 23-mer are converted to normal tries
It was synthesized by the tell method. 27-mer and 25 complementary to each other
20-pmol of -mer and 25-mer and 23-mer DNA
Were dissolved in a total volume of 40 μl of T4 kinase buffer.
4. Add 6 units of polynucleotide kinase (Takara Shuzo)
Then, a phosphorylation reaction was performed at 37 ° C. for 60 minutes. Next, Xho derived from pCfAA1 obtained above
0.1 μg of I-BglI fragment (about 3 kb), pC obtained in the previous section
A BglI-Sau3A fragment derived from fT95K19 (about 350 b
p) Dissolve 0.1 μg in 30 μl T4 DNA ligase buffer
Then, 2 μmol of the above DNA linker was added to this mixture.
added. Add 6 units of T4 DNA ligase and add 4 ° C
For 18 hours. Escherichia coli HB101 strain was transformed with the reaction solution.
Convert, Ap^rFrom the colony, and
Recovery of plasmid DNA by the method of Bernvoim et al.
Thus, pCfAB5 and pCfAB14 shown in FIG. 6 were obtained.
PCfAB5 and pCf were obtained by the dideoxy sequencing method.
The nucleotide sequence of the DNA linker portion of CfAB14 was determined.
However, the first codon encoding the 17th amino acid
Is A in pCfAB5, and in pCfAB14
T, each of the Ser codon (AGC) and Cys
17th codon (TGC) of mature hG-CSF
Is replaced with Ser in pCfAB5, and pCf
AB14 proved not to be substituted. Example 6. (1) Construction of pCfBA8 and pCfBA32 (see FIG. 7)
): 3 μg of pCfAB5 obtained in the previous section was added to 40 μl of Y-
Dissolve in 100 buffer and add 5 units of restriction enzyme AvaI and BglI
I5 units were added and digestion reaction was performed at 37 ° C. for 1 hour. Reaction liquid
From the tryptophan promoter by the LGT method
Approximately 2.8 kb of DNA fragment containing the and lpp terminator part
About 1 μg of a piece (AvaI-BglII fragment) was obtained. Separately from this, pCfWD1 obtained in the first term
 6 μg was dissolved in 50 μl of Y-100 buffer, and restriction enzyme B was dissolved.
5 units of glII were added and digestion reaction was carried out at 37 ° C. for 1 hour.
Completely BglII digestion by agarose gel electrophoresis
After confirming that the restriction enzyme AvaI was
And a partial cleavage reaction was performed at 37 ° C. for 20 minutes. Reaction solution
According to the LGT method, most of hG-CSF cDNA was contained.
About 1.3 kb of DNA fragment (BglII-AvaI fragment)
0.4 μg was obtained. Next, Ava derived from pCfAB5 obtained above
0.1 μg of the I-BglII fragment (about 2.8 kb) and pCfWD1
0.3 μg of the BglII-AvaI fragment (about 1.3 kb)
Dissolve in 4 μl of 4 DNA ligase buffer and add 3 units of T4
DNA ligase was added, and a binding reaction was performed at 4 ° C. for 18 hours.
Escherichia coli HB101 was transformed using the reaction solution, and Ap
^rFrom the colony, and
The plasmid DNA was recovered by the method described above and shown in FIG.
PCfBA8 was obtained. Induction of hG-CSF encoded by pCfBA8
The amino acid sequence of the conductor is the sixth amino acid sequence of mature hG-CSF.
Replace Ala with Asn and 17th Cys with Ser
I have. Hereinafter, this derivative is referred to as hG-CSF [NA8].
Huh. On the other hand, 3 μg of pCfAB14 obtained in the previous section was added to 40 μl of Y
-100 buffer solution, 5 units of AvaI restriction enzyme and Bg
5 units of II were added and digestion reaction was carried out at 37 ° C. for 1 hour. reaction
Tryptophan promoter part from solution by LGT method
2.8 kb DNA containing the DNA and lpp terminator
About 1 μg of a fragment (AvaI-BglII fragment) was obtained. Apart from this, pCfWD1 obtained in the first term
 6 μg was dissolved in 50 μl of Y-100 buffer, and restriction enzyme B was dissolved.
5 units of glII were added and digestion reaction was carried out at 37 ° C. for 1 hour.
Completely BglII digestion by agarose gel electrophoresis
After confirming that the restriction enzyme AvaI was
And a partial cleavage reaction was performed at 37 ° C. for 20 minutes. Reaction solution
According to the LGT method, most of hG-CSF cDNA was contained.
About 1.3 kb of DNA fragment (BglII-AvaI fragment)
0.4 μg was obtained. Next, the Ava derived from pCfAB14 obtained above
0.1 μg of the I-BglII fragment (about 2.8 kb) and pCfWD1
0.3 μg of the BglII-AvaI fragment (about 1.3 kb)
Dissolve in 4 μl of 4 DNA ligase buffer and add 3 units of T4
DNA ligase was added, and a binding reaction was performed at 4 ° C. for 18 hours.
Escherichia coli HB101 was transformed using the reaction solution, and Ap
^rFrom the colony, and
The plasmid DNA was recovered by the method described above and shown in FIG.
The obtained pCfBA32 was obtained. hG coded by pCfBA32
-The amino acid sequence of the CSF derivative is the mature hG-CSF
Is replaced with Asn. (2) Construction of pCfBB101: p obtained in the previous section
Dissolve 6 μg of CfBA8 in 50 μl of Y-100 buffer
And restriction unit BanIII (Toyobo Co., Ltd.) 10 units, Bg
Add 8 units of II and 8 units of XhoI and digest at 37 ° C for 1 hour
The reaction was carried out. HG-CSF was obtained from the reaction solution by the LGT method.
A DNA fragment of about 1.4 kb containing cDNA (XhoI-Bg
About 0.6 μg of tryptophan promoter
2.7 kb DNA fragment (BanIII-BglII digestion)
Fragment) about 0.8 μg was obtained. Separately, the following DNA library
Anker was synthesized. [0094] Embedded imageFirst, single-stranded DNA, 31-mer and 33-mer
It was synthesized by the usual triester method. 31-mer and 3
2 μg of each 3-mer was used in a total volume of 40 μl of T4 kinase buffer.
Dissolved in 30 units of T4 polynucleotide kinase (Takara)
(Manufactured by Seiko Co., Ltd.) and phosphorylation at 37 ° C for 60 minutes.
Was. Next, BanIII-B derived from pCfBA8 obtained above.
0.1 μg of the glII fragment (about 2.7 kb fragment), also pCfBA
XhoI-BglII fragment (about 1.4 kb fragment) from 0.1 μl
was dissolved in 25 μl of T4 DNA ligase buffer.
About 2 pmol of the above DNA linker was added to the mixture. Further
6 units of T4 DNA ligase and ligation at 4 ° C for 18 hours
The reaction was carried out. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed^rColony of
I got From the cultured cells of this colony, plasmid DNA
Was collected to obtain pCfBB101 shown in FIG. pCf
Amino acid sequence of hG-CSF derivative encoded by BB101
The column shows that the first Thr of mature hG-CSF is Ala.
The third Leu is Thr and the fourth Gly is Ar
g, 5th Pro is Ser, 17th Cys is S
has been replaced by er. Thereafter, this derivative was treated with hG-CSF.
[NB101]. (3) pCfBC42B1, pCfBC45,
pCfBC52, pCfBC59, pCfBC76, pCfB
Construction of C77, pCfBC93, pCfBC95, pCfBC97
Synthesis (see FIG. 8): First, synthesize the following DNA linker
Was. [0098] Embedded image This synthetic DNA linker has three bases.
Is one of G, A, T, C, and one salt
If the group is G or A (31-mer), or C or T (33-m
er), for a total of 128 DNA
Obtained as a mixture of kerr. As a result, this DNA library
N-terminal amino acid sequence of hG-CSF encoded by
As the sequence, 16 kinds of amino acids next to Met, Pr
There are eight possibilities for the next amino acid after o
Design so that 128 amino acid sequences are possible
Has been installed. First, single-stranded DNA, 31-mer and 33-mer were passed through.
It was synthesized by the usual triester method. 31-mer and 33
-Mer 2 μg each in a total volume of 40 μl T4 kinase buffer
Dissolved in T4 polynucleotide kinase (Takara Shuzo Co., Ltd.)
Add 30 units and perform phosphorylation at 37 ° C for 60 minutes
Was. Next, BanIII derived from pCfBA8 obtained in Example 6
0.1 μl of a BglII fragment (about 2.7 kb fragment), also pCf
XhoI-BglII fragment derived from BA8 (about 1.4 kb fragment)
Dissolve 0.1 μl in 25 μl T4 DNA ligase buffer,
About 2 pmol of the above DNA linker was added to this mixture.
Was. Add 6 units of T4 DNA ligase and add 18 units at 4 ℃.
A time binding reaction was performed. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed^rColony of
I got From the cultured cells of this colony, plasmid DNA
And pCfBC42B1, pCfBC45, pCfB
C52, pCfBC59, pCfBC76, pCfBC77, p
CfBC93, pCfBC95 and pCfBC97 were obtained. Said
In the dideoxy sequencing method, the DNA linker
When the nucleotide sequence was determined, the N-terminal of the hG-CSF derivative was determined.
It was found that the base sequence at the end was as follows. [0102] Embedded imageHG-CSF derivatives encoded by these plasmids
Are as follows compared to mature hG-CSF, respectively.
The amino acid residue has been substituted. [0103] [Table 3] PCfBC42B1, pCfBC45, pCf
BC52, pCfBC59, pCfBC76, pCfBC77,
Coded in pCfBC93, pCfBC95, pCfBC97
HG-CSF derivatives are hereinafter referred to as hG-CSF, respectively.
[NC42B1], hG-CSF [NC45], hG-CS
F [NC52], hG-CSF [NC59], hG-CSF
[NC76], hG-CSF [NC77], hG-CSF
[NC93], hG-CSF [NC95] and hG-CS
F [NC97]. (4) pCfBD28, pCfBD56, pCf
Construction of BD82: First, synthesize the following DNA linker
Was. [0106] Embedded imageThis DNA linker has four bases.
Any of G, A, T, C, 256 types in total
As a mixture of DNA linkers. as a result,
N-terminal of hG-CSF encoded by this DNA linker
Amino acid sequence of 4 amino acids in 4 places
Potential, 256 amino acid sequences as a whole
It is designed to be. First, single-stranded DNA, 31-mer and 33-mer were passed through.
It was synthesized by the usual triester method. 31-mer and 33
-Mer 2 μg each in a total volume of 40 μl T4 kinase buffer
Toka, T4 polynucleotide kinase 30 units (Takara)
(Manufactured by Seiko Co., Ltd.) and phosphorylation at 37 ° C for 60 minutes.
Was. Next, BanIII derived from pCfBA8 obtained in Example 6
0.1 μg of a BglII fragment (about 2.7 kb fragment), also pCf
XhoI-BglII fragment derived from BA8 (about 1.4 kb fragment)
0.1 μg was dissolved in 25 μl of T4 DNA ligase buffer,
About 2 pmol of the above DNA linker was added to this mixture.
Was. Add 6 units of T4 DNA ligase and add 18 units at 4 ℃.
A time binding reaction was performed. Using the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed^rColony of
I got Recover plasmid from cultured cells of this colony
To obtain pCfBD28, pCfBD56 and pCfBD82
Was. DNA linker by the dideoxy sequencing method
-Base sequence was determined, hG-CSF induction
The nucleotide sequence at the N-terminal side of the body was found to be as follows
did. [0110] Embedded image HG-CSF derivatives encoded by these plasmids
Are as follows compared to mature hG-CSF, respectively.
The amino acid residue has been substituted. [0111] [Table 4] PCfBD28, pCfBD56, pCfBD
The hG-CSF derivative encoded by
hG-CSF [ND28], hG-CSF [ND56] and
And hG-CSF [ND82]. Including pCfBD56
E. coli strain Escherichia coli ECfBD56 (FERM BP
-1221), the E. coli strain containing pCfBD28 is Escherichia coli
Industrial as richia coli ECfBD28 (FERM BP-1479)
Deposited with the Institute of Biotechnology and Industrial Technology
You. (5) Construction of pCfTNS7 (FIG. 14):
Was synthesized. [0114] Embedded imageHG-C encoded by this DNA linker
As the N-terminal amino acid sequence of SF, the first Thr
Amino acid in which four amino acids from Gly to Gly are deleted
Designed to be an acid sequence. First single chain D
NA, 18-mer and 20-mer were obtained by the usual triester method.
Was synthesized. 2 μg each of the 18-mer and 20-mer
Dissolve in a volume of 40 μl T4 kinase buffer,
Add 30 units of Reotide Kinase (Takara Shuzo) and add
For 60 minutes. Next, B derived from pCfBA8 obtained in Example 6
0.1 μg of anIII-BglII fragment (about 2.7 kb fragment)
XhoI-BglII fragment derived from pCfBA8 (about 1.4 k
b) Dissolve 0.1 μg in 25 μl of T4 DNA ligase buffer
Then, about 2 pmol of the above DNA linker was added to this mixture.
