JP2024019733A - RNAi constructs and methods of use thereof to inhibit ASGR1 expression - Google Patents

Abstract

The present invention provides additional therapeutic agents for the treatment of cardiovascular diseases. The present invention provides compositions and methods for modulating hepatic expression of asialoglycoprotein receptor 1 (ASGR1). In particular, the present invention provides nucleic acid-based therapeutics for reducing ASGR1 expression via RNA interference, and such nucleic acid-based therapeutics for treating or preventing cardiovascular disease. Provide methods for use. [Selection diagram] None

Description

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62/380,216, filed August 26, 2016, which is incorporated by reference in its entirety. Incorporated into the specification.

Description of Electronically Submitted Text Files This application contains a sequence listing submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. A copy of the sequence listing in computer readable format, created on July 25, 2017, has the name A-2094-WO-PCT_ST25 and is 1.49 megabytes in size.

The present invention relates to compositions and methods for modulating hepatic expression of asialoglycoprotein receptor 1 (ASGR1). In particular, the present invention provides nucleic acid-based therapeutics for reducing ASGR1 expression via RNA interference, and such nucleic acid-based therapeutics for treating or preventing cardiovascular disease. Regarding how to use.

Despite the many advances and new therapeutic agents that have emerged over recent years, cardiovascular disease remains the leading cause of death worldwide. In the United States, one in three adults has some type of cardiovascular disease, including coronary artery disease, myocardial infarction, angina, heart failure, and stroke. American Heart Association. Circulation, Vol. 133: e38-e360, 2016). In 2013, 17.3 million people worldwide and 1.4 million people in the United States died from some form of cardiovascular disease, accounting for 31% of all deaths worldwide and 54% of all deaths in the United States that year. and stroke statistics-2016 update). Cardiovascular disease now claims more lives each year than the next two leading causes of death, cancer and chronic lower respiratory tract disease combined (Heart disease and stroke statistics - 2016 update). Therefore, there remains a need for additional therapeutic agents for the treatment of cardiovascular disease.
The asialoglycoprotein receptor is a calcium expressed on the surface of hepatocytes that contributes to the removal and degradation of desialylated glycoproteins from serum by binding to ligands with terminal galactose and N-acetylgalactosamine residues. It is an addictive receptor (Weigel, Bioessays, Vol. 16:519-524, 1994; Stockert, Physiol. Rev., Vol. 75:591-609, 1995). The hetero-oligomeric asialoglycoprotein receptor is composed of two distinct proteins: the 48 kDa asialoglycoprotein receptor 1 (ASGR1) major subunit and the 40 kDa asialoglycoprotein receptor 2 (ASGR2) minor subunit ( See, eg, Stockert, 1995). The asialoglycoprotein receptor has been shown to be involved in the clearance of low-density lipoproteins and chylomicron remnants, suggesting a role for the receptor in lipoprotein metabolism (Windler et al. , Biochem J., Vol. 276 (Pt 1): 79-87, 1991; Ishibashi et al., J Biol Chem., Vol. 271: 22422-22427, 1996). In recent years, human carriers of a loss-of-function variant allele of the ASGR1 subunit of the asialoglycoprotein receptor have lower serum levels of non-high-density lipoprotein (HDL) cholesterol and are associated with coronary artery disease and It was reported that the risk of myocardial infarction is low (Nioi et al., New England Journal of Medicine, Vol. 374(22): 2131-2141, 2016). Therefore, therapeutic agents targeting ASGR1 function represent a new strategy to reduce non-HDL cholesterol levels and treat cardiovascular disease, especially coronary artery disease.

Heart disease and stroke statistics-2016 update: a report from the American Heart Association. Circulation, Vol. 133:e38-e360, 2016 Weigel, Bioessays, Vol. 16:519-524, 1994 Stockert, Physiol. Rev. , Vol. 75:591-609, 1995 Windler et al. , Biochem J. , Vol. 276(Pt 1):79-87, 1991 Ishibashi et al. , J Biol Chem. , Vol. 271:22422-22427, 1996 Nioi et al. , New England Journal of Medicine, Vol. 374(22):2131-2141, 2016

The invention is based in part on the design and generation of RNAi constructs that target the ASGR1 gene and reduce ASGR1 expression in liver cells. Sequence-specific inhibition of ASGR1 expression is useful in treating or preventing pathological conditions associated with ASGR1 expression, such as cardiovascular disease. Accordingly, in one embodiment, the invention provides an RNAi construct comprising a sense strand and an antisense strand, the antisense strand comprising a region having a sequence complementary to the mRNA sequence of ASGR1. . In certain embodiments, the antisense strand includes a region having at least 15 contiguous nucleotides from the antisense sequences listed in Table 1, Table 6, or Table 8.

In some embodiments, the sense strand of the RNAi constructs described herein comprises a sequence that is sufficiently complementary to that of the antisense strand to form a duplex region of about 15 to about 30 base pairs in length. . In these and other embodiments, the sense and antisense strands are each about 15-30 nucleotides in length. In some embodiments, the RNAi construct includes at least one blunt end. In other embodiments, the RNAi construct includes at least one nucleotide overhang. Such nucleotide overhangs may contain from 1 to 6 unpaired nucleotides and may be located at the 3' end of the sense strand, the 3' end of the antisense strand, or the 3' end of both the sense and antisense strands. It is possible. In certain embodiments, the RNAi construct includes an overhang of two unpaired nucleotides at the 3' end of the sense strand and at the 3' end of the antisense strand. In other embodiments, the RNAi construct comprises an overhang of two unpaired nucleotides at the 3' end of the antisense strand and a blunt end at the 3' end of the sense strand/5' end of the antisense strand. .

RNAi constructs of the invention may include one or more modified nucleotides, including nucleotides with modifications to the ribose ring, nucleobase, or phosphodiester backbone. In some embodiments, the RNAi construct includes one or more 2'-modified nucleotides. Such 2'-modified nucleotides include 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids ( BNA) or combinations thereof. In one particular embodiment, the RNAi construct comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or a combination thereof. In some embodiments, all nucleotides in the sense and antisense strands of the RNAi construct are modified nucleotides.

In some embodiments, the RNAi construct comprises at least one backbone modification, such as a modified internucleotide or internucleoside linkage. In certain embodiments, the RNAi constructs described herein include at least one phosphorothioate internucleotide linkage. In certain embodiments, phosphorothioate internucleotide linkages may be placed at the 3' or 5' ends of the sense and/or antisense strands.

In some embodiments, the antisense and/or sense strands of the RNAi constructs of the invention may comprise or consist of sequences from the antisense and sense sequences listed in Tables 1, 6, or 8. In certain embodiments, the RNAi construct can be any one of the duplex compounds listed in any one of Tables 1-10. In one embodiment, the RNAi constructs are D-1098, D-1176, D-1200, D-1206, D-1235, D-1246, D-1373, D-1389, D-1813, D-1815, D -1983, D-2000, D-2045, D-2142, D-2143, D-1438, D-1494, D-2357, D-2359, D-2361, D-2365, D-2461, D-3036 , D-3037, D-3051, D-3053, D-3057, D-3779, D-3780, D-3782, D-3788, D-3791, D-3795, D-3799 or D-3800. . In another embodiment, the RNAi construct is D-1200, D-1206, D-1235, D-1815, D-2143, D-2359, D-2361, D-2365, D-2142, D-1176, D-3779, D-3782, D-3788, D-3799 or D-3800. In another embodiment, the RNAi construct is D-2359. In another embodiment, the RNAi construct is D-1815. In yet another embodiment, the RNAi construct is D-1235. In yet another embodiment, the RNAi construct is D-2143. In another embodiment, the RNAi construct is D-2361. In some embodiments, the RNAi construct is D-3782. In other embodiments, the RNAi construct is D-3799.

The RNAi construct may further include a ligand that facilitates delivery or uptake of the RNAi construct into specific tissues or cells, such as liver cells. In certain embodiments, the ligand targets delivery of the RNAi construct to hepatocytes. In these and other embodiments, the ligand may include galactose, galactosamine or N-acetyl-galactosamine (GalNAc). In certain embodiments, the ligand comprises a multivalent galactose or multivalent GalNAc moiety, such as a trivalent or tetravalent galactose or GalNAc moiety. The ligand can be covalently attached to the 5' or 3' end of the sense strand of the RNAi construct, optionally via a linker. In some embodiments, the RNAi construct includes a ligand and a linker having a structure according to any of Formulas I-XXIX described herein. In certain embodiments, the RNAi construct includes a ligand and a linker having a structure according to Formula VII, Formula VIII, Formula XVI, Formula XXVI, or Formula XXIX. In one embodiment, the RNAi construct includes a ligand and a linker having the structure according to Formula XVI, where n=1 and k=3.

In certain embodiments, the ligand may include an antibody or antigen-binding fragment thereof that specifically binds ASGR1. The 5' or 3' end of the sense strand of the RNAi construct can be covalently linked to the antibody or antigen-binding fragment via the side chain of an amino acid residue in the light or heavy chain of the antibody or antigen-binding fragment. In some embodiments, the sense strand of the RNAi construct is covalently linked, optionally via a linker, to the side chain of a cysteine residue present in the heavy or light chain of the antibody or antigen-binding fragment thereof. be done. In one embodiment, the anti-ASGR1 antibody-RNA molecule conjugate comprises at least one copy of an interfering RNA molecule (eg, siRNA or shRNA). In another embodiment, the anti-ASGR1 antibody-RNA molecule conjugate comprises two copies of an interfering RNA molecule (eg, siRNA or shRNA).

The invention also provides pharmaceutical compositions comprising an RNAi construct as described herein and any pharmaceutically acceptable carrier, excipient or diluent. Such pharmaceutical compositions are particularly useful for reducing ASGR1 expression in cells of a patient in need thereof, such as liver cells. Patients to whom the pharmaceutical compositions of the invention may be administered include those with a history of myocardial infarction, those diagnosed with or at risk for coronary artery disease or other forms of cardiovascular disease, and those with elevated non-HDL cholesterol. can include patients with levels. Accordingly, the present invention includes methods of treating or preventing cardiovascular disease in a patient in need thereof by administering an RNAi construct or pharmaceutical composition described herein. In certain embodiments, the invention provides methods of reducing non-HDL cholesterol in a patient in need thereof by administering an RNAi construct or pharmaceutical composition described herein.

The use of RNAi constructs targeting ASGR1 in any of the methods described herein or for the preparation of a medicament for administration by the methods described herein is specifically contemplated. For example, the invention includes RNAi constructs that target ASGR1 for use in methods of treating or preventing cardiovascular disease, including coronary artery disease or myocardial infarction, in a patient in need thereof. The invention also includes RNAi constructs that target ASGR1 for use in methods of reducing non-HDL cholesterol in a patient in need thereof. In some embodiments, the invention provides RNAi constructs that target ASGR1 for use in a method of reducing the risk of myocardial infarction in a patient in need thereof.

