JP2024500804A - Compositions and methods for their identification for use in the treatment of CHD2 haploinsufficiency - Google Patents

Abstract

A method of increasing the amount of chromodomain helicase DNA binding protein 2 (CHD2) in neuronal cells is provided. The method includes introducing into the cell a nucleic acid agent that down-regulates the activity or expression of human Chaser, the nucleic acid agent being directed to the final exon of human Chaser, thereby causing the neural cell to increases the amount of CHD2 in

Description

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Patent Application No. 63/127,212, filed December 18, 2020, which is incorporated herein in its entirety.

(Description of sequence listing)
89180SequenceListing.Created on December 19, 2021, containing 61,440 bytes, filed at the same time as the filing of this application. The ASCII file named .txt is incorporated herein by reference.

The present invention, in some embodiments thereof, relates to compositions for use in treating CHD2 haploinsufficiency, and methods for identifying the same.

The chromodomain helicase DNA binding protein 2 (Chd2) gene encodes an ATP-dependent chromatin remodeling enzyme that, together with CHD1, belongs to subfamily I of the chromodomain helicase DNA binding (CHD) protein family. Members of this subfamily are characterized by two chromodomains located in the N-terminal region and a centrally located SNF2-like ATPase domain [Tajul-Arifin, K.; et al. Identification and analysis of chromodomain-containing proteins encoded in the mouse transcriptome. Genome Res. 13, 1416-1429 (2003)], promoting nucleosome disassembly, expulsion, sliding and spacing [Narlikar, G. J. , Sundaramoorthy, R. &Owen-Hughes, T. Mechanisms and functions of ATP-dependent chromatin-remodeling enzymes. Cell 154, 490-503 (2013)].

In humans, CHD2 haploinsufficiency is associated with neurodevelopmental delay, intellectual disability, epilepsy, and behavioral problems [Lamar, K.; -M. J. & Carvill, G. L. Chromatin remodeling proteins in epilepsy: lessons from CHD2-associated epilepsy. Front. Mol. Neurosci. 11, 208 (2018)]. Studies in mouse models and cell lines have also implicated Chd2 in neuronal dysfunction.

In all of the cases described, these individuals are haploinsufficient for CHD2 and therefore have an intact WT copy of CHD2. Therefore, increasing CHD2 expression through perturbation of Chaser, for example by using antisense oligonucleotides, may have therapeutic benefits.

Multiple lines of evidence point to a strong link between long noncoding RNA (lncRNA) function and the function of chromatin modification complexes [Han, P.; &Chang, C. -P. Long non-coding RNA and chromatin remodeling. RNA Biol. 12, 1094-1098 (2015)]. A number of chromatin modifiers have been reported to interact with lncRNA [Han et al. ,the above]. Furthermore, lncRNAs within vertebrate genomes are enriched near genes encoding transcription-related factors, including numerous chromatin-associated proteins [Ulitsky, I.; , Shkumatava, A. , Jan, C. H. , Sive, H. & Bartel, D. P. Conserved function of lincRNAs in vertebrate embryonic development destination rapid sequence evolution. Cell 147, 1537-1550 (2011)], the functions of most of these lncRNAs remain unknown.

Previous studies by the inventors have shown that in mice, the CHD2 adjacent, suppressive regulatory RNA (CHD2 adjacent, suppressi ve regulatory RNA) and humans discloses the existence of Chaserr, a conserved lncRNA located upstream of LINC01578/LOC100507217 (CHASERR), which is found upstream of and transcribed from the same strand as Chd2, and is almost completely uncharacteristic. This is an unanalyzed lncRNA.

Chaserr acts in concert with the CHD2 protein to maintain appropriate Chd2 expression levels. Loss of Chaserr in mice results in early postnatal lethality in homozygous mice and severe growth retardation in heterozygotes. Mechanistically, loss of Chaserr substantially increases Chd2 mRNA and protein levels, leading to transcriptional interference by inhibiting promoters found downstream of highly expressed genes. Chaserr production suppresses Chd2 expression only in cis, and the phenotypic consequences of Chaserr loss are also rescued when Chd2 is perturbed. Therefore, targeting Chaserr may be a strategy to increase CHD2 levels in haploinsufficient individuals.

Additional background techniques include:
www(dot)iscb(dot)org/cms_addon/conferences/ismb2020/postersdotphp? track=RegSys%20COSI&session=Bgithub(dot)com/lncLOOM/lncLOOM

According to one aspect of some embodiments of the invention, there is provided a method of increasing the amount of chromodomain helicase DNA binding protein 2 (CHD2) in a neuronal cell, the method comprising downregulating the activity or expression of human Chaserr. A method is provided for increasing the amount of CHD2 in a neuronal cell, the method comprising introducing into a cell a nucleic acid agent, said nucleic acid agent being directed to the final exon of human Chaserr. Ru.

According to one aspect of some embodiments of the invention, a method of treating a disease or condition associated with chromodomain helicase DNA binding protein 2 (CHD2) haploinsufficiency in a subject in need thereof. administering to said subject a therapeutically effective amount of a nucleic acid agent that down-regulates the activity or expression of human Chaser, said nucleic acid agent being directed to the final exon of human Chaser, thereby comprising: A method of treating a disease or condition associated with said CHD2 haploinsufficiency is provided.

According to one aspect of some embodiments of the present invention, chromodomain helicase DNA binding protein 2 (CHD2) for use in the treatment of a disease or condition associated with haploinsufficiency in a subject in need of such treatment. Provided are nucleic acid agents for down-regulating the activity or expression of human Chaser, the nucleic acid agents being directed to the final exon of human Chaser.

According to some embodiments of the invention, said human Chaserr is an alternatively spliced protein selected from the group consisting of SEQ ID NO: 11 (NR_037600), SEQ ID NO: 12 (NR_037601), and SEQ ID NO: 13 (NR_037602). including alternatively spliced variants.

According to some embodiments of the invention, the nucleic acid agent hybridizes to a nucleic acid sequence element comprising SEQ ID NO: 2 (AUGG).

According to some embodiments of the invention, the nucleic acid agent hybridizes to a nucleic acid sequence element selected from the group consisting of AAGAUG (SEQ ID NO: 5) and AAAUGGA (SEQ ID NO: 6).

According to some embodiments of the invention, the nucleic acid agent hybridizes to a nucleic acid sequence element comprising AAGAUG (SEQ ID NO: 5) and/or AAAUGGA (SEQ ID NO: 6).

According to some embodiments of the invention, the nucleic acid agent inhibits DHX36 binding to Chaserr.

According to some embodiments of the invention, the nucleic acid agent is an antisense oligonucleotide.

According to some embodiments of the invention, the antisense oligonucleotide has a nucleobase sequence set forth in SEQ ID NOs: 92-99 (where T is replaced by U).

According to some embodiments of the invention, the nucleic acid agent is an RNA silencing agent.

According to some embodiments of the invention, the nucleic acid agent is a genome editing agent.

According to some embodiments of the invention, the nucleic acid agent is active in an inducible manner.

According to some embodiments of the invention, the nucleic acid agent is active in a tissue or cell-specific manner.

According to some embodiments of the invention, the diseases or conditions associated with chromodomain helicase DNA binding protein 2 (CHD2) haploinsufficiency include intellectual disability, autism, epilepsy, and Lennox-Gastaut syndrome (LGS). selected from the group consisting of.

According to one aspect of some embodiments of the invention, a method of analyzing a set of sequences describing a plurality of homologous polynucleotides comprises:
constructing a graph having a plurality of nodes arranged in layers and a plurality of edges connecting the nodes of successive layers, where the first layer represents a sequence describing the query polynucleotide; Each layer consists of one of said sets, such that the nodes represent k-mers in each array, each edge connects nodes representing the same or homologous k-mers, and k is between 6 and 12. represents a sequence of the set;
searching the graph for continuous non-intersecting paths along edges of the graph; and producing an output identifying k-mers corresponding to at least one path as nucleic acid sequences of functional interest; A method is provided comprising:

According to some embodiments of the invention, the method includes iteratively repeating the building and searching for shorter k-mers each time before generating the output. including.

According to some embodiments of the invention, the method comprises, at each iteration cycle, applying the path obtained in the previous iteration cycle as a constraint for the search.

According to some embodiments of the invention, the searching depends on path depth as a constraint for the searching, such that searching is preferentially performed for deeper paths than for shallower paths. Including applying standards.

According to some embodiments of the invention, the searching includes applying an Integer Linear Program (ILP) to the graph.

According to some embodiments of the invention, the homologous polynucleotide is a DNA sequence.

According to some embodiments of the invention, said homologous polynucleotide is an RNA sequence.

According to some embodiments of the invention, the method includes aligning the sequences in the set according to a predetermined order to provide multiple alignment with multiple alignment layers, wherein One layer is the query polynucleotide among the plurality of homologous polynucleotides, and the plurality of alignment layers correspond to each layer of the graph.

According to some embodiments of the invention, said predetermined order is evolution-dictated, optionally said query being the most evolved of said homologous polynucleotides.

According to some embodiments of the invention, the homology between said homologous k-mers is 70% or more.

According to some embodiments of the invention, said homologous polynucleotides include subsequences.

According to some embodiments of the invention, said homologous polynucleotide is selected from the group consisting of 3'UTR, lncRNA and enhancer.

Unless defined otherwise, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and not necessarily intended to be limiting.

Some embodiments of the invention are described herein, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings, it is emphasized that the details shown are by way of example and are for illustrative illustrations of embodiments of the invention. In this regard, the description given with the help of the drawings makes it clear to those skilled in the art how the embodiments of the invention can be implemented.

FIGS. 1A-B provide an overview of an embodiment for discovering nucleic acid sequence elements called the "LncLOOM" framework. (A) Outline of the LncLOOM method. LncLOOM processes an ordered list of sequences and recovers a set of ordered motifs conserved to various depths that can be further annotated as miRNA binding sites or RBP binding sites. (B) Schematic of graph construction and motif discovery using integer linear programming (ILP) to find long non-intersecting paths. Sequences are ordered such that their evolutionary distance from the top layer (human) increases monotonically. BLAST high-scoring pairs (HSPs) (see Methods) that can be used to constrain edge placement are shown as pink and red blocks below each sequence. There is. The graph is used to construct an ILP problem and the solution is used to construct a set of long paths corresponding to conserved syntenic motifs (SEQ ID NOs: 29-32). Figures 2A-F show the discovery of conserved elements in Cyrano lncRNAs. (A) Overview of the genomic organization of Cyrano exons in selected species. (B) Sequence elements identified by LncLOOM as conserved in at least 17 Cyranos. Regions containing elements found in regions that can be aligned by BLAST between human and zebrafish Cyrano sequences are circled. Numbers between elements indicate range distances between the 18 elements. The circled number above each element indicates the element number used in the main text and other panels. (C) Pairing between predicted binding elements in Cyrano and miR-25/92 miRNA and miR-7 miRNA. (D) Evidence for binding of PUM1 and PUM2 to the UGUAUAG motif (shaded region) in the human genome. ENCODE project CLIP data (top, K562 cells) and ²² (bottom, HCT116 cells). Shading is based on the strength of the combined evidence as defined by the ENCODE project. (E) Binding and regulation of mouse Cyrano sequences by Pum1/2 and Rbfox1/2. Top: Pum1/2 CLIP and RNA-seq data from mouse brain and mESCs. Center: Rbfox1 CLIP from mouse brain and mESC. Pumilio and Rbfox binding motifs are highlighted in yellow and blue, respectively. PhyloP sequence conservation scores are from the UCSC genome browser. Bottom: Ago2 binding in mouse brain to the region of the miR-153 binding site near the 3' end of Cyrano. CLIP data from (F) Top left: Alignment of the region surrounding the conserved AUGGCG motif near the 5' end of Cyrano. Top right and bottom: Combined Ribo-seq and RNA-seq data from multiple curated datasets. Chip-seq data for YY1 in K562 cell line from the ENCODE project. Read coverage and IDR peaks are shown. The sequences shown in the panels are marked as SEQ ID NOS: 33-42 and 53-67. Same as above. Figures 3A-E show the discovery of conserved elements in CHASERR lncRNA. (A) The human CHASERR gene structure is shown, with motifs conserved in at least four species color-coded by depth of conservation. The region of the final exon has been expanded to highlight the motifs described in the text. (B) Sequence logo of the sequences flanking the two most conserved motifs, with the shared AARAUGR motif shaded (the sequence shown in the panel is marked as SEQ ID NO: 68). (C) Top: Mouse Chaserr locus highlighting the positions of primer pairs used for qRT-PCR and regions targeted by GapmeR (same as used in) and ASO. Bottom: qRT-PCR using primers targeting Chaserr exon (shown at top) or Chd2 exon in N2a cells treated with indicated reagents, n=4 for ASO treatment, n=4 for GapmeR. 5. (D) Volcano plot for comparison of MS intensity between pulldown with WT sequence of Chaserr final exon and final exon with mutated conserved elements (Fig. 8A). (E) qRT-PCR using primers targeting the indicated regions after IP with the indicated antibodies, n=4. Top right: Western blot using anti-DHX36 antibody on the indicated samples. The sequence shown in the figure is marked as SEQ ID NO: 68. Figure 4 shows the identification of conserved elements in the 3'UTR of PUM1 and PUM2. The human sequence is shown and motifs conserved in at least seven species are color coded based on their conservation. Occurrences of the ultra-conserved UGUACAUU (SEQ ID NO: 14) motif are in boxes. The sequences shown in the panels are marked as SEQ ID NOS: 69-70. Same as above. Figures 5A-I show Global analysis of conserved motifs in the 3'UTR using LncLOOM. (A) Number of genes with varying numbers of orthologous sequences that had no significant alignment to human sequences (black) or to mouse, dog and chicken sequences (gray). (B) Distribution of unique k-mer combinations conserved within the indicated number of sequences that did not align to human 3'UTR sequences. (C) Quantification of the total number of unique k-mers (pink) and their total examples (dark red) identified by LncLOOM per species. The total number of widely conserved miRNA binding sites is shown in green, and the number of unique k-mers corresponding to these sites is shown in yellow. The number of genes that contained any k-mer is shown in gray, and the number of genes that contained at least one k-mer corresponding to the miRNA site is shown in black. (D) Top: Distribution of unique k-mers identified in the first human unalignable sequences in multiple genes (gray). The number of k-mers detected in invertebrate species in at least one gene is shown in black. Bottom: Unique k-mers common to at least 50 genes and detected in invertebrate sequences. ARE-like k-mers are colored red, PAS-like k-mers are colored blue, and PRE-like k-mers are colored green. (E) Comparison of genes containing widely conserved miRNA binding sites detected by LncLOOM and TargetScan within the human sequences of analyzed genes. (F) Number of widely conserved miRNA bindings/number of unalignable sequences detected by LncLOOM; percentage of genes with detected miRNA sites/number of unalignable layers (black), and miRNA binding. Number of unique k-mers corresponding to the site (yellow). (G) Top: widely conserved miRNA binding sites predicted by LncLOOM in human sequences. Sites predicted by TargetScan and recovered by LncLOOM are shown in red, new sites are shown in blue. Bottom: Conservation of these parts/number of species. (H) Comparison of the fraction of genes with at least one miRNA site detected in the indicated species by TargetScan and LncLOOM. Only the sites found in TargetScanHuman were used. (I) Percentage of genes containing miRNA sites detected by LncLOOM/number of unalignable sequences: (red) additions previously predicted by TargetScan in human sequences and not part of the MSA used by TargetScan miRNA sites recovered by LncLOOM in sequences; (blue) New miRNA sites predicted by LncLOOM but not previously predicted by TargetScan in human sequences. Figure 6 shows conserved elements within libra lncRNA. The human sequence is shown and motifs conserved in at least five species are color coded based on their conservation. Pairs of vertical lines represent intron positions. Motifs matching miRNA seed sites are indicated by the miRNA family name above the motif. Regions that are part of the BLASTN alignment (E<0.001) between the human and spotted gar sequences are underlined. The sequence shown in the panel is marked as SEQ ID NO:71. Figure 7 shows gaps in the genome assembly around the first exon of the Chaserr lncRNA locus. For each species, RNA-seq read coverage is shown alongside gaps in the genome assembly (from the UCSC browser). Figures 8A-D show functional characterization of conserved elements in Chaserr lncRNA. (A) Sequence of the final exon of mouse Chaserr. Deeply conserved elements are shared. The conserved AUGG examples mutated in the MS bait are in blue, and all other AUGG examples are in green. The area targeted by ASO is marked. (B) Same as in FIG. 3C for the ASO processing shown. (C) RNA-seq quantification of expression of the indicated genes in HEK293 cells with the indicated genotypes. (D) Data from RNA-seq quantification of expression of the indicated genes in THP1 cells treated with non-targeting shRNAs (shNTs) or ZFR-targeted shRNAs. Data from the sequence shown in 8A is marked as SEQ ID NO: 72. Figure 9 shows the identification of conserved elements in the DICER 3'UTR. The human sequence is shown and motifs conserved in at least eight vertebrate species are color coded based on their conservation (9 species - conserved in amphioxus; 10 species - conserved in amphioxus and sea urchins). Regions of the motif where 100 random sequences that maintain sequence identity do not contain a motif of this length are shaded in light yellow. Regions of motifs where no exact motif is found within the random sequence are shaded in light cyan. The sequence shown in the panel is marked as SEQ ID NO:73. Same as above. Figures 10A-F show additional analysis of LncLOOM motifs identified within the 3'UTR. (A) Distribution of orthologous 3′UTR sequences. Top left: Frequency of genes analyzed at various depths. Top right: Distribution of different combinations of non-amniote sequences included in the 3'UTR sequence dataset. Bottom right: total number of genes analyzed in the indicated species. (B) Distribution of the number of conserved unique k-mer combinations/unalignable sequences in the 3'UTR dataset. We examined alignments to humans, mice, dogs, and chickens. (C) Distribution of unique k-mers identified across amniotes and shared among multiple genes. The number of k-mers containing UUU (red line), AUAA (green line) or matched to widely conserved miRNA sites (yellow line) is shown. (D) Conservation of widely conserved miRNA sites detected by LncLOOM within genes for which TargetScan reported no predictions. (Top) Number of genes/species with detected miRNA sites (left) and number of unalignable sequences (right). (Bottom left) Number/species of genes with detected miRNA sites. (Middle) Number/species of new miRNA sites detected. (Right) Number of new miRNA sites detected/number of unalignable sequences. (E) Comparison of miRNA sites with detected conservation per species by TargetScan and LncLOOM. Only sites previously identified by TargetScanHuman were compared. (F) Conservation of miRNA sites detected by LncLOOM within sequences without alignment to human sequences. Sites previously predicted by TargetScan in the human sequence are colored red and new LncLOOM predictions are colored blue. 11A-D illustrate the constraints imposed on the LncLOOM graph. (A) Examples of scenarios for LncLOOM graphs and how they are represented in ILP. (B) Conditional constraints on intersecting edges. An example of repeated suboptimal exclusion of k-mers in a complex path during refinement in subsequent iterations, which can occur if all intersections are constrained. (C) Flow diagram for defining conditional constraints on intersecting edges: a pair of intersecting edges is constrained only if there is at least one other edge from a unique path that intersects either edge . (D) Example showing how conditional constraints on intersection can relax suboptimal exclusion of tandemly repeated k-mers. The sequence shown in the panel is marked as SEQ ID NO:74. FIG. 12 shows the partitioning of the LncLOOM graph and iterative refinement of selected iterative k-mers. Motif discovery is performed by an iterative process, starting from the deepest layer in the graph, with each step searching for conserved motifs at progressively shallower depths. Here is an example of motif discovery starting with a five-layer graph. The graph is solved and the simple paths obtained at the solution (shown in green) are used to split the graph into subgraphs that are solved individually in the next iteration, and the next iteration is the top four of the graph. It is done for layers. Each simple path is immediately added to the final solution, while complex paths (shown in blue and red) are refined during subsequent iterations of motif discovery. In this case, the repeated k-mers that are removed during optimization are circled in pink. Same as above. 13A-B illustrate the processing steps in the LncLOOM framework. (A) Construction of 5' and 3' graphs. LncLOOM uses the central position of the first motif and final motif identified in the primary ILP (the entire length of each sequence is considered) to calculate the elongated individual sequences compared to other sequences in the graph. Predict and extract the 5' and 3' ends of LncLOOM motif discovery is then performed on a subset of the extracted 5' and 3' regions. In this example, a minimum depth of 3 is imposed, so the AUUGCU (SEQ ID NO: 15, blue) motif, which is conserved in only the top two sequences, is ignored, and CAUCCA (SEQ ID NO: 16, dark red and underlined) is Instead, it is considered as the first node. (B) Illustration of the vicinity of the motif. The reference sequence for each neighborhood is determined by combining all overlapping k-mers within the anchor sequence. All k-mers stored at their respective depths in the graph and connected to one of the overlapping k-mers in the reference sequence are then included within the neighborhood. The sequences shown in the panels are marked as SEQ ID NOS: 75-87. FIG. 14 is a flowchart illustration of a method suitable for analyzing a set of sequences, according to various exemplary embodiments of the invention. FIG. 15 is a schematic diagram of a computing platform configured to analyze a set of sequences, according to various exemplary embodiments of the invention. FIG. 16 is a graphical representation of gene expression changes of CHASERR, CHD2 and p21 (CDKN1A) after transfection of the indicated ASOs (SEQ ID NOs: 128 and 134) compared to untransfected SH-SY5Y cells. be. FIG. 17 is a graphical representation of gene expression changes of CHASERR and CHD2 after transfection of the indicated ASOs (SEQ ID NOs: 128 and 134) compared to untransfected MCF7 and SH-SY5Y cells.