I got it. Add 6 units of T4 DNA ligase and add
The binding reaction was performed for 18 hours. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed^rColony of
I got Recover plasmid from cultured cells of this colony
Thus, pCfTNS7 was obtained. Coded to pCfTNS7
The hG-CSF derivative is hereinafter referred to as hG-CSF [ＳＦ1-
4S]. (6) Construction of pCfTAArg4S (Fig. 1
4): The following DNA linker was synthesized. [0119] Embedded image This DNA linker has two bases A
Or G, a total of four types of DNA linkers
Obtained as a mixture. As a result, this DNA linker
The N-terminal amino acid sequence of hG-CSF encoded by
Design so that the fourth amino acid is possible
Has been imported. First, single-stranded DNA, 31-mer and 33-me
r was synthesized by the usual triester method. 31-mer
And 33-mer in a total volume of 40 μl of T4 kinase
30 units of T4 polynucleotide kinase when dissolved in buffer
(Manufactured by Takara Shuzo) and phosphorylation at 37 ° C for 60 minutes.
went. Next, Ban derived from pCfBA8 obtained in the first term
0.1 μg of III-BglII fragment (about 2.7 kb fragment), p
XhoI-BglII fragment derived from CfBA8 (about 1.4 kb fragment)
Piece) 0.1μg dissolved in 25μl T4 DNA ligase buffer
Then, about 2 pmol of the above DNA linker was added to this mixture.
I got it. Add 6 units of T4 DNA ligase and add
The binding reaction was performed for 18 hours. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed^rColony of
I got Recover plasmid from cultured cells of this colony
Then, pCfTAArg4S was obtained. Dideoxy
Determine base sequence of DNA linker by sequencing method
As a result, the nucleotide sequence at the N-terminal side of the hG-CSF derivative
Was found to be as follows. [0123] Embedded image Encoded by pCfTAArg4S
The hG-CSF derivative is hereinafter referred to as hG-CSF [Arg^Four, S
er¹⁷ ]. (7) Construction of pCfTN205 (FIG. 15): Fifth
3 μg of pCfTNS7 obtained in Section 3 was added to 40 μl of K-150 buffer.
Buffer solution (Y-100 buffer solution 100 mM NaCl to 150 mM KCl
(Replaced with PvuI 5)
And 5 units of XhoI were added and the digestion reaction was performed at 37 ° C for 1 hour.
Was. From the reaction solution, tryptophan pro
A DNA fragment of about 1.0 kb containing the motor part (PvuI-
About 0.5 μg of XhoI fragment) was obtained. Separately from this, pCfBA32 obtained in the first term
3 μg was dissolved in 40 μl of K-150 buffer, and the restriction enzyme Pv was dissolved.
Add 5 units of uI and 5 units of XhoI and remove at 37 ° C for 1 hour.
The reaction was carried out. HG-C was obtained from the reaction solution by the LGT method.
A DNA fragment of about 3.0 kb containing most of the SF cDNA (X
(hoI-PvuI fragment) was obtained in an amount of 2 μg. Then obtained above
A PvuI-XhoI fragment derived from pCfTNS7 (about 1.0 k
b) 0.1 μg of XhoI-PvuI derived from pCfBA32
0.3 μg of the fragment (about 3.0 kb) was added to T4 DNA ligase buffer 25
Dissolve in μl, add 3 units of T4 DNA ligase and add 4
The binding reaction was performed at 18 ° C. for 18 hours. Escherichia coli HB101 strain was transformed with the reaction solution.
Convert, Ap^rFrom the colony, and
Recovery of plasmid DNA by the method of Bernvoim et al.
Thus, pCfTN205 shown in FIG. 15 was obtained. pCfTN205
The amino acid sequence of the hG-CSF derivative encoded by
The mature hG-CSF has the first to fourth amino acids deleted.
You. Hereinafter, this derivative is referred to as hG-CSF [△ 1-4]. (8) Construction of pCfTAArg4 (FIG. 15):
40 μl of 3 μg of pCfTAArg4S obtained in Section 6
Dissolve in K-150 buffer and add 5 units of PvuI restriction enzyme and X
5 units of hoI was added and the digestion reaction was carried out at 37 ° C. for 1 hour.
Tryptophan promoter from reaction solution by LGT method
-Containing about 1.0 kb DNA fragment (PvuI-Xho
I fragment) was obtained in an amount of about 0.5 μg. Separately from this, pCfBA32 obtained in the first term
3 μg was dissolved in 40 μl of K-150 buffer, and the restriction enzyme Pv was dissolved.
Add 5 units of uI and 5 units of XhoI and remove at 37 ° C for 1 hour.
The reaction was carried out. HG-C was obtained from the reaction solution by the LGT method.
A DNA fragment of about 3.0 kb containing most of the SF cDNA (X
(hoI-PvuI fragment) was obtained in an amount of 2 μg. Then obtained above
PvuI-XhoI fragment from pCfTAArg4S
(Approximately 1.0 kb) of 0.1 μg and pCfBA32-derived XhoI-
0.3 μg of the PvuI fragment (about 3.0 kb) was added to T4 DNA ligase
Dissolve in 25 μl of buffer and add 3 units of T4 DNA ligase
In addition, a binding reaction was performed at 4 ° C. for 18 hours. Escherichia coli HB101 strain was transformed with the reaction solution.
Convert, Ap^rFrom the colony, and
Recovery of plasmid DNA by the method of Bernvoim et al.
Then, pCfTAArg4 shown in FIG. 15 was obtained. pCfT
Amino acid of hG-CSF derivative encoded by AArg4
The sequence is such that the fourth Gly of mature hG-CSF is Arg
Has been replaced with Thereafter, the derivative was replaced with G-CSF [Arg
4]. (9) Construction of pCfTNS301 (FIG. 16): No.
6 μg of pCfBA8 obtained in Section 1 was diluted with 50 μl of Y-100
Dissolve in buffer solution, 10 units of restriction enzyme HindIII, BglII
 8 units were added and the digestion reaction was carried out at 37 ° C. for 1 hour. reaction
Approximately 1. containing hG-CSF cDNA from solution by LGT method.
4 kb DNA fragment (HindIII-BglII fragment) about 0.6
μg was obtained. Next, the following DNA linker was synthesized. [0133] Embedded image HG-C encoded by this DNA linker
As the N-terminal amino acid sequence of SF, the first Thr
Amino acids from which the 11th amino acid to the 11th Gln have been deleted
Designed to be an acid sequence. First single chain D
NA, 27-mer and 29-mer were converted by the usual triester method.
Was synthesized. 2 μg each of 27-mer and 29-mer
Dissolve in a volume of 40 μl T4 kinase buffer,
Add 30 units of Reotide Kinase (Takara Shuzo) and add
For 60 minutes. Then, the Ban derived from pCfBA8 obtained above
0.1 μg of III-BglII fragment (about 2.7 kb fragment), p
HindIII-BglII fragment derived from CfBA8 (about 1.4 kb)
Fragment) 0.1 μg dissolved in 25 μl of T4 DNA ligase buffer
However, about 2 pmol of the above DNA linker was added to this mixture.
added. Add 6 units of T4 DNA ligase and add 4 ° C
For 18 hours. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed^rColony of
I got From the cultured cells of this colony, plasmid DNA
Was collected to obtain pCfTNS301. to pCfTNS301
The encoded hG-CSF derivative is hereinafter referred to as hG-CSF
[△ 1-11S]. (10) Construction of pCfTNS401 (FIG. 16): Bottom
The DNA linkers described above were synthesized. [0138] Embedded imageHG-C encoded by this DNA linker
As the amino acid sequence of the N terminal of SF, the first Thr
Amino acid with deletion of 7 amino acids from Ser to 7th Ser
Designed to be an acid sequence. First single chain D
NA, the 39-mer and the 41-mer are converted by the usual triester method.
Synthesized. A total of 40 μg of each of the 39-mer and 41-mer was
Dissolve in μl T4 kinase buffer and add T4 polynucleotide.
Add 30 units of tidokinase (Takara Shuzo) and add 60 units at 37 ° C.
The phosphorylation reaction was performed for minutes. Then, the Ban derived from pCfBA8 obtained above
0.1 μg of III-BglII fragment (about 2.7 kb fragment), p
HindIII-BglII fragment derived from CfBA8 (about 1.4 kb)
Fragment) 0.1 μg dissolved in 25 μl of T4 DNA ligase buffer
However, about 2 pmol of the above DNA linker was added to this mixture.
added. Add 6 units of T4 DNA ligase and add 4 ° C
For 18 hours. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed^rThe colony
Obtained. Plasmid DNA from the cultured cells of this colony
It was collected to obtain pCfTNS401. Copy to pCfTNS401
The hG-CSF derivative to be loaded is hereinafter referred to as hG-CSF.
[△ 1-7S]. (11) Construction of pCfTNS501 (FIG. 12):
6 μg of pCfBA8 obtained in the first paragraph was added to 40 μl of Y-
Dissolve in 100 buffer, add 10 units of restriction enzyme XhoI,
Digestion reaction was performed at 7 ° C for 1 hour. Phenol-chloropho
DNA was collected by Rum extraction and ethanol precipitation and
dissolved in Klenow buffer, and
Add 2 units of Klenow fragment and react at 17 ° C for 30 minutes
Was. Treat at 68 ° C for 10 minutes and DNA polymerase I Kleno
-Inactivate the fragment and add KCl to 150 mM to control
Add 8 units of restriction enzyme PvuI and perform digestion reaction at 37 ℃ for 1 hour.
Was. Include hG-CSF cDNA from the reaction solution by LGT method.
Approximately 3 kb DNA fragment [XhoI (Blunt) -Pv
uI] about 2 μg was obtained. Separately, ATG obtained by the method of Reference Example 4
5 μg of the vector pTrS20 (3.8 kb) was added to 50 μl of Y-0.
Buffer (excluding 100 mM NaCl from Y-100 buffer)
), Add 16 units of restriction enzyme SacI, and add
The cleavage reaction was performed for 3 hours. Phenol-chloroform
After extraction, the DNA was recovered by ethanol precipitation,
dissolved in Klenow buffer, and
Add 2 units of Klenow fragment and react at 17 ° C for 30 minutes
Was. Treat at 68 ° C for 10 minutes and DNA polymerase I Kleno
-Inactivate the fragment, add KCl to 150 mM,
Add 8 units of restriction enzyme PvuI and incubate digestion reaction at 37 ° C for 1 hour
went. Approximately 1 kb containing Ptrp was
DNA fragment [SacI (Blunt) -PvuI] about 0.5 μg
I got Next, Xho derived from pCfBA8 obtained above
0.1 μg of I (Blunt) -PvuI fragment (about 3 kb) and pTr
SacI (Blunt) -PvuI fragment from S20 (about 1 kb)
  Dissolve 0.2 μg in 25 μl T4 DNA ligase buffer
And add 3 units of T4 DNA ligase, 4 ° C, 18 hours
A binding reaction was performed. Using the reaction solution, Escherichia coli HB101 strain
And transformed with Ap^rColony of this colony
Plasmid DNA by the method of Burnboim et al.
It was collected to obtain pCfTNS501 shown in FIG. HG-CS encoded by pCfTNS501
The F derivative is used for the mature hG-CSF up to the N-terminal 6 position.
Amino acid was deleted and Cys at position 17 was replaced with Ser.
I have. hG-CSF induction encoded by pCfTNS501
The conductor is hereinafter referred to as hG-CSF [△ 1-6S]. Example 7. (1) pCfCB101, pCfCC52, pCfCC59, C
Construction of fCD28 and pCfCD56 (FIG. 8): First, pBR
322 [Bolivar et al .: Gene2, 95 (19
77)] Dissolve 3 μg in 40 μl of Y-100 buffer,
Add 5 units of elementary PstI and perform digestion reaction at 37 ° C for 1 hour.
Was. Phenol-chloroform extraction and ethanol precipitation
DNA was collected at 33mM, 33mM tris-acetic acid (pH7.9), 66mM
M potassium acetate, 10 mM magnesium acetate, 5 mM dithios
Reitor and 0.4 mM dATP, dCTP, dG
Solution containing TP and dTTP (hereinafter referred to as T4 DNA polymer
Dissolved in 20 μl, and
Add 1 unit of remelase (Takara Shuzo), 37 ℃, 30 minutes
The reaction was carried out. Phenol-chloroform extraction and d
The DNA was recovered by ethanol precipitation, and 20 μl of T4 DNA
Dissolved in gauze buffer. This is BglII linker DN
A (manufactured by Takara Shuzo: d (pC-A-G-A-T-C-T-
G) was added to about 8 pmol, and T4 DNA ligase was further added.
Six units were added and the binding reaction was performed at 4 ° C. for 18 hours. Feno
DNA extraction by extraction with chloroform and ethanol precipitation
Recover and dissolve in 40 μl of Y-100 buffer,
Add 10 units of coRI and 8 units of BglII, 1 hour at 37 ° C
A rapid digestion reaction was performed. From the reaction solution,
Approximately 3.6 kb DNA fragment (E
(coRI-BglII fragment) about 0.9 μg was obtained. Separately from this, pC obtained in Example 6- (2)
fBB101, pCfBC52 obtained in Example 6- (3) or
pCfBC59, pCfBD28 obtained in Example 6- (4)
3 μg of pCfBD56 or Y of 10 times concentration
Dissolve in -100 buffer, 5 units of EcoRI restriction enzyme,
Add 6 units of BglII and perform digestion reaction at 37 ° C for 1 hour.
Was. The hG-CSF cDNA portion was obtained from the reaction solution by the LGT method.
Approximately 1.8 kb DNA fragment containing EcoRI-BglII
About 0.4 μg of each piece was obtained. EcoRI derived from pBR322 obtained above
-BglII fragment (approximately 3.6 kb) was added to 20 μl T4
Five DNA ligase buffer solutions were prepared.
