JP2024082973A - Method for detecting the risk of antibiotic-resistant bacteria colonization using bacterial flora - Google Patents

Abstract

[Problem] To detect the risk of colonization by drug-resistant bacteria using bacterial flora. [Solution] A method for detecting the risk of colonization by drug-resistant bacteria in a subject includes quantifying the nucleic acid of one or more bacteria that are correlated or inversely correlated with the colonization of drug-resistant bacteria from a fecal sample collected from the subject, and determining the risk of colonization by drug-resistant bacteria from the amount of nucleic acid obtained in the quantification step or an increase or decrease in the amount. [Selected Figure] Figure 9

Description

The present invention relates to a method for detecting the risk of colonization by drug-resistant bacteria, and more specifically, to a method for evaluating the risk of carrying drug-resistant bacteria by utilizing the characteristics of the intestinal flora that are prone to colonization by drug-resistant bacteria.

The progression of drug resistance among bacteria that cause infectious diseases has become a global issue. In particular, the rapid increase in drug resistance in bacteria that live in the intestinal environment, such as extended-spectrum beta-lactamase (ESBL)- and carbapenemase-producing bacteria, and the existence of various resistance mechanisms are problematic, but there are currently no effective countermeasures. One possible reason for this is that the intestinal environment is becoming more susceptible to harboring drug-resistant bacteria. More specifically, when "dysbiosis," a disruption of the intestinal flora brought about by the use of antibiotics, occurs, it may become even easier for drug-resistant bacteria to take root and for drug-resistant genes to spread across bacterial species.

It is known that the susceptibility of drug-resistant bacteria to colonization does not depend only on dysbiosis, but is also influenced by the bacterial groups that compose the bacterial flora. Previously, the inventors used a mouse drug-resistant bacteria intestinal colonization model to compare the bacterial flora obtained by 16S rRNA metagenomic analysis, and identified bacterial groups that are correlated or inversely correlated with the susceptibility of drug-resistant bacteria to colonization by linear discriminant analysis (LDA). As a result, it was revealed that bacterial groups that are resistant to the colonization of drug-resistant bacteria include Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae, while bacterial groups that are tolerant to the colonization of drug-resistant bacteria include Enterobacteriaceae (Non-Patent Document 1).

Japanese Journal of Chemotherapy Vol. 68 No. 3 Page 432 (May 2020)

Before drug-resistant bacteria become established, there exists a risk state in which they are more likely to become established. Drug-resistant bacteria actually invade the intestinal environment during a high-risk state, leading to the establishment of drug-resistant bacteria. In current medical care, although there are measures to deal with people who have become established with drug-resistant bacteria, there are no measures to identify and deal with people who are at risk, and there is a lack of methods for assessing the risk before the patient becomes colonized with resistant bacteria.

The objective of the present invention is to detect the risk of drug-resistant bacteria colonization by utilizing the characteristics of the bacterial flora.

The invention includes the embodiments described below.
Item 1.
A method for detecting a risk of colonization of a drug-resistant bacteria in an animal subject, comprising:
A method comprising: quantifying, from a fecal sample collected from a subject, nucleic acids of one or more bacteria that are in a correlation or inverse correlation with the colonization of drug-resistant bacteria; and determining a risk of colonization of drug-resistant bacteria from the amount of nucleic acid obtained in the quantification step or an increase or decrease in the amount of nucleic acid.
Item 2.
Item 2. The method according to Item 1, wherein the one or more bacteria in a correlation or inverse correlation with colonization of drug-resistant bacteria are bacteria of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae.
Item 3.
Item 2. The method according to Item 1, wherein the one or more bacteria inversely correlated with colonization ability of drug-resistant bacteria are bacteria of the family Enterobacteriaceae.
Item 4.
Item 2. The method according to Item 1, wherein the quantification of the bacterial nucleic acid is carried out by a nucleic acid amplification method using an oligonucleotide primer that specifically hybridizes to a nucleotide sequence of the bacterial cell.
Item 5.
Item 5. The method according to Item 4, wherein the oligonucleotide primers are a primer set consisting of an equimolar mixture of the polynucleotides 1), 2), and 3) below, and an equimolar mixture of the polynucleotides 4) and 5) below.
1) a polynucleotide comprising the sequence of SEQ ID NO:1;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 1, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 1 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 2) A polynucleotide comprising the sequence of SEQ ID NO: 2;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 2, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 2, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 3) A polynucleotide comprising the sequence of SEQ ID NO: 3;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 3, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 3 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 4) A polynucleotide comprising the sequence of SEQ ID NO: 4;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 4, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 4 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 5) A polynucleotide comprising the sequence of SEQ ID NO: 5;
Item 6. A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO:5, which amplifies nucleic acid of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO:5 in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acid of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae.
Item 5. The method according to Item 4, wherein the oligonucleotide primers are a primer set consisting of the following 1) and 2):
1) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:1, a polynucleotide comprising the sequence of SEQ ID NO:2, and a polynucleotide comprising the sequence of SEQ ID NO:3; 2) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:4 and a polynucleotide comprising the sequence of SEQ ID NO:5.
Item 7. The method according to Item 5 or 6, wherein the determining step comprises determining that a risk of colonization of drug-resistant bacteria in the subject is increased when the amount of nucleic acid in the subject's fecal sample during the drug administration period is lower than the amount of nucleic acid in the subject's fecal sample before the drug administration.
Item 8.
Item 7. The method according to item 5 or 6, wherein the determining step comprises determining that a risk of drug-resistant bacteria colonization in the subject has been reduced when the amount of nucleic acid in the subject's fecal sample after the end of drug administration is greater than the amount of nucleic acid in the subject's fecal sample during the drug administration period.
Item 9.
Item 7. The method according to Item 5 or 6, wherein the determining step comprises determining that the subject is at high risk of being colonized by drug-resistant bacteria when the amount of nucleic acid in the subject's fecal sample is lower than the average amount of nucleic acid in fecal samples from healthy individuals.
Item 10.
Item 5. The method according to Item 4, wherein the oligonucleotide primers are a primer set consisting of the following 1) and 2):
1) a polynucleotide comprising the sequence of SEQ ID NO:6;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 6, which amplifies a nucleic acid of the Enterobacteriaceae family; or A polynucleotide comprising the sequence of SEQ ID NO: 6, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family. 2) A polynucleotide comprising the sequence of SEQ ID NO: 7;
Item 11. A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 7, which amplifies a nucleic acid of the Enterobacteriaceae family; or a polynucleotide comprising the sequence of SEQ ID NO: 7, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family.
Item 5. The method according to Item 4, wherein the oligonucleotide primers are a primer set consisting of the following 1) and 2):
1) A polynucleotide comprising the sequence of SEQ ID NO:6; 2) A polynucleotide comprising the sequence of SEQ ID NO:7. 12.
Item 12. The method according to item 10 or 11, wherein the determining step includes determining that a risk of colonization of drug-resistant bacteria in the subject has increased when the amount of nucleic acid in the subject's fecal sample during the drug administration period is lower than the amount of nucleic acid in the subject's fecal sample before the drug administration.
Item 13.
Item 12. The method according to Item 10 or 11, wherein the determining step includes determining that there is a high possibility that drug-resistant bacteria have colonized in the subject when the amount of nucleic acid in the subject's fecal sample is greater than the average amount of nucleic acid in fecal samples from healthy individuals.
Item 14.
A primer set consisting of an equimolar mixture of the following polynucleotides 1), 2), and 3) and an equimolar mixture of the following polynucleotides 4) and 5).
1) a polynucleotide comprising the sequence of SEQ ID NO:1;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 1, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 1 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 2) A polynucleotide comprising the sequence of SEQ ID NO: 2;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 2, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 2, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 3) A polynucleotide comprising the sequence of SEQ ID NO: 3;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 3, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 3 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 4) A polynucleotide comprising the sequence of SEQ ID NO: 4;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 4, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 4 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 5) A polynucleotide comprising the sequence of SEQ ID NO: 5;
Item 14. A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO:5, which amplifies nucleic acid of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO:5 in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acid of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae.
A primer set consisting of the following 1) and 2).
1) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:1, a polynucleotide comprising the sequence of SEQ ID NO:2, and a polynucleotide comprising the sequence of SEQ ID NO:3. 2) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:4 and a polynucleotide comprising the sequence of SEQ ID NO:5. Item 16.
A primer set consisting of the following 1) and 2).
1) a polynucleotide comprising the sequence of SEQ ID NO:6;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 6, which amplifies a nucleic acid of the Enterobacteriaceae family; or A polynucleotide comprising the sequence of SEQ ID NO: 6, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family. 2) A polynucleotide comprising the sequence of SEQ ID NO: 7;
Item 17. A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 7, which amplifies a nucleic acid of the Enterobacteriaceae family; or a polynucleotide comprising the sequence of SEQ ID NO: 7, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family.
A primer set consisting of the following 1) and 2).
1) A polynucleotide comprising the sequence of SEQ ID NO:6; 2) A polynucleotide comprising the sequence of SEQ ID NO:7. 18.
Item 18. Use of the primer set according to any one of Items 14 to 17 for detecting a risk of colonization of a drug-resistant bacterium in an animal subject.
Item 19.
Item 18. A kit for detecting a risk of drug-resistant bacteria colonization in an animal subject, comprising the primer set according to any one of Items 14 to 17.