The present invention, in some embodiments thereof, relates to compositions for use in treating CHD2 haploinsufficiency, and methods for identifying the same.

Before describing at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or illustrated by the examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

CHD2 haploinsufficiency is associated with neurodevelopmental delay, intellectual disability, epilepsy, and behavioral problems. Previous results indicate that CHD2 expression is tightly regulated by Chaserr, a conserved lncRNA located upstream of Chd2. Loss of Chaserr substantially increases Chd2 mRNA and protein levels, leading to changes in gene expression, including transcriptional interference by inhibiting promoters found downstream of highly expressed genes. .

During the conception of embodiments of the present invention, the inventor identified conserved elements within the sequences that have diverged beyond alignment possibilities and/or have accumulated substantial lineage-specific sequences such as transposable elements. We devised a new algorithm for detection. Using this algorithm, or an embodiment thereof called “LncLOOM,” we specifically inhibited Cheserr interaction with functionally relevant interactors and ultimately inhibited CHD2 haploinsufficiency. We have identified and verified conserved regions of Chaserr that can be preferentially mutated/targeted to compensate for.

Accordingly, in accordance with one aspect of the invention, there is provided a method for increasing the amount of chromodomain helicase DNA binding protein 2 (CHD2) in a neuronal cell, the method comprising: administering a nucleic acid agent that down-regulates the activity or expression of human Chaserr to a neuronal cell. introducing a nucleic acid agent to the final exon of human Chaserr, thereby providing a method of increasing the amount of CHD2 in neuronal cells.

As used herein, "a nucleic acid agent that downregulates the activity or expression of human Chaser" refers to a nucleic acid molecule that inhibits the activity or decreases the amount of human Chaser.

According to some embodiments, a "nucleic acid agent that downregulates the activity of human Chaserr" includes a nucleic acid agent that increases the expression (protein and optionally mRNA) of CHD2, a nucleic acid agent that increases the stability of CHD2 mRNA. , a nucleic acid agent that induces expression of CHD2 mRNA, and a nucleic acid agent that induces translation of CHD2.

Accordingly, in accordance with one aspect of the invention, there is provided a nucleic acid agent for the activity or downregulation of human Chaser that hybridizes to the final exon of human Chaser (i.e., is complementary to a nucleotide sequence within the final exon of human Chaser). Nucleic acid agents are provided that include a nucleic acid sequence).

As used herein, "chromodomain helicase DNA binding protein 2 (CHD2)" refers to the enzyme encoded by the CHD2 gene in humans. Examples of CHD2 splice variants in humans include the NCBI reference sequences: NM_001271.4 and NM_001042572.

Splice variant protein products are as described in NCBI reference sequence: NP_001262.3 or NP_001036037.

As used herein, "haploinsufficiency" refers to a model of dominant gene action in diploid organisms in which the standard (so-called wild type) A single copy of the allele is insufficient to produce the standard phenotype. Typically, only about half the amount of protein is produced compared to a healthy state in which both alleles are wild type.

As used herein, "increase the amount" of increasing the amount of the protein or RNA of interest by a statistically significant amount and the usefulness of the protein or RNA for treating haploinsufficiency of the protein or RNA of interest. It refers to increasing the amount that has a certain characteristic. In various embodiments, "increasing the amount" of the protein or RNA of interest is at least 10%, or in some embodiments at least about 20%, at least 20%, 20-150%, 50-150 %, such as at least 50%, 60%, 70%, 80%, 90%, at least 1.2 times 1.4 times 1.5 times or more, such as at least 2 times. According to certain embodiments, CHD2 levels are restored to amounts found in normal cells of the same type (ie, neural) and developmental stage (not having haploinsufficiency).

As used herein, "neuronal cell" refers to cells found within or outside a subject, such as tissue biopsies, cell lines, and primary cultures.

Other cells, ie, non-neuronal cells, are also contemplated.

Neuronal cells may or may not be genetically modified, eg, naïve.

According to certain embodiments, the neuronal cells are located in the central nervous system.

Methods of identifying cells whose levels of CHD2 are altered or have been altered according to some embodiments of the invention are well known in the art.

Contacting the agent with a cell may include, for example, applying the agent to a cell derived from the subject (e.g., primary cell culture, cell line) or into a biological cell containing the same, such that the agent is in direct contact with the cell. This can be done by any in vivo or in vitro conditions, including adding to a sample (eg, a fluid, liquid containing cells). According to some embodiments of the invention, the subject's cells are incubated with the agent. The conditions used to incubate cells determine whether the drug induces cellular changes, such as increased levels (amount) of CHD2, or the rate of transcription and/or translation of a particular gene, proliferation rate, differentiation, or cell death. selected for the period/concentration of cells/concentration of said agent/ratio of cells to said agent etc. which makes it possible to induce relevant changes such as changes such as , necrosis, apoptosis etc.

Levels of CHD2 (mRNA and/or protein) may be analyzed prior to, simultaneously with and/or subsequent to introducing the agent into the cells. Additionally or alternatively, genomic DNA is analyzed for modifications introduced by the agent, such as in the case of genome editing, as described further herein below.

Downregulation at the nucleic acid level (ie, reduction in the abundance of nucleic acids) is typically performed using nucleic acid agents having a nucleic acid backbone, DNA, RNA, mimetics thereof, or combinations thereof. Nucleic acid agents can be encoded from DNA molecules or provided on the cell itself.

According to certain embodiments, the down-regulating agent is a polynucleotide.

It is understood that the nucleic acid agents are contemplated herein per se and encoded from a nucleic acid construct or as part of a pharmaceutical composition.

According to certain embodiments, the down-regulating agent is a polynucleotide or oligonucleotide capable of hybridizing to the gene or mRNA encoding CHD2.

According to certain embodiments, the down-regulating agent interacts directly with the gene or with the RNA transcript of CHD2.

According to certain embodiments, the agent binds directly to a nucleic acid sequence within the final exon of Chaserr.

As used herein, "Chaserr" refers to CHD2 adjacent suppressive regulatory RNA. HGNC:48626 Entrez Gene:100507217

The exon structure of Chaserr is EXON1: nucleotide 1. ．． 344; EXON2: nucleotide 345. ．． 538; EXON3: nucleotide 539. ．． ．． 608; EXON4: nucleotide 609. ．． ．． 694; EXON5: nucleotide 695. ．． ．． 763; EXON6: nucleotide 764. ．． ．． 1787, where the final exon of Chaserr is nucleotide 764.1 of SEQ ID NO: 3 (NR_037601). ．． Points to 1787.

According to certain embodiments, the nucleic acid agent hybridizes to a nucleic acid sequence element comprising SEQ ID NO: 1 (AUG).

According to another embodiment, the nucleic acid agent hybridizes to a nucleic acid sequence element comprising SEQ ID NO: 2 (AUGG).

According to certain embodiments, the nucleic acid agent hybridizes to a nucleic acid sequence element comprising AAGAUGG (SEQ ID NO: 4), AAGAUG (SEQ ID NO: 5) or AAAUGGA (SEQ ID NO: 6).

According to another embodiment, the nucleic acid agent hybridizes to a nucleic acid sequence element comprising SEQ ID NO: 3 (aauaaa).

According to certain embodiments, the nucleic acid agent inhibits DHX36 binding to Chaserr.

As used herein, "DHX36" refers to a likely ATP-dependent RNA helicase, also known as DEAH box protein 36 (DHX36) or MLE-like protein 1 (MLEL1) or G4 resolvase 1 (G4R1). RNA helicase, which refers to DHX36 or associated with AU-rich element (RHAU), is an enzyme encoded by the DHX36 gene in humans.

According to certain embodiments, the nucleic acid agent comprises a nucleotide sequence complementary to UUUUUACCU (SEQ ID NO: 122)

According to certain embodiments, the nucleic acid agent inhibits CHD2 binding to Chaserr.

According to certain embodiments, the down-regulating agent is an antisense, RNA silencing agent or genome editing agent.

According to certain embodiments, the down-regulating agent is antisense.

Antisense Oligonucleotides - Antisense oligonucleotides are single-stranded oligonucleotides designed to hybridize to target RNA and thereby inhibit its function or level. Downregulation or inhibition of Chaserr RNA can be performed using, for example, antisense oligonucleotides that can specifically hybridize to Chaserr transcripts comprising SEQ ID NO: 1, 2, 4, or 6. Preferably, hybridization of the antisense oligonucleotide prevents binding of effector elements to Chaser, but otherwise leaves Chaserr RNA intact. According to certain embodiments, the nucleic acid agent does not recruit RNaseH.

In some embodiments, the antisense oligonucleotide does not recruit RNaseH. For example, an antisense oligonucleotide can substantially include RNA nucleotides. In yet other embodiments, the antisense oligonucleotide recruits RNase H and therefore comprises at least a stretch of DNA nucleotides. For example, an antisense oligonucleotide may be a gapmer.

According to a particular embodiment, antisense sequences corresponding to the antisense oligonucleotides (ASOs) exemplified for mouse in the Examples section below include, but are not limited to, AAGATGGCAGTCTACTATGG (SEQ ID NO: 12). Included are ATCCACTGTCCATTTGTG (SEQ ID NO: 9), which targets CCATAGTAGACTGCCATCTT (SEQ ID NO: 7), and CACAAATGGACAGTGGAT (SEQ ID NO: 10). Although nucleotide sequences are conveniently presented herein as complete DNA or RNA sequences, it is understood that antisense oligonucleotides can be constructed as RNA or DNA nucleotides, or mixtures thereof. That is, it is understood that if an oligonucleotide exhibits the nucleotide thymine (T), the nucleotide can be replaced by its RNA counterpart (uridine, ie, U), and vice versa. Additionally, it is understood that antisense oligonucleotides can be constructed using DNA and RNA nucleotide modifications such as those well known in the art.

According to certain embodiments, the nucleic acid agent comprises a nucleotide sequence complementary to UUUUUACCU (SEQ ID NO: 122). As used herein, the term "complementary" refers to canonical (A/T, A/U, and G/C) base pairing.

According to certain embodiments, the nucleic acid agent inhibits CHD2 binding to Chaserr.

According to a particular embodiment, the antisense oligonucleotide has a nucleobase sequence set forth in SEQ ID NOs: 140-143 (corresponding to A40, 50, 51, 52). In modified versions thereof, antisense oligonucleotides are provided as SEQ ID NOs: 128, 131, 132 and 133.

The design of antisense molecules that can be used to efficiently inhibit or reduce the amount of Chaserr must be done keeping in mind two aspects important to antisense approaches. The first aspect is the delivery of the oligonucleotide to the nucleus of the appropriate cell, and the second aspect is the delivery of the oligonucleotide to the nucleus of the appropriate cell, and the second aspect is the delivery of the oligonucleotide to the nucleus of the appropriate cell. It's by design.

The prior art teaches several delivery strategies that can be used to efficiently deliver oligonucleotides to a wide variety of cell types [eg, Jaaskelainen et al. Cell Mol Biol Lett. (2002) 7(2):236-7; Gait, Cell Mol Life Sci. (2003) 60(5):844-53; Martino et al. J Biomed Biotechnol. (2009) 2009:410260; Grijalvo et al. Expert Opin Ther Pat. (2014) 24(7):801-19; Falzarano et al, Nucleic Acid Ther. (2014) 24(1):87-100; Shilakari et al. Biomed Res Int. (2014) 2014:526391; Prakash et al. Nucleic Acids Res. (2014) 42(13):8796-807 and Asseline et al. J Gene Med. (2014) 16(7-8):157-65]

Additionally, an algorithm is utilized to identify sequences with the highest predicted binding affinity for target RNAs based on thermodynamic cycles that account for the energetic mechanisms of conformational changes in both target RNAs and oligonucleotides. possible [e.g. Walton et al. Biotechnol Bioeng 65:1-9 (1999)]. Such algorithms have been successfully used to implement antisense techniques in cells.

Additionally, several methods have been published for designing specific oligonucleotides and predicting their efficiency using in vitro systems (Matveeva et al., Nature Biotechnology 16:1374-1375 (1998)).

For example, suitable antisense oligonucleotides targeting Chaserr RNA are of the sequences listed in Table 3 below (and considered an integral part of this specification), or SEQ ID NOs: 140- 143, or an antisense oligonucleotide having a modification as set forth in SEQ ID NO: 128, 131, 132, or 133 corresponding to A40, 50, 51, 52.

According to various embodiments, antisense oligonucleotides can include complete RNA nucleotides. Since such antisense oligonucleotides do not recruit RNaseH, Chaserr should not be degraded by its antisense inhibition. In yet other embodiments, the antisense oligonucleotide comprises a mixture of DNA and RNA nucleotides (eg, a gapmer) capable of recruiting RNaseH and degrading Chaser RNA.

In some embodiments, the antisense oligonucleotide contains one or more nucleotides containing a 2' to 4' bridge, such as a locked nucleotide (LNA) or a constrained ethyl (cEt), and herein Contains other bridging nucleotides as described.

In some embodiments, the antisense oligonucleotide contains one or more of the nucleotides with a 2'-O modification, such as 2'-OMe or 2'-O-methoxyethyl (2'-O-MOE). or in some embodiments all).

In some embodiments, antisense oligonucleotides include modified backbones such as phosphorothioate or phosphorodithioate. In yet other embodiments, the antisense oligonucleotide comprises a morpholino backbone.

In some embodiments, antisense oligonucleotides include one or more nucleotides with modified bases, such as 5-methylcytosine.

Other nucleotide modifications that may be used are described elsewhere herein.

Alternatively, downregulation of CHD2 can be achieved by RNA silencing. As used herein, the phrase "RNA silencing" refers to regulatory mechanisms mediated by RNA molecules that result in inhibition or "silencing" of the activity or availability of RNA [e.g., RNA interference (RNAi), transcription gene silencing (TGS), post-transcriptional gene silencing (PTGS), querying and co-suppression]. RNA silencing has been observed in many types of organisms including plants, animals and fungi.

As used herein, the term "RNA silencing agent" refers to an RNA that can specifically inhibit or "silence" the expression of a target gene. In certain embodiments, an RNA silencing agent can prevent complete processing (eg, complete translation and/or expression) of an mRNA molecule via a post-transcriptional silencing mechanism. RNA silencing agents include non-coding RNA molecules, such as RNA duplexes that include paired strands, and precursor RNAs that can generate such small non-coding RNAs. Exemplary RNA silencing agents include dsRNA, such as siRNA, miRNA and shRNA.

In one embodiment, the RNA silencing agent is capable of inducing RNA interference.

According to one embodiment of the invention, the RNA silencing agent is specific for the target RNA and is specific for the final exon of Chaserr (the following elements: e.g. as described above) and an overall homology of 99% or less to the target gene as determined by PCR, Western blot, immunohistochemistry and/or flow cytometry, e.g. Less than 98%, less than 97%, less than 96%, less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, less than 89%, less than 88%, less than 87% , cross-inhibiting or silencing other targets (or other exons within the same target) that exhibit less than 86%, less than 85%, less than 84%, less than 83%, less than 82%, less than 81% overall homology It is actually specific for nucleic acid regions that do not.

RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals that is mediated by small interfering RNA (siRNA).

The following is a detailed description of RNA silencing agents that may be used in accordance with certain embodiments of the invention.

dsRNA, siRNA and shRNA - The presence of long dsRNA in cells stimulates the activity of a ribonuclease III enzyme called Dicer. Dicer is involved in the processing of dsRNA into short fragments of dsRNA known as small interfering RNA (siRNA). Small interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and include duplexes of about 19 base pairs. The RNAi response is also characterized by an endonuclease complex commonly referred to as the RNA-induced silencing complex (RISC) that mediates the cleavage of single-stranded RNA with sequences complementary to the antisense strand of the siRNA duplex. . Cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex.

Accordingly, some embodiments of the invention contemplate the use of dsRNA to downregulate protein expression from mRNA.

According to one embodiment, dsRNAs longer than 30 bp are used. Various studies have demonstrated that long dsRNAs can be used to silence gene expression without inducing stress responses or causing significant off-target effects. For example, [Strat et al. , Nucleic Acids Research, 2006, Vol. 34, No. 13 3803-3810; Bhargava A et al. Brain Res. Protoc. 2004;13:115-125;Diallo M. , et al. , Oligonucleotides. 2003;13:381-392;Paddison P. J. , et al. , Proc. Natl Acad. Sci. USA. 2002;99:1443-1448;Tran N. , et al. , FEBS Lett. 2004;573:127-134].

According to some embodiments of the invention, dsRNA is provided within a cell in which the interferon pathway is not activated. For example, Billy et al. , PNAS 2001, Vol 98, pages 14428-14433 and Diallo et al, Oligonucleotides, October 1, 2003, 13(5): 381-392. See doi:10.1089/154545703322617069.

According to one embodiment of the invention, the long dsRNA is specifically designed not to induce the interferon and PKR pathways to downregulate gene expression. For example, Shinagwa and Ishii [Genes&Dev. 17(11):1340-1345, 2003] have developed a vector called pDECAP for expressing long double-stranded RNA from an RNA polymerase II (Pol II) promoter. Long ds-RNAs from pDECAP induce interferon responses because the transcripts from pDECAP lack both the 5'-cap structure and the 3'-poly(A) tail that facilitate transport of ds-RNA into the cytoplasm. do not.

Another way to circumvent the interferon and PKR pathways in mammalian systems is through the introduction of small inhibitory RNAs (siRNAs) either by transfection or endogenous expression.

The term "siRNA" refers to small inhibitory RNA duplexes (generally 18-30 base pairs) that induce RNA interference (RNAi) pathways. Typically, siRNAs are chemically synthesized as 21-mers with a central 19 bp duplex region and symmetrical 2-base 3' overhangs at the ends, but in recent years siRNAs have been chemically synthesized as 21-mers with a central 19 bp duplex region and symmetrical 2-base 3' overhangs at the ends. It has been described that synthesized RNA duplexes can have as much as a 100-fold increase in potency compared to a 21-mer at the same position. The observed increased potency obtained using longer RNAs when inducing RNAi is due to providing Dicer with substrate (27-mer) instead of product (21-mer) and that this has been suggested to improve the speed or efficiency of entry of siRNA duplexes into RISC.