The pCfBB101 or pCfBC52 obtained above
Or pCfBC59 or pCfBD28 or p
An EcoRI-BglII fragment (about 1.8 kb) derived from CfBD56
Fragment) About 0.1 μg each was added separately, and T4 DNA
Four units of ligase were added, and the binding reaction was performed at 4 ° C. for 18 hours. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain was transformed with Tc^RColony of
I got From the cultured cells of this colony, plasmid DNA
Was recovered and pCfCB101, pCfCC52,
pCfCC59, pCfCD52 and pCfCD56 were obtained. This
HG-CSF derivatives encoded by these plasmids
The amino acid sequences are pCfBB101 and pCfBC5, respectively.
2, Coded to pCfBC59, pCfBD28, pCfBD56
The same as the amino acid sequence of the hG-CSF derivative
You. Example 8. Production and purification of hG-CSF derivatives: Examples 3,4
The recombinant plasmid pCfTL23, p obtained in 6 and 7
CfTL35, pCfTL38, pCfTL41, pCfTM
14, pCfTM17, pCfTM113, pCfBB101, p
CfBC42B1, pCfBC45, pCfBC52, pCf
BC59, pCfBC76, pCfBC77, pCfBC93,
pCfBC95, pCfBC97, pCfBD28, pCfB
D56, pCfBD82, pCfTNS7, pCfAAarg
4S, pCfTNS301, pCfTNS401, pCfT
Large with NS501, pCfBD28A17, pCfBD28T17
Enterobacteriaceae W3110strAShares (ECfTL23, EC respectively)
fTL35, ECfTL38, ECfTL41, ECfTM1
4, ECfTM17, ECfTM113, ECfBB101, E
CfBC42B1, ECfBC45, ECfBC52, ECf
BC59, ECfBC76, ECfBC77, ECfBC93,
ECfBC95, ECfBC97, ECfBD28, ECfB
D56, ECfBD82, ECfTNS7, ECfTAAr
g4S, ECfTNS301, ECfTNS401, ECf
TNS501, ECfBD28A17, ECfBD28T17
G) in an LG medium [Bactotryptone 10 g, yeast extract 5
g, 5 g of NaCl and 1 g of glucose in 1 liter of water,
Adjust the pH to 7.0 with NaOH. ] At 37 ° C for 18 hours
Then, 5 ml of this culture was mixed with 25 μg / ml tryptophan and
MCG medium containing Nag / ml of ampicillin [Na_TwoHP
O_Four 0.6%, KH_TwoPO_Four 0.3%, NaCl 0.5%, Kaza
0.5% amino acid, MgSO_Four 1 mM, vitamin B₁ 4 μg /
ml, pH 7.2] inoculate 100 ml and culture at 30 ° C for 4-8 hours.
Tryptophan inducer 3β-indole-ac
Lyric acid (3β-indoleacrylic acid, hereinafter abbreviated as IAA)
10 μg / ml and continue culturing for another 2 to 12 hours.
Was. The culture is centrifuged at 8000 rpm for 10 minutes to collect the cells, and then 30 mM
Wash with NaCl, 30mM Tris-HCl (pH7.5) buffer
Was cleaned. The washed cells are suspended in 30 ml of the above buffer solution, and
Sonication (BRANSON SONIC POWER COMPANY SONIFIERC
(ELL DISRUPTOR200, OUTPUT CONTROL2, processing for 10 minutes)
Was. This was centrifuged at 9000 rpm for 30 minutes to obtain cell residue.
From the cell residue, the method of Marston et al. [F.A.O.
on et al: BIO / TECHNOLOGY2, 800 (1984)].
-The CSF derivative was extracted, purified, solubilized and regenerated. Protein
The amount is measured by Nippon Bio-Rad Laboratories, Inc.
Rotin Assay Kit (Standard Assay)
[M. M. Bradford: Anal. Biochem.,72 , 248 (1976)]
Was performed. The measurement of G-CSF activity was performed as follows.
Was. 8-12 week old C3H / He male mice (Shizuoka
Aseptically remove bone marrow cells from the femur
Α-Minimum with 10% fetal bovine serum (FBS)
Essential Medium (Flow Laboratories, hereafter α-MEM
(Abbreviated as medium). This cell (about 5 × 10⁷ Pcs)
1.5 ml of the turbid liquid is applied to Nylon wool (Wako
Column packed with pure drug, Nylon Fiber 146-04231) (0.3
g) and 5% CO_Two37 in the incubator
The reaction was performed at 90 ° C for 90 minutes. Then α- preheated to 37 ° C
Flow the MEM medium through the column and elute the nylon
Non-adsorbable bone marrow cells were obtained. The cells were converted to α-MEM
The cells were washed once with a medium and adjusted to a predetermined concentration. Next, the method of Okabe et al. [Okabe T. et al.,
 CancerResearch44 , 4503-4506 (1986))
Medullary hematopoietic stem cell colony forming ability was measured. That is, α
-0.2 ml of MEM, 0.4 ml of FBS and each sample diluted in two steps.
Bone marrow cells prepared by the above method in a mixture of 0.2 ml
(2 × 10⁶ Per ml) was mixed. To 42 ℃
Insulated 0.6% agar (Difco, Agar Purified # 0560-01)
 Mix an equal volume (1.0 ml) of the solution, and add 0.5 ml
The seeds were seeded on a dish (Nunc, # 143982) (5 × 10
^Four Pieces / dish, n = 3). 5% CO_Two In the incubator
Culture at 37 ° C for 7 days at 37 ° C.
The number of cells was counted with a microscope (Olympus, X40). Colony
-After counting, take out carefully on a slide glass and
After fixing for 30 seconds with a mixture of ton formalin, Kubota et al.
(Kubota K., et al., Exp.Hematology.8339-344 (1
980)], and esterase double staining was performed.
Was performed. The titer of each sample was determined by the colony formation test.
It was calculated as follows from the counting results in the two-step dilution.
Intact G-CSF roller used as a standard
Activity that gives half the maximum value of knee formation is defined as 50 units
The dilution rate of each sample and the activity per ml
The value was multiplied by 20 to obtain the titer (unit). Specific activity
Sex is indicated by the titer (unit / mg) per unit protein (mg)
did. Intact G-CSF and G-CSF
Table 5 shows the potency of the derivative. [0154] [Table 5]           ────────────────────────────                      The specific plasmid is the specific activity.             Strain Plasmid Produced product Unit / mg Sex ratio           ────────────────────────────            ECfTA1 pCfTA1 G-CSF (intact) 2.2x1O⁸   1.0            ECfTL38 pCfTL38 G-CSF (Ser¹) 4.Ox1O⁸  1.8            ECfTL41 pCfTL41 G-CSF (Arg¹) 3.7x1O⁸  1.7            ECfTL23 pCfTL23 G-CSF (GIy¹) 3.1x1O⁸  1.4            ECfTL35 pCfTL35 G-CSF (Cys¹) 2.9x1O⁸  1.3            ECfBB101 pCfBB101 G-CSF (NBl01) 7.9x1O⁸  3.6            ECfBC42B1 pCfBC42B1 G-CSF (NC42B1) 5.1x1O⁸   2.3            ECfBC45 pCfBC45 G-CSF (NC45) 7.0x1O⁸  3.2            ECfBC52 pCfBC52 G-CSF (NC52) 6.2x1O⁸  2.8            ECfBC59 pCfBC59 G-CSF (NC59) 5.9x1O⁸   2.7            ECfBC76 pCfBC76 G-CSF (NC76) 6.2x1O⁸  2.8            ECfBC77 pCfBC77 G-CSF (NC77) 7.7x1O⁸  3.5            ECfBC93 pCfBC93 G-CSF (NC93) 9.2x1O⁸  4.2            ECfBC95 pCfBC95 G-CSF (NC95) 9.5x1O⁸  4.3            ECfBC97 pCfBC97 G-CSF (NC97) 8.6x1O⁸  3.9            ECfBD28 pCfBD28 G-CSF (ND28) 7.9x1O⁸  3.6            ECfBD56 pCfBD56 G-CSF (ND56) 5.1x1O⁸   2.3            ECfBD82 pCfBD82 G-CSF (ND82) 4.6x1O⁸  2.1            ECfTM14 pCfTM14 G-CSF (Ser¹, Cys^Three) 3.1x1O⁸  1.4            ECfTM17 pCfTM17 G-CSF (Ser¹, Arg^Three) 3.7x1O⁸  1.7            ECfTM113 pCfTM113 G-CSF (Ser¹, Ser^Three) 2.9x1O⁸  1.3            ECfTNS7 pCfTNS7 G-CSF (△ 1-4S) 7.7x1O⁸  3.5            ECfTAArg4S pCfTAArg4S G-CSF (Arg^Four, Ser¹⁷) 5.7x1O⁸  2.6            ECfTNS301 pCfTNS301 G-CSF (△ 1-11S) 3.1x1O⁸  1.4            ECfTNS401 pCfTNS401 G-CSF (△ 1-7S) 5.5x1O⁸  2.5            ECfTNS501 pCfTNS501 G-CSF (△ 1-6S) 4.4x1O⁸  2.0            ECfBD28A17 pCfBD28A17 G-CSF (ND28A17) 6.8x1O⁸  3.1            ECfBD28T17 pCfBD28T17 G-CSF (ND28T17) 5.9x1O⁸  2.7            ECfTN205 pCfTN205 G-CSF (△ 1-4S) 4.2x1O⁸  1.9           ──────────────────────────── Example 9. Activity measurement of hG-CSF derivative on human bone marrow cells:
Extract bone marrow fluid from the iliac bones of healthy people aged 20 to 30
An equal amount of α-MEM medium was added and mixed. Ficoll-Pa
(Ficoll-Paque) solution (Pharmacia Fine Chemicals)
Miccal, specific gravity 1.077) Overlay 3 ml of the above bone marrow fluid on 3 ml
And centrifuged at 400 xg for 30 minutes to remove cells from the middle layer.
separated. Cells were washed with PBS (NaCl 8 g, KCl 0.2
g, Na_TwoHPO_Four 1.15g and KH_TwoPO_Four 0.2g water
Was washed twice with 10% fetal calf
Suspended in α-MEM medium supplemented with baby serum (FBS),
2 × 10⁶Was adjusted to a cell concentration of / ml or less. plastic
・ Sow 10ml into dish (Falcon 3003)
And 5% CO_Two Incubate at 37 ℃ for 90 minutes
And collect non-adherent cells on a plastic dish
did. Wash cells once with α-MEM medium and
The following human bone marrow stem cell growth promoting activity and
It was subjected to a Ronnie formation test. That is, 96-hole flat micro
10% FBS added to each well of the plate (NUNC, 167008) α
Inject 100 μl of MEM medium and then proceed as in Example 8
Each of the hG-CSF and the hG-CSF derivative obtained in
100 μl of the pull was added to the first row. 100μ well mixed solution
Transfer l to the second column to make a 2-fold dilution, and then up to 12 columns
Two-step dilutions (n = 3). As a negative control, α-ME
A group of M medium alone was set up. Next, the bone prepared as described above was added to each well.
Medullary cell suspension 100 μl (nucleated cell count, 5 × 10^Four Seed)
Seed, 5% CO_Two Incubator at 37 ℃ for 3 days
Cultured. 6 in the last 18-20 hours^ThreeH-thymidine [A
Amersham Japan, CodeTRK61, 107mci /
mg] 10 μl was added and the cells were cultured. Cell harvester (C
ell harvester) (Lab Science)
Collected on a lath filter, dried and taken up by cells
Radioactivity in liquid scintillation counter [Packard
(Packard, Tricarb 3320)]. On the other hand, human bone marrow hematopoietic stem cell colony formation test
The experiment and identification of each colony were performed according to the method of Example 8.
Was. The titer of each sample is determined in the colony formation test.
The activity that can form one colony is defined as one unit.
Was. In other words, the linearity of the counting results in two-step dilution
Ha from the dose-response-curve given
lf Max value (1/2 of the maximum capture value) is determined,
The titer of each sample was calculated. The specific activity is determined by the titer (uni) per unit protein (mg).
t / mg). Intact hG-CSF and
Table 6 shows the titer of the hG-CSF derivative. [0159] [Table 6] Example 10. N-terminal 1st to 7th deletion, 17th serine hG-CSF induction
Preparation of body (hereinafter abbreviated as M-7S): recombinant obtained in Example 6
E. coli harboring the plasmid pCfBC59 (ECfBC
Table 2 obtained by culturing and purifying 59) as described in Example 8.
10 mM Tris-H containing derivative (a) (132 μg / ml) of
Against 50 ml of Cl-100 mM NaCl solution (pH 8.0)
Butyrin BPN '(8.5 units / mg protein) (Sigma)
0.7 μg), and incubate at 25 ° C for 40 hours.
Was. Dilute 3 fold with 10 mM Tris-HCl (pH 8.0)
In addition, DE filled with 10 mM Tris-HCl (pH 8.0)
AE-Toyo Pearl 650M (Toyo Soda Kogyo Co., Ltd.) (1.7cm ×
It passed through 4.4 cm) at a flow rate of 10 ml / hour. Then 10mM Tr
20 ml of is-HCl (pH8.0) is passed through the column at a flow rate of 5 ml / hour.
Then, the solution was linearly added to a buffer system of 10 mM Tris-HCl (pH 8.0).