The present invention also encompasses the use of RNAi constructs that target ASGR1 in the preparation of a medicament for the treatment or prevention of cardiovascular disease, including coronary artery disease or myocardial infarction, in a patient in need thereof. In certain embodiments, the invention provides the use of an RNAi construct that targets ASGR1 in the preparation of a medicament for reducing non-HDL cholesterol in a patient in need thereof. In certain other embodiments, the invention provides the use of an RNAi construct that targets ASGR1 in the preparation of a medicament for reducing the risk of myocardial infarction in a patient in need thereof.
In certain embodiments, for example, the following is provided:
(Item 1)
An RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand includes a region having a complementary sequence to the mRNA sequence of ASGR1, and the region is as shown in Table 1, Table 6, or Table 8. An RNAi construct comprising at least 15 contiguous nucleotides from a listed antisense sequence.
(Item 2)
The RNAi construct of item 1, wherein the sense strand comprises a sequence sufficiently complementary to that of the antisense strand to form a duplex region of about 15 to about 30 base pairs in length.
(Item 3)
The RNAi construct of item 2, wherein the double-stranded region is about 17 to about 24 base pairs in length.
(Item 4)
The RNAi construct of item 2, wherein the double-stranded region is about 19 to about 21 base pairs in length.
(Item 5)
5. The RNAi construct according to any one of items 2-4, wherein the sense strand and the antisense strand are each about 15 to about 30 nucleotides in length.
(Item 6)
The RNAi construct of item 5, wherein the sense strand and the antisense strand are each about 19 to about 27 nucleotides in length.
(Item 7)
The RNAi construct of item 5, wherein the sense strand and the antisense strand are each about 21 to about 25 nucleotides in length.
(Item 8)
RNAi construct according to any one of items 1 to 7, comprising at least one blunt end.
(Item 9)
RNAi construct according to any one of items 1 to 7, comprising at least one nucleotide overhang of 1 to 4 unpaired nucleotides.
(Item 10)
10. The RNAi construct according to item 9, wherein the nucleotide overhang has two unpaired nucleotides.
(Item 11)
11. The RNAi construct according to item 9 or 10, comprising a nucleotide overhang at the 3' end of the sense strand, the 3' end of the antisense strand, or the 3' end of both the sense strand and the antisense strand.
(Item 12)
The RNAi construct according to any one of items 9 to 11, wherein the nucleotide overhang comprises a 5'-UU-3' dinucleotide or a 5'-dTdT-3' dinucleotide.
(Item 13)
RNAi construct according to any one of items 1 to 12, comprising at least one modified nucleotide.
(Item 14)
The RNAi construct according to item 13, wherein the modified nucleotide is a 2'-modified nucleotide.
(Item 15)
The modified nucleotides include 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids (BNA), or these. The RNAi construct according to item 13, which is a combination.
(Item 16)
16. The RNAi construct according to item 15, wherein the modified nucleotide is a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-fluoro modified nucleotide, or a combination thereof.
(Item 17)
14. The RNAi construct according to item 13, wherein all of the nucleotides in the sense strand and the antisense strand are modified nucleotides.
(Item 18)
18. The RNAi construct according to item 17, wherein the modified nucleotide is a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, or a combination thereof.
(Item 19)
RNAi construct according to any one of items 1 to 18, comprising at least one phosphorothioate internucleotide linkage.
(Item 20)
20. The RNAi construct of item 19, comprising two consecutive phosphorothioate internucleotide linkages at the 3' end of the antisense strand.
(Item 21)
Item 19, wherein the antisense strand comprises two consecutive phosphorothioate internucleotide linkages at both the 3' and 5' ends, and the sense strand comprises two consecutive phosphorothioate internucleotide linkages at the 5' end. RNAi construct.
(Item 22)
22. The RNAi construct according to any one of items 1 to 21, wherein the antisense strand comprises a sequence selected from the antisense sequences listed in Table 1, Table 6 or Table 8. (Item 23)
The antisense strand is SEQ ID NO: 1606, SEQ ID NO: 1684, SEQ ID NO: 1708, SEQ ID NO: 1714, SEQ ID NO: 1743, SEQ ID NO: 1754, SEQ ID NO: 1881, SEQ ID NO: 1897, SEQ ID NO: 2321, SEQ ID NO: 2323, SEQ ID NO: 2491, SEQ ID NO: 2508, SEQ ID NO: 2553, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 1946, SEQ ID NO: 2002, SEQ ID NO: 2865, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 2969, SEQ ID NO: 3701, SEQ ID NO: Sequence selected from 3702, SEQ ID NO: 3716, SEQ ID NO: 3718, SEQ ID NO: 3722, SEQ ID NO: 4618, SEQ ID NO: 4619, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4630, SEQ ID NO: 4634, SEQ ID NO: 4638, or SEQ ID NO: 4639. The RNAi construct according to item 22, comprising:
(Item 24)
24. The RNAi construct according to item 22 or item 23, wherein the sense strand comprises a sequence selected from the sense sequences listed in Table 1, Table 6 or Table 8.
(Item 25)
The sense strand includes SEQ ID NO: 103, SEQ ID NO: 181, SEQ ID NO: 205, SEQ ID NO: 211, SEQ ID NO: 240, SEQ ID NO: 251, SEQ ID NO: 378, SEQ ID NO: 394, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 988, SEQ ID NO: No. 1005, SEQ ID NO: 1050, SEQ ID NO: 1147, SEQ ID NO: 1148, SEQ ID NO: 443, SEQ ID NO: 499, SEQ ID NO: 1362, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 1370, SEQ ID NO: 1466, SEQ ID NO: 3050, SEQ ID NO: 3051 , SEQ ID NO: 3065, SEQ ID NO: 3067, SEQ ID NO: 3071, SEQ ID NO: 4443, SEQ ID NO: 4444, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4455, SEQ ID NO: 4459, SEQ ID NO: 4463 or SEQ ID NO: 4464. The RNAi construct according to item 24, comprising:
(Item 26)
(a) the sense strand comprises the sequence SEQ ID NO: 181, and the antisense strand comprises the sequence SEQ ID NO: 1684;
(b) the sense strand comprises the sequence SEQ ID NO: 205, and the antisense strand comprises the sequence SEQ ID NO: 1708;
(c) the sense strand comprises the sequence SEQ ID NO: 211, and the antisense strand comprises the sequence SEQ ID NO: 1714;
(d) the sense strand comprises the sequence SEQ ID NO: 240, and the antisense strand comprises the sequence SEQ ID NO: 1743;
(e) the sense strand comprises the sequence SEQ ID NO: 820, and the antisense strand comprises the sequence SEQ ID NO: 2323;
(f) the sense strand comprises the sequence SEQ ID NO: 1147, and the antisense strand comprises the sequence SEQ ID NO: 2650;
(g) the sense strand comprises the sequence SEQ ID NO: 1148, and the antisense strand comprises the sequence SEQ ID NO: 2651;
(h) the sense strand comprises the sequence SEQ ID NO: 1364, and the antisense strand comprises the sequence SEQ ID NO: 2867;
(i) the sense strand comprises the sequence SEQ ID NO: 1366, and the antisense strand comprises the sequence SEQ ID NO: 2869, or (j) the sense strand comprises the sequence SEQ ID NO: 1370, and The RNAi construct according to any one of items 22 to 25, wherein the antisense strand comprises the sequence SEQ ID NO: 2873.
(Item 27)
RNAi construct according to any one of items 1 to 26, which is any one of the double-stranded compounds listed in any one of Tables 1 to 10.
(Item 28)
D-1098, D-1176, D-1200, D-1206, D-1235, D-1246, D-1373, D-1389, D-1813, D-1815, D-1983, D-2000, D- 2045, D-2142, D-2143, D-1438, D-1494, D-2357, D-2359, D-2361, D-2365, D-2461, D-3036, D-3037, D-3051, The RNAi construct according to item 27, which is D-3053, D-3057, D-3779, D-3780, D-3782, D-3788, D-3791, D-3795, D-3799 or D-3800.
(Item 29)
D-1200, D-1206, D-1235, D-1815, D-2143, D-2359, D-2361, D-2365, D-2142, D-1176, D-3779, D-3782, D- 3788, D-3799 or D-3800.
(Item 30)
RNAi according to any one of items 1 to 29, which reduces the expression level of ASGR1 in liver cells after incubation with said RNAi construct compared to the level of ASGR1 expression in liver cells incubated with a control RNAi construct. construct.
(Item 31)
31. The RNAi construct according to item 30, wherein the liver cells are Hep3B cells, HepG2 cells, or human primary liver cells.
(Item 32)
RNAi construct according to any one of items 1 to 29, which inhibits at least 45% of ASGR1 expression at 5 nM in Hep3B cells in vitro.
(Item 33)
30. The RNAi construct of any one of items 1-29, which inhibits ASGR1 expression in Hep3B cells with an IC50 of less than about 10 nM.
(Item 34)
30. The RNAi construct of any one of items 1-29, which inhibits ASGR1 expression in Hep3B cells with an IC50 of less than about 1 nM.
(Item 35)
35. The RNAi construct according to any one of items 1 to 34, further comprising a ligand.
(Item 36)
36. The RNAi construct of item 35, wherein the ligand comprises a cholesterol moiety, a vitamin, a steroid, a bile acid, a folic acid moiety, a fatty acid, a carbohydrate, a glycoside, or an antibody or antigen-binding fragment thereof.
(Item 37)
36. The RNAi construct of item 35, wherein the ligand targets delivery of the RNAi construct to hepatocytes.
(Item 38)
38. The RNAi construct according to item 37, wherein the ligand comprises a monoclonal antibody that specifically binds to human ASGR1 or an antigen-binding fragment thereof.
(Item 39)
The monoclonal antibody or antigen-binding fragment thereof comprises a substitution of at least one amino acid by a cysteine amino acid, and the sense strand is covalently bound to the monoclonal antibody or antigen-binding fragment thereof via the side chain of the cysteine amino acid. The RNAi construct according to item 38, wherein the RNAi construct is
(Item 40)
36. The RNAi construct according to item 35, wherein the ligand comprises galactose, galactosamine or N-acetyl-galactosamine.
(Item 41)
41. The RNAi construct according to item 40, wherein the ligand comprises a polyvalent galactose moiety or a polyvalent N-acetyl-galactosamine moiety.
(Item 42)
42. The RNAi construct according to item 41, wherein the polyvalent galactose moiety or the polyvalent N-acetyl-galactosamine moiety is trivalent or tetravalent.
(Item 43)
43. The RNAi construct according to any one of items 35 to 42, wherein the ligand is covalently linked to the sense strand, optionally via a linker.
(Item 44)
44. The RNAi construct according to item 43, wherein the ligand is covalently attached to the 3' or 5' end of the sense strand.
(Item 45)
A pharmaceutical composition comprising an RNAi construct according to any one of items 1 to 44 and a pharmaceutically acceptable carrier, excipient or diluent.
(Item 46)
A method of reducing the expression of ASGR1 in a patient in need thereof, the method comprising administering to said patient an RNAi construct according to any one of items 1 to 44.
(Item 47)
47. The method of item 46, wherein the expression level of ASGR1 in hepatocytes is reduced in the patient after administration of the RNAi construct compared to the expression level of ASGR1 in a patient not receiving the RNAi construct.
(Item 48)
47. The method of item 46, wherein the patient has been diagnosed with or is at risk for coronary artery disease.
(Item 49)
47. The method of item 46, wherein the patient has elevated levels of non-HDL cholesterol.
(Item 50)
47. The method of item 46, wherein the patient has a history of myocardial infarction.
(Item 51)
A method of reducing non-HDL cholesterol in a patient in need thereof, the method comprising administering to said patient an RNAi construct according to any one of items 1-44.
(Item 52)
52. The method according to item 51, wherein the non-HDL cholesterol is LDL cholesterol.
(Item 53)
A method of treating or preventing cardiovascular disease in a patient in need thereof, the method comprising administering to said patient an RNAi construct according to any one of items 1 to 44.
(Item 54)
54. The method according to item 53, wherein the cardiovascular disease is coronary artery disease or myocardial infarction.
(Item 55)
A method of reducing the risk of myocardial infarction in a patient in need thereof, the method comprising administering to said patient an RNAi construct according to any one of items 1-44.
(Item 56)
56. The method of item 55, wherein the patient is diagnosed with coronary artery disease.
(Item 57)
56. The method of item 55, wherein the patient has elevated levels of non-HDL cholesterol.
(Item 58)
58. The method of any one of items 46-57, wherein the RNAi construct is administered to the patient via a parenteral route of administration.
(Item 59)
59. The method according to item 58, wherein the parenteral route of administration is intravenous or subcutaneous.
(Item 60)
45. The RNAi construct of any one of items 1-44 for use in a method of reducing non-HDL cholesterol in a patient in need thereof.
(Item 61)
61. The RNAi construct according to item 60, wherein the non-HDL cholesterol is LDL cholesterol.
(Item 62)
RNAi construct according to any one of items 1 to 44 for use in a method of treating or preventing cardiovascular disease in a patient in need thereof.
(Item 63)
63. The RNAi construct according to item 62, wherein the cardiovascular disease is coronary artery disease or myocardial infarction.
(Item 64)
45. An RNAi construct according to any one of items 1 to 44 for use in a method of reducing the risk of myocardial infarction in a patient in need thereof.
(Item 65)
The RNAi construct in item 64, wherein the patient is diagnosed with coronary artery disease.
(Item 66)
65. The RNAi construct of item 64, wherein said patient has elevated levels of non-HDL cholesterol.
(Item 67)
Use of an RNAi construct according to any one of items 1 to 44 in the preparation of a medicament for reducing non-HDL cholesterol in a patient in need thereof.
(Item 68)
68. The use according to item 67, wherein the non-HDL cholesterol is LDL cholesterol.
(Item 69)
Use of an RNAi construct according to any one of items 1 to 44 in the preparation of a medicament for the treatment or prevention of cardiovascular disease in a patient in need thereof.
(Item 70)
The use according to item 69, wherein the cardiovascular disease is coronary artery disease or myocardial infarction.
(Item 71)
Use of an RNAi construct according to any one of items 1 to 44 in the preparation of a medicament for reducing the risk of myocardial infarction in a patient in need thereof.
(Item 72)
The use according to item 71, wherein the patient is diagnosed with coronary artery disease.
(Item 73)
72. The use according to item 71, wherein said patient has elevated levels of non-HDL cholesterol.