The position of the 3'-overhang influences siRNA potency, with asymmetric duplexes with a 3'-overhang on the antisense strand generally being more potent than those with a 3'-overhang on the sense strand. (Rose et al., 2005). This may be due to asymmetric strand loading on RISC, as an opposite efficacy pattern is observed when targeting antisense transcripts.

Strands of double-stranded interfering RNA (eg, siRNA) can be linked to form hairpin or stem-loop structures (eg, shRNA). Thus, as mentioned, the RNA silencing agents of some embodiments of the invention can also be short hairpin RNAs (shRNAs).

The term "shRNA" as used herein refers to an RNA agent that has a stem-loop structure that includes first and second regions of complementary sequence, the degree of complementarity and orientation of the regions being , is sufficient for base pairing to occur between the regions, and the first and second regions are connected by a loop region, the loop being sufficient for base pairing to occur between the nucleotides (or nucleotide analogs) within the loop region. arises from lack. The number of nucleotides within the loop is a number from 3 to 23, or from 5 to 15, or from 7 to 13, or from 4 to 9, or from 9 to 11. Some of the nucleotides within the loop may participate in base pairing interactions with other nucleotides within the loop. Examples of oligonucleotide sequences that can be used to form loops include those listed in International Patent Application Nos. WO2013126963 and WO2014107763. It will be appreciated by those skilled in the art that the resulting single-stranded oligonucleotide will form a stem-loop or hairpin structure that includes a double-stranded region that can interact with the RNAi machinery.

Synthesis of RNA silencing agents suitable for use with some embodiments of the invention can be performed as follows. First, the Chaserr mRNA sequence is scanned for AA dinucleotide sequences. Record the presence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites.

Second, potential target sites are identified using any sequence alignment software such as BLAST software available from NCBI servers (www(dot)ncbi.nlm.nih(dot)gov/BLAST/). Compare to appropriate genomic databases (e.g., human, mouse, rat, etc.).

A qualified target sequence is selected as a template for siRNA synthesis. Preferred sequences are those with low G/C content, as these are likely to be more effective at mediating gene silencing than sequences with G/C content greater than 55%. This is because it has been proven. Preferably, several target sites are selected along the length of the target gene for evaluation. For better evaluation of the selected siRNA, it is preferable to use a negative control in combination. Preferably, the negative control siRNA comprises the same nucleotide composition as the siRNA, but lacks significant homology with the genome. Therefore, it is preferred that scrambled nucleotide sequences of siRNA are used, provided they do not show any significant homology to any other genes.

The RNA silencing agents of some embodiments of the invention need not be limited to molecules containing only RNA, but also chemically modified nucleotides and non-containing molecules, as mentioned herein above. It will be understood that nucleotides are further included.

miRNA and miRNA mimetics - According to another embodiment, the RNA silencing agent can be a miRNA.

The terms "microRNA", "miRNA" and "miR" are synonymous and refer to a collection of non-coding single-stranded RNA molecules approximately 19-28 nucleotides in length that regulate gene expression. miRNAs are found in a wide range of organisms (viruses (dot) fwdarw (dot) humans) and have been shown to play roles in development, homeostasis and disease pathogenesis.

Preparation of miRNA mimetics can be performed by any method known in the art, such as chemical synthesis or recombinant methods.

From the description provided hereinabove, it is understood that contacting a cell with a miRNA can be performed, for example, by transfecting the cell with a mature double-stranded miRNA, pre-miRNA or pri-miRNA. will be done.

Nucleic acid sequence modifications are also contemplated herein to improve bioavailability, affinity, stability, or combinations thereof.

According to one embodiment, the nucleic acid agent includes at least one base (eg, nucleobase) modification or substitution.

As used herein, "unmodified" or "natural" bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil ( U) is included. "Modified" bases include, but are not limited to, other synthetic and natural bases such as 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-amino Adenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-halouracil and cytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine ; and 3-deazaguanine and 3-deazaadenine. Additional modified bases include those described in U.S. Pat. No. 3,687,808; Kroschwitz, J.; I. , ed. (1990), “The Concise Encyclopedia Of Polymer Science And Engineering,” pages 858-859, John Wiley &Sons; Englisch et al. (1991), “Angewandte Chemie,” International Edition, 30, 613; and Sanghvi, Y. S. , “Antisense Research and Applications,” Chapter 15, pages 289-302, S. T. Crooke and B. Lebleu, eds. , CRC Press, 1993. Such modified bases are particularly useful in increasing the binding affinity of oligomeric compounds of the invention. These include 5-substituted pyrimidines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 6-azapyrimidine and N-2, N-6 and O-6-substituted purines. 5-Methylcytosine substitution has been shown to increase the stability of nucleic acid duplexes by 0.6-1.2°C (Sanghvi, Y.S. et al. (1993), “Antisense Research and Applications ," pages 276-278, CRC Press, Boca Raton), are presently preferred base substitutions, and even more particularly preferred when combined with the 2'-O-methoxyethyl sugar modification. Additional base modifications are described in Deleavey and Damha, Chemistry and Biology (2012) 19:937-954, which is incorporated herein by reference.

According to one embodiment, the modification is in the backbone (ie in the internucleotide linkages and/or sugar moieties).

Sugar modification of nucleic acid molecules has been widely described in the art (PCT International Publication Nos. WO92/07065, WO93/15187, WO98/13526 and WO97/26270, all of which are incorporated herein by reference; U.S. Pat. No. 5,334,711; U.S. Pat. No. 5,716,824; and U.S. Pat. No. 5,627,053; Perrault et al., 1990; Pieken et al., 1991; Usman & Cedergren, 1992; Beigelman et al., 1995; Karpeisky et al., 1998; Earnshaw & Gait, 1998; Verma & Eckstein, 1998; Burlina et al., 1997). Such publications describe general methods and strategies for determining the location of incorporation of sugar, base and/or phosphate modifications, etc. into nucleic acid molecules without modulating catalysis. Exemplary sugar modifications include, but are not limited to, 2' modified nucleotides, such as 2'-deoxy, 2'-fluoro (2'-F), 2'-deoxy-2'-fluoro, 2' -O-methyl (2'-O-Me), 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2'-O- Dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2' - Fluoroarabino oligonucleotide (2'-F-ANA), 2'-O--N-methylacetamide (2'-O-NMA), 2'-NH2 or locked nucleic acid (LNA). Additional sugar modifications are described in Deleavey and Damha, Chemistry and Biology (2012) 19:937-954, which is incorporated herein by reference.

Thus, for example, oligonucleotides can be modified to enhance their stability and/or enhance biological activity by modification with nuclease-resistant groups; for example, the nucleic acid agents of the invention may be It can include O-methyl, 2'-fluorine, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-amino, and/or phosphorothioate linkages. Locked nucleic acids (LNAs) include, for example, nucleic acid analogs in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O and 4'-C atoms, ethylene nucleic acids (ENA), e.g. The inclusion of 2'-4'-ethylene bridged nucleic acids and certain nucleobase modifications, such as 2-amino-A, 2-thio (e.g., 2-thio-U), G-clamp modifications, improves the binding affinity for the target. It can also increase sex. Including pyranose sugars in the oligonucleotide backbone can also reduce endonucleolytic cleavage. The binding arm may further include a peptide nucleic acid (PNA) in which the deoxyribose (or ribose) phosphate backbone in the DNA is replaced by a polyamide backbone, or may include a polymer backbone, a cyclic backbone, or an acyclic backbone. . The binding region may incorporate a sugar mimetic and may further include a protecting group, particularly at its terminus, to prevent undesired degradation (as explained below).

Exemplary internucleotide bond modifications include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methylphosphonates, alkylphosphonates (including 3'-alkylenephosphonates). ), chiral phosphonates, phosphinates, phosphoramidates (including 3'-aminophosphoramidates), aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, Boranophosphates (those with the usual 3'-5' linkage, their 2'-5' linked analogs, and those with adjacent nucleoside unit pairs 3'-5' to 5'-3' or 2' boron phosphonate, phosphodiester, phosphonoacetate (PACE), morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, Included are sulfonates, sulfonamides, sulfamates, formacetals, thioformacetals, alkylsilyls, substituted, peptide nucleic acids (PNAs) and/or threose nucleic acids (TNAs). Various salt forms, mixed salt forms and free acid forms of the above modifications may also be used. The additional nucleotide interconnection modifiers are DELEAVEY AND DAMHA, CHEMISTRY AND BIOLOGY (2012) 19: 937-954; and HUNZIKER & LEUMANN ND DE MESMAEKER ET AL. , 1994.

According to certain embodiments, the modifications include modified nucleoside triphosphates (dNTPs).

According to one embodiment, the modification includes an edge-blocker oligonucleotide.

According to certain embodiments, the edge-blocker oligonucleotide includes phosphate, inverted dT and amino-C7.

According to one embodiment, the nucleic acid agent is modified to include one or more protecting groups, eg, 5' and/or 3' cap structures.

As used herein, the phrase "cap structure" is meant to refer to chemical modifications that are incorporated into either terminus of an oligonucleotide (e.g., U.S. Pat. No. 5,998,203). These terminal modifications can protect the nucleic acid molecule from exonucleolytic degradation and aid in intracellular delivery and/or localization. Cap modifications may be present at the 5' end (5'-cap) or the 3' end (3'-cap), or at both ends. In non-limiting examples, the 5'-cap is an inverted abasic residue (part); 4',5'-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4'-thionucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3' , 4'-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-reverse nucleotide moiety; 3'-2'-reverse abasic moiety; 1,4-butanediol phosphate; 3'-phosphoramidate; hexyl phosphate; aminohexyl phosphate; 3'-phosphate ; 3'-phosphorothioate; phosphorodithioate; or a bridged or unbridged methylphosphonate moiety.

In some embodiments, the 3'-cap is an inverted deoxynucleotide, such as an inverted deoxythymidine, a 4',5'-methylene nucleotide; a 1-(beta-D-erythrofuranosyl) nucleotide; a 4'- Thionucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; 3,4- Dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5'-5'-reverse nucleotide moiety; 5'-5'-reverse abasic moiety; 5'-phosphoramidate; 5'-phosphorothioate; 1, 4-butanediol phosphate; 5'-amino; a group containing bridged and/or unbridged 5'-phosphoramidates, phosphorothioates and/or phosphorodithioates, bridged or unbridged methylphosphonates, and 5'-mercapto moieties, etc. (see generally Beaucage & Iyer, 1993, incorporated herein by reference).

Nucleic acid agents can be further modified by including a 3' cationic group or by reversing the terminal nucleoside through a 3'-3' linkage. In another alternative, the 3' end can be blocked by an aminoalkyl group, eg 3' C5-aminoalkyl dT. Other 3' conjugates can inhibit 3'-5' exonuclease cleavage. Without wishing to be bound by theory, 3' conjugates such as naproxen or ibuprofen may inhibit exonuclease cleavage by sterically blocking exonuclease binding to the 3' end of the oligonucleotide. Small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (such as D-ribose, deoxyribose, glucose, etc.) can also block 3'-5'-exonucleases.

According to one embodiment, the 5' end may be blocked by an aminoalkyl group, such as a 5'-O-alkylamino substituent. Other 5' conjugates can inhibit 5'-3' exonuclease cleavage. Without wishing to be bound by theory, 5' conjugates such as naproxen or ibuprofen may inhibit exonuclease cleavage by sterically blocking exonuclease binding to the 5' end of the oligonucleotide. Small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (such as D-ribose, deoxyribose, glucose, etc.) can also block 3'-5'-exonucleases.

According to certain embodiments, the modifications include locked nucleic acids (LNAs), or other bridging nucleotides such as cEt, and/or 2'-O-(2-methoxyethyl) (abbreviated as 2'MOE) or including a 2'-OMe modification whereby at least a portion or all of the sequence is modified at the 2' position of each nucleotide. Examples include, but are not limited to, A40, A50, A51, A35, A49, and A52.

Gapmers are also contemplated herein (see Examples section below, Table 5). Gapmers are chimeric antisense oligonucleotides that contain a central block of deoxynucleotide monomers of sufficient length to induce RNase H cleavage.

Nucleic acid agents (and their modifications described above) can also act at the DNA level as summarized below.

Down-regulation of Chaserr can also be achieved by inactivating the gene (e.g. Chaser) by introducing targeted mutations with loss-of-function changes within the gene structure (e.g. point mutations, deletions and insertions). sell.

As used herein, the phrase "loss-of-function alterations" refers to alterations (loss-of-function alterations) within the DNA sequence of a gene that result in down-regulation of the expression level and/or activity of the expressed lncRNA product. For example, it refers to any mutation in the final exon of Chaserr). Non-limiting examples of such loss-of-function changes include, i.e., mutations within the promoter sequence, usually 5' to the transcription start site of the gene, resulting in down-regulation of a particular gene product; regulatory mutations, i.e. , mutations in regions upstream or downstream of a gene or within a gene that affect the expression of the gene product; deletion mutations, i.e. mutations that delete any nucleic acid within the gene sequence; insertion mutations; , i.e. mutations that may result in the insertion of a nucleic acid into the gene sequence and the insertion of a transcription termination sequence; inversions, i.e. mutations resulting in an inverted sequence; splice mutations, i.e. mutations resulting in aberrant splicing or insufficient splicing; and overlapping mutations, ie, mutations that result in overlapping sequences that may be in frame or cause a frame shift.

According to certain embodiments, a loss-of-function change in a gene may involve at least one allele of the gene.

The term "allele" as used herein refers to any one or more alternative forms of a genetic locus, any allele of which is associated with a trait or characteristic. In diploid cells or organisms, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.

According to other specific embodiments, the loss-of-function alteration of a gene includes both alleles of the gene. In such cases, for example, mutations within the final exon of Chaserr may be homozygous or heterozygous.

Methods of introducing nucleic acid changes into genes of interest are well known in the art [see, eg, Menke D.; Genesis (2013) 51:-618; Capecchi, Science (1989) 244:1288-1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Numbers WO2014085593, WO2009071334 and WO2011146121; US Patent No. 8771945, US Patent No. 8586526, US Patent No. 6774279 Specification and U.S. Patent See Published Application No. 20030232410, Published Patent Application No. 20050026157, Published Patent Application No. 20060014264, by targeted homologous recombination, site-specific recombinases, PB transposases, and engineered nucleases. Including genome editing. Agents for introducing nucleic acid changes into genes of interest can be designed by publicly available sources or commercially obtained from Transposagen, Addgene and Sangamo Biosciences.

Examples include the use of genome editing agents such as CRISPR-Cas, meganucleases, zinc finger nucleases (ZFNs), TALENs, transposons, and the like.

Genome Editing Using a Recombinant Adeno-Associated Virus (rAAV) Platform - This genome editing platform is based on rAAV vectors that allow the insertion, deletion, or replacement of DNA sequences within the genome of living mammalian cells. The rAAV genome is a single-stranded deoxyribonucleic acid (ssDNA) molecule that is either positive sense or negative sense and is approximately 4.7 kb long. These single-stranded DNA viral vectors have high transduction rates and have the unique property of stimulating endogenous homologous recombination in the absence of double-stranded DNA breaks within the genome. Those skilled in the art can design rAAV vectors to target desired genomic loci and make both global and/or subtle endogenous genetic changes within cells. rAAV genome editing has the advantage of targeting a single allele and not resulting in any off-target genomic changes. rAAV genome editing technology is commercially available, for example, as the rAAV GENESIS™ system from Horizon™ (Cambridge, UK).

Methods for identifying efficacy and detecting sequence variations are well known in the art and include DNA sequencing, electrophoresis, enzyme-based mismatch detection assays, and hybridization assays such as PCR, RT-PCR, RNase Including, but not limited to, protection, in situ hybridization, primer extension, Southern blot, Northern blot and dot blot analysis.

Sequence changes within particular genes can also be determined at the protein level using, for example, chromatography, electrophoresis, immunodetection assays such as ELISA, and Western blot analysis, as well as immunohistochemistry.

Additionally, those skilled in the art can readily design knock-in/knock-out constructs containing positive and/or negative selection markers to efficiently select transformed cells that have undergone a homologous recombination event with the construct. . Positive selection provides a means to enrich the clonal population that has incorporated foreign DNA. Non-limiting examples of such positive markers include markers that confer antibiotic resistance such as glutamine synthetase, dihydrofolate reductase (DHFR), neomycin, hygromycin, puromycin and blasticidin S resistance cassettes. . Negative selection markers are required to select against random integration and/or exclusion of marker sequences (eg, positive markers). Non-limiting examples of such negative markers include herpes simplex-thymidine kinase (HSV-TK), which converts ganciclovir (GCV) into cytotoxic nucleoside analogs, hypoxanthine phosphoribosyltransferase (HPRT), and adenine Examples include phosphoribosyltransferase (ARPT).

According to one embodiment, the technology relates to introducing RNA silencing molecules using transient DNA or DNA-free methods (such as RNA transfection).

According to one embodiment, the RNA silencing molecule (eg, antisense molecule) is delivered as a "naked" oligonucleotide, ie, without an additional delivery vehicle. According to one embodiment, a "naked" oligonucleotide includes chemical modifications to facilitate its tissue delivery (e.g., utilizing inverted nucleotides, phosphorothioate linkages, or incorporation of locked nucleic acids, as described above). ).

Any method known in the art for transfection of RNA or DNA, such as, but not limited to, microinjection, electroporation, using liposomes or cationic molecules or nanomaterials. Lipid-mediated transfection can be used in accordance with the present teachings (described below and further described in Roberts et al. Nature Reviews Drug Discovery (2020) 19:673-694, incorporated herein by reference). ing).

According to one embodiment, as mentioned above, if the RNA silencing molecule (e.g. antisense) does not contain chemical modifications, the RNA silencing molecule is used as part of the expression construct in the target cell (e.g. senescent cells). In this case, the RNA silencing molecule (e.g. antisense molecule) is a system capable of constitutively or inducibly directing the expression of the RNA silencing molecule (e.g. antisense) in the target cell (e.g. neuron). ligated into a nucleic acid construct (also referred to herein as an "expression vector") under the control of an operative regulatory element (eg, a promoter).

Expression constructs of the invention may also contain additional sequences (eg, shuttle vectors) that make the expression construct suitable for replication and integration in eukaryotes. A typical cloning vector contains transcription and translation initiation sequences (eg, promoters, enhancers) and transcription and translation terminators (eg, polyadenylation signals). Expression constructs of the invention may further include an enhancer, which may be adjacent to the promoter sequence or remote from the promoter sequence, and which functions upon upregulation of transcription from the promoter sequence. can do. Polyadenylation sequences can also be added to the expression constructs of the invention to increase the efficiency of expression.

In addition to the embodiments already described, the expression constructs of the invention can increase the expression level of cloned nucleic acids or facilitate the identification of cells with RNA silencing molecules (e.g., antisense). Other specialized elements intended for use may typically be included. Expression constructs of the invention may or may not include eukaryotic replicons.

Nucleic acid constructs can be introduced into target cells (eg, neural cells) of the invention using appropriate gene delivery vehicles/methods (transfection, transduction, etc.) and appropriate expression systems. Such a method is described by Sambrook et al. , Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), Ausubel et al. , Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al. , Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al. , Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4(6):504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation, and infection with recombinant viral vectors. Additionally, see US Pat. No. 5,464,764 and US Pat. No. 5,487,992 regarding positive-negative selection methods.