Gradient NaCl from 0M to 0.4M over a total volume of 50ml
In addition, elution was performed at the same flow rate. M-7S derivative is Na
It was eluted at a Cl concentration of 100 to 150 mM (yield 0.7 mg, yield 10
%). Purity was more than 90%. Example 11. Production of M-7S: recombinant plasmid p obtained in Example 6
E. coli having CfBC59 (ECfBC59) was used in Example 8.
The derivatives (b) (132) of Table 2 obtained by culturing and purifying as described
μm / ml) containing 10 mM Tris-HCl-100 mM Na
Subtilin BPN 'to 50 ml of Cl solution (pH 8.0)
(8.5 units / mg protein) (manufactured by Sigma) 0.7 μg,
Incubated at 25 ° C for 14 hours. 10mM Tris-H
After three-fold dilution with Cl (pH 8.0), 10 mM Tris-H
DEAE-Toyopearl 650M filled with Cl (pH 8.0)
(Toyo Soda Industry Co., Ltd.) (1.7cm × 4.4cm) at 10ml / hour
The tower passed at a high speed. Then, 10 mM Tris-HCl (pH 8.0)
After passing 20 ml through the column at a flow rate of 5 ml / hour, 10 mM Tris-HC
1M (pH 8.0) buffer system with NaCl
To 0.4 M over a total volume of 50 ml, and elute at the same flow rate.
Was. The M-7S derivative elutes at a NaCl concentration of 100 to 150 mM
(Yield 4.2 mg, 63%). Purity is more than 90%
Was. Example 12. Production of M-7S: recombinant plasmid p obtained in Example 6
Escherichia coli having CfTAArg4S (ECfTAArg4
Table 2 obtained by culturing and purifying S) as described in Example 8.
10mM Tris-H containing derivative (d) (132 µg / ml) of
Cl-100mM NaCl solution (pH8.0) 50ml
Chiricin BPN '(8.5 units / mg-protein) (Sigma)
0.7 μg), and incubate at 25 ° C for 40 hours.
Was. After adjusting the NaCl concentration to 0.5 M, 10 mM Tris-H was used.
Cl (pH 8.0)-Zn chelate filled with 0.5M NaCl
Tosepharose (Pharmacia Fine Chemicals Co., Ltd.
(1.7 cm × 2.6 cm) at a flow rate of 6 ml / hour. Next
Then, 10 mM Tris-HCl (pH 8.0) -0.5 M NaC
After passing 12 ml of the solution at a flow rate of 3 ml / hour, 10 mM Tris-H was added.
A buffer of Cl-0.5 mM NaCl was applied with a linear gradient from pH 8.0 to pH 8.0.
Elution was performed at the same flow rate over a total volume of 30 ml until H6.0. M
The -7S derivative was eluted around pH 7.0 (yield 0.6 mg, yield
Rate 9%). Purity was 90%. Example 13 N-terminal 1st to 6th deletion, 17th serine hG-CSF induction
Preparation of a derivative (hereinafter abbreviated as M-6S): Derivative (a) (1
10 mM Tris-HCl-100 mM N containing 32 μg / ml)
Subtilisin BP to 50 ml of aCl solution (pH 8.0)
0.7 μg of N ′ (8.5 units / mg protein) (manufactured by Sigma)
And incubated at 25 ° C. for 2 hours. 10mM Tri
After three-fold dilution with s-HCl (pH 8.0), 10 mM Tri was added.
DEAE-Toyopar filled with s-HCl (pH 8.0)
650M (manufactured by Toyo Soda Kogyo Co., Ltd.) (10 ml / 1.7 cm x 4.4 cm)
The column was passed at the current flow rate. Then, 10 mM Tris-HCl (p
H8.0) After passing 20 ml through the column at a flow rate of 5 ml / hour, 10 mM Tris
-HCl (pH8.0) buffer solution with NaCl
Add from 0 M to 0.4 M over a total volume of 50 ml and dissolve at the same flow rate.
Went out. The M-6S derivative has a NaCl concentration of 100 to 150 mM.
(2.6 mg, 40% yield). Purity 90% or less
Was on. Example 14. M-6S production: containing derivative (a) of Table 2 (132 μg / ml)
10 mM Tris-HCl-100 mM NaCl solution (pH 8.
0) 50ml of epolzyme (4120 units / mg protein
Quality) Kyowa Hakko Kogyo Co., Ltd.) (0.7μg), 25 ℃, 20:00
For a while. NaCl concentration was 0.5M
Then, 10 mM Tris-HCl (pH 8.0) -0.5 M NaCl
Chelating Sepharose filled with
6ml in (A Fine Chemical Co.) (1.7cm × 2.6cm)
Per hour. Then, 10 mM Tris-HC
1 (pH 8.0) 12 ml of 0.5 M NaCl at a flow rate of 3 ml / hour.
After passing through the tower, 10 mM Tris-HCl-0.5 M NaCl was released.
Apply a 30 mL total volume from pH 8.0 to pH 6.0 with a linear gradient.
Elution was performed at the same flow rate. M-6S derivative has pH around 7.0
Eluted (2.5 mg, 38% yield). 90% or higher purity
Met. Example 15. Preparation of M-6S: containing derivative (b) of Table 2 (132 μg / ml)
10 mM Tris-HCl 100 mM NaCl solution (pH 8.0)
Subtilisin amylosaccharides for 50 ml.
7 μg was added and incubated at 25 ° C. for 20 hours. Na
After adjusting the Cl concentration to 0.5 M, 10 mM Tris-HCl (pH
8.0) Zn chelate sef filled with -0.5 M NaCl
AROS (Pharmacia Fine Chemical) (1.
(7 cm × 2.6 cm) at a flow rate of 6 ml / hour. Then 10
mM Tris-HCl (pH 8.0) -0.5 M NaCl 12 ml
At a flow rate of 3 ml / hour, and then 10 mM Tris-HCl (pH
8.0) pH 8.0 with a linear gradient in -0.5 M NaCl buffer system
And elute at the same flow rate over a volume of 30 ml from pH 6.0 to pH 6.0.
Was. The M-6S derivative was eluted around pH 7.0 (yield 2.5
mg, yield 38%). Purity was more than 90%. Example 16. Preparation of M-6S: containing derivative (d) of Table 2 (132 μg / ml)
10 mM Tris-HCl-100 mM NaCl solution (pH 8.
0) Subtilisin Carlsberg (0.034) for 50 ml
Unit / mg protein) (NOVO) (0.7 μg) was added and 25
Incubated at ℃ for 20 hours. NaCl concentration 0.5
M, then 10 mM Tris-HCl (pH 8.0) -0.5 M
Zn-chelated Sepharose filled with NaCl
(Almacia Fine Chemical Co., Ltd.) (1.7cm × 2.6c)
m) at a flow rate of 6 ml / h. Then, 10 mM Tri
s-HCl (pH 8.0)-12 ml of 0.5 M NaCl at 3 ml / hour
After passing the column at a flow rate of 10 mM Tris-HCl-0.5 M NaC
1 buffer system from pH 8.0 to pH 6.0 with a linear gradient
Elution was performed at the same flow rate over ml. M-6S derivative is pH
It was eluted around 7.0 (3 mg, 45% yield). Purity 9
0% or more. Example 17: Preparation of M-6S: containing derivative (a) of Table 2 (132 μg / ml)
10 mM Tris-HCl-100 mM NaCl solution (pH 8.
0) Proteinase K (0.027 units / mg-
Protein) (manufactured by Sigma) was added in an amount of 0.7 μg at 25 ° C for 40 hours.
For a while. 10 mM Tris-HCl (pH 8.
0), and then diluted 3 times with 10 mM Tris-HCl (pH 8.
0) Filled with DEAE-Toyopearl 650M (Toyo Soda)
(Manufactured by Kogyo Co., Ltd.) (1.7 cm x 4.4 cm) at a flow rate of 10 ml / hour.
Was. Then, 5 ml of 20 mM 10 mM Tris-HCl (pH 8.0)
After passing through the column at a flow rate of 10 mM / hr, 10 mM Tris-HCl (pH 8.0)
Buffer system with a linear gradient from 0M NaCl to 0.4M Na
Cl to a total volume of 50 ml and elute at the same flow rate.
Was. The M-6S derivative eluted at a NaCl concentration of 100 to 150 mM.
(Yield 2.6 mg, 39%). Purity is more than 90%
Was. Example 18. N-terminal 1st to 5th deletion, 17th serine hG-CSF derivative
Preparation of (hereinafter abbreviated as M-5S): Derivative (b) (132) in Table 2.
μm / ml) containing 10 mM Tris-HCl-100 mM Na
Trypsin (267 units) for 50 ml of Cl solution (pH 8.0)
/ Mg-protein) (manufactured by Sigma) in an amount of 0.5 μg,
Incubated at 10 ° C for 10 hours. 0.5M NaCl concentration
After that, 10 mM Tris-HCl (pH 8.0) -0.5 M N
Zn-chelated Sepharose filled with aCl
Lumasia Fine Chemical Co., Ltd.) (1.7cm × 2.6cm)
At a flow rate of 6 ml / h. Then, 10 mM Tris
-HCl (pH 8.0) -0.5M NaCl 12ml of 3ml / h
After passing through the column at a flow rate, 10 mM Tris-HCl (pH 8.0) -0.5
M NaCl buffer system with a linear gradient from 0M to 0.3M.
Add the imidazole from above at a total volume of 30 ml and dissolve at the same flow rate.
Went out. M-5S derivative is 0.1M imidazole
Eluted (2.7 mg, 41% yield). 90% or higher purity
Met. Example 19. Preparation of M-4S: containing derivative (d) of Table 2 (132 μg / ml)
10 mM Tris-HCl-100 mM NaCl solution (pH 8.
0) For 50 ml, trypsin 267 units / mg-protein
(Manufactured by Sigma) in an amount of 5 μg, and incubated at 25 ° C. for 20 hours.
I was vate. After adjusting the NaCl concentration to 0.5 M, the 10 mM Tr
is-HCl (pH 8.0)-filled with 0.5 M NaCl
Zn Chelate Sepharose (Pharmacia Fine)
・ Chemical) (1.7cm × 2.6cm) at a flow rate of 6ml / hour
I passed through the tower. Then, 10 mM Tris-HCl (pH 8.0)-
The column was passed through 12 ml of 0.5 M NaCl at a flow rate of 3 ml / hour, and then 10 mM
 Tris-HCl (pH 8.0)-0.5 M NaCl buffer
A linear gradient from 0M to 0.3M of imidazole was added to the system.
Elution was performed at the same flow rate by adding over a total volume of 30 ml. M-
The 4S derivative was eluted with 0.1 M imidazole (yield 2.
7 mg, 41% yield). Purity was more than 90%. Example 20. Preparation of M-4S: containing derivative (d) of Table 2 (132 μg / ml)
10 mM Tris-HCl-100 mM NaCl solution (pH 8.
0) α-chymotrypsin 267 units / mg-protein per 50 ml
Quality (manufactured by Sigma) in an amount of 5 μg, and then add
Was added. After adjusting the NaCl concentration to 0.5 M, 10 mM T
ris-HCl (pH 8.0)-filled with 0.5 M NaCl
Zn Chelate Sepharose (Pharmacia Phi
Flow rate of 6 ml / hour for (1.7 cm x 2.6 cm)
I passed through the tower. Then, 10 mM Tris-HCl (pH 8.0)
After passing 12 ml of -0.5 M NaCl at a flow rate of 3 ml / hour, 10 ml
mM Tris-HCl (pH 8.0)-0.5 M NaCl buffer
Imidazole from 0M to 0.3M with linear gradient in liquid system
Was added over a total volume of 30 ml, and elution was performed at the same flow rate. M
-4S derivative was eluted with 0.1M imidazole (yield
2.3 mg, 35% yield). Purity was more than 90%. Example 21. It was recognized in Examples 10-20
As shown, the 17th is substituted with serine, and the N-terminal amino acid
Has 4 deletions (M-4S), 5 deletions (M-5S), 6
Deleted (M-6S), and 7 deleted (M-7S)
The obtained hG-CSF derivative is obtained. Generally recombinant DNA
When using the technique, a methionine is added to the N-terminus.
This is one disadvantage of recombinant products. But the book
With the enzymatic cleavage method of the invention, methionine is added to the N-terminal.
Advantageously, it can be manufactured without adding. G-CSF of the derivative thus obtained
The activities were measured and compared. Table 7 shows the results. [0173] [Table 7] From the results of Table 7, N-terminal side amino acids 4 to 7
All of the deletions were intact hG-CSF.
2 to 4 times higher activity in in vitro evaluation
Was issued. Therefore, the N-terminal side which can be produced by the present invention
In the amino acid deletion, methionine is not added to the N-terminal side,
Moreover, it has 2 to 4 times higher activity than intact.
You. For hydrolases due to mutations at the N-terminal part
The following example demonstrates the acquisition of cleavage reactivity (sensitivity)
You. Experimental Example 1. Intact hG-CSF and N-terminal mutant hG-CSF
Of Reactivity to Subtilisin Carlsberg In the same manner as in Example 16, the derivatives of Table 2 and intact h
G-CSF to be subtilisin Carlsberg (NOVO
Company) 3.6 × 10^-FourUnit / mg-14 hours in the presence of G-CSF, 2
After incubation at 5 ° C,
An M-6S derivative was obtained, but intact hG-CSF
Was unreacted. Furthermore, the amount of enzyme is 100 times (3.6 × 10^-2single
Position / mg-G-CSF).