Figure 2 shows the nucleotide sequence of human ASGR1 transcript variant 1 (NCBI reference SEQ ID NO: NM_001671.4; SEQ ID NO: 1). Transcript sequences are shown as complementary DNA (cDNA) sequences with uracil bases replaced by thymine bases. Figure 2 shows the nucleotide sequence of human ASGR1 transcript variant 2 (NCBI reference SEQ ID NO: NM_001197216.2; SEQ ID NO: 2). Transcript sequences are shown as cDNA sequences with uracil bases replaced by thymine bases. The nucleotide sequence of transcript variant 1 of mouse Asgr1 is shown (NCBI reference SEQ ID NO: NM_009714.2; SEQ ID NO: 3011). Transcript sequences are shown as complementary DNA (cDNA) sequences with uracil bases replaced by thymine bases. The nucleotide sequence of the rat Asgr1 transcript is shown (SEQ ID NO: 3012). Transcript sequences are shown as complementary DNA (cDNA) sequences with uracil bases replaced by thymine bases. Figure 2 shows the nucleotide sequence of the transcript of macaque (Macaca fascicularis) ASGR1 (NCBI reference SEQ ID NO: XM_005582698.1; SEQ ID NO: 3013). Transcript sequences are shown as complementary DNA (cDNA) sequences with uracil bases replaced by thymine bases. A synthetic scheme for a tetravalent GalNAc moiety that can be incorporated into any of the RNAi constructs of the invention is shown. Figure 2 is a bar graph of the expression levels of human ASGR1 in the livers of ASGR1 knockout mice injected with AAV encoding human ASGR1 and treated with 5 mg/kg subcutaneous injection of the indicated GalNAc-ASGR1 siRNA conjugates. Human ASGR1 expression was measured by qPCR and reported as expression levels relative to AAV-only control animals that were ASGR1 knockout animals injected with AAV encoding human ASGR1 but not otherwise treated. Expression levels are shown at day 8 (d8) and day 15 (d15) after administration of the GalNAc-siRNA conjugate. Wild type (WT) mice and ASGR1 knockout (KO) animals were included as controls. FIG. 6B is a bar graph of serum levels of alkaline phosphatase (ALP) from the animals described in FIG. 6A. Serum was obtained on day 8 (d8) and day 15 (d15) after administration of the indicated GalNAc-siRNA conjugates. FIG. 2 is a schematic diagram showing the reaction of adding a bromoacetyl linker to the 3' end of the sense strand of an siRNA duplex. FIG. 2 is a schematic diagram showing a conjugation reaction that binds an siRNA duplex to an anti-ASGR1 antibody. ASGR1 mRNA dose-dependent effects in human primary hepatocytes observed with 3549 (RNA to Ab ratio is 1) and 3550 (RNA to Ab ratio is 2) anti-ASGR1 mAb-siRNA conjugates. FIG. 3 is a bar graph showing knockdown. Unconjugated anti-ASGR1 cys mAb (PL-53515) was used as a control. Figure 2 is a bar graph showing ASGR1 mRNA levels in livers from wild type mice in all dose groups measured at the indicated time points (days 2, 4, 8 and 15). The same siRNA (compound 1418) conjugated to a GalNAc moiety was used as a positive control. The siRNA amount in 5mpk 1418 is equivalent to the siRNA amount in 30mpk 3550 compound with two siRNA/mAbs. Figure 2 is a line graph showing protein expression of ASGR1 in livers from wild type mice in all dose groups measured at the indicated time points (days 2, 4, 8 and 15). The same siRNA (compound 1418) conjugated to a GalNAc moiety was used as a positive control. The siRNA amount in 5mpk 1418 is equivalent to the siRNA amount in 30mpk 3550 compound with two siRNA/mAbs. Figure 2 is a bar graph showing serum alkaline phosphatase (ALP) from wild type mice in all dose groups measured at the indicated time points (days 2, 4, 8 and 15). The same siRNA (compound 1418) conjugated to a GalNAc moiety was used as a positive control. The siRNA amount in 5mpk 1418 is equivalent to the siRNA amount in 30mpk 3550 compound with two siRNA/mAbs.

The present invention relates to compositions and methods for modulating the expression of asialoglycoprotein receptors in cells or mammals. In some embodiments, compositions of the invention include an RNAi construct that targets ASGR1 mRNA and reduces ASGR1 expression in a cell or mammal. Such RNAi constructs may be useful in treating or preventing various forms of cardiovascular disease, such as by reducing serum levels of non-HDL cholesterol and reducing the risk of developing coronary artery disease or myocardial infarction. Useful.

As used herein, the term "RNAi construct" refers to an agent that includes an RNA molecule that is capable of downregulating the expression of a target gene (e.g., ASGR1) through an RNA interference mechanism when introduced into a cell. Point. RNA interference involves a nucleic acid molecule inducing the cleavage and degradation of a target RNA molecule (e.g., a messenger RNA or mRNA molecule) in a sequence-specific manner, e.g., via the RNA-induced silencing complex (RISC) pathway. It's a process. In some embodiments, the RNAi construct comprises a double-stranded RNA molecule comprising two antiparallel strands of contiguous nucleotides that are sufficiently complementary to each other and hybridize to form a duplex region. "Hybridize" or "hybridization" typically refers to hydrogen bonds between complementary bases in two polynucleotides (e.g., Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonds). refers to the pairing of complementary polynucleotides. A strand that includes a region that has a sequence that is substantially complementary to a target sequence (eg, a target mRNA) is referred to as an "antisense strand." "Sense strand" refers to a strand that includes a region that is substantially complementary to a region of the antisense strand. In some embodiments, the sense strand may include a region with substantially identical sequence to the target sequence.

Double-stranded RNA molecules may contain chemical modifications to the ribonucleotides, including modifications to ribose sugars, bases, or ribonucleotide backbone components, such as those described herein or known in the art. Any such modifications, such as those used in double-stranded RNA molecules (eg, siRNA, shRNA, etc.), are encompassed by the term "double-stranded RNA" for purposes of this disclosure.

As used herein, under certain conditions, such as physiological conditions, a polynucleotide comprising a first sequence hybridizes to a polynucleotide comprising a second sequence to form a double-stranded region. A first sequence is "complementary" to a second sequence if it can. Other such conditions can include moderate or stringent hybridization conditions known to those of skill in the art. A first sequence base pairs with a second sequence if the polynucleotide comprising the first sequence base pairs with the polynucleotide comprising the second sequence over the entire length of one or both nucleotide sequences without mismatch. They are considered completely complementary (100% complementary). A sequence is "substantially complementary" to a target sequence if the sequence is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% complementary to the target sequence. be. Percent complementarity can be calculated by dividing the number of bases in a first sequence that are complementary to bases at corresponding positions in a second or target sequence by the total length of the first sequence. A sequence is said to be substantially complementary to the other if there are no more than 5, 4, 3, or 2 mismatches over a 30 base pair duplex region when the two sequences hybridize. It can be said. Generally, if any nucleotide overhangs as defined herein are present, the sequence of such overhangs will not be considered in determining the degree of complementarity between two sequences. As an example, a 21 nucleotide long sense strand and a 21 nucleotide long antisense strand that hybridize to form a 19 base pair duplex region with a 2 nucleotide overhang at the 3' end of each strand are As the terms are used herein, they are considered fully complementary.

In some embodiments, the region of the antisense strand includes a sequence that is fully complementary to a region of the target RNA sequence (eg, ASGR1 mRNA). In such embodiments, the sense strand may contain a sequence that is completely complementary to that of the antisense strand. In other such embodiments, the sense strand has a sequence that is substantially complementary to that of the antisense strand, such as 1, 2, 3, 4 in the duplex region formed by the sense and antisense strands. or may contain sequences with 5 mismatches. In certain embodiments, it is preferred that any mismatches occur within the terminal regions (eg, within 6, 5, 4, 3, or 2 nucleotides of the 5' and/or 3' ends of the strands). In one embodiment, any mismatches in the duplex region formed from the sense and antisense strands occur within 6, 5, 4, 3 or 2 nucleotides of the 5' end of the antisense strand.