Additionally or alternatively, lipid-based systems can be used to deliver constructs or nucleic acid agents encoded thereby to target cells of the invention (eg, senescent cells or cancer cells). Lipid-based systems include, for example, liposomes, lipoplexes and lipid nanoparticles (LNPs). In some embodiments, the antisense oligonucleotide or siRNA comprises a conjugated lipid or cholesteryl moiety.

Neuronal cell-specific promoters can be used to improve the specificity of the method. Examples of neuron-specific promoters include, but are not limited to, synapsin. Since synapsin is considered to be a neuron-specific protein (DeGennaro et al., 1983 Cold Spring Harb. Symp. Quant. Biol. 1, 337-345), we utilized its neuron-specific expression pattern to Transgenes can be expressed specifically in neurons. Adenovirus and AAV vectors for local injection use the minimal human synapsin promoter (Kugler et al. 2003 Human synapsin 1 gene promoter confers highly neuron-specific long-term transg ene expression from an adenoviral vector in the adult rat brain dependent on the transduced area. Gene Ther. 10, 337-347). AAV capsids that can reach the CNS after peripheral administration, such as AAV9 or other native AAV serotypes, are advantageous for relatively non-invasive administration resulting in large scale expression. At present, several engineered capsids exist with increased neuronal transduction efficiency. It has been reported that a lentivirus having an E/SYN promoter shows strong and sustained expression in neurons (Hioki et al. Gene Therapy volume 14, pages 872-882 (2007)).

The present teachings can be utilized in the clinic in treating related diseases, syndromes, disorders and conditions associated with CHD2 haploinsufficiency.

Accordingly, one aspect of the invention provides a method of treating a disease or condition associated with chromodomain helicase DNA binding protein 2 (CHD2) haploinsufficiency in a subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of a nucleic acid agent that down-regulates the final exon of human Chaser, thereby treating a disease or condition associated with CHD2 haploinsufficiency. A method is provided.

According to alternative or additional aspects, the activity of human Chaser or Nucleic acid agents that downregulate expression are provided that are directed to the final exon of human Chaserr.

As used herein, "a disease or condition associated with chromodomain helicase DNA-binding protein 2 (CHD2) haploinsufficiency" is characterized by a decrease in the expression (protein and optionally mRNA) of CHD2, or the onset of or refers to a pathogenic condition whose progression is associated with a decrease in the expression (protein and optionally mRNA) of CHD2.

According to certain embodiments, a disease or condition associated with CHD2 haploinsufficiency is early-onset epileptic encephalopathy (i.e., intractable seizures associated with frequent ongoing epileptiform activity and cognitive slowing or regression). ) refers to a CHD2-related neurodevelopmental disorder typically characterized by Onset of seizures is typically between 6 months and 4 years of age. Seizure types include fall seizures, myoclonus, and rapid onset of multiple seizure types associated with generalized spike waves on the EEG, atonic-myoclonic-absence seizures, and clinical photosensitivity. are typically included. Intellectual disability and/or autism spectrum disorder are common.

According to certain embodiments, the medical condition is selected from the group consisting of Lennox-Gastaut syndrome (LGS), myoclonic absence epilepsy (MAE), Dravet syndrome, intellectual disability with epilepsy, and autism spectrum disorder (ASD). be done.

Diagnosis of CHD2-associated neurodevelopmental disorders is based on heterozygous CHD2 single nucleotide pathogenic variants, small indel (insertion/deletion) pathogenic variants, or partial or total gene deletions detected by molecular genetic testing. Established for subjects with

Mutations in the CHD2 gene can be the result of germline mutations or de novo somatic mutations.

The term "treating" refers to inhibiting, preventing or preventing the occurrence of a pathology (disease, disorder or condition) and/or causing reduction, amelioration or regression of the pathology. Those skilled in the art can use a variety of methods and assays to assess the occurrence of a disease state, and may similarly use a variety of methods and assays to assess reduction, remission, or regression of a disease state. You will understand that.

As used herein, the term "prevent" means to prevent a disease, disorder or condition from occurring in a subject who may be at risk for the disease but has not yet been diagnosed as having the disease. refers to something.

As used herein, the term "subject" includes mammals, preferably humans of any age suffering from a disease condition. Preferably, the term encompasses individuals at risk of developing the condition. It will be appreciated that the mammal may be an embryo or a fetus. Alternatively, the subject may be a child or adolescent up to 15 or 18 years of age.

For in vivo therapy, the nucleic acid agent is administered to a subject by itself or as part of a pharmaceutical composition.

As used herein, "pharmaceutical composition" means a composition containing one or more of the active ingredients described herein, including other chemical ingredients such as physiologically suitable carriers and excipients. Refers to a preparation. The purpose of pharmaceutical compositions is to facilitate the administration of compounds to living organisms.

As used herein, the term "active ingredient" refers to a nucleic acid agent that is capable of being primarily responsible for a biological effect.

Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier", which may be used interchangeably, mean a carrier that does not cause significant irritation to living organisms and that does not cause biological activity of the administered compound. and carriers or diluents that do not negate the properties. Adjuvants are included under these terms.

As used herein, the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of the active ingredient. Examples of excipients include, but are not limited to, calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.

Techniques for the formulation and administration of drugs are described in "Remington's Pharmaceutical Sciences," Mack Publishing Co., which is incorporated herein by reference. , Easton, PA, latest edition.

Suitable routes of administration include, for example, systemic, oral, rectal, transmucosal, especially nasal, intestinal or parenteral delivery, such as intramuscular, subcutaneous and intramedullary injection, as well as intrathecal, directly intraventricular, intracardiac. may include, for example, intraluminal injection into the right or left ventricle, into the common coronary artery, intravenous, intraperitoneal, intranasal, intratumoral or intraocular injection.

According to certain embodiments, the composition is for an inhalation mode of administration.

According to certain embodiments, the composition is for intranasal administration.

According to certain embodiments, the composition is for intraventricular administration.

According to certain embodiments, the composition is for intrathecal administration.

According to certain embodiments, the composition is for intratumoral administration.

According to certain embodiments, the composition is for oral administration.

According to certain embodiments, the composition is for local injection.

According to certain embodiments, the composition is for systemic administration.

According to certain embodiments, the composition is for intravenous administration.

Conventional approaches for drug delivery to the central nervous system (CNS) include neurosurgical strategies (e.g., intracerebral injection or intraventricular injection); Molecular engineering of agents (e.g., production of chimeric fusion proteins containing transit peptides with affinity for endothelial cell surface molecules in combination with agents that cannot cross the BBB by themselves); increasing the lipid solubility of agents; (e.g., conjugation of water-soluble agents with lipid or cholesterol carriers); temporary disruption of BBB integrity due to hyperosmolar disruption (resulting from the use of agents). However, each of these strategies suffers from the inherent risks associated with invasive surgical procedures, size limitations imposed by limitations inherent in endogenous transport systems, and the potential for chimeras composed of carrier motifs that can be active outside the CNS. Each of these strategies has limitations, such as potentially undesirable biological side effects associated with systemic administration of the molecule, and the possible risk of brain damage in areas of the brain where the BBB is disrupted. would be a suboptimal delivery method.

Alternatively, the pharmaceutical composition may be administered locally rather than systemically, for example, by injecting the pharmaceutical composition directly into a tissue area of the patient.

The pharmaceutical compositions of some embodiments of the invention are prepared by processes well known in the art, such as conventional mixing, dissolving, granulating, dragee-making, wet milling, emulsifying, encapsulating, entrapping or lyophilizing processes. can be manufactured by.

Accordingly, pharmaceutical compositions for use in accordance with some embodiments of the invention may be conventionally formulated using one or more physiologically acceptable carriers including excipients and auxiliaries. This facilitates the processing of the active ingredient into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredient of the pharmaceutical composition may be formulated in an aqueous solution, preferably in a physiologically compatible buffer, such as Hank's solution, Ringer's solution or saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be penetrated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, pharmaceutical compositions can be readily formulated by combining the active compound with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc. for oral ingestion by a patient. Pharmacological preparations for oral use can be prepared by using solid excipients and optionally grinding the resulting mixture, if desired after adding suitable auxiliaries, in order to obtain tablets or dragee cores. and can be made by processing a mixture of granules. Suitable excipients include fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; for example, corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methylcellulose, hydroxypropylmethylcellulose, carboxylic acid. Cellulose preparations such as sodium methylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, a disintegrant such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof, eg, sodium alginate, may be added.

Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solution and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.

Pharmaceutical compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. Additionally, stabilizers may be added. All formulations for oral administration should be in dosages appropriate for the chosen route of administration.

For buccal administration, the compositions may take the form of conventionally formulated tablets or lozenges.

For administration by nasal inhalation, the active ingredient for use according to some embodiments of the invention may be administered using a suitable propellant, such as dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. It is conveniently delivered in the form of an aerosol spray from a pressurized pack or nebulizer. In the case of pressurized aerosols, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, for example, gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The pharmaceutical compositions described herein can be formulated for parenteral administration, eg, by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, eg, in ampoules or in multi-dose containers, optionally with an added preservative. The compositions may be suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulating agents such as suspending, stabilizing, and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparations in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or aqueous injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, eg, a sterile pyrogen-free aqueous solution, before use.

The pharmaceutical compositions of some embodiments of the invention can also be formulated into rectal compositions, such as suppositories or retention enemas, using, for example, conventional suppository bases such as cocoa butter or other glycerides. sell.

Pharmaceutical compositions suitable for use in connection with some embodiments of the present invention include compositions in which the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount is an amount effective to prevent, alleviate, or ameliorate the symptoms of a disorder (e.g., associated with CHD2 haploinsufficiency) or to prolong the survival of the subject being treated. , refers to the amount of active ingredient (eg, nucleic acid agent).

Determination of a therapeutically effective amount is well within the ability of one of ordinary skill in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, any dose can be formulated for animal models to achieve a desired concentration or potency. Such information can be used to more accurately determine useful doses for humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures, or in experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating various dosages for use in humans. The dosage may vary depending on the dosage form used and the route of administration utilized. The precise formulation, route of administration and dosage may be selected by the individual physician taking into account the patient's condition. (See, eg, Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. 1).

Dosage amount and interval can be individually adjusted to provide a sufficient level (minimum effective concentration, MEC) of the active ingredient to induce or suppress a biological effect. The MEC varies from preparation to preparation, but can be estimated from in vitro data. The dosage required to achieve the MEC depends on individual characteristics and the route of administration. Detection assays can be used to determine plasma concentrations.

Depending on the severity and responsiveness of the condition being treated, dosing may be in single or multiple administrations, with a series of treatments lasting from days to weeks, or until cure or disease state is achieved. continues until a reduction in is achieved.

The amount of composition administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, and the like.

The compositions of some embodiments of the invention are provided, if desired, in a pack or dispenser device, e.g., an FDA-approved kit, which may contain one or more unit dosage forms containing the active ingredient. sell. The pack may, for example, include metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be supported by a notice relating to the container in the form prescribed by the government agency regulating the manufacture, use or sale of pharmaceutical products, which notice may be in the form of the composition or for human or veterinary administration. reflects institutional approval for clinical administration. Such notice may be, for example, a label approved by the US Food and Drug Administration for prescription drugs, or an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared and placed in a suitable container, as detailed further above, for the treatment of the indicated condition. can be labeled for.

Treatment with the nucleic acid agents of the invention can be enhanced using other management protocols known in the art. For example, antiepileptic drugs (AEDs).

FIG. 14 is a flowchart illustration of a method suitable for analyzing a set of sequences, according to various exemplary embodiments of the invention. It is to be understood that, unless otherwise defined, the operations described herein below can be performed simultaneously or sequentially in many combinations or orders of performance. In particular, the order of flowchart illustrations should not be considered limiting. For example, two or more acts that appear in a particular order in the following description or flowchart illustrations may be performed in a different order (eg, in reverse order) or substantially simultaneously. Additionally, some operations described below are optional and may not be performed.

At least some of the operations described herein may be performed by a data processing system, e.g., special purpose circuitry or a general purpose computer, configured to receive data and perform the operations described below. At least some of the operations may be performed by a remote cloud computing facility.

A computer program implementing the methods of the present embodiments is typically provided to a user over a communications network or on a presentation medium such as, but not limited to, a floppy disk, a CD-ROM, a flash memory device, and a portable hard drive. sell. A computer program can be copied from a communication network or provisioning medium to a hard disk or similar intermediate storage medium. Computer programs may be executed by loading code instructions into an executable memory of a computer from either their provisioning medium or their intermediate storage medium and configuring the computer to operate according to the methods of the invention. During operation, the computer may store data structures or values obtained by intermediate calculations in memory and retrieve these data structures or values for use in subsequent operations. All of these operations are well known to those skilled in the art of computer systems.

The processing operations described herein may be performed by a processor circuit such as a DSP, microcontroller, FPGA, ASIC, or any other conventional and/or special purpose computing system.

The method of this embodiment can be implemented in many forms. For example, the methods of the present embodiments may be embodied on a tangible medium such as a computer for performing method operations. The methods of the present embodiments may be embodied on a computer-readable medium comprising computer-readable instructions for performing method operations. Additionally, the methods of the present embodiments may be implemented in an electronic device having digital computer functionality configured to execute a computer program on a tangible medium or to execute instructions on a computer-readable medium.

Referring now to FIG. 14, the method begins at 10 and optionally and preferably continues at 11 where a set of sequences is received. Typically, each sequence within the set describes a polynucleotide, such as, but not limited to, DNA or RNA, wherein the polynucleotides described by the various sequences within the set are homologous to each other. is determined manually or using bioinformatics tools such as Blastn, FASTA, etc. known to those skilled in the art, as further described herein below and in the Examples section below. . According to certain embodiments, the DNA is genomic DNA. According to another embodiment, the DNA is cDNA or library DNA. According to certain embodiments, the DNA represents a genetic locus. According to another embodiment, the DNA is coding DNA or non-coding DNA. According to certain embodiments, the DNA includes exons, introns, or a combination thereof. According to certain embodiments, the sequence is an RNA sequence. According to certain embodiments, the RNA is code RNA. According to another embodiment, the RNA is non-coding RNA.

In some embodiments of the invention, homologous polynucleotides are selected from the group consisting of 3'UTRs, lncRNAs, and enhancers.

The polynucleotides within a set can be complete sequences or partial sequences.

In some embodiments of the invention, the method proceeds to 12, where the sequences in the set are aligned according to a predetermined order, e.g. Provide alignment.

Alignments can be ordered as multiple alignments or using a phylogenetic tree representation-dendrogram. Typically, in multiple alignments, the first alignment layer is a sequence that describes the query polynucleotide. If the alignment is determined by evolution, the first layer is optionally and preferably a sequence that describes the species of interest. For example, if one of the polynucleotides is a human polynucleotide, the first alignment layer can be a sequence of human polynucleotides.

Alignment can be by any technique known in the art. Typically, the alignment technique provides a score and the order follows the score. For example, BLAST can be used to determine the order of the array. If the alignment technique provides a score, the second alignment layer is preferably the sequence with the highest alignment score relative to the first alignment layer, and the third alignment layer is preferably the sequence with the highest alignment score relative to the first alignment layer. It is preferable that the sequence has the next highest alignment score, and the same applies hereinafter. This provides an alignment in which the sequences in each layer are the ones with the best alignment scores relative to the sequences in the previous layer. If the alignment technique does not provide significant alignment for a particular alignment layer, the layers after that particular alignment layer include the next available sequence according to the order of the received set.

However, it should be understood that act 12 need not be performed. For example, the method may use an order at the time of the received set. Alternatively, the method may allow a user to select or input, for example by a user interface device, the order to be used by the method.

Preferably, the method continues at 13 where a graph is constructed. The inventors have found that it is advantageous to transform the sequence analysis problem into a graph traversal problem in order to allow defining the problem constraints in a more structured manner. Preferably, the graph is a layered and connected graph, with each edge of the graph connecting nodes of successive layers. The layers of the graph preferably represent arrays, and the nodes within the layers represent the k-mers within the respective array. Thus, for example, assume that the i-th layer of the graph represents a particular arrangement of the set (eg, the arrangement of dog organisms). In this case, each node of the i-th layer represents a particular arrangement of k-mers. For example, the first node of the i-th layer can represent the first k-mer in that particular sequence (e.g., bases 1-k of the sequence), and the second node of the i-th layer can represent the second k-mer within that particular sequence (eg, bases 2 to k+1 of the sequence), and so on. In various exemplary embodiments of the invention, 6≦k≦12.

If act 12 is not performed and the method does not receive user input regarding order, then the method builds the layers of the graph according to the order of the arrays in the received set. Specifically, the first layer of the graph represents the first array in the received set, the second layer of the graph represents the second array in the received set, and so on. be. When the method receives user input regarding the order, the method builds the layers of the graph according to the user input. Specifically, the first layer of the graph represents the array that is first in order according to user input, the second layer of the graph represents the array that is second in order according to user input, and so on. be. When act 12 is performed, the method builds the layers of the graph according to the alignment. Specifically, the first layer of the graph represents the arrangement of the first alignment layer, the second layer of the graph represents the arrangement of the second alignment layer, and so on.

In various exemplary embodiments of the invention, the first layer of the graph represents sequences that describe the query polynucleotide.

The graph is optionally and preferably constructed such that each edge connects nodes representing the same or homologous k-mer. An advantage of this embodiment is that motifs that are conserved or substantially conserved across multiple polynucleotides can be identified.

According to some embodiments of the invention, the homology between homologous k-mers connected by edges of the graph is at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably is at least 90%, 95% or more.

Representative examples of typical layered graphs according to some embodiments of the invention are shown in FIGS. 11B, 11D, and 12. In these figures, nodes are shown as strings corresponding to nucleotide bases forming k-mers, edges are shown as straight solid lines, and layers are indicated by L ₁ , L ₂ , etc.

The method continues at 14 where the graph is searched for continuous non-intersecting paths along the edges of the graph. The search may be performed using any known optimization technique such as, but not limited to, linear programming (e.g., integer linear programming), mixed linear programming, or any method to find a locally maximal solution. Other techniques can be used, such as greedy algorithms.

A path is non-conforming in the sense that edges connecting nodes representing one particular k-mer do not intersect edges connecting nodes representing k-mers that are not the same or homologous to that particular k-mer. It is an intersection. However, if there are multiple edges that represent a specific k-mer and connect nodes belonging to two consecutive layers, these edges may intersect, but do not necessarily need to intersect. Please note that. For example, referring to the simplified graph at the bottom of FIG. 11D, the graph includes two k-mers, eight nodes representing the heptamer AGAAUCG and five nodes representing the hexamer CCGUAC. . Edges connecting heptamers (same or homologous) do not intersect edges connecting hexamers (same or homologous). On the other hand, there are edges connecting the heptamers and intersecting each other (e.g. an edge connecting the fourth node of layer L ₂ to the fourth node of layer L ₃ and the fifth node of layer L ₂ (see the edge connecting L3 to the third node of layer _L3 ). Still, some of the edges connecting the heptamers do not intersect other edges (e.g., the edge connecting the fourth node of layer L ₂ to the _third node of layer L ₃ (see not intersecting the edge connecting the fifth node to the fourth node of layer _L3 ).

In some embodiments of the present invention, the search involves searching for deeper paths (i.e., paths that traverse more graph-rich layers) than shallower paths (i.e., paths that traverse graph-less layers). ), including applying criteria by path depth as a constraint for the search, such that the search is preferential for the search.

From 14, the method optionally and preferably continues to 15, in which the value of k is decreased (preferably by 1), and then wraps around to 13 to remove nodes already represented by nodes already present in the graph. Restructure the graph according to the reduced value of k by including nodes in the graph that represent k-mers that are shorter than the k-mer that is being used. Preferably, the reconstruction includes adding nodes corresponding to shorter k-mers while preserving at least some of the existing nodes, thus increasing the order (number of nodes) of the graph. Referring again to the simplified case of FIG. 11D, the top graph of this figure has eight nodes representing heptamers and no nodes representing k-mers with k<7. The middle graph in FIG. 11D shows the reconstruction of the graph by adding 5 nodes representing hexamers so that the order of the graph increases from 8 to 8+5=13.