There was no formation of 6S and the overall decomposition reaction took precedence. Experimental Example 2. Intact hG-CSF and N-terminal mutant hG-CSF
Of Reactivity of Trypsin to Trypsin In the same manner as in Example 19, the derivative (a) in Table 2 was intact.
hG-CSF was converted to trypsin (Sigma) 0.22 unit / mg-
Incubate at 25 ° C for 20 hours in the presence of G-CSF
As a result, the M-4S derivative was obtained from the derivative (a) in Table 2.
However, intact hG-CSF was unreacted.
Furthermore, the enzyme amount was increased to 100 times (22 units / mg-G-CSF).
However, M-4S is not generated in intact hG-CSF.
The overall decomposition reaction took precedence. Experimental Example 3. Thermal stability of hG-CSF derivative: of the present invention shown in Table 8
20 μg of various derivatives was added to a phosphate buffer-saline (PB)
S) (pH 7.2) or 10% fetal bovine serum (FBS) added α
-Dissolved in 1 ml of MEM medium. Incubate at 56 ° C
And taking samples over time to determine its CSF activity
Colony formation test using mouse bone marrow cells (Okabe et al.
Method). Each sample was diluted to 40 ng / ml using a two-step dilution method.
Perform 10 steps of dilution, measure each step, and
Add activity at any concentration that gives a Dose response.
Residual activity was determined by comparison with before heat (0 min).
Residue in PBS or α-MEM medium supplemented with 10% FBS
Table 8 (A) and Table 8 (A)
And (B). [0180] [Table 8] Example 22. PCfBD28A17, pCfBD using site-directed mutation
Construction of 28T17 (see Fig. 17): (a) Production of template single-stranded DNA (single-stranded pt19BD28N)
Composition: 3 μg of pCfBD28 obtained by the method of Example 6 (4)
Dissolve in 0 μl of Y-100 buffer, and use restriction enzyme BanIII
(Manufactured by Toyobo) and PstI by 10 units each
Then, a cleavage reaction was performed at 37 ° C. for 2 hours. From this reaction solution, L
According to the GT method, the N-terminal part of the hG-CSF derivative (ND28)
A DNA fragment of about 210 bp (BanIII-Ps
About 0.1 μg of the (tI fragment) was obtained. On the other hand, M13m which is an M13 phage vector
1 μg of p19RFDNA (manufactured by Takara Shuzo Co., Ltd.) was used in a total volume of 50 μl
-50 buffer solution and use the restriction enzyme AccI (Toyobo Co., Ltd.)
Was added at 37 ° C. for 2 hours. So
After that, add NaCl so that the NaCl concentration becomes 100 mM.
And add 10 units of restriction enzyme PstI and cut at 37 ° C for 2 hours
The reaction was carried out. About 7.24 kb from this reaction solution by LGT method
About 0.8 μg of the DNA fragment (AccI-PstI fragment)
Obtained. The BanIII-PstI fragment obtained above (approximately 2
10 bp) 0.2 μg and the AccI-PstI fragment (about 7.24 k
b) Dissolve 0.05 μg in 50 μl of T4 ligase buffer and add
Add 10 units of T4 DNA ligase to the mixture of
An interbonding reaction was performed. Next, according to a known method,
Transfection of E. coli JM105 strain using the reaction solution
As a result, a recombinant phage was obtained. This recombinant phage
Plasmids were obtained from the cultured cells of infected E. coli JM105 strain.
Recombinant M13 phage RFDN was prepared according to the DNA recovery method.
A was recovered. This RF DNA (this is called pt19BD28N
Are called PstI, EcoRI, AvaI,
Cleavage with XhoI for polyacrylamide gel electrophoresis
More confirmed. Therefore, from this recombinant phage,
Single-stranded pt19BD28N was recovered and used as a template according to the method of
Was. (B) Gapped duplex DNA
Creation of (Gapped Duplex DNA): M13mp19RFDN
Dissolve 3 μg of A (Takara Shuzo) in 30 μl of Y-100 buffer.
However, each of the restriction enzymes EcoRI and HindIII was added 10 times.
Each unit was added and the cleavage reaction was carried out at 37 ° C for 2 hours. This anti
About 7.2 kb of DNA fragment (Eco
RI-HindIII fragment) about 2.5 μg was obtained. EcoRI-derived from this mp19RF DNA
HindIII fragment (about 7.2 kb) and the template single-stranded D obtained in the previous section
NA, 1 µg of pt19BD28N in 27 µl of Klenow buffer
Dissolve and boil at 100 ° C for 6 minutes to transform DNA.
Sexuality. Then, 10 minutes at 65 ° C, 40 minutes at 37 ° C, 4 ° C
For 40 minutes and in ice for 10 minutes to perform an annealing reaction.
The G-SCF gene portion of the mold is single-stranded.
A top duplex DNA was generated. Generated
Gapped duplex DNA is recovered by the LGT method.
Received. (C) Mutagenesis (pt19BD28NA17,
Construction of pt19BD28NT17): hG-C obtained in Example 6
It is the 17th amino acid from the N-terminal of SF derivative [ND28].
Single-stranded DN required to replace a Ser with Ala
Place A (this is called D-1) and Ser in Thr.
Single-stranded DNA required for conversion (this is called D-2
(B) was synthesized by the usual triester method. D-1
The base sequences of (33-mer) and D-2 (33-mer) are shown below.
You. [0187] Embedded imageStu by mutagenesis with D-1
The I site was converted to Xba by mutagenesis with D-2.
I site is designed to be newly created
Therefore, those with the introduced mutations are
Can be confirmed by cutting. D-1, D-2
Dissolve 1 μg separately in 50 μl T4 kinase buffer
And add 30 units of T4 polynucleotide kinase and add
For 60 minutes. Next, this phosphorylated D-1 or D
0.2 g of -2 and the gapped duplex obtained in the previous section
0.1 μg of DNA in 6.5 mM Tris-HCl (pH 7.5),
8 mM MgCl_Two, 1 mM 2-mercaptoethanol and 1
Dissolve in 34 μl of buffer containing 00 mM NaCl,
For 1 minute and room temperature for 30 minutes.
Annealed to gapped duplex DNA. DATP, dTTP and dCT were added to this solution.
After adding P and dGTP to 0.5 mM each,
1.5 units of DNA polymerase I Klenow fragment plus 10 units
Add T4 DNA ligase at 4 ° C for 16 hours at 16 ° C.
Responded. E. coli JM105 was transfected with the reaction solution.
After the transfection, a mutated phage was obtained. Mutation introduction
RF DNA was recovered from E. coli JM105 infected with phage.
AvaI, XhoI, StuI (using D-1
Case) or XbaI (when D-2 is used)
After that, it was confirmed by polyacrylamide gel electrophoresis.
RF DNA having the mutation introduced by D-1 was pt19BD28
RF DNA into which mutation was introduced by NA17, D-2 was pt
Called 19BD28NT17. StuI of pt19BD28NA17
XbaI site near the site and pt19BD28NT17
The following nucleotide sequence is confirmed by M13 file.
Confirmation by the dideoxy sequencing method using
Was. [0191] Embedded image (D) pCfBD28A17 and pCfBD28
Construction of T17: pt19BD28NA17 or p obtained in the previous section
Dissolve 173 μg of t19BD28NT in 50 μl of Y-100 buffer
And 10 units of each of the restriction enzymes AvaI and XhoI
In addition, a cleavage reaction was performed at 37 ° C. for 2 hours. LGT from reaction solution
Approximately 110 bp of D containing the mutation site introduced in the previous section
0.05 μg of an NA fragment (AvaI-XhoI fragment) was obtained. On the other hand, pCfBD28 obtained in (4) of Example 6
Dissolve 2 μg in 50 μl of Y-100 buffer and add restriction enzyme X
Add 10 units each of hoI and BglII, 2 hours at 37 ° C
A cleavage reaction was performed. From this reaction solution, by the LGT method,
About 2.74 kb DN containing tryptophan promoter
About 1 μg of A fragment (XhoI-BglII fragment) was obtained. Ma
282 μg of pCfBD was dissolved in 50 μl of Y-100 buffer.
Then, 10 units of restriction enzyme BglII was added, and the mixture was cut at 37 ° C. for 2 hours.
Responded. BglII cleavage by agarose gel electrophoresis
After confirming that it was completely performed, the restriction enzyme Av
5 units of aI were added and a partial cleavage reaction was performed at 37 ° C. for 10 minutes.
The mature hG-CSFc was obtained from the reaction solution by the LGT method.
Approximately 1., including the bulk of the DNA and the lpp terminator
A 29 kb DNA fragment (BglII-AvaI fragment) was
g was obtained. Next, Xho derived from pCfBD28 obtained above
0.1 μg of I-BglII fragment (about 2.74 kb) and BglII-
AvaI fragment (about 1.29 kb) and pt19BD28NA17 or
Is the AvaI-XhoI fragment of pt19BD28NT17 (about 11
0bp) Dissolve 0.02 μg in 60 μl of T4 ligase buffer,
Add 0 units of T4 DNA ligase and bind at 12 ° C for 16 hours
The reaction was carried out. Escherichia coli HB101 strain was transformed with the reaction solution.
Convert, Ap^rColonies were obtained. Culture of this colony
Plasmid DNA was recovered from the cells. pt19BD28N
A17 was used to construct a plasmid constructed with pCfBD28A17,
Plasmid constructed using pt19BD28NT17
Called fBD28T17. The structure of pCfBD28A17 is Av
After digestion with aI, XhoI, BglII, StuI, agaro
Confirmation was performed by gel electrophoresis. Also, pCfBD28
The structure of T17 is AvaI, XhoI, BglII, XbaI
And then confirmed by agarose gel electrophoresis. HG encoded by these two plasmids
-CSF derivatives are compared to mature hG-CSF, respectively.
And amino acid residues are substituted as follows. [0197] [Table 9] PCfBD28A17 and pCfBD28T17
The hG-CSF derivative encoded by
G-CSF [ND28A17], hG-CSF [ND28T1
7]. Reference Example 1. Plasmid pCSF1-2 carrying hG-CSF cDNA
Isolation (1) Poly (A) RN from normal human peripheral blood macrophages
Preparation of A: White blood cells obtained by centrifugation from peripheral blood of a normal person
Culture in a plastic bottle to wash non-adherent cells
・ By removing, macrophages that are adhesive cells
Page was isolated. From this macrophage, thiocyan
Guanidine acid-lithium chloride method (Cathala et al .:
DNA (DNA)2, 329 (1983)).
RNA having lipase (A) was prepared as follows. [0200] Hitachi RPR10
Centrifuged at 1800 rpm for 20 minutes to precipitate blood cells.
This was added to 50 ml phosphate buffered saline [NaCl 8 g / l, K
Cl 0.2 g / l, anhydrous Na_TwoHPO_Four 1.15 g / l, KH_Two
PO_Four 0.2 g / l (pH 7.2); hereinafter abbreviated as PBS]
Suspended. 25 ml of this suspension is used as a lymphocyte separation solution [Bionete
BIONETICS Co., Ltd.]
The mixture was centrifuged at 1800 rpm for 30 minutes in a rotor. Middle layer white
Collect blood cells and wash with an equal volume of PBS (HitachiRPR10
5% calf fetus after 1500 rpm for 10 minutes)
20 ml of RPMI1640 medium containing serum (Nissui Pharmaceutical Co., Ltd.)
Was suspended and cultured. For culture, use a tissue culture flask (
Manufactured by Erning Co., Ltd. After culturing at 37 ° C for 1.5 hours,
The culture supernatant was removed together with the non-adherent cells. 20 new
0.3 mg / ml of E. coli lipopolysaccharide (LPS) and the same medium
And cultured at 37 ° C. for 4 hours. Then,
From the nutrient solution, centrifuge at 1100 xg for 10 minutes at 4 ° C.
Was collected, washed with 80 ml of PBS, and then washed with 5M thiocyanic acid.
Guanidine, 10 mM EDTA, 50 mM Tris-HCl
(PH 7.0) and 8% (v / v) 2-mercaptoethanol
Using a vortex mixer in 10 ml of a solution consisting of
Solubilized. Transfer this lysate to a centrifuge tube and add 4M LiCl
After 80 ml of the solution was added and stirred, the mixture was allowed to stand at 4 ° C. for 20 hours.
Centrifuge with Hitach-i RPR10 rotor at 9000 rpm for 90 minutes
Thereafter, the RNA was recovered as a precipitate. 4M RNA precipitation
Suspended in 50 ml of a solution consisting of urea and 2M lithium chloride
And centrifuged at 9000 rpm for 60 minutes in a Hitachi RPR10 rotor.
Thereafter, the RNA was recovered again as a precipitate. RNA precipitation was performed with 0.1% sodium lauryl sulfate.
Um, 1 mM EDTA, 10 mM Tris-HCl (pH 7.
Dissolve in 10 ml of the solution consisting of 5)
After extraction with lume, the precipitate was collected by ethanol precipitation. Obtained
About 0.8 mg of RNA was added to 10 mM Tris-HCl (pH 8.0)
And 1 mM EDTA. 65
Incubate for 5 minutes at 0 ° C and add 0.1 ml of 5M NaCl.
added. Transfer the mixture to an oligo (dT) cellulose column
[PL Biochemical (PL Biochemical)
Company) chromatography (column volume 0.5ml)
Was. The mRNA having the adsorbed poly (A) was converted to 10 mM Tr.