The present invention makes it possible to assess subjects at risk of carrying drug-resistant bacteria as well as to take measures after the bacteria are detected.

This could lead to measures being taken to tackle the intestinal environment, which is said to be a breeding ground for drug-resistant bacteria, before the bacteria become present, potentially reducing the overall problem of drug-resistant bacteria.

Design of forward and reverse primers used in PCR for LRB detection system. Design of forward and reverse primers used in PCR for ETB detection system. A graph showing the time course of the amount of drug-resistant bacteria and LRB bacteria in feces after inoculation of drug-resistant bacteria (ESBL-producing E. coli) into each of the antibiotic-free control group (control group), ampicillin-administered group (ABPC group), and metronidazole-administered group (MNZ group). A graph showing the time course of changes in the amount of drug-resistant bacteria and ETB bacteria after inoculation of drug-resistant bacteria (ESBL-producing E. coli) into each of the antibiotic-free control group (control group), ampicillin-administered group (ABPC group), and metronidazole-administered group (MNZ group). (A)-(E) Graphs showing changes in C _T values due to antibiotic administration in five patients in the LRB detection system. The names of bacteria in Figure 5 (A), (C), and (D) indicate that the growth of these drug-resistant bacteria was confirmed in each patient after antibiotic administration. (A)-(D) Graphs showing changes in C _T values during and after antibiotic administration in four patients using the LRB detection system. Assessment of the risk of antibiotic-resistant bacteria colonization using the LRB detection system. (A) C _T values for each group. (B) Pie chart showing the results when subjects in each group were divided at a C _T value of 22. (A)-(D) Graphs showing changes in C _T values during and after antibiotic administration in four patients using the ETB detection system. (A) Graph of _C values in the LRB detection system for healthy subjects, ESBL-producing bacteria carriers, and ESBL-non-carriers. (B) Graph of _C values in the ETB detection system for healthy subjects, ESBL-producing bacteria carriers, and ESBL-non-carriers.

In this specification, the singular forms "a," "the," and "the" include both the singular and the plural, unless otherwise expressly stated in the specification or clearly contradictory in the context.

In this specification, the terms "comprise" and "consist of" are concepts that also encompass "consist of only."

As used herein, "specific" means that a nucleotide sequence hybridizes to a given target sequence, does not hybridize substantially to non-target sequences, and does not amplify the non-target sequences when the target sequence is amplified.

In the study of Non-Patent Document 1, the inventors investigated bacterial groups in the human intestinal flora that are associated with the colonization of drug-resistant bacteria, but did not develop a method for using them to detect the risk of colonization by drug-resistant bacteria.

The inventors extracted bacterial groups that could be resistance indicators and bacterial groups that could be tolerance indicators from among the bacterial groups identified from the results of metagenomic analysis of the bacterial flora of a mouse drug-resistant bacteria intestinal colonization model, while referring to base sequence information. Furthermore, they constructed a quantitative PCR detection system (real-time PCR method) to detect each bacterial group. By combining these, they established a method for detecting or screening the risk of drug-resistant bacteria colonization. They named this novel method for detecting or screening the risk of drug-resistant bacteria colonization the MARS method (microbiota-based AMR [antimicrobial resistance] risk screening method).

The inventors further found through validation using human clinical samples that the disclosed method for detecting the risk of drug-resistant bacteria colonization can be applied to assessing the risk of drug-resistant bacteria colonization and the presence or absence of bacteria carriage in actual clinical settings.

According to a first aspect of the present invention, there is provided a method for detecting a risk of colonization of a drug-resistant bacteria in an animal subject, comprising the steps of:
The present invention provides a method for determining a risk of colonization by drug-resistant bacteria from a fecal sample collected from a subject, the method comprising: quantifying nucleic acids of one or more bacteria that are correlated or inversely correlated with colonization by drug-resistant bacteria from the amount of nucleic acid obtained in the quantification step or an increase or decrease in the amount of nucleic acid.