When nodes representing shorter k-mers are included in the graph, the method optionally and preferably updates the edges of the graph to connect the same or homologous k-mers of successive layers. This is illustrated in the middle graph of FIG. 11D, where edges were added to the graph to connect the newly added nodes representing hexamers. can be added in combination such that any node in layer L _i representing a particular k-mer is connected to any node in layer L _i+1 representing the same particular k-mer. .

After each reconstruction of the graph, the method optionally and preferably re-performs act 14 to provide continuous non-intersecting paths along the edges of the reconstructed graph. Such re-execution may result in the exclusion of a previously obtained path, for example, if it is found to intersect a newly added edge. This is illustrated in the top graph of FIG. 11D, where, for example, a path that starts at the leftmost node of layer _L1 and ends at the rightmost node of layer _L3 is shown in the top graph of FIG. (before), but is not included in the lower graph of FIG. 11D (after reconstruction) because it was found to intersect with an edge connecting the hexamers that was added during reconstruction.

The folding back from 14 to 13 via 15 is optionally and preferably repeated repeatedly. Preferably, in each iteration cycle, the method applies the paths obtained in the previous iteration cycle as constraints for the search. A representative example of such application of constraints is shown in FIG. 12 and further illustrated in the Examples section below. Iterations are optionally and preferably repeated until no more k-mers are added or no new non-crossing paths are found, or until some other predetermined stopping criterion is met.

At 16, output is generated. Preferably, the output identifies a k-mer corresponding to at least one of the pathways as a nucleic acid sequence of functional interest. The output may be displayed graphically or textually on a display device, or may be stored on a computer-readable storage medium for subsequent use.

The method ends at 17.

FIG. 15 illustrates hardware that typically includes an input/output (I/O) circuit 134, a hardware central processing unit (CPU) 136 (e.g., a hardware microprocessor), and both volatile and nonvolatile memory. 1 is a schematic diagram of a client computer 130 having a hardware processor 132 that typically includes a hardware memory 138. FIG. CPU 136 communicates with I/O circuitry 134 and memory 138. Client computer 130 preferably includes a graphical user interface (GUI) 142 that communicates with processor 132. I/O circuitry 134 preferably communicates information to and from GUI 142 in a suitably structured format. Also shown is a server computer 150, which may also include a hardware processor 152, an I/O circuit 154, a hardware CPU 156, and a hardware memory 158. I/O circuits 134 and 154 of client computer 130 and server computer 150 can operate as transceivers that communicate information with each other via wired or wireless communications. For example, client computer 130 and server computer 150 may communicate via network 140, such as a local area network (LAN), wide area network (WAN), or the Internet. Server computer 150 may be part of the cloud computing resources of a cloud computing facility that communicates with client computer 130 via network 140 in some embodiments.

GUI 142 and processor 132 may be integrated within the same housing or may be separate units that communicate with each other.

GUI 142 may optionally and preferably be part of a system that includes dedicated CPU and I/O circuitry (not shown) that allows GUI 142 to communicate with processor 132. Processor 132 issues graphical and textual output generated by CPU 136 to GUI 142 . Processor 132 also receives signals from GUI 142 related to control instructions generated by GUI 142 in response to user input. GUI 142 may be of any type known in the art, such as, but not limited to, a keyboard and display, a touch screen, and the like. In a preferred embodiment, GUI 142 is a GUI of a mobile device, such as a smartphone, tablet, or smartwatch. If GUI 142 is a GUI of a mobile device, processor 132, the mobile device's CPU circuitry can function as processor 132 and can execute the code instructions described herein.

Client computer 130 and server computer 150 may further include one or more computer-readable storage media 144, 164, respectively. Media 144 and 164 are preferably non-transitory storage media that store computer code instructions for performing the methods further detailed herein, and processors 132 and 152 execute these code instructions. do. Code instructions may be executed by loading respective code instructions into respective execution memories 138 and 158 of respective processors 132 and 152.

Each of storage media 144 and 164 can store program instructions that, when read by a respective processor, cause the processor to perform the methods described herein. In some embodiments of the invention, a set of sequences describing a plurality of homologous polynucleotides is received by processor 132 by I/O circuit 134. Processor 132 constructs a graph, searches the graph for continuous non-intersecting paths, and functionalizes the k-mer corresponding to at least one path, as further detailed herein above. generate an output that identifies the nucleic acid sequence of interest. Alternatively, processor 132 can send the set of sequences to server computer 150 via network 140. Computer 150 receives the set of sequences, constructs a graph, and searches the graph for continuous non-intersecting paths, as described in further detail hereinabove. functionally identify the k-mer as the nucleic acid sequence of interest. Computer 150 functionally transmits the nucleic acid sequence of interest back to computer 130 via network 140 . Computer 130 receives the nucleic acid sequence and displays it on GUI 142.

Once a motif is identified, molecular biology techniques can be used to verify the motif, eg, by cloning into an expression vector, which typically carries a reporter sequence.

As used herein, the term "about" refers to ±10%.

The terms "comprises," "comprising," "includes," "including," "having," and their root words include, but are not limited to. It means "not done".

The term "consisting of" means "including and limited to."

The term "consisting essentially of" means that the composition, method, or structure may include additional ingredients, steps, and/or parts, but that the additional ingredients, steps, and/or parts are not claimed. This means only if the fundamental and novel characteristics of the composition, method, or structure being used do not materially change.

As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "compound" or "at least one compound" can include multiple compounds, including mixtures thereof.

Throughout this application, various embodiments of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and is not to be construed as an inflexible limitation on the scope of the invention. Accordingly, range descriptions should be considered to specifically disclose all possible subranges and individual numerical values within that range. For example, a description of a range such as 1 to 6 includes subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, e.g. , 1, 2, 3, 4, 5 and 6. This applies regardless of the width of the range.

Whenever a numerical range is indicated herein, it is meant to include any recited number (fraction or integer) within the indicated range. The phrase "ranging/ranges between" the first number and the second number, and the phrase "from" the first number and "to" the second number. The phrase "ranging/ranges" is used interchangeably herein and is meant to include the first and second indicated numbers and all fractions and integers therebetween.

As used herein, the term "method" refers to, but is not limited to, methods known to or known to those skilled in the art of chemistry, pharmacology, biology, biochemistry, and medicine. refers to the manners, means, techniques, and procedures for accomplishing a given task, including manners, means, techniques, and procedures readily developed from the manner, means, techniques, and procedures of

It is understood that an RNA antisense sequence may be provided herein as a DNA sequence in which a U is replaced by a T.

When referring to a particular sequence listing, such reference includes minor sequence variations resulting from, for example, sequencing errors, cloning errors, or other changes resulting in base substitutions, base deletions, or base additions. It should be understood to include sequences that substantially correspond to complementary sequences, provided that the frequency of such mutations is less than 1 in 50 nucleotides, or less than 1 in 100 nucleotides, or less than 1 in 200 nucleotides. or less than 1 in 500 nucleotides, or less than 1 in 1000 nucleotides, or less than 1 in 5,000 nucleotides, or less than 1 in 10,000 nucleotides.

It will be understood that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention that are, for brevity, described in the context of a single embodiment may also be used separately or in any suitable subcombination or together with any other features of the invention. may be provided as suitable in the described embodiments. Certain features described in the context of various embodiments should not be considered essential features of those embodiments unless the embodiments are inoperable without those elements.

The various embodiments and aspects of the invention described hereinabove and claimed in the following claims section find experimental support in the following examples.

Reference is now made to the following examples which, together with the above description, illustrate in a non-limiting manner some embodiments of the invention.

Materials and Methods Input to LncLOOM LncLOOM operates on a set of sequences obtained from different species. Typically, each sequence corresponds to a putative homolog of the sequence obtained from various species. Currently we are working with only one sequence isoform per species, but accommodation is possible if multiple sequences per species exist, for example to alternatively spliced products. Input sequences are typically constructed by manual inspection of RNA-seq and EST data and existing annotations. It is noted that some of the input sequences may be incomplete and, according to some embodiments of the invention, the present framework includes specific steps to accommodate such scenarios. sea bream. Before graph construction, the set is filtered to remove identical sequences. This may be further adjusted by the user to remove sequences with percentage identity above a threshold, in which case LncLOOM calculates the percentage identity between each pair of sequences using MAFFT MSA and calculates the percentage identity between each pair of sequences using the input data Keep the first occurrence of the array in the set.

Sequence Ordering The LncLOOM framework generates an ordered set of sequences that ideally should be from a species (human in both examples in this manuscript) with monotonically increasing evolutionary distances to the anchor sequence. built around. The order of the sequences can be provided by the user or determined by using BLAST. When BLAST is used, the anchor sequence is defined to be the first sequence in the dataset. The second sequence is the sequence with the highest alignment score to the anchor sequence. Each subsequent sequence is the one with the best alignment score to the previous sequence among the as yet unordered sequences. If no significant alignment is found, the next available sequence within the original input is selected.

Overview of the LncLOOM Method Once the sequence order is established, LncLOOM calculates short conserved values for various values of k by reducing each nucleotide sequence to an array of k-mers, each represented by a node in the graph. Identify a set of k-mer combinations. Identical k-mers in adjacent sequences are connected in graphs by additional constraints (Figures 11A-D) and the use of integer linear programming (ILP) to eliminate long non-intersecting paths in these graphs. Find a set. The set of paths identified within each graph is used in subsequent iterations to define constraints on the graph and partition the graph (an example of graph partitioning is shown in Figure 12). Starting from the largest k and decreasing it iteratively, LncLOOM constructs an initial principal graph for every k-mer length within the specified range. The main graph is constructed over every ordered array in the dataset, then pruned layer by layer into a series of subgraphs (until only the top two arrays remain), and the ILP problem for each subgraph is solved independently. It will be destroyed. At any given depth, the subgraph may be partitioned into additional sets of smaller subgraphs based on the paths found in previous iterations. In practice, this approach makes it possible to prioritize the identification of deeply conserved longer motifs over shorter, less conserved motifs, reducing the size of the ILP program to less than 1,000 edges that can be rapidly solved. It also makes it possible to maintain LncLOOM's overall execution time to a few minutes even when applied to tens of long arrays.

Graph Construction Considering the data set of lncRNA sequences derived from species D and the k-mer length k (6 to 15 nt), LncLOOM constructs a directed graph G = (V, E). , where V is the set of all nodes in the graph and E is the set of edges. The graph is composed of D layers, where D is the number of arrays in the dataset. Each array is modeled as a layer (L ₁ , L ₂ ...L _D ), and a layer L _i (corresponding to an array of length N(i)) is a node (v ₁ , v ₂ ...v _{N (i)−k+1} ), where each node v _n represents the k-mer at position n in the i-th array (FIG. 1B). All pairs of nodes representing the same k-mer and found in successive layers (L _i and L _j for j=i+1) are connected by edges x _uv = (u, v), where u∈ L _i■ and v∈L _j■ . Since each substring typically occurs multiple times within an array, the number of edges can significantly exceed the number of nodes in the graph. Ordered combinations of deeply conserved k-mers are nonintersecting (i.e.,

), which corresponds to a long path in G with a node at _L1 . Therefore, the goal is to find a set S in E such that each edge is reachable from _L1 via an edge that is in S, and no two edges in S intersect. Ideally, it would be desirable to find the largest S subject to potential additional constraints. For example, short paths may not be desirable, so this requires that any edges in S are found on the path to reach a particular layer.

Identification of Long Non-Intersecting Paths Using ILP In the ILP problem, each edge in G is represented by a variable x _uv that is assigned a value of 1 if (u,v) is in S. The objective function is defined to maximize |S| below.

Additional constraints placed on this model derive from several considerations. First, LncLOOM aims to identify short conserved k-mers that occur in the same order within LncRNA sequences. However, it is unlikely that a k-mer occurs more than once within each sequence. Therefore, the constraints applied to the ILP model are that complex paths containing multiple repeats of a single k-mer in one or more layers must not intersect paths of unmatched k-mers that do not have the same depth. (FIGS. 1B and 11A). To ensure the selection of non-intersecting paths, the following constraints are imposed on any pair of edges that intersect between two consecutive layers:

Since the above constraint only considers the starting position of each node, it also excludes intersecting edges connecting the same k-mers that are repeated in two consecutive layers. If the k-mer is repeated in both successive layers, a network of edges is constructed from each repeat-repeat connection (FIG. 11B). This network of edges may override the selection of other paths that are equally conserved but have fewer k-mers connecting them. Therefore, we impose this constraint on edges connecting identical k-mers because this constraint facilitates the splitting of complex paths into multiple non-intersecting paths interspersed by paths of uniquely existing k-mers. This is very important. However, if the network of edges connecting identical iterations is constrained to each other only if no other path exists, then the ILP solver selects any possible solution of the edge from multiple iteration-iteration connections. be able to. This can lead to repeated suboptimal exclusion of k-mers during subsequent iterations of graph refinement (the scenario shown in Figure 13B). To avoid this scenario, crossing constraints are only imposed on edges connecting the same k-mers if there is at least one other path with equal depth that intersects the network of repeated k-mers. be done.

where Z and P denote the respective subsets of all immediate successors and predecessors of node v, y is the minimum depth requirement, and M is a sufficiently large constant (in practice 100 is used). ). Under this constraint, only paths with continuous connections from L ₁ to at least L _y are selected. At the same time, this constraint allows the selection of connected complex pathways involving tandemly repeated k-mers within one or more layers (Fig. 1B).

In the graph G, each layer L _i consists of nodes (v _{1 ,} v _{2 .} . . v _N(i)−k+1 ) starting at every consecutive position in the sequence and having a length of k bases. This follows from the set S that a set S _union can be formed by merging edges connecting neighboring nodes that overlap with each other. When the ILP is solved, these overlapping nodes are combined into a single longer k-mer. This step may encounter scenarios in which a set of contiguous k-mers represents a region of a sequence that contains a single repeated string of bases (see FIG. 1B for an example). The resulting merged k-mer may then contain layer-specific insertions. To overcome this, we can use either L _i or L _j to connect overlapping adjacent k-mers such that the start and length of the overlap region is equal between the two adjacent nodes in each layer. The following constraints are imposed on edge pairs.

ILP is a well-known NP challenge that poses major challenges to the scalability of LncLOOM for very long arrays or large data sets. To overcome this limitation, several steps are included in the framework to reduce the ILP complexity of each graph and also favor the selection of deeply conserved k-mers. These include graph pruning, partitioning the graph based on simple paths, additional constraints on edge construction, and iterative refinement of complex non-intersecting paths.

Graph Pruning Two pruning steps are used in the LncLOOM framework. The first step involves excluding nodes corresponding to over-repeated k-mers within one or more layers. The number of repetitions allowed per layer can be adjusted by the user, and if a small k (eg, 6) is used, the density of edges in even longer arrays can be significantly reduced. For a given k-mer length, this step is performed during initial graph construction for all sequences in the data set, and the excluded nodes are then excluded from any resulting subgraph. A second pruning step is performed at each iteration of subgraph construction at a given level to exclude any nodes that do not have a connected path from _L1 to the current depth.

Partitioning the graph to reduce computational complexity The constraints imposed on the ILP problem allow the choice of simple or complex paths, where a simple path consists of only one node per layer. is defined as a route that includes A simple path should not intersect with a shallower path and therefore consists of deterministically selected edges that present boundaries at which the graph can be divided into even smaller subgraphs that can be solved independently (Fig. 12 ). Currently, these graphs are solved serially, but in the future there is scope to use parallel computing to process even larger data sets, provided at least one simple path is found. The partitioning is based on a simple path of the current k-mer length found at each level in layer-by-layer iterations. Each subgraph is constructed by selecting a subset of nodes that are located between two simple paths τ _a and τ _b with depth = y, where the boundaries are for each layer L ₁ to L _{y− 1} , defined as the ending and starting positions of the nodes in each path: W={v _n |q+k−1<n, n+k−1<r, v _q ∈τ _a , v _r ∈τ _b }( The final layer is removed for the next iteration). If the k-mers of adjacent simple paths overlap, the k-mers are combined first and boundaries are defined by the start and end positions of the longer combined k-mers.

Refinement of complex non-intersecting paths. In contrast to simple paths, complex paths have many branches connecting repeated k-mers, especially for paths chosen in early iterations when the graph is unconstrained. can include. In an unconstrained graph, it is impossible to decipher which iterations happen to appear in each layer. Therefore, complex paths are not used to constrain edge selection in the graph in subsequent iterations. Instead, the set S found at each iteration consists of 1) a subset of simple paths used for partitioning and edge constraint definition, and 2) complex paths that are stored separately and continuously refined in subsequent iterations. is divided into a subset of During refinement, the complex path is optimized to remove branches that intersect the newly discovered path (Fig. 12). The refinement of complex paths is done in two steps during layer-by-layer exclusion. First, before solving a subgraph spanning y layers, each graph of complex paths only is divided into a longer k-mer subset LC _d=y with depth=y and a point in time with a minimum depth y+1. It is constructed from a subset C _d>y of the k-mer length path (the complex path selected in the previous iteration at the current k-mer length). Then, a subset of the refined complex paths C _refined is found according to the above ILP problem. However, to ensure the selection of any complex path in C _d>y over any shallower path in LC _d=y , the following additional constraints are imposed.

Under this constraint, for each path τ in C _d>y , at least one repeated k-mer is selected from L ₁ . If this constraint is imposed along with the above constraints, the solution includes a refined path that spans at least y layers. Once the set C _refined is found, a subgraph of every k-mer of that point in time and depth is constructed. Every path in C _refined is then added to the current subgraph, and the ILP problem is solved with additional constraints imposed to favor the selection of each path τ in C _refined . This solution is then split into a set of simple paths and a set of complex paths for the next iteration. LncLOOM also includes an option to store and refine simple paths, such that simple paths with larger depths and shorter k-mers are preferred over longer, shallower k-mers. However, when this option is applied, the graph is not partitioned and no constraints are imposed on edge construction in subsequent iterations. Therefore, this option is computationally expensive and can only be used to analyze small datasets of short sequences.

Using BLAST High Scoring Pairs (HSP) to Reduce Graph Complexity BLAST may be used as an optional step in the process of LncLOOM graph construction. BLAST HSP is a local ungapped alignment between segments of sequences found in successive layers that have significant similarity. We use these HSPs to constrain edge construction such that any pair of nodes that are not contained within the same HSP between two consecutive layers are not connected. HSPs found by BLAST are redundant in that HSPs can overlap with each other and any segment can match multiple segments within the target sequence. For any set of HSPs that overlap with each other, only the most significant pairs are included in the HSPs used for graph construction. Similarly, if one segment aligns with multiple segments within the target sequence, only the highest scoring alignment is included. These constraints derived from BLAST analysis can effectively reduce the number of possible paths in the graph and can facilitate correct placement of edges between layers where part of the alignment is incomplete. (Figure 1A).

Graph Size Limits Although steps are included to reduce the complexity of ILP problems, in some scenarios the graph is too large to be solved in a reasonable time. To address this bottleneck, the total number of edges in the graph is limited. By default, the maximum number of edges allowed in an ILP problem is 1200, but this can be set to any number greater than 50. During any iteration, if the number of edges in the graph G exceeds a maximum limit, the graph is divided into a series of subclusters where the ILP problem is solved individually. Starting from the path with the fewest edges (fewest repeated k-mers), an individual graph is constructed from each path τ in G and only the paths in C _refined that intersect it. The allowed edges within this subcluster of G are then optimized using ILP, and then C _refined is updated to include these edges and the path τ is removed from G. This process is repeated for each remaining path in G until either all paths are individually optimized for C _refined , or the number of edges in G is maximized, at which point , all remaining paths in G are mutually optimized in a single ILP problem. If the number of edges in the graph constructed from individual subclusters of intersecting paths exceeds the maximum limit, ILP does not proceed and only paths from _{C_refined} are kept in the solution.