A solution consisting of is-HCl (pH 7.5) and 1 mM EDTA
Eluted with the solution to obtain about 30 μg of mRNA having poly (A).
Was. (2) cDNA synthesis and vectorization of the DNA
Insertion: Okayama-Berg method
Regular and Cellular Biology (Mol.Ce
ll.Biol.),2, 161 (1982)].
And the construction of a recombinant plasmid incorporating it
Was. The outline of the process is shown in FIG. PCDV1 [Okayama and Berg (O
kayama & Berg): molecular and cellular ba
Iodology (Mol.Cell.Biol.),3, 280 (1983)] 400μ
g of 10 mM Tris-HCl (pH 7.5), 6 mM MgCl_Two
And 10 mM NaCl to a solution of 300 μl.
Add 500 units of KpnI to the mixture and react at 37 ° C for 6 hours.
And cut at the KpnI site in the plasmid. Feno
After extracting with chloroform, the DNA was precipitated by ethanol precipitation.
Was recovered. Approximately 200 μg of the DNA digested with KpnI was
M sodium cacodylate, 30 mM Tris-HCl (pH
6.8), 1 mM CaCl_Two And 0.1 mM dithiothreito
(Hereinafter abbreviated as DTT)
DTTP to 0.25 mM in T buffer)
Add 200 μl of added solution and 81 units of terminal
Deoxynucleotidyl transferase (hereinafter Td)
T) (P-L Bioche-micals) and add 3
The reaction was performed at 7 ° C. for 11 minutes. Here, Kpn of pCDV1
About 67 poly (dT) chains are added to the 3 ′ end of the I cleavage site.
Was. Phenol-chloroform extraction from the solution, ethanol
PCDV with poly (dT) chains added by phenol precipitation
About 100 μg of 1 DNA was recovered. The DNA was added to 10 mM Tri.
s-HCl (pH 7.5), 6 mM MgCl_Two, 100mM NaC
1 μl of buffer solution (150 μl) and 360 units of Ec
oRI was added and reacted at 37 ° C. for 2 hours. The reaction is
After treatment by the GT method, a DNA fragment of about 3.1 kb was recovered, and about 60 kb was recovered.
μg of poly (dT) chain-added pCDV1 was obtained. The DNA
With 10 mM Tris-HCl (pH 8.0) and 1 mM EDT
Dissolve in 500 μl of the solution consisting of A
After the incubation, cool with ice and add 50 μl of 5M NaCl.
Was. Mix the mixture with an oligo (dA) cellulose column (Collaboration
The product was subjected to chromatography (manufactured by Lativ Research).
Those with a sufficient poly (dT) chain length adsorb to the column,
With 10 mM Tris-HCl (pH 8.0) and 1 mM EDT
A, eluted with a solution consisting of p
27 μg of CD1 (hereinafter abbreviated as vector primer)
Obtained. Next, linker DNA was prepared. pL
1 [Okayama & Berg:
Molecular and Cellular Biology (Mol.
Cell. Biol.),3, 280 (1983)] Approximately 14 μg of 10 mM Tri
s-HCl (pH 7.5), 6 mM MgCl_Two And 50 mM Na
In addition to 200 μl of buffer consisting of Cl, 50 units of P
stI was added and the reaction was carried out at 37 ℃ for 4 hours in pL1 DNA.
Cleavage at the PstI site of The reaction product was phenol-
After extraction with chloroform, ethanol precipitation is performed to obtain PstI.
About 13 .mu.g of pL1 DNA cleaved with 1. was recovered. The DNA
About 13 μg was added to TdT buffer to give a final concentration of 0.25 mM dGTP.
In addition to 50 μl of the solution containing TdT (P-L Biochemica
54 units) and incubated at 37 ° C for 13 minutes,
About 14 (dG) chains were added at the 3'end of the PstI cleavage site of pL1.
I added one. Ethanol after phenol-chloroform extraction
The DNA was recovered by precipitation. The DNA was added to 10 mM Tri.
s-HCl (pH 7.5), 6 mM MgCl_TwoAnd 60 mM N
Add 100 μl of aCl buffer, and add 80 units of
Add HindIII and incubate at 37 ℃ for 3 hours,
It was cut at the HindIII site of pL1 DNA. The reactant
Was fractionated by agarose gel electrophoresis to give about 0.5 kb DN
The A fragment is processed by the DEAE paper method [Dretzen]
Et al: Analytical Biochemistry (Anal.Bioch
em.),112,  295 (1981)], oligo (dG)
Linker DNA with a chain (hereinafter simply abbreviated as linker DNA
Note). About 3 μ of poly (A) RNA prepared above
g, about 1.4 μg of vector primer was added to 50 mM Tris-H.
Cl (pH 8.3), 8 mM MgCl_Two, 30 mM KCl, 0.3 mM D
TT, 2 mM dNTP (dATP, dTTP, dGTP
And dCTP) and 10 units of ribonucleasein
Solution consisting of inhibitor (P-L Biochemicals) 22.3μ
and 10 units of reverse transcriptase (manufactured by Seikagaku Corporation)
Incubate at 41 ° C for 90 minutes to complement mRNA
DNA was synthesized. The reaction is phenol-chloro
After form extraction and ethanol precipitation, RNA-DNA
The vector primer DNA to which the heavy chain was added was recovered.
The DNA was combined with 66 μM dCTP and 0.2 μg poly (A).
Dissolve in 20 µl of TdT buffer solution containing 14 units of TdT (P-
L Bio-chemicals) and incubate at 37 ° C for 2 minutes.
And add 20 (dC) chains to the 3 'end of the cDNA.
Was. The reaction was phenol-chloroform extracted and
CDNA-vector with (dC) chain added by
The terprimer DNA was recovered. The DNA was added to 10 mM T
ris-HCl (pH 7.5), 6 mM MgCl_Two And 60mM
 Dissolve in 400 μl of NaCl solution and add 20 units of Hin
Add dIII and incubate at 37 ° C for 2 hours.
Cleavage at the dIII site. The reaction is phenol-chloro
Form extraction, ethanol precipitation and 0.5 picomoles of (dC)
 A strand-added cDNA-vector primer DNA was obtained.
0.2 pmol of the DNA and the linker DNA 0.4
Picomol is 10 mM Tris-HCl (pH 7.5), 0.1 M Na
Dissolved in 100 μl of a solution consisting of Cl and 1 mM EDTA
And at 65 ° C, 42 ° C, and 0 ° C for 10, 25, and 30 minutes, respectively.
Incubated. 20 mM Tris-HCl (pH 7.5),
4 mM MgCl_Two, 10 mM (NH_Four)_TwoSO_Four, 0.1M KCl
And the composition of 0.1 mM β-NAD makes the total volume 1000 μl.
A reaction solution was prepared. The reaction solution contains 25 units of E. coli DNA.
Ligase (New England Biolabs)
In addition, the mixture was incubated at 11 ° C. for 18 hours. The reaction solution was added to each
Components to become 40 μM dNTP and 0.15 mM β-NAD
Add 10 units of E. coli DNA ligase, 20 units
E. coli DNA polymerase I (P-L Biochemicals)
E. coli ribonuclease H (P-L Bi
ochemicals) at 12 ℃ and 25 ℃ for 1 hour
Incubated. In the above reaction, the recombinant containing cDNA
Circularization of DNA and RNA part of RNA-DNA duplex
A complete double-stranded DNA recombinant
A plasmid was generated. (3) Recombinant D containing hG-CSF cDNA
Selection of NA: Use the recombinant plasmid obtained in (2)
E. coli C600SF8 strain by the method of Scott et al.
[Katsuya Shigesada: Cell EngineeringTwo , 616 (1983)]
did. About 9200 colonies obtained were treated with nitrocellulose.
-Fixed on the filter. Nagata et al. (Nagata et al .:
Nature319 , 415 (1986)] isolated hG
-Corresponds to the N-terminal 9 amino acids of the mature protein of CSF
27-base synthetic DNA 5'-ACCCCCCTGGGCCCTGCCAGCTCCCTG-
3 '³²Strongly associated with P-labeled probe at 60 ° C 1
Selected strains [Grunstein-
Hogness) method, Proceeding of the National
Naru Academia of Science (Proc. Natl. Ac
ad. Sci.) USA72, 3961 (1975)]. The plastic that this strain has
Full nucleotide sequence of cDNA of Smid pCSF1-2
Of the dideoxy sequence using M13 phage
It was determined by the method (SEQ ID NO: 1). As a result, pCSF
The cDNA of 1-2 encodes hG-CSF.
Turned out to be. This strain was transformed into Escherichia c as described above.
oli ECSF1-2 [FERM BP-1220]
Deposited at the Institute of Biotechnology and Industrial Technology. Reference Example 2. Separation and purification of plasmid pKYP26 E. coli containing pKYP26 [Escherichia coli IKYP26 (F
ERM BP-863)] in an L medium containing 50 μg / ml ampicillin.
Ground (1% bactotripton, 0.5% yeast extract, 1% N
(aCl, pH 7.5) at 37 ° C. for 18 hours. This culture
1 L of L medium containing 50 μg / ml ampicillin
The cells were inoculated into and cultured at 37 ° C. Four hours later, chloramphe
Nicole was added to a concentration of 170 μg / ml, and 37
The culture was performed at 16 ° C for 16 hours. Centrifugation (5000 rpm for 10 minutes)
After harvesting the cells and washing the cells with 0.8% NaCl,
Suspend in 20 ml of 0 mM Tris-HCl (pH 8.0) and cool on ice.
Was. Add 8ml of 10mg / ml lysozyme and leave in ice for 10 minutes
Then, add 9.6 ml of 0.5 M EDTA and let stand on ice for 10 minutes.
2.3% 2% Triton X-100 (Wako Pure Chemical Industries, Ltd.)
ml was added and the mixture was left still on ice for 1 hour. 4 at 50000 × g
Ultracentrifugation was performed at 1 ° C. for 1 hour to obtain about 40 ml of the supernatant. next
3M NaOH was added to the supernatant to adjust the pH to 12.5.
Stir gently for 10 minutes. 2M Tris-HCl (pH 7.
5) was added, the pH was returned to 8.5, and the mixture was further stirred for 3 minutes.
At this point, the volume of the liquid was about 55 ml. 1/9 volume of 5M
 After adding NaCl, phenol extraction was performed. 1
/ 250 volume of 5 mg / ml RNase A (Sigma).
After performing RNA degradation reaction at 37 ° C for 1 hour,
Of 5M NaCl and add 1/3 volume of 30% PEG6000
(Manufactured by Hani Chemical Co., Ltd.) was added and the mixture was allowed to stand at -20 ° C for 2 hours.
The precipitate was collected by a centrifugation method, and 10 mM Tris-HCl (pH 7.
5) Dissolve in 2 ml of 1 mM EDTA
Um Dodecyl Sulfate (SDS) reduced to 0.5%
And add proteinase K (manufactured by Sigma)
g / ml, 37 ° C, 1 hour
Responded. After repeating phenol extraction three times,
DNA recovery by chloroform extraction and ethanol precipitation
10 mM Tris-HCl (pH 7.5) and 1 mM ED
Dissolved in 1 ml of a solution consisting of TA. In this way, pKY
800 μg of P26 was obtained. Structure of pKYP26
Are EcoRI, KpnI, BamHI, BglII, P
It was cut with stI and confirmed by agarose gel electrophoresis. Reference Example 3. 1) Plasmid pLT1 carrying human LTcDNA
Release: (1) Preparation of poly (A) RNA from LukII cells: human
From the lymphoblastoid cell line LukII, guanidine thiocyanate
Gin-lithium chloride method [Cathala et al .: Die
Nuei (DNA)2, 329 (1983)].
Was prepared as follows. Human lymphoblastoid cell line LukII [Berrit
Berish Y. Rubin et al .: Procedure
Ing of the national academy of sa
Jens (Proc. Natl. Acad. Sci.) USA82, 6637 (19
85)] with 5% fetal calf serum and 1 mM N-2-hydro
Xyethylpiperazine-N'-2-ethanesulfonic acid
(HEPES) containing 1 l of RPMI1640 medium (Nissui
8 × 10^Five/ Ml and inoculated.
I let you. Use spinner culture bottle for culture
Was. After culturing at 37 ° C for 48 hours, collect cells by centrifugation.
10 ng / ml phorbol myristate acetate
(PMA; Phorbol myristate acetate) and 5% calf
New 1 l RP containing fetal serum and 1 mM HEPES
The cells were transferred to MI1640 medium and cultured at 37 ° C. for 48 hours. Continued
From a part (250 ml) of this cell suspension, 1100 × g,
Collect the cells by centrifugation at 4 ° C for 10 minutes, and add 80 ml of phosphoric acid.
After washing with salt buffer, 5M guanidinium thiocyanate
, 10 mM EDTA, 50 mM Tris-HCl (pH 7.0)
And 8% (V / V) 2-mercaptoethanol
Solubilized in 10 ml of solution using a vortex mixer
Was. The lysate was transferred to a centrifuge tube and 4M LiCl solution 8
After adding 0 ml and stirring, the mixture was allowed to stand at 4 ° C. for 20 hours. Hitac
hi After centrifugation at 9000 rpm for 90 minutes in a RPR10 rotor, RN
A was collected as a precipitate. RNA precipitation was performed with 4M urea and
Suspension in 50 ml of a solution consisting of
i After centrifugation at 9000 rpm for 60 minutes in an RPR10 rotor,
RNA was collected as a precipitate. 0.1% LA
Sodium uryl sulfate, 1 mM EDTA, 10 mM Tris
-HCl (pH 7.5) dissolved in 10 ml
Extraction with ethanol-chloroform and ethanol precipitation.