In certain embodiments, the sense and antisense strands of a double-stranded RNA can be two separate molecules that hybridize to form a duplex region, but are not joined except for this region. Such double-stranded RNA molecules formed from two separate strands are referred to as "small interfering RNA" or "short interfering RNA" (siRNA). Thus, in some embodiments, RNAi constructs of the invention include siRNA.

In other embodiments, the sense and antisense strands that hybridize to form a duplex region can be part of a single RNA molecule, i.e., the sense and antisense strands are part of a single RNA molecule. is part of the self-complementary region of In such cases, the single RNA molecule includes a duplex region (also called a stem region) and a loop region. The 3' end of the sense strand is joined to the 5' end of the antisense strand by a flanking sequence of unpaired nucleotides that will form a loop region. The loop region is usually long enough to allow the RNA molecule to fold back on itself so that the antisense strand can base pair with the sense strand to form a duplex or stem region. It is something. The loop region can include about 3 to about 25, about 5 to about 15, or about 8 to about 12 unpaired nucleotides. Such RNA molecules having at least partially self-complementary regions are referred to as "short hairpin RNAs" (shRNAs). In certain embodiments, RNAi constructs of the invention include shRNAs. The length of a single at least partially self-complementary RNA molecule can be from about 35 nucleotides to about 100 nucleotides, from about 45 nucleotides to about 85 nucleotides, or from about 50 to about 60 nucleotides, as listed herein. The double-stranded region and the loop region each have a length.

In some embodiments, the RNAi constructs of the invention include a sense strand and an antisense strand, the antisense strand comprising a region having a sequence that is substantially or completely complementary to the messenger RNA (mRNA) sequence of ASGR1. including. As used herein, "ASGR1 mRNA sequence" encodes an ASGR1 protein, including variants or isoforms of the ASGR1 protein from any species (e.g., mouse, rat, non-human primate, human). Refers to any messenger RNA sequence including splice variants. ASGR1 protein (also known as HL-1, ASGPR H1, ASGPR1 and CLEC4H1), as used herein, refers to the major subunit of the asialoglycoprotein receptor. In humans, ASGR1 is found on chromosome 17p13.2 and exists in two different forms: a long isoform of about 291 amino acids (H1a or isoform A) and a short soluble isoform of about 252 amino acids (H1b or isoform B). Expressed as isoforms.

The ASGR1 mRNA sequence also includes the transcript sequence expressed as its complementary DNA (cDNA) sequence. cDNA sequence refers to the sequence of an mRNA transcript that is expressed as DNA bases (eg, guanine, adenine, thymine, and cytosine) rather than RNA bases (eg, guanine, adenine, uracil, and cytosine). Accordingly, the antisense strand of the RNAi construct of the invention may include a region having a sequence that is substantially or completely complementary to the target ASGR1 mRNA sequence or ASGR1 cDNA sequence. The mRNA or cDNA sequence of ASGR1 is based on the NCBI reference sequence NM_001671.4 (human; Figure 1A, SEQ ID NO: 1), NM_001197216.2 (human; Figure 1B, SEQ ID NO: 2), NM_009714.2 (mouse; Figure 2, 3011) and XM_005582698.1 (cynomolgus monkey; Figure 4, SEQ ID NO: 3013) or the rat sequence of Figure 3 (SEQ ID NO: 3012), but which but not limited to. In one embodiment, the ASGR1 mRNA sequence is human transcript variant 1 listed in the NCBI database as reference sequence NM_001671.4 (Figure 1A; see SEQ ID NO: 1). In another embodiment, the ASGR1 mRNA sequence is human transcript variant 2 listed in the NCBI database as reference sequence NM_001197216.2 (Figure IB; see SEQ ID NO: 2).

The region of the antisense strand can be substantially complementary or completely complementary to at least 15 contiguous nucleotides of the ASGR1 mRNA sequence. In some embodiments, the target region of the ASGR1 mRNA sequence in which the antisense strand includes a region of complementarity is about 15 to about 30 contiguous nucleotides, about 16 to about 28 contiguous nucleotides, about 18 ~ about 26 contiguous nucleotides, about 17 to about 24 contiguous nucleotides, about 19 to about 25 contiguous nucleotides, about 19 to about 23 contiguous nucleotides, or about 19 to about 21 contiguous nucleotides nucleotide range. In certain embodiments, the regions of the antisense strand that include sequences that are substantially or fully complementary to the ASGR1 mRNA sequence are listed in Table 1, Table 6, or Table 8, in some embodiments. It may contain at least 15 contiguous nucleotides from the antisense sequence. In other embodiments, the antisense sequence comprises at least 16, at least 17, at least 18, or at least 19 contiguous nucleotides from the antisense sequences listed in Table 1, Table 6, or Table 8. For example, in some embodiments, the region of the antisense strand that includes a sequence that is substantially or completely complementary to the ASGR1 mRNA sequence is SEQ ID NO: 1606, SEQ ID NO: 1684, SEQ ID NO: 1708, SEQ ID NO: 1714, SEQ ID NO: 1743, SEQ ID NO: 1754, SEQ ID NO: 1881, SEQ ID NO: 1897, SEQ ID NO: 2321, SEQ ID NO: 2323, SEQ ID NO: 2491, SEQ ID NO: 2508, SEQ ID NO: 2553, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 1946, SEQ ID NO: 2002, SEQ ID NO: 2865, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 2969, SEQ ID NO: 3701, SEQ ID NO: 3702, SEQ ID NO: 3716, SEQ ID NO: 3718, SEQ ID NO: 3722, SEQ ID NO: 4618, SEQ ID NO: 4619, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4630, SEQ ID NO: 4634, SEQ ID NO: 4638 or SEQ ID NO: 4639.

The sense strand of an RNAi construct typically includes a sequence that is sufficiently complementary to that of the antisense strand such that the two strands hybridize under physiological conditions to form a duplex region. "Double-stranded region" refers to two complementary or substantial regions that base pair with each other, either by Watson-Crick base pairing or other hydrogen bonding interactions, to produce a duplex between the two polynucleotides. Refers to a region of a polynucleotide that is complementary to the polynucleotide. The duplex region of the RNAi construct should be of sufficient length to allow the RNAi construct to enter the RNA interference pathway, eg, by binding of the Dicer enzyme and/or the RISC complex. For example, in some embodiments, the duplex region is about 15 to about 30 base pairs long. Other lengths of the duplex region within this range, such as about 15 to about 28 base pairs, about 15 to about 26 base pairs, about 15 to about 24 base pairs, about 15 to about 22 base pairs, about 17 to about about 28 base pairs, about 17 to about 26 base pairs, about 17 to about 24 base pairs, about 17 to about 23 base pairs, about 17 to about 21 base pairs, about 19 to about 25 base pairs, about 19 to about 23 Also suitable are base pairs or about 19 to about 21 base pairs. In one embodiment, the duplex region is about 17 to about 24 base pairs in length. In another embodiment, the duplex region is about 19 to about 21 base pairs in length.

For embodiments where the sense and antisense strands are two separate molecules (e.g., the RNAi construct comprises siRNA), the sense and antisense strands need to be the same length as the duplex region. There isn't. For example, one or both strands can be longer than the duplex region and can have one or more unpaired nucleotides or mismatches adjacent to the duplex region. Thus, in some embodiments, the RNAi construct includes at least one nucleotide overhang. As used herein, "nucleotide overhang" refers to unpaired nucleotides at the end of a strand or nucleotides that extend beyond the duplex region. Nucleotide overhangs are typically when the 3' end of one strand extends beyond the 5' end of the other strand or when the 5' end of one strand extends beyond the 3' end of the other strand. Generated when The length of the nucleotide overhang is generally 1-6 nucleotides, 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, 2-6 nucleotides, 2-5 nucleotides or 2-4 nucleotides. In some embodiments, the nucleotide overhang comprises 1, 2, 3, 4, 5 or 6 nucleotides. In certain embodiments, the nucleotide overhang comprises 1-4 nucleotides. In certain embodiments, the nucleotide overhang comprises 2 nucleotides. The nucleotides in the overhang can be ribonucleotides, deoxyribonucleotides or modified nucleotides as described herein. In some embodiments, the overhang comprises a 5'-uridine-uridine-3' (5'-U-U-3') dinucleotide. In such embodiments, the UU dinucleotides may include ribonucleotides or modified nucleotides, such as 2'-modified nucleotides. In other embodiments, the overhang comprises a 5'-deoxythymidine-deoxythymidine-3' (5'-dTdT-3') dinucleotide.

Nucleotide overhangs can be present at the 5' or 3' ends of one or both strands. For example, in one embodiment, the RNAi construct includes nucleotide overhangs at the 5' and 3' ends of the antisense strand. In another embodiment, the RNAi construct includes nucleotide overhangs at the 5' and 3' ends of the sense strand. In some embodiments, the RNAi construct includes nucleotide overhangs at the 5' end of the sense strand and at the 5' end of the antisense strand. In other embodiments, the RNAi construct includes nucleotide overhangs at the 3' end of the sense strand and at the 3' end of the antisense strand.

The RNAi construct may include a single nucleotide overhang at one end of the double-stranded RNA molecule and a blunt end at the other end. "Blunt ended" means that the sense and antisense strands are perfectly base-paired at the ends of the molecule and there are no unpaired nucleotides extending beyond the duplex region. In some embodiments, the RNAi construct includes a nucleotide overhang at the 3' end of the sense strand and blunt ends at the 5' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the RNAi construct includes a nucleotide overhang at the 3' end of the antisense strand and blunt ends at the 5' end of the antisense strand and the 3' end of the sense strand. In certain embodiments, the RNAi construct includes blunt ends at both ends of the double-stranded RNA molecule. In such embodiments, the sense and antisense strands have the same length, and the duplex region is the same length as the sense and antisense strands (i.e., the molecule is double-stranded over its entire length). main chain).

The sense strand and the antisense strand are each independently about 15 to about 30 nucleotides in length, about 18 to about 28 nucleotides in length, about 19 to about 27 nucleotides in length, about 19 to about 25 nucleotides in length, about 19 to about 23 nucleotides in length. nucleotides in length, about 21 to about 25 nucleotides in length, or about 21 to about 23 nucleotides in length. In certain embodiments, the sense and antisense strands are each about 18, about 19, about 20, about 21, about 22, about 23, about 24 or about 25 nucleotides in length. In some embodiments, the sense and antisense strands form a duplex region that has the same length but is shorter than the strands such that the RNAi construct has a two nucleotide overhang. For example, in one embodiment, the RNAi construct comprises (i) a sense strand and an antisense strand that are each 21 nucleotides long, (ii) a duplex region that is 19 base pairs long, and (iii) a 3' end of the sense strand. and a nucleotide overhang of two unpaired nucleotides at both the 3' end of the antisense strand. In another embodiment, the RNAi construct comprises (i) a sense strand and an antisense strand that are each 23 nucleotides long, (ii) a duplex region that is 21 base pairs long, and (iii) the 3' end of the sense strand and Contains a nucleotide overhang of two unpaired nucleotides at both 3' ends of the antisense strand. In other embodiments, the sense and antisense strands have the same length and include a duplex region throughout their length, such that there are no nucleotide overhangs at either end of the double-stranded molecule. Form. In one such embodiment, the RNAi construct is blunt ended and includes (i) a sense and antisense strand that are each 21 nucleotides in length and (ii) a duplex region that is 21 base pairs in length. In another such embodiment, the RNAi construct is blunt ended and includes (i) a sense and antisense strand that are each 23 nucleotides in length and (ii) a duplex region that is 23 base pairs in length.