The animal subject may be a human or a non-human animal. Non-human animals include, but are not limited to, birds and non-human mammals. Examples of non-human animals include, but are not limited to, livestock such as cows, pigs, horses, sheep, and goats; poultry such as chickens, ducks, and ostriches; pet animals such as dogs, cats, and rabbits; and rodents such as mice, guinea pigs, and rats. The animals are preferably birds and mammals, and more preferably humans.

Examples of one or more bacteria that are inversely correlated with the colonization of drug-resistant bacteria include the families Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae, which are bacterial groups that are resistant to the colonization of drug-resistant bacteria.

"Inversely correlated with colonization by drug-resistant bacteria" means that, when comparing the bacterial load in the stool of healthy individuals and patients at high risk of colonization by drug-resistant bacteria, the bacterial load of these resistant bacterial groups is relatively high in healthy individuals, while the bacterial load of these resistant bacterial groups is relatively low in patients at high risk of colonization by drug-resistant bacteria.

One or more bacteria that are correlated with the colonization of drug-resistant bacteria include Enterobacteriaceae, a bacterial group that is tolerant to the colonization of drug-resistant bacteria.

"Correlated with colonization by drug-resistant bacteria" means that, when comparing the amount of bacteria in the stool of healthy individuals and patients colonized with drug-resistant bacteria, the amount of bacteria in these tolerant bacterial groups is relatively low in healthy individuals, while the amount of bacteria in these tolerant bacterial groups is relatively high in patients colonized with drug-resistant bacteria.

Quantification of bacterial nucleic acid can be performed by amplifying the nucleotide sequence of the nucleic acid using a primer that can specifically detect the nucleic acid, and such techniques are well known. For example, quantification of bacterial nucleic acid can be performed by amplifying the nucleotide sequence of the bacteria by a nucleic acid amplification method using an oligonucleotide primer that specifically hybridizes to a specific nucleotide sequence of the bacteria.

Nucleic acid amplification methods include the polymerase chain reaction (PCR) method, the loop-mediated isothermal amplification (LAMP) method, and the transcription-reverse transcription concerted reaction (TRC) method, all of which are well known.

PCR using oligonucleotide primers that specifically hybridize with bacterial sequences has high detection sensitivity, and PCR devices are widely available in medical institutions and nursing homes, making it preferable in that the testing method according to this embodiment of the present invention can be carried out at many facilities.

The amount of bacterial nucleic acid may be indicated by a _C value, which is the number of PCR cycles required for a fluorescent signal to exceed a threshold value, or the amount of bacterial nucleic acid may be the amount of nucleic acid amplified by quantitative PCR, i.e., the amount of PCR product.

The threshold is defined as the level at which a statistically significant increase is observed relative to the baseline signal, where the baseline signal is a nearly constant fluorescent signal in the initial cycles of PCR. The C _T value is the number of PCR cycles required for the fluorescent signal to exceed this threshold. The C _T value is inversely proportional to the amount of target nucleic acid in the sample. That is, a lower C _T value indicates an increased amount of target nucleic acid in the sample.

In some embodiments, the oligonucleotide primers are a primer set consisting of an equimolar mixture of the polynucleotides 1), 2), and 3) below, and an equimolar mixture of the polynucleotides 4) and 5) below.
1) a polynucleotide comprising the sequence of SEQ ID NO:1;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 1, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 1 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 2) A polynucleotide comprising the sequence of SEQ ID NO: 2;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 2, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 2, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 3) A polynucleotide comprising the sequence of SEQ ID NO: 3;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 3, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 3, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 4) A polynucleotide comprising the sequence of SEQ ID NO: 4;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 4, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 4, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae, which are inversely correlated with the colonization ability of the drug-resistant bacteria. 5) A polynucleotide comprising the sequence of SEQ ID NO: 5;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO:5, which amplifies nucleic acids of the Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae families, or a polynucleotide comprising the sequence of SEQ ID NO:5 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae families.
GCGTTAAGTATTCCACCTGGGG (SEQ ID NO: 1)
ACAATAAGTATCCCACCTGGGG (SEQ ID NO: 2)
GCAATAAGTATACCACCTGGGG (SEQ ID NO: 3)
GGTAAGGTTCCTCGCGTATC (SEQ ID NO: 4)
GGTAAGGTTCTTCGCGTTGC (SEQ ID NO:5)
The equimolar mixture of polynucleotides 1), 2), and 3) is a set of forward primers for detecting only Lachnospiraceae, Ruminococcaceae, and Bacteroidetes. The equimolar mixture of polynucleotides 4) and 5) is a set of reverse primers for detecting only Lachnospiraceae, Ruminococcaceae, and Bacteroidetes, used in combination with a set of forward primers. These polyoligonucleotides can be synthesized by known nucleic acid synthesis methods.

By using PCR with a primer set consisting of a forward primer and a reverse primer, it is possible to specifically and quantitatively detect bacteria of the Lachnospiraceae, Ruminococcaceae, and Bacteroidetes families, which are bacterial groups that are resistant to the establishment of drug-resistant bacteria.

The length of each of the polynucleotides 1) to 5) is not particularly limited, but is preferably a polynucleotide consisting of 15 to 50 bases, more preferably a polynucleotide consisting of 15 to 30 bases, and more preferably a polynucleotide consisting of 18 to 25 bases.

The polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 1 to 5 is preferably a polynucleotide containing at least 15 consecutive bases from each of the sequences of SEQ ID NOs: 1 to 5. Also, the polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 1 to 5 is preferably a polynucleotide containing at least 18 bases from each of the sequences of SEQ ID NOs: 1 to 5, and more preferably a polynucleotide containing at least 18 consecutive bases from each of the sequences of SEQ ID NOs: 1 to 5.

In some embodiments, the oligonucleotide primers are a primer set of 1) and 2) below.
1) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:1, a polynucleotide comprising the sequence of SEQ ID NO:2, and a polynucleotide comprising the sequence of SEQ ID NO:3. 2) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:4 and a polynucleotide comprising the sequence of SEQ ID NO:5. The equimolar mixture of three polynucleotides in 1) is a set of forward primers for detecting only Lachnospiraceae, Ruminococcaceae, and Bacteroidetes. The equimolar mixture of two polynucleotides in 2) is a set of reverse primers for detecting only Lachnospiraceae, Ruminococcaceae, and Bacteroidetes, used in combination with the set of forward primers in 1).

By using the PCR with the primer sets 1) and 2) above, it is possible to specifically and quantitatively detect bacteria of the Lachnospiraceae, Ruminococcaceae, and Bacteroidetes families, which are bacterial groups that are resistant to the establishment of drug-resistant bacteria.

The step of determining the risk of drug-resistant bacteria colonization using a primer set related to SEQ ID NOs: 1 to 5 can be carried out in various embodiments.