Finding Motifs within Extended 5' and 3' Regions of Sequences The input to LncLOOM may occasionally contain 5' or 3' incomplete sequences. Because the dataset is ordered by homology and not completeness, these sequences can be found in any layer in the graph, potentially preventing layer-by-layer connection of nodes within these regions. In this scenario, motif discovery is performed in three stages to reduce the possibility of losing conserved motifs. In the first stage, LncLOOM identifies motifs from a primary graph built over all sequences (sum of Dsequences) in the dataset. LncLOOM then determines which sequences potentially have extended 5' or 3' ends by considering the position of the first and final motif within each sequence relative to the central position across the entire sequence. (Figure 13A). Based on this, LncLOOM constructs and solves individual graphs of the extended 5' and 3' regions of the more complete sequences in the dataset. To construct the 5' elongated graph, LncLOOM selects the first node in each layer L ₁ to L _D

First, calculate the center position _Mq of the starting position. Then, a subset of nodes _W ={v _n |n+k−1<q _i } is extracted from each layer L _i if q i >t·M _q , where t is some tolerance defined by the user. It is. The nodes of the extended 3' graph are extracted based on the ending position of the final motif relative to the length of each sequence. Specifically, LncLOOM is the final node in each layer L ₁ to L _D

Calculate the median relative position M _Re of the end position of , where:

It is. Then, if Re _i <M _Re ·(1+t), a subset of nodes W={v _n |n<r _i +k−1} is extracted from each layer L _i . By default, t=0.5 for both 5' and 3' graph extraction, but the tolerance can be defined independently for each graph. This step of motif discovery only proceeds if the graph contains nodes from the extended region of the anchor sequence. For example, a scenario in which shallowly conserved motifs prevent the identification of 5' or 3' truncations within deeper layers, because motifs found near the 5' end are conserved only within the first two layers. To avoid this, a "minimum depth" parameter can be applied to select the positions of the first motif and the final motif within each sequence from a subset of motifs that are conserved to a specified depth. If a minimum depth parameter is applied, any motifs that do not meet the specified depth requirement are also removed from the solution.

Calculation of Motif Modules and Neighborhoods Once the ILP problem is solved for every subgraph in the framework, each set of non-intersecting paths selected from the linear, 5' elongated, and 3' elongated graphs is processed into motif modules and neighborhoods. be done. A motif module is defined as an ordered combination of at least two unique motifs conserved within a set of sequences, where each motif can have any number of tandem repeats. By default, the module is computed at every layer of the graph, L _i |2≦i≦D, by extracting paths that span all layers from L ₁ to L _i . If a minimum depth d is specified in the parameters, the module is computed for every layer L _i |d≦i≦D. As mentioned above, motif discovery is performed by an iterative process of layer-by-layer exclusion. This selects for longer regions of identity as the set of sequences is successively reduced to include more closely related sequences. As a result, shorter motifs that are more deeply conserved are often embedded in longer motifs that are conserved only among the top layers (Fig. 13B). We define these regions in the graph as motif neighborhoods, where each neighborhood, along with the neighboring regions of each node in each layer, is connected to a single region of L ₁ overlapping nodes. , including all nodes in the graph. To compute motif neighborhoods, LncLOOM first combines every overlapping node in L ₁ to form a set of reference k-mers representing each neighborhood. For each reference k-mer, all paths connected to each shorter k-mer embedded within the reference k-mer are included in its neighborhood. For each motif within each layer, the length of the flanking region is calculated relative to the motif's position within the reference k-mer (FIG. 13B). Motif modules and neighborhoods from each of the primary, 5' elongated, and 3' elongated graphs are presented in HTML and plain text file formats.

Calculating Motif Significance Motif significance is inferred by calculating the empirical p-value of each motif within the two genres of the random data set. First, for a motif of length k conserved in _Li , we find that within _Li a set of random sequences with the same percentage identity between successive layers observed in the input sequence. Determine the empirical probability of finding the exact motif found at least once in any combination of the actual data set and any motifs of the same length or greater and the same number. It uses MAFFT to generate the MSAs of the input array, then performs multiple iterations (100 for the analysis described in this manuscript) of LncLOOM iterations in which the columns of the MSA are randomly shuffled. This is achieved by Second, we _determined that the exact Determine the empirical probability of finding any combination of a motif and any motif of the same number of the same length (but not preserving the % identity between layers). Only the former P value was used in the analyzes described in this manuscript. Multiprocessing is implemented to perform iterations in parallel.

Functional Annotation of Motifs LncLOOM has two optional annotation functions. First, the discovered motifs ensure perfect base pairing with the seed region of conserved (conserved across mammals) and widely conserved (typically found across vertebrates) miRNAs. can be mapped to the binding site of miRNA by identifying it from TargetScan. For each motif, the type of pairing (hexamer, heptamer, heptamer-A1, heptamer-M8, or octamer) considers the motif together with the immediately adjacent bases from both sides of the motif. is determined for each sequence by A match is only found if the complete seed region (hexamer) matches the motif directly. Second, motifs found in genes expressed in HepG2 or K562 cell lines can also be mapped to RBP binding sites identified by eCLIP in the ENCODE project. To determine the chromosomal coordinates of each motif within the selected query sequence, LncLOOM aligns the sequences to the genome using BLAT (Kent, 2002) and then extracts the chromosomal coordinates from the ENCODE bigBed file using the pyBigWig package. The overlap with the extracted coordinates of the binding site of RBP is calculated. Alternatively, the user can upload a bed file that specifies the chromosomal coordinates and length of each exon within the query sequence. The extracted eCLIP data is filtered to exclude any peaks with enrichment <2 beyond the mock input. RBPs that bind to a large portion of the anchor sequence are marked because the overlap of their binding peak with any conserved motif is unlikely to be functionally related to that particular motif.

LncLOOM Implementation and Availability Graph construction is performed using the networkx package. The integer programming problem was modeled using PuLP and either the open source COIN-OR Branch-and-Cut solver (CBC) (www(dot)coin-or(dot)org/) or the commercially available Gurobi solver (www (dot) gurobi (dot) com/). LncLOOM utilizes the following alignment programs: BLAST, BLAT and MAFFT during graph construction, motif annotation, and empirical evaluation of motif significance. A multiprocessing Python package is used to compute statistical iterations in parallel.

Calculation of Motif Enrichment To assess the enrichment of a particular motif within a sequence, we generated 1,000 sets of random sequences that matched the dinucleotide composition of the input sequence and calculated the occurrence of motifs. The expected number of motifs and empirical p-values were calculated by counting.

LncLOOM analysis of lncRNA and 3'UTR Using LncLOOM, Cyrano sequences from 18 species, libra (Nrep in mammals) from 8 species, Chaserr sequences from 16 species, DICER1 sequences from 12 species, and analyzed the PUM1 and PUM2 sequences from. For all genes, the LncLOOM parameters were set to search for k-mers of 15-6 bases in length, and the sequences were reordered by BLAST with the human sequence defined as the anchor sequence in each case. No HSP restrictions were imposed. Motif significance was calculated over 100 iterations. Table 1 shows the sequence order of each gene as represented in the LncLOOM framework.

Also, LncLOOM was used to analyze 2,439 3'UTR genes. The dataset was constructed from 3'UTR MSA generated by TargetScan7.2 miRNA Target Site Prediction Suite ¹⁰ and included human, mouse, dog and chicken sequences that were between 300 and 3,000 nt. . Depending on availability and length (>200 bases), sequences from frog, shark, zebrafish, gar and lamprey, cioan and fly were obtained from Ensembl and added to their respective genetic datasets. For each dataset, we used BLASTN with a cutoff E value of 0.05 to determine which sequences in each of each species had no detectable alignment to their human orthologs, as well as mouse, dog, and chicken. Also classify sequences that were not aligned. The k-mers identified by LncLOOM were matched to the seeds of a widely conserved miRNA family for which TargetScanHuman reported hsa-miRNA. To evaluate the sensitivity of LNCLOOM, to evaluate the sensitivity of LNCLOOM, the widely preserved MIRNA binding site identified by LNCLOOM and TARGETSCAN (WWW (DOT) TargetScan (DOT) ORG / CGI -BIN / TARGETSCAN / DATA / DATA / DATA Reported by _download. vert72.cgi) The results were compared with the predictions. Specifically, we only compared miRNA sites from genes for which TargetScan reported sites in the same representative human transcripts used within the present LncLOOM dataset. In total, this represented 2,359 out of 2,439 genes.

Tissue Culture Neuro2a cells (ATCC) were routinely cultured in DMEM containing 10% fetal bovine serum and 100 U penicillin/0.1 mg ml ⁻¹ streptomycin in a humidified incubator at 37° C. and 5% CO ₂ . Cells were routinely tested and not authenticated for mycoplasma contamination.

Mass Spectrometry Sample Preparation Samples were subjected to in-solution trypsin digestion using suspension trapping (S-trap) as previously described ⁴⁷ . Briefly, pull-down proteins were eluted from beads using 5% SDS in 50mM Tris-HCl. Eluted proteins were reduced with 5mM dithiothreitol and alkylated with 10mM iodoacetamide in the dark. Each sample was loaded onto an S-Trap microcolumn (Protifi, USA) according to the manufacturer's instructions. After loading, samples were washed with 90:10% methanol/50mM ammonium bicarbonate. Samples were then digested with trypsin for 1.5 hours at 47°C. Digested peptides were eluted using 50mM ammonium bicarbonate. Trypsin was added to this fraction and incubated overnight at 37°C. Two further elutions were performed using 0.2% formic acid and 0.2% formic acid in 50% acetonitrile. The three eluates were pooled together and vacuum centrifuged to dryness. Samples were kept at -80°C until further analysis.

Liquid Chromatography ULC/MS grade solvents were used for all chromatography steps. The dried digested sample was dissolved in 97:3% H ₂ O/acetonitrile + 0.1% formic acid. Each sample was loaded using a splitless nano-Ultra Performance Liquid Chromatography (10 kpsi nanoAcquity; Waters, Milford, Mass., USA). Mobile phases were A) H ₂ O + 0.1% formic acid, and B) acetonitrile + 0.1% formic acid. Desalting of the samples was performed online using a reverse phase Symmetry C18 trapping column (180 μm inner diameter, 20 mm length, 5 μm particle size; Waters). Peptides were then separated using a T3 HSS nanocolumn (75 μm inner diameter, 250 mm length, 1.8 μm particle size; Waters) at 0.35 μL/min. Peptides were eluted from the column into the mass spectrometer using the following gradient: 4% to 30% B in 55 min, 30% to 90% B in 5 min, held at 90% for 5 min, then initial Returned to condition.

Mass spectrometry A FlexIon nanospray device (Proxeon) was used to transfer nano to a quadrupole orbitrap mass spectrometer (Q Exactive HF, Thermo Scientific) via a nanoESI emitter (10 μm tip; New Objective; Woburn, MA, USA). UPLC were combined online.

Data were acquired using the Top 10 method in data-dependent acquisition (DDA) mode. MS1 resolution was set to 120,000 (200 m/z), mass range was set to 375-1650 m/z, AGC was set to 3e6, and maximum injection time was set to 60 ms. MS2 resolution was set to 15,000, quadrupole isolation to 1.7 m/z, AGC to 1e5, dynamic exclusion to 20 seconds, and maximum injection time to 60 ms.

Mass spectrometry data processing and analysis Raw data were processed using MaxQuant v1.6.6.0. Data were searched using the Andromeda search engine against the mouse (Mus musculus) protein database downloaded from Uniprot (www(dot)uniprot(dot)com) and appended with common experimental protein contaminants. )did. Enzyme specificity was set to trypsin and a maximum of two missed cleavages were allowed. Fixed modifications were set to carbamidomethylation of cysteine, and variable modifications were set to oxidation of methionine and protein N-terminal acetylation. Peptide precursor ions were searched with a maximum mass deviation of 4.5 ppm and fragment ions with a maximum mass deviation of 20 ppm. Peptide and protein identifications were filtered at 1% FDR using a decoy database strategy (MaxQuant's "Revert" module). The minimum peptide length was 7 amino acids and the minimum Andromeda score of the modified peptide was 40. The run-to-run match option was checked to ensure that peptide identifications were reflected across samples. The search was performed with the label-free quantitation option selected. Quantitative comparisons were calculated using Perseus v1.6.0.7. Excludes decoy hits. Student's t-test was used after logarithmic transformation to identify significant differences between experimental groups across biological replicas. The fold change was calculated based on the ratio of the geometric means of different experimental groups.

RNA-pulldown assay By amplifying synthetic oligos (Twist Bioscience) and adding the T7 promoter to the 5' end for the sense sequence and to the 3' end for the antisense control sequence (see Table 2 for complete sequence). Templates for in vitro transcription were generated. Biotinylated transcripts were generated using the MEGAscript T7 in vitro transcription reaction kit (Ambion) and biotin RNA labeling mixture (Roche). Template DNA was removed by treatment with DNase I (Quanta). Neuro2a cells (ATCC) were lysed using RIPA supplemented with protease inhibitor cocktail (Sigma-Aldrich, #P8340) + 100U/ml RNase inhibitor (#E4210-01) and 1mM DTT for 15 minutes on ice. . The lysate was clarified by centrifugation at 21,130 xg for 20 minutes at 4°C. Streptavidin magnetic beads (NEB #S1420S) were washed twice with buffer A (NaOH 0.1M and NaCl 0.05M) and once with buffer B (NaCl 0.05M), then binding/washing. (NaCl 1M with PI+100U/ml RNase inhibitor and 1mM DTT, 5mM Tris-HCl pH 7.5 and 0.5mM EDTA supplement). One tube of beads was washed three times in RIPA supplemented with PI and DTT 1 mM, then the cell lysate was added and pre-clarified by upward rotation for 30 min at 4°C. The second tube was divided equally into individual tubes for each RNA probe. 2-10 pmol of biotinylated transcript was then added to each tube and rotated upwards for 30 minutes at 4°C. The beads were then washed three times with binding/wash buffer, after which equal volumes of pre-clarified cell lysate were added to each sample of beads and RNA probes. The sample was then rotated upwards for 30 minutes at 4°C. After spinning, the beads were washed three times with high salt CEB (10mM HEPES pH 7.5, 3mM _MgCl2 , 250mM NaCl, 1mM DTT and 10% glycerol). Proteins were then eluted from the beads in 5% SDS in 50 mM Tris pH 7.4 for 10 minutes at room temperature.

Antisense Oligonucleotides and LNA GapmeR Transfection ASO (Integrated DNA Technologies) was designed to target the conserved ATGG site identified by LncLOOM in the final exon of mouse Chaser (Figure 8A). All ASOs were modified with 2'-O-methoxy-ethyl base. LNA gapmers (Qiagen) targeting the Chaserr intron were used for Chaserr knockdown (see Table 3 for complete oligo sequences). Transfection: 2 x ¹⁰ Neuro2A cells were seeded in a 6-well plate with a mixture of LNA1-4, or with ASO1, ASO2, ASO3, or with a mixture of ASO1 and ASO3, or ASO1-3. was transfected using Lipofectamine 3000 (Life Technologies, L3000-008) according to the manufacturer's protocol to a final concentration of 25 nM. The end point for all experiments was 48 hours after transfection, after which cells were harvested using TRIZOL for RNA extraction and evaluation by RT-qPCR analysis.

RNA immunoprecipitation (RIP)
Neuro2a cells (ATCC) were collected, centrifuged at 94 × g for 5 min at 4 °C, and treated with ribonuclease inhibitor (100 U/mL, #E4210-01) and protease inhibitor cocktail (Sigma-Aldrich, #P8340). The cells were washed twice with ice-cold phosphate-buffered saline (PBS) supplemented with Next, add 1 mL of lysis buffer (protease inhibitor cocktail + 5 mM PIPES, 200 mM KCl, 1 mM CaCl ₂ , 1.5 mM MgCl _{2 , 5 mM PIPES supplemented with 100 U/ml RNase inhibitor and 1 mM DTT for 10 min on ice)} . % sucrose, 0.5% NP-40). Lysates were sonicated three times at 30% amplitude with 1 s ON and 30 s OFF (Vibra-cell VCX-130), followed by centrifugation at 21,130 xg for 10 min at 4°C. The supernatant was then transferred to a new 2 mL tube and 1 mL of IP binding/wash buffer (protease inhibitor cocktail + 150 mM KCl, 25 mM Tris (pH 7.5) supplemented with 100 U/ml RNase inhibitor and 0.25 mM DTT; 5mM EDTA, 0.5% NP-40). Samples were then rotated for 2-4 hours at 4° C. using 5 μg of antibody per reaction. 50 μl of beads per reaction GenScript A/G beads (#L00277) were washed three times with IP binding/wash buffer and then added to the lysate and incubated overnight with rotation. After incubation, beads were washed three times with IP binding/wash buffer. 10% of each sample was collected and boiled for 5 minutes at 95°C for subsequent analysis by Western blot. For RNA extraction and evaluation by RT-qPCR analysis, the remaining beads were resuspended in 0.5 mL of TRIZOL and the immunoprecipitated material was normalized to the total cell lysate.

Western Blot Protein samples collected from RIP were separated on 8-10% SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes. After blocking with 5% nonfat milk in PBS containing 0.1% Tween-20 (PBST), membranes were incubated with primary antibodies followed by secondary antibodies conjugated with horseradish peroxidase. Blots were quantified using Image Lab software. Primary antibody anti-Dhx36 (Bethyl, #A300-525A, 1:1,000 dilution) and secondary antibody anti-rabbit (JIR #111-035, 1:10,000 dilution) were used.

qRT-PCR
Total RNA was extracted from transfected N2a cells using TRIREAGENT (MRC) according to the manufacturer's protocol. cDNA was synthesized using the qScript Flex cDNA synthesis kit (95049, Quanta) with random primers. Fast SYBR Green master mix (4385614) was used for qPCR. Gene expression levels were normalized to the housekeeping genes Actin and Gapdh.

Example 1
LncLOOM Framework LncLOOM receives a collection of putatively homologous sequences of a genomic sequence of interest. Although one embodiment focuses on lncRNAs and 3'UTRs, other elements such as enhancers can be easily used as well. For lncRNAs, only exon sequences are used for motif identification, but LncLOOM visualizes the location of exon-exon junctions. Input sequences are provided in a specific order that ideally matches the evolutionary distance between species and can be automatically set based on sequence similarity (Fig. 1A). The exact definition of the data structures and algorithms used in LncLOOM appears in "Materials and Methods" and an overview of the framework is shown in Figures 1A-B. LncLOOM represents each RNA sequence as a "layer" of nodes in the network graph (FIG. 1B), where each node represents a short k-mer (eg, k of 6-15). The order of the layers reflects the evolutionary distance of the input sequence from the query sequence, which is placed in the first layer of the graph (human in the analysis described herein), and sequences from other species are added to the graph. arranged in successive layers. Edges in the graph connect nodes with the same k-mer in successive layers. It is understood that it is also possible to link "similar" k-mers. Under these definitions, the goal is to identify combinations of long "paths" within the graph that do not intersect with each other, and thus connect short motifs that maintain the same order within the various sequences. Since the object of interest is typically a motif present in the top layer, it is a requirement that the path begins within it. For k = 1, the problem of identifying the maximal set of such paths is computationally difficult, as it is the same as the longest common subsequence problem, but current results suggest that the integer linear programming (ILP) Although it is computationally difficult to find an optimal solution for integer linear programming (ILP), efficient solvers are available (Fig. 1B and “Method”).