In other embodiments, the sense or antisense strand is longer than the other strand such that the RNAi construct includes at least one nucleotide overhang, and the two strands are equal in length to the shorter strand. form a double-stranded region with a length. For example, in one embodiment, the RNAi construct comprises (i) a sense strand that is 19 nucleotides long, (ii) an antisense strand that is 21 nucleotides long, (iii) a duplex region that is 19 base pairs long, and (iv) Contains a single nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand. In another embodiment, the RNAi construct comprises (i) a sense strand that is 21 nucleotides long, (ii) an antisense strand that is 23 nucleotides long, (iii) a duplex region that is 21 base pairs long, and (iv) an antisense strand that is 21 nucleotides long. Contains a single nucleotide overhang of two unpaired nucleotides at the 3' end of the sense strand.

The antisense strand of the RNAi construct of the present invention can be an antisense sequence listed in Table 1, Table 6 or Table 8, a sequence of nucleotides 1 to 19 of any of these antisense sequences, or any of these antisense sequences. The sequence of nucleotides 2 to 19 can include any one of the following sequences. Each of the antisense sequences listed in Table 1, Table 6, or Table 8 must contain at least 19 contiguous nucleotides (counting from the 5' end) that are complementary to the ASGR1 mRNA sequence, in addition to a 2-nucleotide overhang sequence. (first 19 nucleotides). Thus, in some embodiments, the antisense strand comprises the sequence of nucleotides 1-19 of any one of SEQ ID NOs: 1508-3010, 3665-4315, or 4513-4687. In other embodiments, the antisense strand comprises the sequence of nucleotides 2-19 of any one of SEQ ID NOs: 1508-3010, 3665-4315, or 4513-4687. In yet other embodiments, the antisense strand comprises a sequence selected from SEQ ID NOs: 1508-3010, 3665-4315, or 4513-4687. In certain embodiments, the antisense strand is SEQ ID NO. 1606, SEQ ID NO. 1684, SEQ ID NO. 1708, SEQ ID NO. 1714, SEQ ID NO. 1743, SEQ ID NO. 1754, SEQ ID NO. 1881, SEQ ID NO. 2323, SEQ ID NO: 2491, SEQ ID NO: 2508, SEQ ID NO: 2553, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 1946, SEQ ID NO: 2002, SEQ ID NO: 2865, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 2969, SEQ ID NO: 3701, SEQ ID NO: 3702, SEQ ID NO: 3716, SEQ ID NO: 3718, SEQ ID NO: 3722, SEQ ID NO: 4618, SEQ ID NO: 4619, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4630, SEQ ID NO: 4634, SEQ ID NO: 4638 or SEQ ID NO: 4,639. In some embodiments, the antisense strand is SEQ ID NO:1684, SEQ ID NO:1708, SEQ ID NO:1714, SEQ ID NO:1743, SEQ ID NO:2323, SEQ ID NO:2650, SEQ ID NO:2651, SEQ ID NO:2867, SEQ ID NO:2869, SEQ ID NO: 2873, SEQ ID NO: 4618, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4638 or SEQ ID NO: 4639. In other embodiments, the antisense strand comprises or consists of SEQ ID NO: 1743, SEQ ID NO: 2323, SEQ ID NO: 2651, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 4621 or SEQ ID NO: 4638.

In these and other embodiments, the sense strand of the RNAi constructs of the invention comprises the sense sequences listed in Table 1, Table 6 or Table 8, the sequence of nucleotides 1-19 of any of these sense sequences, or Any one of the sequences from nucleotides 2 to 19 of the sense sequence can be included. Each of the sense sequences listed in Table 1, Table 6, or Table 8 must contain, in addition to a two-nucleotide overhang sequence, at least 19 contiguous sequences that are identical to the ASGR1 mRNA sequence and complementary to the corresponding antisense sequence. Contains a sequence of nucleotides (first 19 nucleotides counting from the 5' end). Thus, in some embodiments, the sense strand comprises the sequence of nucleotides 1-19 of any one of SEQ ID NOs: 5-1507, 3014-3664, or 4319-4512. In other embodiments, the sense strand comprises the sequence of nucleotides 2-19 of any one of SEQ ID NOs: 5-1507, 3014-3664, or 4319-4512. In yet other embodiments, the sense strand comprises a sequence selected from SEQ ID NOs: 5-1507, 3014-3664, or 4319-4512. In certain embodiments, the sense strand is SEQ ID NO:103, SEQ ID NO:181, SEQ ID NO:205, SEQ ID NO:211, SEQ ID NO:240, SEQ ID NO:251, SEQ ID NO:378, SEQ ID NO:394, SEQ ID NO:818, SEQ ID NO:820. , SEQ ID NO: 988, SEQ ID NO: 1005, SEQ ID NO: 1050, SEQ ID NO: 1147, SEQ ID NO: 1148, SEQ ID NO: 443, SEQ ID NO: 499, SEQ ID NO: 1362, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 1370, SEQ ID NO: 1466, SEQ ID NO: No. 3050, SEQ ID NO: 3051, SEQ ID NO: 3065, SEQ ID NO: 3067, SEQ ID NO: 3071, SEQ ID NO: 4443, SEQ ID NO: 4444, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4455, SEQ ID NO: 4459, SEQ ID NO: 4463 or SEQ ID NO: 4464 comprising or consisting of a sequence selected from In certain other embodiments, the sense strand is SEQ ID NO:181, SEQ ID NO:205, SEQ ID NO:211, SEQ ID NO:240, SEQ ID NO:820, SEQ ID NO:1147, SEQ ID NO:1148, SEQ ID NO:1364, SEQ ID NO:1366, 1370, SEQ ID NO: 4443, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4463 or SEQ ID NO: 4464. In some embodiments, the sense strand comprises or consists of SEQ ID NO: 240, SEQ ID NO: 820, SEQ ID NO: 1148, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 4446, or SEQ ID NO: 4463.

In certain embodiments of the invention, the RNAi construct comprises (i) any one nucleotide of SEQ ID NO: 5-1507, 3014-3664 or 4319-4512; a sense strand comprising a sequence selected from nucleotides 2-19 of SEQ ID NO: 1-19 or any one of SEQ ID NO: 5-1507, 3014-3664 or 4319-4512, and (ii) SEQ ID NO: 1508-3010, 3665-4315 or From nucleotides 1 to 19 of any one of SEQ ID NO: 1508 to 3010, 3665 to 4315 or 4513 to 4687 or nucleotides 2 to 19 of any one of SEQ ID NO: 1508 to 3010, 3665 to 4315 or 4513 to 4687 Contains an antisense strand containing the selected sequence. In some embodiments, the RNAi constructs include (i) SEQ ID NO: 103, SEQ ID NO: 181, SEQ ID NO: 205, SEQ ID NO: 211, SEQ ID NO: 240, SEQ ID NO: 251, SEQ ID NO: 378, SEQ ID NO: 394, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 988, SEQ ID NO: 1005, SEQ ID NO: 1050, SEQ ID NO: 1147, SEQ ID NO: 1148, SEQ ID NO: 443, SEQ ID NO: 499, SEQ ID NO: 1362, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 1370, SEQ ID NO: 1466, SEQ ID NO: 3050, SEQ ID NO: 3051, SEQ ID NO: 3065, SEQ ID NO: 3067, SEQ ID NO: 3071, SEQ ID NO: 4443, SEQ ID NO: 4444, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4455, SEQ ID NO: 4459, SEQ ID NO: 4463, or a sense strand comprising or consisting of a sequence selected from SEQ ID NO: 4464, and (ii) SEQ ID NO: 1606, SEQ ID NO: 1684, SEQ ID NO: 1708, SEQ ID NO: 1714, SEQ ID NO: 1743, SEQ ID NO: 1754, SEQ ID NO: 1881, SEQ ID NO: No. 1897, SEQ ID NO: 2321, SEQ ID NO: 2323, SEQ ID NO: 2491, SEQ ID NO: 2508, SEQ ID NO: 2553, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 1946, SEQ ID NO: 2002, SEQ ID NO: 2865, SEQ ID NO: 2867, SEQ ID NO: 2869 , SEQ ID NO: 2873, SEQ ID NO: 2969, SEQ ID NO: 3701, SEQ ID NO: 3702, SEQ ID NO: 3716, SEQ ID NO: 3718, SEQ ID NO: 3722, SEQ ID NO: 4618, SEQ ID NO: 4619, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4630, Sequence 4634, SEQ ID NO: 4638 or SEQ ID NO: 4639. In other embodiments, the RNAi construct comprises (i) a sense strand comprising or consisting of a sequence selected from No. 1370, SEQ ID No. 4443, SEQ ID No. 4446, SEQ ID No. 4452, SEQ ID No. 4463 or SEQ ID No. 4464, and (ii) SEQ ID No. 1684, SEQ ID No. 1708, SEQ ID No. 1714, SEQ ID NO: 1743, SEQ ID NO: 2323, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 4618, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4638 or SEQ ID NO: 4639 Includes an antisense strand comprising or consisting of the selected sequence. In yet other embodiments, the RNAi construct (i) comprises a sequence selected from SEQ ID NO: 240, SEQ ID NO: 820, SEQ ID NO: 1148, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 4446, or SEQ ID NO: 4463; or and (ii) an antisense strand comprising or consisting of a sequence selected from SEQ ID NO: 1743, SEQ ID NO: 2323, SEQ ID NO: 2651, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 4621 or SEQ ID NO: 4638. including.

In certain embodiments, the RNAi construct comprises (a) a sense strand comprising the sequence of SEQ ID NO: 181 and an antisense strand comprising the sequence of SEQ ID NO: 1684; (b) a sense strand comprising the sequence of SEQ ID NO: 205 and an antisense strand comprising the sequence of SEQ ID NO: 1684; (c) a sense strand containing the sequence SEQ ID NO: 211 and an antisense strand containing the sequence SEQ ID NO: 1714; (d) a sense strand containing the sequence SEQ ID NO: 240 and an antisense strand containing the sequence SEQ ID NO: 1743. (e) a sense strand comprising a sequence of SEQ ID NO: 820 and an antisense strand comprising a sequence of SEQ ID NO: 2323; (f) a sense strand comprising a sequence of SEQ ID NO: 1147 and a sequence of SEQ ID NO: 2650; (g) a sense strand comprising a sequence of SEQ ID NO: 1148 and an antisense strand comprising a sequence of SEQ ID NO: 2651; (h) a sense strand comprising a sequence of SEQ ID NO: 1364 and an antisense strand comprising a sequence of SEQ ID NO: 2867; a sense strand, (i) a sense strand comprising a sequence of SEQ ID NO: 1366 and an antisense strand comprising a sequence of SEQ ID NO: 2869; or (j) a sense strand comprising a sequence of SEQ ID NO: 1370 and an antisense strand comprising a sequence of SEQ ID NO: 2873. including.