In some embodiments, the determining step includes determining that the risk of colonization of drug-resistant bacteria in the subject is increased when the amount of nucleic acid in the subject's fecal sample during the drug administration period is lower than the amount of nucleic acid in the subject's fecal sample before drug administration.

In some embodiments, the determining step includes determining that the risk of colonization of drug-resistant bacteria in the subject has been reduced when the amount of nucleic acid in the subject's fecal sample after the end of drug administration is greater than the amount of nucleic acid in the subject's fecal sample during the drug administration period.

In some embodiments, the determining step includes determining that the subject is at high risk of being colonized by drug-resistant bacteria when the amount of nucleic acid in the subject's fecal sample is low compared to the average amount of nucleic acid in fecal samples from healthy individuals.

In some embodiments, the oligonucleotide primers are a primer set consisting of the following 1) and 2):
1) a polynucleotide comprising the sequence of SEQ ID NO:6;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 6, which amplifies a nucleic acid of the Enterobacteriaceae family; or A polynucleotide comprising the sequence of SEQ ID NO: 6, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family. 2) A polynucleotide comprising the sequence of SEQ ID NO: 7;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 7, which amplifies the nucleic acid of the Enterobacteriaceae family, or a polynucleotide comprising the sequence of SEQ ID NO: 7, in which one or two bases have been deleted, substituted, or added, which amplifies the nucleic acid of the Enterobacteriaceae family.
GGGGGATAACTACTGGAAACGG (SEQ ID NO: 6)
GATCGTCGCCTAGGTGAGC (SEQ ID NO: 7)
The polynucleotide 1) is a forward primer for detecting only Enterobacteriaceae. The polynucleotide 2) is a reverse primer for detecting only Enterobacteriaceae, which is used in combination with the forward primer 1). These polyoligonucleotides can be synthesized by known nucleic acid synthesis methods.

By using the above primer sets 1) and 2), PCR can be used to specifically and quantitatively detect Enterobacteriaceae bacteria, which are a bacterial group that is permissive for the colonization of drug-resistant bacteria.

The length of each of the polynucleotides 1) and 2) is not particularly limited, but is preferably a polynucleotide consisting of 15 to 50 bases, more preferably a polynucleotide consisting of 15 to 30 bases, and more preferably a polynucleotide consisting of 18 to 25 bases.

The polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 6 and 7 is preferably a polynucleotide containing at least 15 consecutive bases from each of the sequences of SEQ ID NOs: 6 and 7. Also, the polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 6 and 7 is preferably a polynucleotide containing at least 18 bases from each of the sequences of SEQ ID NOs: 1 to 5, and more preferably a polynucleotide containing at least 18 consecutive bases from each of the sequences of SEQ ID NOs: 1 to 5.

In some embodiments, the oligonucleotide primers are a primer set of 1) and 2) below.
1) A polynucleotide comprising the sequence of SEQ ID NO: 6 2) A polynucleotide comprising the sequence of SEQ ID NO: 7 The polynucleotide of 1) is a forward primer for detecting only Enterobacteriaceae The polynucleotide of 2) is a reverse primer for detecting only Enterobacteriaceae, used in combination with the forward primer of 1).

By using the above primer sets 1) and 2), PCR can be used to specifically and quantitatively detect Enterobacteriaceae bacteria, which are a bacterial group that is permissive for the colonization of drug-resistant bacteria.

The step of determining the risk of drug-resistant bacteria colonization using a primer set related to SEQ ID NOs: 6 and 7 can be carried out in various embodiments.

In some embodiments, the determining step includes determining that the risk of colonization of drug-resistant bacteria in the subject is increased when the amount of nucleic acid in the subject's fecal sample during the drug administration period is lower than the amount of nucleic acid in the subject's fecal sample before drug administration.

In some embodiments, the determining step includes determining that the subject is likely to be colonized by drug-resistant bacteria when the amount of nucleic acid in the subject's fecal sample is higher than the average amount of nucleic acid in fecal samples from healthy individuals.

The method for detecting the risk of drug-resistant bacteria colonization according to the first aspect of the present invention uses a known nucleic acid amplification method and can utilize PCR equipment that has become common during the COVID-19 pandemic, making it a method that is easily accepted by medical institutions. In addition, it will enable investigations into the risk of drug-resistant bacteria colonization in nursing homes and other facilities where drug-resistant bacteria are a problem, which will lead to identifying the actual situation and issues surrounding the spread of drug-resistant bacteria in medical institutions and nursing homes, where there is still a lack of data, and is expected to provide new insight into the background to the spread of drug-resistant bacteria.

According to a second aspect of the present invention, there is provided a primer set comprising an equimolar mixture of the following polynucleotides 1), 2), and 3) and an equimolar mixture of the following polynucleotides 4) and 5).
1) a polynucleotide comprising the sequence of SEQ ID NO:1;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 1, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 1 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 2) A polynucleotide comprising the sequence of SEQ ID NO: 2;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 2, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 2, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 3) A polynucleotide comprising the sequence of SEQ ID NO: 3;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 3, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 3, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 4) A polynucleotide comprising the sequence of SEQ ID NO: 4;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 4, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 4, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae, which are inversely correlated with the colonization ability of the drug-resistant bacteria. 5) A polynucleotide comprising the sequence of SEQ ID NO: 5;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO:5, which amplifies nucleic acid of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO:5 in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acid of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. The length of each of the polynucleotides 1) to 5) is not particularly limited, but is preferably a polynucleotide consisting of 15 to 50 bases, more preferably a polynucleotide consisting of 15 to 30 bases, and more preferably a polynucleotide consisting of 18 to 25 bases.

The polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 1 to 5 is preferably a polynucleotide containing at least 15 consecutive bases from each of the sequences of SEQ ID NOs: 1 to 5. Also, the polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 1 to 5 is preferably a polynucleotide containing at least 18 bases from each of the sequences of SEQ ID NOs: 1 to 5, and more preferably a polynucleotide containing at least 18 consecutive bases from each of the sequences of SEQ ID NOs: 1 to 5.

In some embodiments, the following primer sets 1) and 2) are provided.
1) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:1, a polynucleotide comprising the sequence of SEQ ID NO:2, and a polynucleotide comprising the sequence of SEQ ID NO:3. 2) An equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:4 and a polynucleotide comprising the sequence of SEQ ID NO:5. According to a third aspect of the present invention, there is provided a primer set consisting of the following 1) and 2).
1) a polynucleotide comprising the sequence of SEQ ID NO:6;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 6, which amplifies a nucleic acid of the Enterobacteriaceae family; or A polynucleotide comprising the sequence of SEQ ID NO: 6, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family. 2) A polynucleotide comprising the sequence of SEQ ID NO: 7;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 7, which amplifies a nucleic acid of the Enterobacteriaceae family; or A polynucleotide comprising the sequence of SEQ ID NO: 7 in which one or two bases have been deleted, substituted or added, which amplifies a nucleic acid of the Enterobacteriaceae family. The length of each of the polynucleotides 1) and 2) is not particularly limited, but is preferably a polynucleotide consisting of 15 to 50 bases, more preferably a polynucleotide consisting of 15 to 30 bases, and more preferably a polynucleotide consisting of 18 to 25 bases.

The polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 6 and 7 is preferably a polynucleotide containing at least 15 consecutive bases from each of the sequences of SEQ ID NOs: 6 and 7. Also, the polynucleotide containing at least 15 bases from each of the sequences of SEQ ID NOs: 6 and 7 is preferably a polynucleotide containing at least 18 bases from each of the sequences of SEQ ID NOs: 1 to 5, and more preferably a polynucleotide containing at least 18 consecutive bases from each of the sequences of SEQ ID NOs: 1 to 5.

In some embodiments, the following primer sets 1) and 2) are provided.
1) A polynucleotide comprising the sequence of SEQ ID NO: 6 2) A polynucleotide comprising the sequence of SEQ ID NO: 7 The primer sets of the second and third aspects can be used to detect the risk of drug-resistant bacteria colonization in an animal subject.

According to a fourth aspect of the present invention, there is provided a kit for detecting the risk of colonization of drug-resistant bacteria in a mammalian subject, comprising the primer set of the second or third aspect.

The kit may further include instructions for quantifying nucleic acids of one or more bacteria that are correlated or inversely correlated with colonization of drug-resistant bacteria from a fecal sample collected from a mammalian subject according to the method of the first aspect.

The kit may further include a first container that contains the primer set of the second or third aspect.

The kit may also include a second container containing dNTPs (deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), and deoxythymidine triphosphate (dTTP)).

Further, the kit may include DNA polymerase, _MgCl2 , buffer solution, etc., and these compounds may be contained in the first container or the second container, or may be contained together or separately in containers different from the first container and the second container.

The disclosures of all patent applications and literature cited herein are hereby incorporated by reference in their entireties.

The following examples are intended for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Unless otherwise specified, reagents are commercially available or are obtained or prepared according to procedures commonly used in the art or procedures described in the literature.

1. Standard strains used The 40 standard strains used in connection with the present invention are listed below.
Lacrimispora indolis (ATCC 25771), Ruminococcus gauvreauii (JCM 14987 ^T ), Ruminococcus gnavus (ATCC 29149), Ruminiclostridium cellobioparum (ATCC 15832), Pseudoflavonifractor capillosus (JCM 32126 ^T ), Alistipes indistinctus (JCM 16068 ^T ), Bacteroides fragilis (ATCC 25285), Phocaeicola vulgatus (ATCC 8482), Bacteroides acidifaciens (JCM 10556 ^T ), Bacteroides uniformis (ATCC 8492), Bacteroides dorei (JCM 13471 ^T ), Bacteroides finegoldii (JCM 13345 ^T ), Bacteroides intestinalis (JCM 13265 ^T ), Bacteroides thetaiotaomicron (ATCC 29148), Parabacteroides johnsonii (JCM 13406 ^T ), Parabacteroides merdae (ATCC 43184), Clostridium butyricum (ATCC 19398), Clostridium sporogenes (ATCC 3584), Clostridium ramosum (ATCC 25582), Clostridium intestinale (ATCC 49213), Clostridium innocuum (ATCC 14501), Clostridium spiroforme (ATCC 29900), Eggerthella lenta (ATCC 25559), Finegoldia magna (ATCC 14904), Lactobacillus casei (ATCC 393), Lactobacillus acidophilus (ATCC 4356), Lactobacillus gasseri (ATCC 33323), Ligilactobacillus animalis (ATCC 35046), Corynebacterium striatum (ATCC 6940), Corynebacterium ulcerans (ATCC 51799), Corynebacterium pseudodiphtheriticum (ATCC 10700), Staphylococcus lugdunensis (ATCC 49576), Staphylococcus saprophyticus (ATCC 15305), Escherichia coli (ATCC 35218), Klebsiella pneumoniae (ATCC 13883), Klebsiella oxytoca (ATCC 700324), Klebsiella variicola (ATCC 31488), Proteus vulgaris (ATCC 6380), Enterobacter cloacae (NCTC 13406), and Haemophilus influenzae (ATCC 43335).

2. Nucleic acid extraction method from bacterial strains and stool For nucleic acid extraction from bacterial strains, a small amount of a single colony grown on the medium was collected with a platinum loop, suspended in 50 μL of 0.05 mol/L NaOH, heat-treated at 95°C for 10 minutes, and 11 μL of 1 mol/L Tris-HCl (pH 7.0) was added. The mixture was diluted 10-fold with sterile water and used as template DNA. For nucleic acid extraction from stool, Quick-DNA Fecal/Soil Microbe Miniprep Kit (ZYMO Research) and QIAamp Power Fecal Pro DNA kit (QIAGEN) were used, following the instructions attached to each product.

3. Primer set design Among the bacterial groups identified as being in a correlation or inverse correlation with the colonization of drug-resistant bacteria from the results of the bacterial flora metagenomic analysis of the mouse intestinal colonization model, Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae were selected as bacterial groups that could be resistance indicators, and Enterobacteriaceae as a bacterial group that could be a tolerance indicator, with reference to the base sequence information published in GenBank (NCBI). We searched for base sequences common only to these bacterial groups, and examined one candidate region (16S rRNA gene region), 10 forward primers, and 6 reverse primers as primer candidates for universal detection of bacterial groups that could be resistance indicators (Lachnospiraceae/Ruminococcaceae/Bacteroidaceae, hereafter referred to as LRB). In addition, three candidate regions (all 16S rRNA gene regions), four types of forward primers, and three types of reverse primers were considered as primer candidates for universal detection of Enterobacteriaceae (ETB), a bacterial group that can also serve as an acceptable indicator.

4. Establishment of LRB detection system (real-time PCR method) Based on the examination using nucleic acid samples extracted from various standard strains, we designed the following primers to specifically detect LRB: a forward primer consisting of an equal mixture of LRB-F1, LRB-F2, and LRB-F3 targeting the site corresponding to 912-933 of Bacteroides finegoldii NCBI Reference Sequence:AAB222699, and a reverse primer consisting of an equal mixture of LRB-R1 and LRB-R2 targeting the site corresponding to 1030-1011 of the same (Table 1, Figure 1). The size of the polynucleotide amplified using the forward primer consisting of an equal mixture of LRB-F1, LRB-F2, and LRB-F3 and the reverse primer consisting of an equal mixture of LRB-R1 and LRB-R2 targeting the site corresponding to 1030-1011 of the same was 119 bp.