Once the graph is constructed, the process begins by identifying the paths with the largest k values, and then uses these paths (if found) to constrain the possible locations of even smaller k paths. This approach allows favoring longer conserved elements, but also allows identifying short k-mers that are significantly conserved. Once every k value is tested, the resulting graphs are merged to obtain combinations of motifs and the depths at which they are conserved. To calculate the statistical significance of motif conservation, an MSA of the input sequence is generated and alignment columns are shuffled to derive random sequences with similar internal similarity structure to the input sequence. The complete LncLOOM pipeline is then applied to these sequences, and for each motif found in the original input sequence stored in layer D, the exact same motif stored in layer D, or the same number of its length An empirical probability of identifying any combination of motifs is applied. Additional P values are calculated for less stringent controls in which random sequences with the same dinucleotide composition are generated and no intersequence similarity structures are conserved.

A rich HTML-based suite is used to visualize these motifs in various ways, e.g. color-coding them based on depth of conservation and highlighting motifs both in the query sequence and in other sequences ( See Figures 3A-E and Figure 4 for examples of LncLOOM output). The LncLOOM output also includes color-coded custom tracks of motifs identified within the query sequence that can be viewed in the UCSC Genome Browser. Motifs are annotated using a set of conserved microRNA seed sites (from TargetScan) and RBP binding sites found in eCLIP data from the ENCODE project.

Example 2
LncLOOM identifies deeply conserved elements within Cyrano lncRNAs Cyrano lncRNAs are widely and highly expressed lncRNAs ^12,13 . Despite being conserved across vertebrates, Cyrano exhibits approximately 5-fold variation across exon sequence lengths (from 2,340 nt in medaka to 10,155 nt in opossum, Fig. 2A). Cyrano's previously identified 67 nt highly constrained element is the only region where BLAST reports significant similarity when comparing zebrafish and human sequences. Furthermore, the entire Cyrano locus cannot be aligned between mammals and fish by 100-way whole genome alignment (UCSC Genome Browser). The highly conserved element contains the very extensively complementary miR-7 binding site required for miR-7 degradation by Cyrano.

To identify additional conserved elements, eight mammalian species, chicken, X. Cyrano sequences were curated from 18 species where usable RNA-seq data could be located, including X. tropicalis, seven vertebrate fish species, and elephant shark (not shown). LncLOOM identified 7 elements conserved across all species, 9 elements conserved across all species except sharks (Figure 2B), and 37 motifs conserved across mammals. The following study focuses on nine elements (numbered 1-9 in Figure 2B) that are conserved across all species except sharks.

AUGGCG (SEQ ID NO: 17)
UGUGCAAUA (SEQ ID NO: 18)
ACAAGU (SEQ ID NO: 19)
CAACAAAAU (SEQ ID NO: 20)
GUCUUCCAUU (SEQ ID NO: 21)
UGUAUAG (SEQ ID NO: 22)
UGCAUGA (SEQ ID NO: 23)
CUAUGCA (SEQ ID NO: 24)
GCAAUAAA (SEQ ID NO: 25)

Seven of these were found to be statistically significant (P<0.01) by both LncLOOM tests (described in Materials and Methods). Only elements 3-6 were present, two corresponding to pairing with miR-7 5' and 3' (Fig. 2C), and another UGUAUAG (sequence) similar to Pumilio Recognition Element (PRE, element #6). No. 22) within a 67 nt conserved region identifiable by BLAST. This element indeed binds PUM1 and PUM2 in CLIP data from humans and mice (Fig. 2D-E), and in neonatal mouse brains where Cyrano levels are relatively high, depletion of Pum1 and Pum2 inhibits RNA decay. Consistent with the function of these proteins, ¹⁵ leads to increased Cyrano expression (adjusted P value 3.49 × 10 ⁻³ , data from ¹⁴ , Figure 2E). This suppression is likely due to the combined effects of this highly conserved PRE and others. The 18 Cyrano sequences from different species had an average of 3.2 consensus PREs (compared to an average of 1.3 within 1,000 randomly shuffled sequences, including 2 within the mouse sequences). P < 0.001, see Methods).

Several additional conserved elements within the Cyrano sequence identified by LncLOOM can be assigned putative biological functions. A nonamer UGUGCAAUA (element #2 in Figure 2B, SEQ ID NO: 35), conserved in all 18 input species, was found approximately 60 nt upstream of the miR-7 binding site, outside the region that could be aligned by BLAST. It will be done. This element corresponds to a seed match for the miR-25/92 family (Fig. 2C) and was recently shown to be bound and regulated by members of the miR-25/92 family in the mouse fetal heart ^. At the 3' end of Cyrano, one conserved element (SEQ ID NO: 25, GCAAUAAA) corresponds to the Cyrano polyadenylation signal (PAS) and miR-137 site. Another sequence CUAUGCA (SEQ ID NO: 24), found approximately 100 nt upstream of PAS, corresponds to the seed match of miR-153, and this region is bound by Ago2 in mouse brain (FIG. 2E). Interestingly, Cyrano levels in HeLa cells are reduced by 41% and 11% after miR-137 and miR-153 transfection, respectively ¹⁷ . Thus, Cyrano is under highly conserved regulation by additional microRNAs beyond its reported interactions with miR-7 and miR-25/92.

Approximately 55 nt downstream of the conserved Pumilio binding site is the conserved WGCAUGA motif (W=A/U, SEQ ID NO: 27), which matches the consensus binding motif of Rbfox RBP. This motif, as well as an additional region containing examples of WGCAUGA in the 3' half of Cyrano, are bound by Rbfox1/2 in mice (Fig. 2E). Indeed, analysis of 18 Cyrano species showed a significant enrichment of WGCAUGA (9.8 vs. 4.5 expected by chance, P<0.001, see Methods). In contrast to miRNA-binding sites and Pumilio-binding sites, examination of various RNA-seq datasets of Rbfox1/2 loss of function did not identify any effects on Cyrano levels (not shown), suggesting that Rbfox1/2-induced widespread and It was suggested that conserved binding, but not expression, may influence Cyrano functionality.

Another highly conserved hexamer AUGGCG (SEQ ID NO: 17) is found just 5' of Cyrano. Examination of Cyrano sequences and Ribo-seq data from human, mouse, and zebrafish revealed that this hexamer corresponds to the first two codons of a conserved short 2-3 aa ORF (Figure 2F). Clear ribosome association is seen at the 5' end of Cyrano in this ORF, and a very limited number of ribosome-protected fragments are observed downstream of this element in both human and zebrafish (Fig. 2F), indicating that this short This suggests efficient translation and ribosome release at the ORF. The context of the AUG start codon within the ORF perfectly matches the 12 bases of the TISU motif, a regulatory element that affects both transcription and translation. TISU is a highly efficient and accurate cap-dependent translation initiator for translation that is located at the 5' end of the transcript and acts as a YY1 binding site that can determine the transcription start site and without scanning. acting as an element ^18,19 . The genomic region of this motif shows strong YY1 binding to DNA (Fig. 2F). It has been suggested that this motif may have a dual function as a YY1 element regulating Cyrano expression and as the beginning of a short ORF that may contribute to Cyrano function, as suggested for other lncRNAs ^. . Overall, the putative biological functions are as follows: 8 out of 9 conserved elements in Cyrano, 4 as miRNA binding sites, 2 as RBP binding sites, and 2 as conserved short ORFs. and one as PAS. These elements are separated by long stretches of non-conserved sequence (Fig. 2B), highlighting the ability to combine LncLOOM with annotation and orthogonal data to reveal lncRNA biology.

Example 3
LncLOOM identifies deeply conserved elements within libra lncRNAs As another example of LncLOOM's ability to find conserved elements in transcripts known to be relevant to miRNA biology, we It was applied to eight homologs of libra lncRNA in zebrafish and Nrep protein in mammals. This is one of the few ^examples of a gene that changed from a possible ancestral lncRNA to a protein-coding gene while retaining substantial sequence homology within its 3′ region. libra triggers miR-29b degradation in zebrafish and mice through a highly conserved and highly complementary site ²¹ . Comparing zebrafish libra with human and mouse sequences using BLASTN, an alignment of approximately 250 nt was recovered from the approximately 2.2 kb human sequence, with an even shorter significant alignment in spotted gar (E value < 0.001). LncLOOM found 17 elements conserved across all species and >25 elements conserved across all species except zebrafish (Figure 6). These include the miR-29 site and conserved binding sites for eight additional miRNAs, three found outside the alignment region between mammalian and fish species by BLAST. (Figure 6). Therefore, Cyrano and libra, two lncRNAs that have been shown to effectively induce target-directed miRNA degradation (TDMD), are linked to several additional highly conserved miRNA binding mechanisms. sites, but in contrast to TDMD-mediated sites, these appear to be “regular” seed sites that may influence lncRNA levels rather than miRNAs.

Example 4
LncLOOM identifies conserved motifs within the CHASERR lncRNA To test the ability of LncLOOM to identify conserved modules within sequences that are not amenable to BLAST comparisons, we We focused on CHASERR, an lncRNA that has recently been characterized as essential27 ^. CHASERR homologs are easily identifiable in various species based on their proximity (<2 kb) to the transcription start site of CHD2 and their characteristic 5-exon gene structure ²⁷ . We found that due to some gaps in the genome assembly around the extremely G/C-rich promoter and first exon of CHASERR, the length ranged from 579 to 1313 nt, four of which 'We manually curated CHASERR sequences from 16 vertebrate species that are likely to be ^incomplete27 (Fig. 7). BLASTN found significant (E value <0.01) alignments between human CHASERR and nine sequences from amniotes, but none of the other six vertebrate species. Conversely, when using zebrafish sequences as queries, BLAST found homology only in other fish species and opossums. When the ^CHASERR sequence is fed into the ClustalO MSA, only three identical positions are found. Therefore, the limited conservation of CHASERR is a challenge for analysis using commonly used tools for comparative genomics.

LncLOOM has two k-mers that are conserved in all layers, namely: AAUAAA (SEQ ID NO: 3) at the 3' end corresponding to PAS, and AAGAUG found once or twice in the final exon of all CHASERR sequences. (SEQ ID NO: 2) (motif 1 in Figure 3A) was identified. The AAUAAA (SEQ ID NO: 1 motif) was found near the 3' end of CHASERR and most likely corresponds to a polyadenylation signal (PAS) and was not tested further. Examination of the CHASERR sequence revealed that the AAGAUG motif ( SEQ ID NO: 5) was found to be substantially over-represented. CHASERR homologs had an average of 2.1 instances of the motif, compared to only 0.45 predicted by chance (P Motif context was also typically similar across these 34 cases, with motifs typically followed by purines (Figure 3B). 2) (SEQ ID NO: 2) was conserved in 11 sequences. Including flanking sequences, motif 2 shares an ARAUGR core with motif 1 (Figure 3B). These sequences are unique to any RBP. Inspection of the eCLIP data did not reveal any obvious candidates for binders, suggesting that there was no agreement with known binding preferences either. Therefore, the functionality of these sequences was further explored experimentally.

To test the functional significance of conserved elements, we designed antisense oligonucleotides (ASOs) complementary to three examples of conserved motifs in mouse Chaserr (Fig. 8A) and mouse Neuro2a (N2a). cells were transfected. It was previously shown that Chaserr depletion results in increased levels of Chd2 RNA and protein27 ^. The human sequences corresponding to these ASOs are CCATAGTAGACTGCCATCTT (SEQ ID NO: 7), which targets AAGATGGCAGTCTACTATGG (SEQ ID NO: 12), and ATCCACTGTCCATTTGTG (SEQ ID NO: 9), which targets CACAAATGGACAGTGGAT (SEQ ID NO: 10).

Transfection of ASO1 and ASO3 individually or in combination resulted in a significant increase in Chd2 levels comparable to that caused by Chaserr knockdown (Fig. 3C). Interestingly, ASO treatment resulted in increased Chaserr levels as assessed by RT-PCR primer pairs found either upstream or downstream of the ASO targeting region (Fig. 3C).

To identify proteins that potentially bind to the conserved region, we used in vitro transcription to synthesize the WT sequence of the final exon of Chaserr and the AUGG→UACC mutation in four conserved motifs. A biotinylated RNA was generated containing the same sequence with the same sequence and a second mutant in which all seven of the AUGG sites in the final exon were mutated to UACC (FIG. 8A). These sequences were incubated with lysates from N2a cells along with their antisense controls, and proteins associated with the various RNA variants were isolated and identified using mass spectrometry. As is typical in these experiments, a large number of proteins, 938, were identified as associated with the WT sequence (not shown), and 74 of these were more than 3-fold enriched with the antisense sequence. however, only nine of these had more than twice the recovery of both mutants when using the WT sequence (Fig. 3D). We then investigated publicly available RNA-seq datasets and looked for evidence of changes in Chd2 and/or Chaserr levels when these proteins are perturbed. Such evidence was available for DHX36 and ZFR (Fig. 8B-C). RNA immunoprecipitation (RIP) and specific antibodies were used to verify the significant association of Chaserr with DHX36, the protein that showed the highest enrichment compared to the mutant sequence (Fig. 3D). Interestingly, DHX36 is known to bind G-quadruplex sequences29,30, and ^although the conserved elements do contain GG pairs, they are quite far from each other and are typical of G-quadruplex sequences. The quadruplex contains at least 3G runs. Although the QGRS mapper ³¹ predicts one G-quadruplex within the final exon of Chaserr (Fig. 8A), other tools, including the G4 RNA scanner ³² that incorporate different scoring systems, predict a high G-quadruplex within the final exon of Chaserr. No scoring G-quadruplexes were found. It is also possible that non-canonical G-quadruplex formations are formed within this sequence or have a different mode of recognition by DHX36.

Therefore, LncLOOM can identify functionally relevant elements within lncRNAs that can serve as a basis for the design of targeting reagents to disrupt lncRNA function, and can identify specific and functionally relevant lncRNA interactions. Enables the use of proteomic methods to identify partners.

Example 5
Deeply conserved elements within the 3'UTR of DICER1 and Pumilio mRNAs. We next sought to evaluate the applicability of LncLOOM for comparing sequences over longer evolutionary distances beyond lncRNAs. Ta. The 3'UTR can determine the RNA stability and translation efficiency of an mRNA and ^typically evolves much more rapidly than other mRNA regions. Orthology between 3'UTRs is fairly easy to define based on their adjacent coding sequences, which are often easily comparable over very long evolutionary distances. However, there are few known cases of long-range conservation of functional elements within the 3'UTR between vertebrates and invertebrates. To test 3'UTR conservation using LncLOOM, we first focused on genes that act during post-transcriptional regulation, particularly as they typically undergo complex post-transcriptional regulation. Using available RNA-seq and expressed sequence tag (EST) data, we identified eight vertebrates, amphioxus, lamprey, sea urchin, C. We compiled a collection of DICER1 3'UTR sequences encoding key components of the miRNA pathway from 12 species, including C. intestinalis and two DICERs in Drosophila. BLASTN was able to align human DICER1 to, but not beyond, the 3'UTR from vertebrate species. LncLOOM identified 15 elements conserved within all vertebrate sequences, 6 of which were of lengths not found within random sequences (P<0.01, Figure 9) . Eight of the conserved motifs are conserved across vertebrates (and could not be assessed by MSA or BLAST), and one, corresponding to the conserved binding site for miR-219, is found in fly Dicer2. Found in all species containing the 3'UTR.

Next, the present inventors focused on the 3'UTR of PUM1 mRNA and PUM2 mRNA, which encode Pumilio proteins that post-transcriptionally suppress gene expression. Pumilio proteins are deeply conserved, with two Pumilio proteins, PUM1 and PUM2, existing in vertebrates and a single ortholog in other chordates and flies. We curated 3'UTR sequences from 12 vertebrates and 4 invertebrates (lamprey, amphioxus, C. intestinalis and Drosophila). The human and zebrafish 3'UTRs can be easily aligned by BLASTN, and there is even significant homology between the 3'UTR of human PUM1 and that of the lamprey and amphioxus Pumilio mRNA, whereas the fly and C. There is no significant homology to that of Intestinalis. LncLOOM identified eight elements conserved across the vertebrate PUM1 3'UTR, one of which, UGUACAUU (SEQ ID NO: 14), was found in all 16 3'UTRs analyzed in the fly pum 3' It was preserved up to the UTR (Figure 4, top). In PUM2, there were three elements conserved across vertebrates, including UGUACAUU, which was found in the entire sequence (Fig. 4, bottom). Interestingly, this UGUACAUU motif partially matches the PRE consensus UGUANAUA (SEQ ID NO: 28), which is bound by both PUM1 and PUM2 in human ENCODE data, and this ancient element is known to be present in Pumilio mRNA. ^This suggests that it is part of a self-regulatory program that is associated with Thus, LncLOOM can identify deeply conserved elements within 3'UTR sequences, including those separated by more than 500 million years, when available tools do not detect significant sequence conservation.

Example 6
Systematic analysis of conserved motifs within the 3'UTR reveals deeply conserved elements To broadly assess the predictive power of LncLOOM, we performed a comprehensive analysis of the 3'UTR sequences. We were able to build a high-confidence input dataset spanning hundreds of millions of years of evolution, from which we were able to systematically test thousands of elements using LncLOOM. , focused on a well-defined 3'UTR based on highly conserved coding sequences flanking the 3'UTR. The dataset was based on 2,439 genes with 3'UTR MSAs generated as part of the TargetScan7.2 miRNA target site prediction suite10 ^. For each gene, in each of the four species (human, mouse, dog and chicken), for LncLOOM analysis containing aligned sequences from TargetScan MSA only if they were between 300 and 3,000 nt long. , generated a dataset of 3'UTR sequences. For genes with several 3'UTR isoforms, we selected the longest 3'UTR. We then added sequences of 3'UTRs annotated with Ensembl in additional species to the data set if they were longer than 200 bases, if available. These included sequences from five non-amniote vertebrate species (frogs, sharks, zebrafish, gars and lampreys) and two invertebrates (snails and flies). The main objective was to evaluate the ability of LncLOOM to identify deeply conserved elements, so only genes with suitable sequences from at least one non-amniote were used. The number of sequences that can be analyzed at various depths is shown in Figure 10A. Of the 2,439 3'UTR datasets, 2,117 contained at least one sequence for which BLASTN did not report any significant alignment to the human sequence (E value <0.05); 031 datasets contained at least one sequence that did not have a significant alignment to any of the four species (Fig. 5A). It was therefore possible to analyze a large number of sequences for which MSA-based approaches could not potentially explore the full depth of conservation.

LncLOOM was used to search for conserved motifs with a minimum length of 6 bases and P<0.05 in all LncLOOM tests. LncLOOM detected over 150,000 significant motifs in human sequences, of which 27,826 (18.3%) corresponded to seed sites of widely conserved miRNA families (as defined by TargetScan). ). 11,725 k-mers are conserved across amniotes, 3,897 of which were detected in at least one unalignable sequence (Figures 5A-I and Figure 10). LncLOOM identified at least one unique k-mer in the first unalignable layer of 1,640 of the 2,117 genes containing sequences that did not align to their respective human orthologs. detected and at least three unique k-mer combinations were found in 1,088 genes (Fig. 5B). Considering only sequences that did not align to any of the four amniote species, at least one unique k-mer was detected within the first unalignable sequence in the 1,529 datasets. (Figures 10A-F). In 114 genes, conservation was found across vertebrates, and in 97, conservation was found from humans to Drosophila. A total of 170 unique k-mers (265 cases) were found in the fly genes, of which only two matched widely conserved miRNA binding sites (Fig. 5C).