Received. About 2.5 mg of the obtained RNA was added to 10 mM Tris-HC.
1 (pH 8.0) and 1 mM EDTA
I did it. Incubate at 65 ° C for 5 minutes, and add 0.1 ml of 5M
NaCl was added. Mix the mixture with oligo (dT) cellulose
・ Column [P-L Biochemi
cal) company] chromatography (column volume 0.5 ml)
I took it. 10 mM of mRNA having adsorbed poly (A)
Tris-HCl (pH 7.5) and 1 mM EDTA
Eluted with a solution containing 100 μl of mRNA containing poly (A).
g was obtained. (2) cDNA synthesis and vectorization of the DNA
Insertion: Okayama-Berg method
Regular and Cellular Biology (Mol. C
ell. Biol.),2, 161 (1982)].
And the construction of recombinant plasmids incorporating it
Was. The outline of the process is shown in FIG. PCDV1 [Okayama and Berg
(Okayama & Berg): Molecular and Cellular
・ Biology (Mol. Cell. Biol.),3, 280 (1983)]
400 μg of 10 mM Tris-HCl (pH 7.5), 6 mM Mg
Cl_Two And 300 μl of a solution consisting of 10 mM NaCl.
And then add 500 units of KpnI, 37 ° C, 6 hours
The reaction was allowed to proceed, and cut at the KpnI site in the plasmid. H
After ethanol-chloroform extraction, ethanol precipitation
The DNA was recovered. Approximately 200 μm of the DNA digested with KpnI
g to TdT buffer to add dTTP to 0.25 mM
200 μl of the resulting solution, and an additional 81 units of TdT (P-L Bioc
Chemicals) and reacted at 37 ° C. for 11 minutes.
Here, a port is located at the 3 'end of the KpnI cleavage site of pCDV1.
About 67 re (dT) chains were added. Phenol from the solution
Polychloroform extraction and ethanol precipitation
About 100 μg of the pCDV1 DNA to which the (dT) chain is added
Received. The DNA was added to 10 mM Tris-HCl (pH 7.5),
6 mM MgCl_Two, 150 μM buffer consisting of 100 mM NaCl
and 360 units of EcoRI at 37 ° C.
The reaction was performed for 2 hours. After treating the reaction product by the LGT method, about 3.
A 1 kb DNA fragment was recovered, and about 60 μg of a poly (dT) chain
Additional pCDV1 was obtained. The DNA was purified with 10 mM Tris-H.
500 μL solution consisting of Cl (pH 8.0) and 1 mM EDTA
After incubating at 65 ° C for 5 minutes, cool on ice.
50 μl of 5 M NaCl was added. Mix the mixture with oligo (d
A) Cellulose column (manufactured by Collaborative Research)
Chromatography. Poly (dT) chain length is sufficient
Is adsorbed on the column, and the 10 mM Tris-HC
Elution with a solution consisting of 1 (pH 8.0) and 1 mM EDTA
And pCDV1 (hereinafter referred to as a vector) to which a poly (dT) chain is added.
-Abbreviated as primer). Next, linker DNA was prepared. pL
1 [Okayama & Berg: Mo
Regular and Cellular Biology (Mol. C
ell. Biol.),3, 280 (1983)] Approximately 14 μg was added to 10 mM Tri
s-HCl (pH 7.5), 6 mM MgCl_Two And 50 mM N
Add 200 μl of buffer consisting of aCl, and add another 50 units
Add PstI and incubate at 37 ℃ for 4 hours, then pL1DNA
It was cut at the PstI site inside. Phenol the reaction product
-Chloroform extraction followed by ethanol precipitation and Pst
About 13 μg of pL1 DNA cleaved with I was recovered. The DN
About 13 μg of A was added to TdT buffer to a final concentration of 0.25 mM dGTP.
To 50 μl of the solution containing TdT (P-L Biochemi
cals) 54 units added and incubated at 37 ℃ for 13 minutes
And a (dG) chain at the 3 'end of the PstI cleavage site of pL1.
About 14 were added. After phenol-chloroform extraction
DNA was recovered by knol precipitation. The DNA was added to 10 mM T
ris-HCl (pH 7.5), 6 mM MgCl_Two And 60mM
 Add 100 μl of NaCl buffer and add another 80 units
Add HindIII and incubate at 37 ℃ for 3 hours
And cleaved at the HindIII site of pL1 DNA. The anti
The reaction product was fractionated by agarose gel electrophoresis,
The DNA fragment was subjected to the DEAE paper method [Dretze (Dretze
n) et al .: Analytical Biochemistry (Anal. Bi
ochem.),112, 295 (1981)] and oligo (d
G) Linker DNA with chain (hereinafter simply referred to as linker DNA
Abbreviated). About 2 μ of the poly (A) RNA prepared above
g, about 1.4 μg of vector primer was added to 50 mM Tris-H.
Cl (pH 8.3), 8 mM MgCl_Two, 30 mM KCl, 0.3 mM
DTT, 2 mM dNTP (dATP, dTTP, dGT
P and dCTP) and 10 units of ribonuclease
Solution consisting of inhibitor (P-L Biochemicals) 22.3
Dissolve in μl and add 10 units of reverse transcriptase (Seikagaku Corporation)
And incubate at 41 ° C for 90 minutes.
Complementary DNA was synthesized. The reactants are phenol-c
After performing roloform extraction and ethanol precipitation, RNA-DN
The vector primer DNA to which the double-strand A was added was recovered.
Was. The DNA was converted to 66 μM dCTP and 0.2 μg
Dissolve in 20 μl of TdT buffer containing (A) and add 14 units of T
Add dT (P-L Biochemicals) and incubate at 37 ° C for 2 minutes.
Incubate 20 (dC) strands at the 3 'end of the cDNA
Was added. The reaction product was extracted with phenol-chloroform.
Then, the cDN to which the (dC) chain was added by ethanol precipitation
The A-vector primer DNA was recovered. The DNA
10 mM Tris-HCl (pH 7.5), 6 mM MgCl_Two You
Dissolve in 400 μl of a solution consisting of
Add HindIII and incubate at 37 ℃ for 2 hours
And cut at the HindIII site. The reaction mixture
Extracted with chloroform and precipitated with ethanol 0.5 picomo
(DC) chain added cDNA-vector primer DN
A was obtained. 0.2 pmol of said DNA and said linker
0.4 pmol of DNA was added to 10 mM Tris-HCl (pH 7.
5) A solution consisting of 0.1 M NaCl and 1 mM EDTA
Dissolve in 100 µl, and heat at 65 ° C, 42 ° C, and 0 ° C for 10 minutes each.
Incubated for 5 minutes and 30 minutes. 20 mM Tris-HC
1 (pH 7.5), 4 mM MgCl_Two, 10 mM (NH_Four)_TwoSO_Four,
Composition of 0.1 M KCl and 0.1 mM β-NAD, total amount 10
A reaction solution was prepared to have a volume of 0 μl. 25 units in the reaction
Escherichia coli DNA ligase (New England Bio
Labs) and incubate at 11 ° C for 18 hours.
Was. The reaction was combined with 40 μM each of dNTPs and 0.15 mM β-NA.
Add additional components to make D, and add 10 units of E. coli DNA
Ligase, 20 units of E. coli DNA polymerase I (P-L
Biochemicals) and 10 units of E. coli ribonuclease
Add Hase H (manufactured by P-L Biochemicals) at 12 ° C and 25 ° C.
The incubation was continued for 1 hour. In the above reaction, cD
Circularization of recombinant DNA containing NA and RNA-DNA
The RNA portion of the heavy chain is replaced by DNA and the complete duplex D
A recombinant plasmid of NA was generated. (3) Recombinant DNA containing human LT cDNA
Selection of E. coli using the recombinant plasmid obtained in (2)
C600SF8 strain [Cameron: Proceedin
Gu of the National Academic of Sayer
(Proc. Natl. Acad. Sci.) USA72, 3416 (1975)
 ] Scott's method [Katsuya Shigetsada: Cell Engineering2616 (19
83)]. About 30,000 colonies obtained
Immobilized on a nitrocellulose filter. Jae
Human LT cDNA isolated by Genentech
[Patrick W. Gray (PatrickW.Gray)
Et al: Nature312, 721 (1984)] 5'non
17-base synthetic DN that matches part of the base sequence of the translation region
A5'-GATCCCCCGGCCTGCCTG-3 '³²
Select one strain that strongly associates with the P-labeled probe at 52 ° C.
Grunstein-Hognes
s) method, Proceeding of the National
・ Academy of Science (Proc. Natl. Acad.S
ci.) USA72, 3961 (1975)]. The plasmid that this strain has
The complete nucleotide sequence of the cDNA of pLT1
It was determined by the dideoxy sequence method used.
As a result, the pLT1 cDNA encodes human LT.
Turned out to be. 2) Construction of recombinant plasmid pLA1:
5 μg of pLT1 (4.7 kb) obtained by the method of the previous section was added to 10 mM.
 Tris-HCl (pH 7.5), 7 mM MgCl_Two, 6 mM 2-
A total volume of 50 μl solution containing mercaptoethanol (below
(Abbreviated as "Y-0 buffer"), and the restriction enzyme X
Add 10 units of hoII (Boehringer Mannheim)
Then, the cleavage reaction was performed at 37 ° C. for 2 hours. Then NaCl
Was added to a final concentration of 150 mM, and the restriction enzyme NsiI was added.
(New England Biolabs) 10 units added
Then, the cleavage reaction was carried out at 37 ° C. for another 3 hours. From the reaction solution
Approximately 750 bp containing most of human LT DNA by LGT method
DNA fragment (XhoII-NsiI fragment) of about 0.3 μg
Obtained. Separately, pLT120 μg was added to 200 μl of Y-50.
Dissolve in buffer and add 40 units of the restriction enzyme HaeIII to give 3
The cleavage reaction was performed at 7 ° C. for 2 hours. Then, NaCl is terminated.
Add 3 units of NsiI to a concentration of 150 mM and add
Cleavage reaction was performed at 7 ° C. for another 3 hours. Poly from reaction solution
N-terminal of human LT by acrylamide gel electrophoresis
An approximately 50 bp DNA fragment (HaeIII-Nsi
I fragment) about 40 ng was obtained. On the other hand, the total amount of 3 μg of pGEL1 (3.4 kb) was 3
Dissolve in 0 μl of Y-100 buffer and control with restriction enzyme StuI.
Add 6 units of BglII restriction enzyme at 37 ° C for 3 hours
A cleavage reaction was performed. Ap was obtained from this reaction solution by the LGT method.
^rA DNA fragment of about 2.3 kb containing the gene (StuI-Bg
About 1.0 μg of (II fragment) was obtained. Next, XhoII-derived from pLT1 obtained above was
0.2 μg of NsiI fragment (about 750 bp) and HaeIII-N
20 ng of the siI fragment (about 50 bp) and StuI derived from pGEL1
-0.6 μg of BglII fragment (about 2.3 kb) was added to a total amount of 20 μl of T4
Dissolve in ligase buffer and add 2 units
Add T4 DNA ligase (Takara Shuzo) at 4 ℃, 18:00
Reaction was carried out. Recombinant plasmid D thus obtained
Using NA, Escherichia coli KM430 strain was transformed into Cohen et al.
By the method of Ap^rColonies were obtained. This
Plasmid DNA from the transformed strain according to a known method.
And purify the plasmid DNA by restriction such as StuI.
Structural analysis of plasmid by digestion with enzyme
Was. As a result, it was confirmed that the desired plasmid was obtained.
did. This recombinant plasmid is called pLA1. 3) Construction of LT expression plasmid pLSA1
Adult: Large intestine with pLA1 (3.1 kb) obtained in the previous section
The bacterium strain KM430 was cultured, and pLA was prepared from the cultured cells by a conventional method.
1 DNA was prepared. 3 μg of the obtained pLA1 DNA
Dissolve in 30 μl of Y-100 buffer and add StuI and BglII.
Add 3 units each and perform the cleavage reaction at 37 ℃ for 3 hours.
Was. From this reaction mixture, the large amount of human LT gene was analyzed by the LGT method.
A DNA fragment of about 790 bp (StuI-BglII
Fragment) about 0.5 μg was obtained. Separately, the method described in JP-A-58-110600
3 μg of pKYP10 prepared in the above to 30 μl of Y-100 buffer
Dissolve the restriction enzymes BanIII and PstI
6 units each were added and a cleavage reaction was performed at 37 ° C. for 3 hours.
From this reaction solution, tryptophan promotion was performed by the LGT method.
Approximately 1.1 kb DNA fragment (BanI) containing the
(II-PstI fragment) about 0.6 μg was obtained. Also, pGEL
Dissolve 2 μg of 1 (3.4 kb) in 20 μl of Y-100 buffer,
Restriction enzymes HindIII, BamHI and PstI
Then, 4 units were added, and a cleavage reaction was performed at 37 ° C. for 3 hours. This
Lipoprotein-derived termi
DNA fragment (PstI-Ba)
About 0.7 μg of mHI fragment) was obtained. On the other hand, the N-terminus of the mature human LT polypeptide
Is the fifth amino acid from Leu (CTA)
Up to the second base (GG) of Gly (GGC) and expression
Start codon (ATG) required for
And the distance between the ATG and the SD sequence downstream of Ptrp
Should be of an appropriate length between 6 and 18 bp
For any reason, the following DNA linkers were synthesized. [0225] Embedded image First, single-stranded DNA, 27-mer and 25-mer
It was synthesized by the usual triester method. 27-mer and 2
Twenty picomoles of each 5-mer were combined with a total of 40 μl of T4 kinase.