The optimal conditions for this detection system vary depending on the real-time PCR device, reagents, reaction vessel, etc. used, and are not limited as long as the real-time PCR reaction is carried out appropriately. Specific examples are shown below.

The real-time PCR device used was the LightCycler (registered trademark) 96 System (Roche), and the reaction reagent used was THUNDERBIRD (registered trademark) SYBR (registered trademark) qPCR Mix (TOYOBO). The composition of the PCR reaction solution was 10 μL of 1×THUNDERBIRD (registered trademark) SYBR (registered trademark) qPCR Mix (TOYOBO), a total of 10.0 pmol of forward primer equimolar mix (LRB-F1 + LRB-F2 + LRB-F3), and a total of 10.0 pmol of reverse primer equimolar mix (LRB-R1 + LRB-R2), and 1.0 μL of template DNA was added, and the total volume was adjusted to 20 μL with sterile purified water. The reaction conditions were determined as follows: 3-step PCR.
Initial denaturation: 95℃ 60 sec. Denaturation: 95℃ 15 sec. Annealing: 62℃ 5 sec. Extension: 72℃ 30 sec. 45 cycles from denaturation to extension.

Real-time PCR reactions were performed on 40 standard strains using the LRB detection system described above. As a result, nucleic acid amplification was observed only in 18 species of bacteria contained in the LRB, namely Lacrimispora indolis, Ruminococcus gauvreauii, Ruminococcus gnavus, Ruminiclostridium cellobioparum, Pseudoflavonifractor capillosus, Alistipes indistinctus, Bacteroides fragilis, Phocaeicola vulgatus, Bacteroides acidifaciens, Bacteroides uniformis, Bacteroides dorei, Bacteroides finegoldii, Bacteroides intestinalis, Bacteroides thetaiotaomicron, Parabacteroides johnsonii, Parabacteroides merdae, Clostridium butyricum, and Clostridium sporogenes, but not in other bacterial species (Table 2). As described above, the primer set designed to comprehensively detect LRB was able to specifically detect only LRB, and no cross-reactivity with other bacterial species was observed.

5. Establishment of an ETB detection system (real-time PCR method) As primers for specifically detecting Enterobacteriaceae (ETB) using nucleic acid samples extracted from various standard strains, we designed a forward primer consisting of ETB-F1 targeting the site corresponding to 169-191 of Escherichia coli NCBI Reference Sequence:AM980865, and a reverse primer consisting of ETB-R1 targeting the site 322-304 of the same (Table 3, Figure 2). The size of the polynucleotide amplified using the forward primer consisting of ETB-F1 and the reverse primer consisting of ETB-R1 targeting the site 322-304 of the same was 144 bp.

As with the LRB detection system, the optimal conditions for this detection system vary depending on the real-time PCR device, reagents, and reaction vessels used, and are not limited as long as the real-time PCR reaction is carried out appropriately. Specific examples are shown below.

The real-time PCR device used was the LightCycler® 96 System (Roche), and the reaction reagent was THUNDERBIRD® Next SYBR® qPCR Mix (TOYOBO). The PCR reaction solution was composed of 10 μL of 1×THUNDERBIRD® Next SYBR® qPCR Mix (TOYOBO), 10.0 pmol of forward primer (ETB-F1), and 10.0 pmol of reverse primer (ETB-R1), with 1.0 μL of template DNA added, and the total volume was adjusted to 20 μL with sterile purified water. After investigation, the reaction conditions were determined to be the following two-step PCR.
Initial denaturation: 95℃ 30 sec. Denaturation: 95℃ 5 sec. Extension: 72℃ 30 sec. 45 cycles from denaturation to extension.

Real-time PCR reactions were performed on 40 standard strains using the ETB detection system described above. Nucleic acid amplification was observed only in six species of bacteria: Escherichia coli, Klebsiella pneumoniae, Klebsiella oxytoca, Klebsiella variicola, Enterobacter cloacae, and Proteus vulgaris, and no amplification was observed in other bacterial species (Table 4). In addition, clinical isolates isolated and identified from stool samples of hospitalized patients were also examined, and nucleic acid amplification was observed in 10 strains of Escherichia coli, 2 strains of Klebsiella aerogenes, 2 strains of Klebsiella oxytoca, 1 strain of Citrobacter freundii, and 1 strain of Raoultella ornithinolytica, but no amplification was observed in 1 strain of Acinetobacter species and 1 strain of Aeromonas veronii (Table 5). As described above, the primer set designed for comprehensive detection of ETB was able to specifically detect only ETB in both standard strains and clinical isolates, and no cross-reactivity with other bacterial species was observed.

6. Verification in a mouse intestinal colonization model of resistant bacteria
C57BL/6J mice (6-8 weeks old, female) were given no antibiotics (control group, n=4), 1.0 g/L ampicillin (ABPC group, n=4), or 1.0 g/L metronidazole (MNZ group, n=4) in drinking water ad libitum for 3 days to disrupt the intestinal microbiota in the ABPC and MNZ groups. ESBL-producing E. coli (CTX-M-9, ST131, cefoperazone-resistant) were orally inoculated, and feces were smeared on MacConkey medium containing cefoperazone (32 μg/mL), and the number of developing colonies was measured over time as the amount of drug-resistant bacteria. Nucleic acids were extracted from feces immediately before inoculation and on the 3rd and 8th days after inoculation, and the amount of LRB and ETB bacteria was evaluated using the LRB and ETB detection systems established in 4. and 5. above, respectively.

The amount of drug-resistant bacteria in feces (mean ± SEM) (Fig. 3, bar graph) peaked 1 day after inoculation in all groups, with _Log10 CFU/g of feces being 3.9 ± 0.2 in the control group, 8.7 ± 0.4 in the ABPC group, and 6.5 ± 0.4 in the MNZ group. Drug-resistant bacteria did not grow in the control and MNZ groups from day 3 after inoculation. On the other hand, in the ABPC group, although a decrease in the amount of drug-resistant bacteria in feces was observed from day 5 to day 8 after inoculation, drug-resistant bacteria continued to grow even on day 12 after inoculation.

In the evaluation using the LRB detection system, the C _T value (mean ± SEM) of the control group immediately before inoculation was 18.2 ± 0.6, that of the ABPC group was 39.3 ± 1.9, and that of the MNZ group was 29.1 ± 2.4. The LRB bacterial load was lowest in the ABPC group, which had the longest intestinal colonization of drug-resistant bacteria, followed by the MNZ group (Fig. 3, scatter plot). Furthermore, in both the ABPC and MNZ groups, it was confirmed that the LRB bacterial load recovered over time to the same level as the control group, in line with the decrease in the amount of drug-resistant bacteria in the feces from the third day after inoculation. From the above, it was revealed that the LRB detection system can quantitatively evaluate the risk of colonization of drug-resistant bacteria and its increase or decrease.