We next investigated certain conserved k-mers shared between the 3'UTRs of multiple genes. Among the k-mers detected within unalignable sequences, 42 are common to at least 50 genes, and only 2 of the at least 50 genes correspond to widely conserved miRNA binding sites. and 30 were conserved within the invertebrate sequences (Fig. 5D). Of these 30, 18 k-mers contained UUU sequences in an A/U-rich context similar to AU-rich elements (AREs), and 5 k-mers contained AUAAs similar to PAS. body. Other k-mers contained a PRE-like UGUA core. Therefore, these three groups of miRNA-unrelated elements are also often highly conserved within the 3'UTR, and their conserved occurrences can be detected by LncLOOM.

To assess the sensitivity of LncLOOM, we compared the widely conserved miRNA binding sites identified by LncLOOM with TargetScan predictions for each of the 2,439 genes, and for 2,121 of them, TargetScan The binding site within the human sequence was predicted. lncLOOM predicted binding sites in 2,330 genes, including 217 for which the TargetScan alignment did not identify widely conserved sites (Fig. 5E). An overview of all miRNA sites predicted by lncLOOM can be found at github(dot)com/LncLOOM/LncLOOM. In a significant number of cases (29% of 2,117 genes), LncLOOM found miRNA binding sites that were significantly conserved in species whose 3'UTRs could not be aligned to the human sequence in MSA (Fig. 5F ). To more accurately compare lncLOOM and TargetScan predictions, we focused on the 2,359 genes for which TargetScan predicted binding sites in the same human transcripts used for lncLOOM analysis. (Fig. 5E), of which lncLOOM recovered 90.24% of all widely conserved sites predicted by TargetScan within the human sequence (Fig. 5G). Among the 217 genes, 42 had conserved sites across mammals, and some genes showed conservation in fish and Drosophila species (FIGS. 10A-F). In addition to the recovered miRNA sites, lncLOOM identified an additional 21,615 widely conserved sites that were not previously predicted. Comparing the depth of conservation, lncLOOM often detected sites recovered by TargetScan in more distal species (Fig. 5G and Fig. 10A-F). Importantly, 831 recovered predictions and 331 new predictions were detected within unalignable sequences for 24% and 13% of genes, respectively.

Thus, LncLOOM is also a powerful tool for the analysis of 3'UTR sequences, while revealing greater depth of conservation of miRNAs or other functional binding sites than is possible by MSA-based approaches. , has only limited compromises in sensitivity.

Example 7
Targeting of CHASERR causes upregulation of CHD2 in neuroblasts. Sequences are provided below.

(ASO targeting CHASERR:)
A35: The same ASO used for the mouse. This ASO is complementary to mouse sequences.
A40: ASO that targets the same region as ASO1 in mouse but is fully complementary to the human sequence.
A49: ASO similar to A35 and A40, but with the potential to base pair with both human and mouse sequences using GU pairing.
A50: Same as A40, but with 2'MO modification instead of 2'MOE, and only 2 bases are truncated at the 3' end.A51: Same as A40, but with 2'MOE modification instead of 2'MOE. 'MO modification, truncated by 2 bases at 5' end A52: Same as A40, but includes LNA modification

Results The effects on CHD2 mRNA and protein levels were compared with non-targeted ASOs A27 and A28. Since A28 causes p21 upregulation and stress response in SH-SY5Y cells (FIG. 16), a comparison was made with A27.

Cells were plated at a density of 2.5×10 ⁵ /35 mm plate. Cells were transfected with 25 nM ASO using DharmaFECT4 transfection reagent (T-2004-03, horizon). RNA was extracted 48 hours after transfection.

ASOs A40, A50, A51 and A52 were the most potent in upregulating CHD2 compared to untransfected cells or cells transfected with control ASOs (Figure 16).

Example 8
Targeting of CHASERR causes upregulation of CHD2 in MCF7 cells and SH-SY5Y Antisense oligonucleotides and LNA GapmeR transfection DMEM containing 10% fetal calf serum and 100 U penicillin/0.1 mg ml ^-1 streptomycin The MCF7 cell line (obtained from ATCC) was cultured therein. SH-S in DMEM/Nutrient Mixture F-12 Ham (Sigma: D6421) containing 10% fetal bovine serum, 100 U penicillin/0.1 mg ml ^-1 streptomycin, and 2 mM GlutaMAX (Thermofisher: 35050061). Y5Y cell strain (obtained from ATCC) was cultured. All cells were cultured at 37°C in a humidified incubator with 5% _CO2 and routinely tested for mycoplasma contamination. The first set of ASOs: ASO1 (A40, SEQ ID NO: 128) and ASO3 (A41, SEQ ID NO: 134) were modified with a 2'-O-methoxyethyl base. An LNA gapmer targeting the second intron of human Chaserr was used for Chaserr knockdown. Transfection: 2 × ¹⁰ MCF7 or SH-SY5Y were seeded in a 6-well plate and transfected with ASO1 (ASO40) to a final concentration of 50 nM using Dharmafect4 (Dharmacon) transfection reagent according to the manufacturer's protocol. ) and ASO3 (ASO41), or with Chaser gapmeR (Table 5). The end point for all experiments was 48 hours after transfection, after which cells were harvested using TRIZOL for RNA extraction and evaluation by RT-qPCR analysis. The effects on the expression of Chaser and CHD2 are shown in FIG. 17.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, it is intended to cover all such alternatives, modifications, and variations as fall within the spirit and broad scope of the appended claims.

All publications, patents, and patent applications mentioned herein are specifically and individually named as if each individual publication, patent, or patent application was incorporated by reference herein. It is the applicant's intention to incorporate herein by reference in its entirety as if mentioned. Furthermore, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not necessarily be construed as limiting. Additionally, any priority documents of this application are incorporated herein by reference in their entirety.

References (Other references are included in the text)
1. Ulitsky, I. & Bartel, DP lincRNAs: genomics, evolution, and mechanisms. Cell 154, 26-46 (2013).
2. Iyer, MK et al. The landscape of long noncoding RNAs in the human transcriptome. Nat. Genet. 47, 199-208 (2015).
3. Ulitsky, I. Evolution to the rescue: using comparative genomics to understand long non-coding RNAs. Nat. Rev. Genet. (2016) doi:10.1038/nrg.2016.85.
4. Hezroni, H. et al. Principles of Long Noncoding RNA Evolution Derived from Direct Comparison of Transcriptomes in 17 Species. Cell Rep. (2015) doi:10.1016/j.celrep.2015.04.023.
5. Wang, AX, Ruzzo, WL & Tompa, M. How accurately is ncRNA aligned within whole-genome multiple alignments? BMC Bioinformatics 8, 417 (2007).
6. Bartel, DP Metazoan MicroRNAs. Cell 173, 20-51 (2018).
7. Dominguez, D. et al. Sequence, Structure, and Context Preferences of Human RNA Binding Proteins. Mol. Cell 70, 854-867.e9 (2018).
8. Maier, D. The Complexity of Some Problems on Subsequences and Supersequences. (1978).
9. Atamturk, A. & Savelsbergh, MWP Integer-Programming Software Systems. Ann. Oper. Res. 140, 67-124 (2005).
10. Agarwal, V., Bell, GW, Nam, J.-W. & Bartel, DP Predicting effective microRNA target sites in mammalian mRNAs. Elife 4, e05005 (2015).
11. Van Nostrand, EL et al. A Large-Scale Binding and Functional Map of Human RNA Binding Proteins. bioRxiv 179648 (2017) doi:10.1101/179648.
12. Ulitsky, I., Shkumatava, A., Jan, CH, Sive, H. & Bartel, DP Conserved function of lincRNA embryos in vertebratenic development despite rapid sequence evolution. Cell 147, 1537-1550 (2011).
13. Kleaveland, B., Shi, CY, Stefano, J. & Bartel, DP A Network of Noncoding Regulatory RNAs Acts in the Mammalian Brain. bioRxiv (2018).
14. Zhang, M. et al. Post-transcriptional regulation of mouse neurogenesis by Pumilio proteins. Genes Dev. 31, 1354-1369 (2017).
15. Goldstrohm, AC, Hall, TMT & McKenney, KM Post-transcriptional Regulatory Functions of Mammalian Pumilio Proteins. Trends Genet. 34, 972-990 (2018).
16. Li, X., Pritykin, Y., Concepcion, CP, Lu, Y. & La Rocca, G. High-resolution in vivo identification of miRNA targets by Halo-Enhanced Ago2 Pulldown. bioRxiv (2019).
17. McGeary, SE, Lin, KS, Shi, CY, Bisaria, N. & Bartel, DP The biochemical basis of microRNA targeting efficacy. doi:10.1101/414763.
18. Elfakess, R. & Dikstein, R. A translation initiation element specific to mRNAs with very short 5'UTR that also regulates transcription. PLoS One 3, e3094 (2008).
19. Elfakess, R. et al. Unique translation initiation of mRNAs-containing TISU element. Nucleic Acids Res. 39, 7598-7609 (2011).
20. Housman, G. & Ulitsky, I. Methods for distinguishing between protein-coding and long noncoding RNAs and the elusive biological purpose of translation of long noncoding RNAs. Biochim. Biophys. Acta (2015) doi:10.1016/j.bbagrm. 2015.07.017.
21. Bitetti, A. et al. MicroRNA degradation by a conserved target RNA regulates animal behavior. Nat. Struct. Mol. Biol. 25, 244-251 (2018).
22. Munschauer, M. et al. The NORAD lncRNA assembles a topoisomerase complex critical for genome stability. Nature 561, 132-136 (2018).
23. Lovci, MT et al. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges. Nat. Struct. Mol. Biol. 20, 1434-1442 (2013).

24. Jangi, M., Boutz, PL, Paul, P. & Sharp, PA Rbfox2 controls autoregulation in RNA-binding protein networks. Genes Dev. 28, 637-651 (2014).
25. Chi, SW, Zang, JB, Mele, A. & Darnell, RB Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 460, 479-486 (2009).
26. Michel, AM et al. GWIPS-viz: development of a ribo-seq genome browser. Nucleic Acids Res. 42, D859-64 (2014).
27. Rom, A. et al. Regulation of CHD2 expression by the Chaserr long noncoding RNA gene is essential for viability. Nat. Commun. 10, 5092 (2019).
28. Sievers, F. et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7, (2011).
29. Chen, MC et al. Structural basis of G-quadruplex unfolding by the DEAH/RHA helicase DHX36. Nature 558, 465-469 (2018).
30. Sauer, M. et al. DHX36 prevents the accumulation of translationally inactive mRNAs with G4-structures in untranslated regions. Nat. Commun. 10, 2421 (2019).
31. Kikin, O., D'Antonio, L. & Bagga, PS QGRS Mapper: a web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res. 34, W676-82 (2006).
32. Garant, J.-M., Perreault, J.-P. & Scott, MS G4RNA screener web server: User focused interface for RNA G-quadruplex prediction. Biochimie vol. 151 115-118 (2018).
33. Haque, N., Ouda, R., Chen, C., Ozato, K. & Hogg, JR ZFR coordinates crosstalk between RNA decay and transcription in innate immunity. Nat. Commun. 9, 1145 (2018).
34. Shabalina, SA, Ogurtsov, AY, Rogozin, IB, Koonin, EV & Lipman, DJ Comparative analysis of orthologous eukaryotic mRNAs: potential hidden functional signals. Nucleic Acids Res. 32, 1774-1782 (2004).
35. Kirk, JM et al. Functional classification of long non-coding RNAs by k-mer content. Nat. Genet. 50, 1474-1482 (2018).
36. Quinn, JJ et al. Rapid evolutionary turnover underlies conserved lncRNA-genome interactions. Genes Dev. 30, 191-207 (2016).
37. Tycowski, KT, Shu, MD, Borah, S., Shi, M. & Steitz, JA Conservation of a triple-helix-forming RNA stability element in noncoding and genomic RNAs of diverse viruses. Cell Rep. 2, 26- 32 (2012).
38. Deveson, IW et al. Universal Alternative Splicing of Noncoding Exons. Cell Syst 6, 245-255.e5 (2018).
39. Katoh, K., Misawa, K., Kuma, K.-I. & Miyata, T. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30, 3059-3066 ( 2002).
40. Altschul, SF, Gish, W., Miller, W., Myers, EW & Lipman, DJ Basic local alignment search tool. J. Mol. Biol. 215, 403-410 (1990).
41. Karp, RM Reducibility among Combinatorial Problems. in Complexity of Computer Computations: Proceedings of a symposium on the Complexity of Computer Computations, held March 20-22, 1972, at the IBM Thomas J. Watson Research Center, Yorktown Heights, New York. , and sponsored by the Office of Naval Research, Mathematics Program, IBM World Trade Corporation, and the IBM Research Mathematical Sciences Department (eds. Miller, RE, Thatcher, JW & Bohlinger, JD) 85-103 (Springer US, 1972).
42. Hagberg, A., Swart, P. & S Chult, D. Exploring network structure, dynamics, and function using NetworkX. www(dot)osti(dot)gov/biblio/960616 (2008).
43. Mitchell, S., OSullivan, M. & Dunning, I. PuLP: a linear programming toolkit for python. The University of Auckland, Auckland, New Zealand (2011).
44. Kent, WJ BLAT-The BLAST-Like Alignment Tool. Genome Res. 12, 656-664 (2002).
45. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013).
46. Li, B. & Dewey, CN RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323 (2011).

47. Elinger, D., Gabashvili, A. & Levin, Y. Suspension Trapping (S-Trap) Is Compatible with Typical Protein Extraction Buffers and Detergents for Bottom-Up Proteomics. J. Proteome Res. 18, 1441-1445 (2019 ).
48. Cox, J. & Mann, M. MaxQuant enables high peptide identification rates, individualized ppb-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 26, 1367-1372 (2008).

Claims (33)

A method for increasing the amount of chromodomain helicase DNA binding protein 2 (CHD2) in a neuronal cell, the method comprising introducing into the cell a nucleic acid agent that downregulates the activity or expression of human Chaserr, the method comprising: to the final exon of human Chaserr, thereby increasing the amount of CHD2 in said neuronal cells. A method of treating a disease or condition associated with chromodomain helicase DNA binding protein 2 (CHD2) haploinsufficiency in a subject in need thereof, the method comprising: reducing the activity or expression of human Chaser in a therapeutically effective amount. A method of treating a disease or condition associated with said CHD2 haploinsufficiency, comprising administering to said subject a nucleic acid agent that regulates said nucleic acid agent directed to the final exon of human Chaserr. A nucleic acid that downregulates the activity or expression of human Chaserr for use in the treatment of a disease or condition associated with chromodomain helicase DNA binding protein 2 (CHD2) haploinsufficiency in a subject in need of such treatment. A nucleic acid agent directed to the final exon of human Chaserr. A nucleic acid agent for the activity or expression of human Chaser, which is a nucleic acid agent comprising a nucleic acid sequence that hybridizes to the final exon of human Chaser. The human Chaserr comprises an alternatively spliced variant selected from the group consisting of SEQ ID NO: 11 (NR_037600), SEQ ID NO: 12 (NR_037601), and SEQ ID NO: 13 (NR_037602). The method or nucleic acid agent according to any one of claims 1 to 4. The method or nucleic acid agent according to any one of claims 1 to 5, wherein the nucleic acid agent comprises a sequence complementary to SEQ ID NO: 2 (AUGG). The method or nucleic acid agent according to any one of claims 1 to 5, wherein the nucleic acid agent comprises a sequence complementary to AAGAUG (SEQ ID NO: 5) or AAAUGGA (SEQ ID NO: 6). The method or nucleic acid agent according to any one of claims 1 to 5, wherein the nucleic acid agent comprises a sequence complementary to UUUUUACCU (SEQ ID NO: 122). 9. The method or nucleic acid agent of any one of claims 1 to 8, wherein the nucleic acid agent inhibits binding of DHX36 to Chaserr. 9. The method or nucleic acid agent according to any one of claims 1 to 8, wherein the nucleic acid agent inhibits binding of CHD2 to Chaserr. The method or nucleic acid agent according to any one of claims 1 to 9, wherein the nucleic acid agent is an antisense oligonucleotide. Any one of claims 1 to 11, wherein the nucleic acid agent is one or more nucleotides containing a 2' to 4' bridge, or one or more nucleotides having a 2'-O modification. The method or nucleic acid agent described in section. 10. The method or nucleic acid agent of claim 9, wherein the antisense oligonucleotide is as shown in SEQ ID NOs: 92-99. 13. The method or nucleic acid agent of claim 10 or claim 12, wherein the antisense oligonucleotide is as shown in SEQ ID NO: 128, 131, 132, 133, 140, 141, 142, or 143. 14. The method or nucleic acid agent according to any one of claims 11, 12, and 13, wherein the antisense oligonucleotide comprises two or more types of antisense oligonucleotides. 16. The method or nucleic acid agent according to claim 15, wherein the two or more antisense oligonucleotides include ASO40 of SEQ ID NO: 140 or SEQ ID NO: 128, and ASO41 of SEQ ID NO: 144 or SEQ ID NO: 134. The method or nucleic acid agent according to any one of claims 1 to 10, wherein the nucleic acid agent is an RNA silencing agent. The method or nucleic acid agent according to any one of claims 1 to 10, wherein the nucleic acid agent is a genome editing agent. 19. The method or nucleic acid agent of any one of claims 1 to 18, wherein the nucleic acid agent is active in an inducible manner. 11. The method or nucleic acid agent according to any one of claims 1 to 10, wherein the nucleic acid agent is active in a tissue or cell-specific manner. The disease or condition associated with chromodomain helicase DNA binding protein 2 (CHD2) haploinsufficiency is selected from the group consisting of intellectual disability, autism, epilepsy, and Lennox-Gastaut syndrome (LGS). 21. The method or nucleic acid agent according to any one of claims 20. A method for analyzing a set of sequences describing a plurality of homologous polynucleotides, the method comprising:
constructing a graph having a plurality of nodes arranged in layers and a plurality of edges connecting the nodes of successive layers, where the first layer represents a sequence describing the query polynucleotide; Each layer consists of the above-mentioned elements, such that the nodes represent k-mers in each array, each edge connects nodes representing the same or homologous k-mers, and k is between 6 and 12. represents a sequence of the set;
searching the graph for continuous non-intersecting paths along edges of the graph; and producing an output identifying k-mers corresponding to at least one path as nucleic acid sequences of functional interest; A method that includes doing. 23. The method of claim 22, comprising iteratively repeating the building and searching for a shorter length each time before generating the output. 24. The method of claim 23, wherein the method comprises, at each iteration cycle, applying as a constraint for the search a path obtained in a previous iteration cycle. Claims 22 to 22, wherein the searching includes applying a criterion based on path depth as a constraint for the search, such that searching is given priority to deeper routes than shallower routes. 25. A method according to any one of claims 24. 26. The method of any one of claims 22 to 25, wherein said searching comprises applying an Integer Linear Program (ILP) to said graph. 26. A method according to any one of claims 22 to 25, wherein the homologous polynucleotide is a DNA sequence. 26. A method according to any one of claims 22 to 25, wherein the homologous polynucleotide is an RNA sequence. aligning the sequences in the set according to a predetermined order to provide a multiple alignment having multiple alignment layers, wherein a first layer 29. The method of any one of claims 22 to 28, wherein the query polynucleotide is a query polynucleotide, and the plurality of alignment layers correspond to respective layers of the graph. 30. The method of claim 29, wherein the predetermined order is evolution-dictated, and optionally, the query is the most evolved of the homologous polynucleotides. The method according to any one of claims 22 to 30, wherein the homology between the homologous k-mers is 70% or more. 32. The method of any one of claims 22 to 31, wherein the homologous polynucleotide comprises a partial sequence. 33. The method of any one of claims 22 to 32, wherein the homologous polynucleotide is selected from the group consisting of 3'UTR, lncRNA and enhancer.