The RNAi constructs of the invention can be any of the double-stranded compounds listed in Tables 1-10 (including chemical modifications of the nucleotide sequence and/or compound). In some embodiments, the RNAi construct is any of the duplex compounds listed in Table 1. In other embodiments, the RNAi construct is any of the duplex compounds listed in Table 6 (including chemical modifications of the nucleotide sequence and/or compound). In yet other embodiments, the RNAi construct is any of the duplex compounds listed in Table 8 (including chemical modifications of the nucleotide sequence and/or compound). In certain embodiments, the RNAi construct is D-1098, D-1176, D-1200, D-1206, D-1235, D-1246, D-1373, D-1389, D-1813, D-1815 , D-1983, D-2000, D-2045, D-2142, D-2143, D-1438, D-1494, D-2357, D-2359, D-2361, D-2365, D-2461, D -3036, D-3037, D-3051, D-3053, D-3057, D-3779, D-3780, D-3782, D-3788, D-3791, D-3795, D-3799 or D-3800 It is. In some embodiments, the RNAi construct is D-1200, D-1206, D-1235, D-1815, D-2143, D-2359, D-2361, D-2365, D-2142, D-1176 , D-3779, D-3782, D-3788, D-3799 or D-3800. In one particular embodiment, the RNAi construct is D-1235. In another specific embodiment, the RNAi construct is D-2143. In another embodiment, the RNAi construct is D-2361. In another embodiment, the RNAi construct is D-1815. In another embodiment, the RNAi construct is D-2359. In yet another embodiment, the RNAi construct is D-3782. In yet another embodiment, the RNAi construct is D-3799.

In certain embodiments, the antisense strand of the RNAi constructs of the invention may target specific regions of the ASGR1 mRNA sequence. For example, in some embodiments, the antisense strand of the RNAi constructs of the invention comprises nucleotides 692-721 of the human ASGR1 mRNA transcript set forth in SEQ ID NO:1, the human ASGR1 mRNA transcript set forth in SEQ ID NO:1 or nucleotides 692-710 of the human ASGR1 mRNA transcript set forth in SEQ ID NO: 1. In such embodiments, the RNAi construct may include a sense strand that is substantially or fully complementary to the antisense strand that targets this region. Thus, in these embodiments, the sense strand may include a sequence identical to nucleotides 692-721, nucleotides 692-716 or nucleotides 692-710 of SEQ ID NO:1.

In other embodiments, the antisense strand of the RNAi constructs of the invention comprises nucleotides 396-425 of the human ASGR1 mRNA transcript set forth in SEQ ID NO:1, nucleotides 396-425 of the human ASGR1 mRNA transcript set forth in SEQ ID NO:1. 420 or substantially complementary or completely complementary to nucleotides 396-414 of the human ASGR1 mRNA transcript set forth in SEQ ID NO:1. In such embodiments, the RNAi construct may include a sense strand that is substantially or completely complementary to the antisense strand that targets this region. Thus, in these embodiments, the sense strand may include a sequence identical to nucleotides 396-425, nucleotides 396-420 or nucleotides 396-414 of SEQ ID NO:1.

In yet other embodiments, the antisense strand of the RNAi constructs of the invention comprises nucleotides 886-915 of the human ASGR1 mRNA transcript set forth in SEQ ID NO:1, nucleotides 886-915 of the human ASGR1 mRNA transcript set forth in SEQ ID NO:1. 886-910 or a sequence that is substantially complementary or completely complementary to nucleotides 886-904 of the human ASGR1 mRNA transcript set forth in SEQ ID NO:1. In such embodiments, the RNAi construct may include a sense strand that is substantially or completely complementary to the antisense strand that targets this region. Thus, in these embodiments, the sense strand may include a sequence identical to nucleotides 886-915, nucleotides 886-910 or nucleotides 886-904 of SEQ ID NO: 1.

RNAi constructs of the invention may include one or more modified nucleotides. "Modified nucleotide" refers to a nucleotide having one or more chemical modifications to the nucleoside, nucleobase, pentose ring or phosphate group. As used herein, modified nucleotides include ribonucleotides containing adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate, as well as deoxyadenosine monophosphate, deoxyguanosine monophosphate, deoxy Does not include deoxyribonucleotides containing thymidine monophosphate and deoxycytidine monophosphate. However, RNAi constructs can include combinations of modified nucleotides, ribonucleotides and deoxyribonucleotides. Incorporation of modified nucleotides into one or both strands of a double-stranded RNA molecule can improve the in vivo stability of the RNA molecule, for example, by reducing the susceptibility of the molecule to nucleases and other degradation processes. The efficacy of RNAi constructs to reduce target gene expression can also be enhanced by the incorporation of modified nucleotides.

In certain embodiments, the modified nucleotide has a ribose sugar modification. Such sugar modifications can include modifications at the 2' and/or 5' positions of the pentose ring as well as bicyclic sugar modifications. 2'-modified nucleotide refers to a nucleotide having a pentose ring with a substituent other than H or OH at the 2' position. Such 2'-modifications include 2'-O-alkyl (e.g. O-C ₁ -C ₁₀ or O-C ₁ -C ₁₀ substituted alkyl), 2'-O-allyl (O-CH ₂ CH= CH ₂ ), 2'-C-allyl, 2'-fluoro, 2'-O-methyl (OCH ₃ ), 2'-O-methoxyethyl (O-(CH ₂ ) ₂ OCH ₃ ), 2'-OCF ₃ , 2'-O(CH ₂ ) ₂ SCH ₃ , 2'-O-aminoalkyl, 2'-amino (e.g. NH ₂ ), 2'-O-ethylamine and 2'-azide; Not limited. Modifications at the 5' position of the pentose ring include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy.

"Bicyclic sugar modification" refers to a modification of a pentose ring, where a bridge connects two atoms of the ring to form a second ring resulting in a bicyclic sugar structure. In some embodiments, the bicyclic sugar modification comprises a bridge between the 4' and 2' carbons of the pentose ring. Nucleotides containing sugar moieties with bicyclic sugar modifications are referred to herein as bicyclic nucleic acids or BNAs. Exemplary bicyclic sugar modifications include α-L-methyleneoxy (4'-CH ₂ -O-2') bicyclic nucleic acid (BNA); β-D-methyleneoxy (4'-CH 2 -O- ₂ ');-2') BNA (also called locked nucleic acid or LNA); ethyleneoxy (4'-(CH ₂ ) ₂ -O-2') BNA; aminooxy (4'-CH ₂ -O-N(R) -2') BNA; Oxyamino (4'-CH ₂ -N(R)-O-2') BNA; Methyl (methyleneoxy) (4'-CH(CH ₃ )-O-2') BNA (restricted ethyl (also called constrained ethyl or cEt); methylene-thio(4'-CH ₂ -S-2')BNA; methylene-amino (4'-CH2-N(R)-2')BNA; methyl carbocyclic (4'-CH ₂ -CH(CH ₃ )-2') BNA; propylene carbocyclic (4'-(CH ₂ ) ₃ -2') BNA; and methoxy (ethyleneoxy) (4'- CH( _CH2OMe )-O-2') BNA (also referred to as constrained MOE or cMOE). These and other sugar-modified nucleotides that can be incorporated into the RNAi constructs of the invention are described in U.S. Pat. , Vol. 19:937-954, 2012, all of which are incorporated herein by reference in their entirety.

In some embodiments, the RNAi construct comprises one or more of a 2'-fluoro modified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-O-allyl modified nucleotide, bicyclic nucleic acids (BNA) or combinations thereof. In certain embodiments, the RNAi construct comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, 2'-O-methoxyethyl modified nucleotides, or combinations thereof. In one particular embodiment, the RNAi construct comprises one or more 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or a combination thereof.

Both the sense and antisense strands of the RNAi construct can include one or more modified nucleotides. For example, in some embodiments, the sense strand includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In certain embodiments, all nucleotides in the sense strand are modified nucleotides. In some embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified nucleotides. In other embodiments, all nucleotides in the antisense strand are modified nucleotides. In certain other embodiments, all nucleotides in the sense strand and all nucleotides in the antisense strand are modified nucleotides. In these and other embodiments, the modified nucleotides can be 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, or combinations thereof.

In some embodiments, all pyrimidine nucleotides preceding the adenosine nucleotide in the sense strand, antisense strand, or both strands are modified nucleotides. For example, if the sequence 5'-CA-3' or 5'-UA-3' appears on either strand, the cytidine and uridine nucleotides are modified nucleotides, preferably 2'-O-methyl modified nucleotides. . In certain embodiments, all pyrimidine nucleotides in the sense strand are modified nucleotides (e.g., 2'-O-methyl modified nucleotides) and all pyrimidine nucleotides present in the antisense strand are 5'-CA-3' Alternatively, the 5' nucleotide of 5'-UA-3' is a modified nucleotide (eg, a 2'-O-methyl modified nucleotide). In other embodiments, all nucleotides in the duplex region are modified nucleotides. In such embodiments, the modified nucleotides are preferably 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides or combinations thereof.

In embodiments where the RNAi construct includes a nucleotide overhang, the nucleotides in the overhang can be ribonucleotides, deoxyribonucleotides or modified nucleotides. In one embodiment, the nucleotides in the overhang are deoxyribonucleotides, such as deoxythymidine. In another embodiment, the nucleotides in the overhang are modified nucleotides. For example, in some embodiments, the nucleotides in the overhang are 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides, or combinations thereof.

RNAi constructs of the invention may also include one or more modified internucleotide linkages. As used herein, the term "modified internucleotide linkage" refers to a linkage between nucleotides other than the naturally occurring 3'-5' phosphodiester linkage. In some embodiments, the modified internucleotide linkages include phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonates, 3'-alkylenephosphonates), phosphinates, phosphoramidates ( For example, 3'-aminophosphoramidates and aminoalkylphosphoramidates), phosphorothioates (P=S), chiral phosphorothioates, phosphorodithioates, thionophosphoramidates, thionoalkylphosphonates, thionoalkyl Phosphorus-containing internucleotide linkages such as phosphotriesters and boranophosphates. In one embodiment, the modified internucleotide linkage is a 2'-5' phosphodiester linkage. In other embodiments, the modified internucleotide linkage is a phosphorus-free internucleotide linkage and may therefore be referred to as a modified internucleoside linkage. Such non-phosphorus-containing bonds include morpholino bonds (some formed from sugar moieties of nucleosides); siloxane bonds (-O-Si(H) ₂ -O-); sulfide, sulfoxide, and sulfone bonds; formacetyl and thioformacetyl bonds; alkene-containing skeletons; sulfamate skeletons; methylenemethylimino (-CH ₂ -N(CH ₃ )-O-CH ₂ -) and methylenehydrazino bonds; sulfonate and sulfonamide bonds; amide bonds; and mixtures including, but not limited to, others having N, O, S and _CH2 component moieties. In one embodiment, the modified internucleoside linkage is as described in U.S. Pat. No. 5,539,082; U.S. Pat. No. 5,714,331; Peptide-based linkages (eg, aminoethylglycine) to generate peptide nucleic acids or PNAs, such as those in Other suitable modified internucleotide and internucleoside linkages that can be used in the RNAi constructs of the invention are described in U.S. Patent No. 6,693,187, U.S. Pat. Publication No. 2016/0122761 and Deleavey and Damha, Chemistry and
Biology, Vol. 19:937-954, 2012, all of which are incorporated herein by reference in their entirety.