In the ETB detection system, the C _T values (mean ± SEM) immediately before inoculation were 29.8 ± 0.9 in the control group, 42.9 ± 1.3 in the ABPC group, and 17.0 ± 0.3 in the MNZ group (Fig. 4, scatter plot). In the ABPC group, the amount of ETB immediately before inoculation was the lowest among all groups due to the reduction of Enterobacteriaceae bacteria in the mouse intestine by ABPC administration, but on the third day after inoculation, the amount of ETB was the highest, reflecting the intestinal colonization of ESBL-producing E. coli orally inoculated. In the MNZ group, the amount of ETB was higher than that of the control group immediately before inoculation because MNZ does not show antibacterial activity against Enterobacteriaceae bacteria, but in both the ABPC and MNZ groups, the amount of ETB settled to the same level as the control group as the amount of drug-resistant bacteria in the feces decreased. These results suggest that a decrease in the amount of ETB bacteria indicates an increased risk of colonization, and an increase in the amount of ETB bacteria reflects the colonization of drug-resistant bacteria.

7. Validation with human clinical specimens Next, to confirm the operation of the detection system using actual human samples and to verify its applicability in clinical practice, we used 80 diarrheal specimens (clinical residual specimens) from 58 hospitalized patients considered to be at high risk of colonization and 20 stool specimens from 20 healthy individuals considered to be at low risk of colonization to verify whether the established LRB and ETB detection systems are useful for evaluating the risk of colonization by drug-resistant bacteria. In addition, 57 diarrheal specimens from 52 hospitalized patients were smeared with CHROMagar ^TM ESBL (Kanto Chemical Co., Ltd.), an ESBL screening medium, during stool specimen processing, and verified whether it was possible to evaluate the presence or absence of ESBL-producing bacteria by dividing them into carriers in which bacterial colonies were observed and non-carriers in which no growth was observed.

First, to determine whether the LRB detection system can be used to evaluate the increased risk of colonization of drug-resistant bacteria due to antibiotic administration, an evaluation was conducted using 34 diarrheal stool specimens from 12 hospitalized patients from whom stool samples were collected multiple times and from whom longitudinal evaluation was possible. As shown in Figures 5(A)-(E), which show examples of graphs showing the change in LRB bacterial load over time for five of the 12 hospitalized patients, it was demonstrated that the LRB detection system can evaluate the reduction in LRB bacterial load due to antibiotic administration.

Next, we verified whether the LRB bacteria amount recovered after the end of antibiotic treatment. As shown in Figure 6(A)-(D), the LRB detection system showed a decrease in the _CT value after the end of antibiotic treatment, and the recovery of the LRB bacteria amount was also evaluated. In case H in Figure 6(C), carbapenemase-producing Enterobacteriaceae (CPE) was also detected in the stool, but as the LRB bacteria amount increased, CPE was no longer detected. On the other hand, in the case of case I in Figure 6(D), where the LRB bacteria amount did not recover even after the end of antibiotic treatment, the clinical picture showed a relapse of enteritis. From the above, it was confirmed that the LRB detection system can evaluate the increase or decrease in the risk of drug-resistant bacteria colonization associated with the administration and completion of antibiotics, even when using actual human samples.

Next, the hospitalized patients were divided into those who were receiving antibiotics at the time of submitting the stool samples (37 patients, 46 samples in total) and those who were not receiving antibiotics (28 patients, 34 samples in total), and healthy subjects (20 patients, 20 samples) who were considered to be at low risk were also evaluated using the LRB detection system (Figures 7(A) and (B)). Note that for some patients, stool samples were collected when antibiotics were administered and when antibiotics were administered, and they were counted as two patients in total, so the total number of patients here exceeds 58 hospitalized patients. As a result, a significant difference in the amount of LRB bacteria was confirmed in each group, with the highest amount of LRB bacteria in healthy subjects and the lowest amount in hospitalized patients receiving antibiotics (Figure 7(A)). In Figure 7(B), the proportions of patients with C _T values > 22 and patients with C _T values ≦ 22 were 85% and 15%, respectively, in hospitalized patients not receiving antibiotics were 71% and 29%, respectively, and in healthy subjects were 10% and 90%, respectively. Although this is only one specific example, it was suggested that when sorting by a C _T value of 22 as a boundary for dividing high-risk and low-risk groups for resistant bacteria colonization, it is possible to relatively clearly distinguish between healthy individuals considered to have a low risk of colonization and hospitalized patients considered to have a high risk of colonization.

Next, using the ETB detection system, we similarly evaluated whether it was possible to evaluate the increased risk of drug-resistant bacteria colonization due to antibiotic administration using 34 diarrheal stool samples from 12 hospitalized patients from whom stool samples were collected multiple times and from whom longitudinal evaluation was possible. As shown in Figures 8(A)-(D), which show examples of graphs showing the change in ETB bacterial load over time for four patients, a decrease in the ETB bacterial load was confirmed following antibiotic administration, and a decrease in ETB bacterial load indicates an environment in which drug-resistant bacteria are likely to colonize, suggesting a state of high risk of drug-resistant bacteria colonization.

Using the LRB and ETB detection systems, we divided subjects into ESBL-producing bacteria carriers (15 patients, 16 samples in total) and non-carriers (38 patients, 41 samples in total) (same as the 52 hospitalized patients and 57 diarrheal samples mentioned above, except that one patient had two stool samples taken, one of which detected ESBL-producing bacteria and the other did not, so the total number of subjects was counted as two) and healthy subjects (20 samples from 20 subjects), and examined whether they could actually evaluate the presence or absence of drug-resistant bacteria (Fig. 9(A), (B)). The LRB bacterial load was highest in healthy subjects, and low in both ESBL-producing and non-carrier hospitalized patients, who are considered to be at high risk of becoming infected with drug-resistant bacteria (Fig. 9(A)). On the other hand, the ETB bacterial load was highest in ESBL-producing bacteria carriers, and there was no difference between healthy subjects and non-carriers (Fig. 9(B)). Thus, it became clear that the LRB detection system is useful for evaluating the "risk of colonization" of drug-resistant bacteria, and the ETB detection system is useful for evaluating whether ESBL-producing bacteria have "colonized."