Dissolve in buffer and use T4 polynucleotide kinase (Takara)
Add 6 units and perform phosphorylation at 37 ° C for 60 minutes.
went. Next, StuI-Bg derived from pLA1 obtained above
0.3 μg of the II fragment (about 790 bp) and the expression vector pKYP10
0.4 μg of the BanIII-PstI fragment (about 1.1 kb) of
A PstI-BamHI fragment derived from pGEL1 (about 1.7 k
b) Dissolve 0.6 μg of 25 μl of T4 ligase buffer and mix
About 1 pmol of the above DNA linker was added to the mixture. this
6 units of T4 DNA ligase was further added to the mixed solution, and 4
The binding reaction was performed at 18 ° C. for 18 hours. Use reaction mixture containing recombinant plasmid
To transform E. coli KM430,^rColony of
I got From the cultured cells of this colony, plasmid DNA
Was recovered. The resulting plasmid has the structure of the restriction enzyme Ec
oRI, BanIII, PstI, HindIII, BglII
And then confirmed by agarose gel electrophoresis. This
Is called pLSA1. Ban of pLSA1
The base sequences near III and HindIII are as follows:
That's Maxam Gilbert's method [Am Maki
A. M. Maxam et al .: The Proceeding of the
National Academy of Science (Proc. Na
tl.Acad.Sci.), USA74, 560 (1977)]. [0228] Embedded image Reference Example 4. Construction of ATG vector pTrS20: According to the procedure shown in FIG.
Therefore, the distance between the SD sequence and the ATG start codon is 14 bases
And has a SacI site immediately after the ATG codon
The ATG vector pTrS20 was constructed. First, the method described in JP-A-58-110600
3 μg of pKYP10 prepared in the above to 30 μl of Y-100 buffer
Melt, restriction enzyme BanIII and restriction enzyme NruI (new
-England Biolabs) 6 units each
Each was added, and a cleavage reaction was performed at 37 ° C. for 3 hours. This reaction solution
Of about 3.8 kb of DNA containing Ptrp by LGT method
About 0.5 μg of a piece (BanIII-NruI fragment) was obtained. On the other hand, the ATG start codon was provided downstream of Ptrp.
To give the following DNA linker
It was synthesized by the method. [0232] Embedded image Synthetic DNA of 19-mer and 17-mer (10 pins each)
Mol) in 50 mM Tris-HCl (pH 7.5), 10 mM
 MgCl_Two , 5 mM dithiothreitol, 0.1 mM ED
Dissolve in a total volume of 20 μl containing TA and 1 mM ATP
And T4 polynucleotide kinase 3 units (Takara Shuzo)
And phosphorylation reaction was carried out at 37 ° C. for 60 minutes. Next
First, the BanIII-NruI fragment derived from pKYP10 obtained above was cut.
0.1 μg of a piece (about 3.8 kb) and about 0.5 pi of the above DNA linker
Was dissolved in 20 μl of T4 ligase buffer,
Add 2 units of 4 DNA ligase and bind at 4 ° C for 18 hours
Was done. Use the resulting mixture of recombinant plasmids
E. coli HB101 strain [Boliver et al .: Gene
(Gene)2, 75 (1977)].^rThe Colony
I got it. From the cultured cells of this colony, plasmid DN
A was recovered. The structure of the obtained plasmid is a restriction enzyme E
coRI, BanIII, HindIII, SacI, Nru
After cutting with I, it was confirmed by agarose gel electrophoresis.
This plasmid was named pTrS20 (FIG. 13). pT
Base sequence near the BanIII and HindIII sites of rS20
The columns are as follows.
It was confirmed using the idoxy sequence method. [0235] Embedded image[0236] According to the present invention, a polypeptide having a high CSF activity is provided.
Peptides can be supplied in large quantities at low cost. [0237] [Sequence List] SEQ ID NO: 1 Sequence length: 527 Sequence type: nucleic acid Number of chains: double strand Topology: linear Sequence type: cDNA to mRNA origin Organism name: Human Cell type: peripheral blood macrophages Array features Characteristic symbol: mat peptide Location: 1..525 How the feature was determined: E Array        ACC CCC CTG GGC CCT GCC AGC TCC CTG CCC CAG AGC TTC CTG CTC 45        Thr Pro Leu Gly Pro Ala Ser Ser Leu Pro Gln Ser Phe Leu Leu          1 5 10 15        AAG TGC TTA GAG CAA GTG AGG AAG ATC CAG GGC GAT GGC GCA GCG 90        Lys Cys Leu Glu Gln Val Arg Lys Ile Gln Gly Asp Gly Ala Ala                         20 25 30        CTC CAG GAG AAG CTG TGT GCC ACC TAC AAG CTG TGC CAC CCC GAG 135        Leu Gln Glu Lys Leu Cys Ala Thr Tyr Lys Leu Cys His Pro Glu                         35 40 45        GAG CTG GTG CTG CTC GGA CAC TCT CTG GGC ATC CCC TGG GCT CCC 180        Glu Leu Val Leu Leu Gly His Ser Leu Gly Ile Pro Trp Ala Pro                         50 55 60        CTG AGC AGC TGC CCC AGC CAG GCC CTG CAG CTG GCA GGC TGC TTG 225        Leu Ser Ser Cys Pro Ser Gln Ala Leu Gln Leu Ala Gly Cys Leu                         65 70 75        AGC CAA CTC CAT AGC GGC CTT TTC CTC TAC CAG GGG CTC CTG CAG 270        Ser Gln Leu His Ser Gly Leu Phe Leu Tyr Gln Gly Leu Leu Gln                         80 85 90        GCC CTG GAA GGG ATC TCC CCC GAG TTG GGT CCC ACC TTG GAC ACA 315        Ala Leu Glu Gly Ile Ser Pro Glu Leu Gly Pro Thr Leu Asp Thr                         95 100 105        CTG CAG CTG GAC GTC GCC GAC TTT GCC ACC ACC ATC TGG CAG CAG 360        Leu Gln Leu Asp Val Ala Asp Phe Ala Thr Thr Ile Trp Gln Gln                        110 115 120        ATG GAA GAA CTG GGA ATG GCC CCT GCC CTG CAG CCC ACC CAG GGT 405        Met Glu Glu Leu Gly Met Ala Pro Ala Leu Gln Pro Thr Gln Gly                        125 130 135        GCC ATG CCG GCC TTC GCC TCT GCT TTC CAG CGC CGG GCA GGA GGG 450        Ala Met Pro Ala Phe Ala Ser Ala Phe Gln Arg Arg Ala Gly Gly                        140 145 150        GTC CTA GTT GCC TCC CAT CTG CAG AGC TTC CTG GAG GTG TCG TAC 495        Val Leu Val Ala Ser His Leu Gln Ser Phe Leu Glu Val Ser Tyr                        155 160 165        CGC GTT CTA CGC CAC CTT GCC CAG CCC TGA 525        Arg Val Leu Arg His Leu Ala Gln Pro ***                        170 174

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows the construction steps of plasmid pCfTA1. FIG. 2 shows the construction steps of plasmid pCfTB20. FIG. 3 shows the steps of constructing plasmids pCfTL23, 38, 35, 41. FIG. 4 shows the construction steps of plasmids pCfTM14, 17, 113. FIG. 5 shows a construction step of plasmid pCfWD1. FIG. 6 shows construction steps of plasmids pCfT95K19, pCfAA1 and pCfAB5. FIG. 7 shows plasmids pCfBA8, pCfBB101, p
The construction process of CfBC52,59,42B1,45,76,77,93,95,97 and pCfBD28,56,82 is shown. FIG. 8 shows plasmids pCfCB101, pCfCC52,5
9, the construction process of pCfCD28, 56 is shown. FIGS. 9 (1) and (2) show the outline of the process of cDNA synthesis by the Okayama-berg method and the construction of a recombinant plasmid containing the DNA. FIG. 10 shows the steps for constructing plasmid pLA1. FIG. 11 shows a step of constructing plasmid pLSA1. FIG. 12 shows a step of constructing plasmid pCfTNS501. FIG. 13 shows the steps for constructing the plasmid pTrS20. FIG. 14. Plasmids pCfTNS7 and pCfTA
3 shows a step of forming Arg4S. FIG. 15. Plasmids pCfTN205 and pCfTA
3 shows a step of forming Arg4. FIG. 16. Plasmids pCfTNS301 and pCfT
The construction of NS401 is shown. FIG. 17 (1) and (2) show plasmid pCfBD28A1
7 shows the process of forming pCfBD28T17.

   ────────────────────────────────────────────────── ─── Continuation of front page    (72) Inventor Shin Morimoto               203-5 Shimochikari, Nagaizumi-cho, Sunto-gun, Shizuoka Prefecture (72) Inventor Satoshi Ito               218-14 Hachiman Nishi, Sawara, Sagamihara City, Kanagawa Prefecture (72) Inventor Motoo Yamazaki               3-6-6 Asahi-cho, Machida-shi, Tokyo (72) Inventor Yoshiharu Yokoo               3-4-17 Yokoyama, Sagamihara City, Kanagawa Prefecture (72) Inventor Kazuo Yamaguchi               2121-8 Isobe, Sagamihara City, Kanagawa Prefecture                (56) References NATURE, 319, (1986), P.               415-418                 SCIENCE, 232, (1986), P.               61-65                 EMBO J.M. , 5, (1986), P.               575-581

Claims (1)

(57) [Claims] General formula A polypeptide represented by the formula (wherein R ¹ is SerPro
LeuGlyProAlaSerSerLeuProGlnSer, ArgProLeuGlyProAla
SerSerLeuProGlnSer, CysProLeuGlyProAlaSerSerLeuPro
GlnSer, GlyProLeuGlyProAlaSerSerLeuProGlnSer, SerP
roCysGlyProAlaSerSerLeuProGlnSer, SerProArgGlyProA
laSerSerLeuProGlnSer, SerProSerGlyProAlaSerSerLeuP
roGlnSer, AlaProThrArgSerAlaSerSerLeuProGlnSer, Th
rProGluLysSerAlaSerSerLeuProGlnSer, ValProIleArgSe
rAlaSerSerLeuProGlnSer, CysProIleArgSerAlaSerSerLe
uProGlnSer, ArgProThrArgSerAlaSerSerLeuProGlnSer,
ThrProThrArgSerAlaSerSerLeuProGlnSer, AsnProGluArg
SerAlaSerSerLeuProGlnSer, IleProThrArgSerAlaSerSer
LeuProGlnSer, SerProThrArgSerAlaSerSerLeuProGlnSe
r, AlaProSerAsnSerAlaSerSerLeuProGlnSer, AlaProPro
AsnArgGlySerSerLeuProGlnSer, ThrProLeuArgProAlaSer
SerLeuProGlnSer, ThrProLeuArgProAlaSerSerLeuProGln
Ser, AlaProThrTyrArgAlaSerSerLeuProGlnSer, ProAlaS
erSerLeuProGlnSer, AlaSerSerLeuProGlnSer, SerSerLe
UProGlnSer, a peptidyl radical or an amino acid residue selected from the group consisting of SerLeuProGlnSer and Ser, R ²
Is an amino acid residue selected from the group consisting of Cys, Ser, Ala and Thr, and R ¹ is AlaProThrArgSerAlaSerSerLeuProGlnSer, ThrPr.
oGluLysSerAlaSerSerLeuProGlnSer, ValProIleArgSerAl
aSerSerLeuProGlnSer, CysProIleArgSerAlaSerSerLeuPr
oGlnSer, ArgProThrArgSerAlaSerSerLeuProGlnSer, Thr
ProThrArgSerAlaSerSerLeuProGlnSer, AsnProGluArgSer
AlaSerSerLeuProGlnSer, IleProThrArgSerAlaSerSerLeu
ProGlnSer, SerProThrArgSerAlaSerSerLeuProGlnSer, A
laProSerAsnSerAlaSerSerLeuProGlnSer, AlaProProAsnA
rgGlySerSerLeuProGlnSer, ProAlaSerSerLeuProGlnSe
r, SerLeuProGlnSer, SerSerLeuProGlnSer and Ser when it is a peptidyl group or amino acid residue, R ² is Ser and R ¹ is SerProLeuGlyProAlaSerSerLeuProGlnSer, ArgPr.
oLeuGlyProAlaSerSerLeuProGlnSer, CysProLeuGlyProAl
aSerSerLeuProGlnSer, GlyProLeuGlyProAlaSerSerLeuPr
oGlnSer, SerProCysGlyProAlaSerSerLeuProGlnSer, Ser
ProArgGlyProAlaSerSerLeuProGlnSer and SerProSerGl
When it is a peptidyl group selected from the group consisting of yProAlaSerSerLeuProGlnSer, R ² is Cys and R ¹ is ThrProLeuArgProAlaSerSerLeuProGlnSer or P
R ² is Cys or S when roAlaSerSerLeuProGlnSer
, R ¹ is AlaProThrTyrArgAlaSerSerLeuProGlnSer, R ² is an Ala or Thr residue) and has human granulocyte colony stimulating factor activity.