In certain embodiments, the RNAi construct includes one or more phosphorothioate internucleotide linkages. Phosphorothioate internucleotide linkages may be present in the sense strand, antisense strand or both strands of the RNAi construct. For example, in some embodiments, the sense strand includes 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In other embodiments, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. In still other embodiments, both strands contain 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages. The RNAi construct can include one or more phosphorothioate internucleotide linkages at the 3' end, the 5' end, or both the 3' and 5' ends of the sense strand, antisense strand, or both strands. For example, in certain embodiments, the RNAi construct contains about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more consecutive phosphorothioate internucleotide bonds. In other embodiments, the RNAi construct contains about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, 6 or more) at the 5' end of the sense strand, antisense strand, or both strands. ) containing consecutive phosphorothioate internucleotide linkages. In one embodiment, the RNAi construct comprises a single phosphorothioate internucleotide linkage at the 3' end of the sense strand and a single phosphorothioate internucleotide linkage at the 3' end of the antisense strand. In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at the 3' end of the antisense strand (i.e., phosphorothioate nucleotides at the first and second internucleotide linkages at the 3' end of the antisense strand). inter-connections). In another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at both the 3' and 5' ends of the antisense strand. In yet another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at both the 3' and 5' ends of the antisense strand, and two consecutive phosphorothioate nucleotide linkages at the 5' end of the sense strand. Includes interlinks. In yet another embodiment, the RNAi construct comprises two consecutive phosphorothioate internucleotide linkages at both the 3' and 5' ends of the antisense strand, and at both the 3' and 5' ends of the sense strand. Contains two consecutive phosphorothioate internucleotide linkages (i.e., phosphorothioate internucleotide linkages at the first and second internucleotide linkages at the 5' and 3' ends of the antisense strand, and the 5' and 3' ends of the sense strand) phosphorothioate internucleotide linkages in the first and second internucleotide linkages). In any of the embodiments in which one or both strands contain one or more phosphorothioate internucleotide linkages, the remaining internucleotide linkages within the strands may be native 3'-5' phosphodiester linkages. For example, in some embodiments, each internucleotide linkage of the sense and antisense strands is selected from phosphodiester and phosphorothioate, and at least one internucleotide linkage is phosphorothioate.

In embodiments where the RNAi construct includes a nucleotide overhang, two or more of the unpaired nucleotides in the overhang can be joined by phosphorothioate internucleotide bonds. In certain embodiments, all unpaired nucleotides in the 3'-terminal nucleotide overhangs of the antisense and/or sense strands are joined by phosphorothioate internucleotide linkages. In other embodiments, all unpaired nucleotides in the 5'-terminal nucleotide overhangs of the antisense and/or sense strands are joined by phosphorothioate internucleotide linkages. In yet other embodiments, all unpaired nucleotides in any nucleotide overhang are joined by phosphorothioate internucleotide linkages.

In certain embodiments, the modified nucleotides that are incorporated into one or both strands of the RNAi constructs of the invention have nucleobase (also referred to herein as "base") modifications. "Modified nucleobase" or "modified base" means a base other than the naturally occurring purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Refers to bases. Modified nucleobases can be synthetic or naturally occurring modifications and include the universal bases 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine (X), hypoxanthine (I), 2-aminoadenine, 6-methyladenine, 6-methylguanine and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5 - Halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thio, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- Azaadenine can include, but is not limited to, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

In some embodiments, the modified base is a universal base. "Universal base" refers to a base analog that base pairs indiscriminately with all of the natural bases of RNA and DNA without altering the double helix structure of the resulting duplex region. Universal bases are known to those skilled in the art and include inosine, C-phenyl, C-naphthyl and other aromatic derivatives, azole carboxamides and 3-nitropyrrole, 4-nitroindole, 5-nitroindole and 6-nitroindole. including, but not limited to, nitroazole derivatives such as.

Other suitable modified bases that can be incorporated into the RNAi constructs of the invention are described by Herdewijn, Antisense Nucleic Acid Drug Dev. , Vol. 10:297-310, 2000 and Peacock et al. , J. Org. Chem. , Vol. 76:7295-7300, 2011, both of which are incorporated herein by reference in their entirety. Guanine, cytosine, adenine, thymine, and uracil can be substituted by other nucleobases, such as the modified nucleobases described above, without substantially altering the base-pairing properties of polynucleotides containing nucleotides with such substituted nucleobases. Those skilled in the art are well aware that this can be achieved.

In some embodiments, the sense and antisense strands of the RNAi construct may include one or more abasic nucleotides. An "abasic nucleotide" or "abasic nucleoside" is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the ribose sugar. In certain embodiments, abasic nucleotides are incorporated at the ends of the sense and/or antisense strands of the RNAi construct. In one embodiment, the sense strand includes an abasic nucleotide as a terminal nucleotide at its 3' end, its 5' end, or both its 3' and 5' ends. In another embodiment, the antisense strand comprises an abasic nucleotide as a terminal nucleotide at its 3' end, its 5' end, or both its 3' and 5' ends. In such embodiments where the abasic nucleotide is a terminal nucleotide, it connects to the adjacent nucleotide through a 3'-3' internucleotide bond (i.e., a reverse nucleotide) rather than a natural 3'-5' internucleotide bond. Can be combined.

In some embodiments of the RNAi constructs of the invention, the 5' ends of the sense strand, the antisense strand, or both the antisense and sense strands include a phosphate moiety. As used herein, the term "phosphate moiety" refers to a terminal phosphate group, including unmodified phosphates (-O-P=O)(OH)OH) and modified phosphates. Modified phosphates include phosphates in which one or more of the O and OH groups are substituted with H, O, S, N(R) or alkyl, where R is H, an amino protecting group or unsubstituted or substituted alkyl. Exemplary phosphate moieties include 5'-monophosphate; 5'-diphosphate; 5'-triphosphate; 5'-guanosine cap (7-methylated or unmethylated); 5'-adenosine cap or any other modified or unmodified nucleotide cap structure; 5'-monothiophosphate (phosphorothioate); 5'-monodithiophosphate (phosphorodithioate); 5'-α-thiotriphosphate; 5'-γ-thiotriphosphate; 5'-phosphoramidates; 5'-vinyl phosphates; 5'-alkyl phosphonates (e.g. alkyl methyl, ethyl, isopropyl, propyl, etc.); and 5'-alkyl ether phosphonates (e.g. alkyl ether methoxy); methyl, ethoxymethyl, etc.).

Modified nucleotides that can be incorporated into RNAi constructs of the invention can have two or more chemical modifications described herein. For example, a modified nucleotide can have a modification to the ribose sugar and a modification to the nucleobase. By way of example, modified nucleotides can include 2' sugar modifications (eg, 2'-fluoro or 2'-methyl) and can include modified bases (eg, 5-methylcytosine or pseudouracil). In other embodiments, the modified nucleotide has a sugar modification combined with a modification to the 5' phosphate that will produce a modified internucleotide or internucleoside linkage when the modified nucleotide is incorporated into a polynucleotide. may be included. For example, in some embodiments, modified nucleotides can include sugar modifications such as 2'-fluoro modifications, 2'-O-methyl modifications, or bicyclic sugar modifications and 5' phosphorothioate groups. Thus, in some embodiments, one or both strands of an RNAi construct of the invention comprises a combination of 2' modified nucleotides or BNA and phosphorothioate internucleotide linkages. In certain embodiments, both the sense and antisense strands of the RNAi constructs of the invention include a combination of 2'-fluoro modified nucleotides, 2'-O-methyl modified nucleotides, and phosphorothioate internucleotide linkages. Exemplary RNAi constructs containing modified nucleotides and internucleotide linkages are shown in Tables 6 and 8.

Preferably, the RNAi constructs of the invention reduce or inhibit ASGR1 expression within cells, particularly within liver cells. Accordingly, in one embodiment, the invention provides a method of reducing ASGR1 expression in a cell by contacting the cell with any of the RNAi constructs described herein. The cells can be in vitro or in vivo. ASGR1 expression can be assessed by measuring the amount or level of another biomarker associated with ASGR1 expression, such as serum levels of ASGR1 mRNA, ASGR1 protein, or alkaline phosphatase. A reduction in ASGR1 expression in cells or animals treated with an RNAi construct of the invention can be determined compared to ASGR1 expression in cells or animals that are not treated with an RNAi construct or treated with a control RNAi construct. . For example, in some embodiments, reducing ASGR1 expression is determined by (a) measuring the amount or level of ASGR1 mRNA in liver cells treated with an RNAi construct of the invention, (b) using a control RNAi construct (e.g. (c) measuring the amount or level of ASGR1 mRNA in liver cells treated with RNA molecules not expressed in liver cells or RNAi agents that are directed to RNAi constructs with nonsense or scrambled sequences) or without the construct; Assessed by comparing ASGR1 mRNA levels measured from treated cells in (a) with ASGR1 mRNA levels measured from control cells in (b). Prior to comparison, ASGR1 mRNA levels in treated and control cells can be normalized to RNA levels relative to a control gene (eg, 18S ribosomal RNA or housekeeping gene). ASGR1 mRNA levels were determined by various methods including Northern blot analysis, nuclease protection assay, fluorescence in situ hybridization (FISH), reverse transcriptase (RT)-PCR, real-time RT-PCR, quantitative PCR, droplet digital PCR, etc. can be measured.

In other embodiments, reducing ASGR1 expression is determined by (a) measuring the protein amount or level of ASGR1 in liver cells treated with an RNAi construct of the invention; (b) reducing ASGR1 expression in a control RNAi construct (e.g., liver cells (c) measuring the protein amount or level of ASGR1 in liver cells treated with an RNAi agent that is not expressed in an RNA molecule or an RNAi construct with a nonsense or scrambled sequence) or without the construct; and (c) Assessed by comparing the protein levels of ASGR1 measured from cells treated in (b) with the protein levels of ASGR1 measured from control cells in (b). Methods for measuring ASGR1 protein levels are known to those skilled in the art and include Western blots, immunoassays (eg, ELISA), and flow cytometry. Exemplary immunoassay-based methods for assessing protein expression of ASGR1 are described in Examples 2 and 7. Example 3 describes an exemplary method for measuring ASGR1 mRNA using RNA FISH, and Example 8 describes an exemplary method for assessing ASGR1 mRNA using droplet digital PCR. do. Any method that can measure ASGR1 mRNA or protein can be used to assess the effectiveness of the RNAi constructs of the invention.