Claims (19)

A method for detecting a risk of colonization of a drug-resistant bacteria in an animal subject, comprising:
A method comprising: quantifying, from a fecal sample collected from a subject, nucleic acids of one or more bacteria that are in a correlation or inverse correlation with the colonization of drug-resistant bacteria; and determining a risk of colonization of drug-resistant bacteria from the amount of nucleic acid obtained in the quantification step or an increase or decrease in the amount of nucleic acid. The method according to claim 1, wherein the one or more bacteria that are correlated or inversely correlated with the colonization of drug-resistant bacteria are bacteria of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. The method according to claim 1, wherein the one or more bacteria that are correlated or inversely correlated with the colonization of drug-resistant bacteria are bacteria of the family Enterobacteriaceae. The method according to claim 1, wherein the quantification of the bacterial nucleic acid is performed by a nucleic acid amplification method using an oligonucleotide primer that specifically hybridizes to a nucleotide sequence of the bacterial cell. The method according to claim 4, wherein the oligonucleotide primers are a primer set consisting of an equimolar mixture of the polynucleotides 1), 2), and 3) below, and an equimolar mixture of the polynucleotides 4) and 5) below.
1) a polynucleotide comprising the sequence of SEQ ID NO:1;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 1, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 1 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 2) A polynucleotide comprising the sequence of SEQ ID NO: 2;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 2, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 2, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 3) A polynucleotide comprising the sequence of SEQ ID NO: 3;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 3, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 3 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 4) A polynucleotide comprising the sequence of SEQ ID NO: 4;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 4, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 4 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 5) A polynucleotide comprising the sequence of SEQ ID NO: 5;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO:5, which amplifies nucleic acids of the Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae families, or a polynucleotide comprising the sequence of SEQ ID NO:5 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae families. The method according to claim 4, wherein the oligonucleotide primers are a primer set consisting of the following 1) and 2):
1) an equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:1, a polynucleotide comprising the sequence of SEQ ID NO:2, and a polynucleotide comprising the sequence of SEQ ID NO:3; 2) an equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:4 and a polynucleotide comprising the sequence of SEQ ID NO:5. The method according to claim 5 or 6, wherein the determining step includes determining that the risk of colonization of drug-resistant bacteria in the subject is increased when the amount of nucleic acid in the subject's fecal sample during the drug administration period is lower than the amount of nucleic acid in the subject's fecal sample before the drug administration. The method according to claim 5 or 6, wherein the determining step includes determining that the risk of colonization of drug-resistant bacteria in the subject has decreased when the amount of nucleic acid in the subject's fecal sample after the end of drug administration is greater than the amount of nucleic acid in the subject's fecal sample during the drug administration period. The method according to claim 5 or 6, wherein the determining step includes determining that the subject is at high risk of being colonized by drug-resistant bacteria when the amount of nucleic acid in the subject's fecal sample is lower than the average amount of nucleic acid in fecal samples from healthy individuals. The method according to claim 4, wherein the oligonucleotide primers are a primer set consisting of the following 1) and 2):
1) a polynucleotide comprising the sequence of SEQ ID NO:6;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 6, which amplifies a nucleic acid of the Enterobacteriaceae family; or A polynucleotide comprising the sequence of SEQ ID NO: 6, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family. 2) A polynucleotide comprising the sequence of SEQ ID NO: 7;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 7, which amplifies the nucleic acid of the Enterobacteriaceae family, or a polynucleotide comprising the sequence of SEQ ID NO: 7, in which one or two bases have been deleted, substituted, or added, which amplifies the nucleic acid of the Enterobacteriaceae family. The method according to claim 4, wherein the oligonucleotide primers are a primer set consisting of the following 1) and 2):
1) A polynucleotide comprising the sequence of SEQ ID NO:6; 2) A polynucleotide comprising the sequence of SEQ ID NO:7. The method according to claim 10 or 11, wherein the determining step includes determining that the risk of colonization of drug-resistant bacteria in the subject is increased when the amount of nucleic acid in the subject's fecal sample during the drug administration period is lower than the amount of nucleic acid in the subject's fecal sample before the drug administration. The method according to claim 10 or 11, wherein the determining step includes determining that there is a high possibility that drug-resistant bacteria have colonized in the subject when the amount of nucleic acid in the subject's fecal sample is greater than the average amount of nucleic acid in fecal samples from healthy individuals. A primer set consisting of an equimolar mixture of the following polynucleotides 1), 2), and 3) and an equimolar mixture of the following polynucleotides 4) and 5).
1) a polynucleotide comprising the sequence of SEQ ID NO:1;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 1, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 1 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 2) A polynucleotide comprising the sequence of SEQ ID NO: 2;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 2, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 2, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 3) A polynucleotide comprising the sequence of SEQ ID NO: 3;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 3, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 3, in which one or two bases have been deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 4) A polynucleotide comprising the sequence of SEQ ID NO: 4;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 4, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae; or a polynucleotide comprising the sequence of SEQ ID NO: 4 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the family Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae. 5) A polynucleotide comprising the sequence of SEQ ID NO: 5;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO:5, which amplifies nucleic acids of the Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae families, or a polynucleotide comprising the sequence of SEQ ID NO:5 with one or two bases deleted, substituted, or added, which amplifies nucleic acids of the Lachnospiraceae, Ruminococcaceae, and Bacteroidaceae families. A primer set consisting of the following 1) and 2).
1) an equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:1, a polynucleotide comprising the sequence of SEQ ID NO:2, and a polynucleotide comprising the sequence of SEQ ID NO:3; 2) an equimolar mixture of a polynucleotide comprising the sequence of SEQ ID NO:4 and a polynucleotide comprising the sequence of SEQ ID NO:5. A primer set consisting of the following 1) and 2).
1) a polynucleotide comprising the sequence of SEQ ID NO:6;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 6, which amplifies a nucleic acid of the Enterobacteriaceae family; or A polynucleotide comprising the sequence of SEQ ID NO: 6, in which one or two bases have been deleted, substituted, or added, which amplifies a nucleic acid of the Enterobacteriaceae family. 2) A polynucleotide comprising the sequence of SEQ ID NO: 7;
A polynucleotide comprising at least 15 bases of the sequence of SEQ ID NO: 7, which amplifies the nucleic acid of the Enterobacteriaceae family, or a polynucleotide comprising the sequence of SEQ ID NO: 7, in which one or two bases have been deleted, substituted, or added, which amplifies the nucleic acid of the Enterobacteriaceae family. A primer set consisting of the following 1) and 2).
1) A polynucleotide comprising the sequence of SEQ ID NO:6; 2) A polynucleotide comprising the sequence of SEQ ID NO:7. Use of the primer set according to any one of claims 14 to 17 for detecting the risk of colonization of drug-resistant bacteria in an animal subject. A kit for detecting the risk of drug-resistant bacteria colonization in an animal subject, comprising the primer set according to any one of claims 14 to 17.