In some embodiments, methods for assessing the expression level of ASGR1 are performed in vitro in cells that naturally express ASGR1 (eg, liver cells) or that have been engineered to express ASGR1. In certain embodiments, these methods are performed in vitro in liver cells. Suitable liver cells include primary hepatocytes (e.g., human, non-human primate or rodent hepatocytes), HepAD38 cells, HuH-6 cells, HuH-7 cells, HuH-5-2 cells, BNLCL2 cells, Including, but not limited to, Hep3B cells or HepG2 cells. In one embodiment, the liver cells are Hep3B cells. In another embodiment, the liver cells are human primary hepatocytes.

In other embodiments, the method for assessing the expression level of ASGR1 is performed in vivo. The RNAi construct and any control RNAi construct can be administered to an animal (e.g., a rodent or non-human primate) and ASGR1 mRNA or protein levels assessed in liver tissue taken from the animal after treatment. I can do it. Alternatively or in addition, biomarkers or functional phenotypes associated with ASGR1 expression can be assessed in treated animals. For example, elevated serum alkaline phosphatase levels correlate with reduced serum levels of non-HDL cholesterol in individuals with loss-of-function mutations in the ASGR1 gene (Nioi et al., New England Journal of Medicine, Vol. 374(22): 2131-2141, 2016, incorporated herein by reference in its entirety). Accordingly, serum levels of alkaline phosphatase or non-HDL cholesterol can be measured in animals treated with RNAi constructs of the invention to assess the functional effectiveness of reducing ASGR1 expression. Exemplary methods for these analyzes are described in Examples 6, 9, and 10.

In certain embodiments, expression of ASGR1 is increased by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, in liver cells by the RNAi constructs of the invention. Reduce by at least 45% or at least 50%. In some embodiments, ASGR1 expression is reduced by at least 60%, at least 65%, at least 70%, at least 75%, at least 80% or at least 85% in liver cells by the RNAi constructs of the invention. In other embodiments, expression of ASGR1 is reduced by about 90% or more, such as about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, in liver cells by the RNAi constructs of the invention. , about 97%, about 98%, about 99% or more. Percent reduction in ASGR1 expression can be measured by any of the methods described herein and other methods known in the art. For example, in certain embodiments, the RNAi constructs of the invention inhibit at least 45% of ASGR1 expression at 5 nM in Hep3B cells in vitro. In related embodiments, the RNAi constructs of the invention inhibit at least 50%, at least 55%, at least 60%, at least 65%, at least 70% or at least 75% of ASGR1 expression at 5 nM in Hep3B cells in vitro. In other embodiments, the RNAi constructs of the invention provide at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96% or at least 98% of ASGR1 expression at 5 nM in Hep3B cells in vitro. inhibit.

In some embodiments, IC50 values are calculated to assess the efficacy of RNAi constructs of the invention for inhibiting ASGR1 expression in liver cells. An "IC50 value" is the dose/concentration required to achieve 50% inhibition of a biological or biochemical function. The IC50 value for any particular substance or antagonist can be determined by constructing a dose-response curve and testing the effect of different concentrations of the substance or antagonist on expression levels or functional activity in any assay. An IC50 value can be calculated for a given antagonist or substance by determining the concentration required to inhibit half the maximal biological response or original expression level. Therefore, in any of the assays described in the Examples, such as immunoassays, RNA FISH assays, qPCR or droplet digital PCR, half of the native ASGR1 expression level in liver cells (e.g., ASGR1 expression level in control liver cells) is An IC50 value can be calculated for any RNAi construct by determining the concentration of RNAi construct required for inhibition. RNAi constructs of the invention can inhibit ASGR1 expression in liver cells (eg, Hep3B cells) with an IC50 of less than about 10 nM, less than about 5 nM, or less than about 1 nM. For example, the RNAi construct can be about 0.5 nM to about 10 nM, about 0.8 nM to about 8 nM, about 1 nM to about 5 nM, about 0.8 nM to about 3 nM, about 0.001 nM to about 1 nM, about 0.001 nM to about 0.50nM, about 0.001nM to about 0.1nM, about 0.001nM to about 0.01nM, about 0.01nM to about 0.50nM, about 0.02nM to about 0.80nM, about 0.01nM to about Inhibits ASGR1 expression in liver cells with an IC50 of 1.0 nM, about 0.1 nM to about 0.9 nM, or about 0.05 nM to about 0.5 nM. In certain embodiments, the RNAi construct inhibits ASGR1 expression in liver cells (eg, Hep3B cells) with an IC50 of about 0.5 nM to about 5 nM. In other embodiments, the RNAi construct inhibits ASGR1 expression in liver cells (eg, Hep3B cells) with an IC50 of about 0.01 nM to about 0.9 nM.

RNAi constructs of the invention can be readily made using techniques known in the art, such as conventional solid phase nucleic acid synthesis. Polynucleotides of RNAi constructs can be assembled on a suitable nucleic acid synthesizer utilizing standard nucleotide or nucleoside precursors (eg, phosphoramidites). Automated nucleic acid synthesizers include Applied Biosystems (Foster City, CA) DNA/RNA synthesizers, BioAutomation (Irving, TX) MerMade synthesizers, and GE Healthcare Life Sciences (Pittsburgh) DNA/RNA synthesizers. Several devices, including the OligoPilot synthesizer from GH, PA) commercially available from vendors.

Oligonucleotides can be synthesized via phosphoramidite chemistry using a 2' silyl protecting group with acid-labile dimethoxytrityl (DMT) at the 5' position of the ribonucleoside. The final deprotection conditions are known not to significantly degrade the RNA product. All syntheses can be performed in any automated or manual synthesis equipment on a large, medium or small scale. Synthesis can also be performed in multi-well plates, columns or glass slides.

The 2'-O-silyl group can be removed via exposure to fluoride ions, which can be removed from any source of fluoride ions, such as fluoride ions paired with an inorganic counterion. containing salts, such as cesium fluoride and potassium fluoride, or salts containing fluoride ions paired with organic counterions, such as tetraalkylammonium fluoride. Crown ether catalysts can be utilized in combination with inorganic fluorides in deprotection reactions. Preferred fluoride ion sources are tetrabutylammonium fluoride or amine hydrofluoride (eg triethylamine combined with aqueous HF in a dipolar aprotic solvent such as dimethylformamide).

The choice of protecting groups for use on phosphite triesters and phosphotriesters can vary the stability of the triesters toward fluoride. Methyl protection of phosphotriesters or phosphite triesters can stabilize binding to fluoride ions and improve process yield.

Ribonucleosides have a reactive 2' hydroxyl substituent, thus protecting the reactive 2' position in RNA from protecting groups that are orthogonal to the 5'-O-dimethoxytrityl protecting group, such as acid treatment. It may be desirable to protect the material with something that is stable and stable. The silyl protecting group can be easily removed in a final fluoride deprotection step that satisfies this condition and can result in minimal RNA degradation.

Tetrazole catalysts can be used in standard phosphoramidite coupling reactions. Preferred catalysts include, for example, tetrazole, S-ethyl-tetrazole, benzylthiotetrazole, p-nitrophenyltetrazole.

Additional methods of synthesizing the RNAi constructs described herein will be apparent to those skilled in the art, as can be appreciated by those skilled in the art. Additionally, the various synthetic steps can be performed in alternative orders or orders to yield the desired compounds. Other synthetic chemical transformations, protecting groups (e.g., for hydroxyl, amino, etc. present in the base) and protecting group techniques (protection and deprotection) useful in the synthesis of the RNAi constructs described herein are of interest. Known in the technical field, for example R. T. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2d. Ed. , John Wiley and Sons (1991); Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed. , Encyclopedia of Reagents
for Organic Synthesis, John Wiley and Sons (1995) and subsequent editions thereof. Custom synthesis of RNAi agents is also available from Dharmacon, Inc. (Lafayette, CO), AxoLabs GmbH (Kulmbach, Germany) and Ambion, Inc. (Foster City, Calif.) from several commercial vendors.

RNAi constructs of the invention may include a ligand. As used herein, "ligand" refers to any compound or molecule that can interact directly or indirectly with another compound or molecule. The interaction of a ligand with another compound or molecule may elicit a biological response (e.g., trigger a signal transduction cascade, induce receptor-mediated endocytosis), or the mere physical association It can be. The ligand can modify one or more properties of the double-stranded RNA molecule to which it binds, such as the pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge, and/or clearance properties of the RNA molecule. .

Ligands include serum proteins (e.g., human serum albumin, low-density lipoproteins, globulins), cholesterol moieties, vitamins (biotin, vitamin E, vitamin _B12 ), folic acid moieties, steroids, bile acids (e.g., cholic acid), fatty acids. (e.g. palmitic acid, myristic acid), carbohydrates (e.g. dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid), glycosides, phospholipids or antibodies or binding fragments thereof (e.g. specific cells such as the liver). (antibodies or binding fragments targeting RNAi constructs). Other examples of ligands are dyes, intercalating agents (e.g. acridine), cross-linkers (e.g. psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphirin), polycyclic aromatic hydrocarbons (e.g. phenazine, dihydrophenazine). ), artificial endonucleases (e.g. EDTA), lipophilic molecules such as adamantane acetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine), peptides (e.g. antennapedia peptide, Tat peptide, RGD peptide) ), alkylating agents, polymers such as polyethylene glycol (PEG) (eg, PEG-40K), polyamino acids and polyamines (eg, spermine, spermidine).

In certain embodiments, the ligand has endosome-destabilizing properties. Endosome-destabilizing ligands promote endosomal lysis and/or transport of the RNAi constructs of the invention or components thereof from the endosomes and into the cytoplasm of the cell. Endosome-destabilizing ligands can be polycationic peptides or peptidomimetics that exhibit pH-dependent membrane activity and fusogenic properties. In one embodiment, the endosome-destabilizing ligand assumes its active conformation at endosomal pH. An "active" conformation is one in which the endosome-destabilizing ligand promotes lysis of the endosome and/or transport of the RNAi construct of the invention or its components from the endosome to the cytoplasm of the cell. Exemplary endosome-destabilizing ligands include the GALA peptide (Subbarao et al., Biochemistry, Vol. 26:2964-2972, 1987), the EALA peptide (Vogel et al., J. Am. Chem. Soc., Vol. 118:1581-1586, 1996) and their derivatives (Turk et al., Biochem. Biophys. Acta, Vol. 1559:56-68, 2002). In one embodiment, the endosome destabilizing component may contain a chemical group (eg, an amino acid) that will undergo a change in charge or protonation in response to a change in pH. Endosome destabilizing components can be linear or branched.

In some embodiments, the ligand includes a lipid or other hydrophobic molecule. In one embodiment, the ligand includes a cholesterol moiety or other steroid. Cholesterol conjugated oligonucleotides are reported to be more active than their unconjugated counterparts (Manoharan, Antisense Nucleic Acid Drug Development, Vol. 12:103-228, 2002). Ligands containing cholesterol moieties and other lipids for conjugation to nucleic acid molecules are described in US Pat. No. 7,851,615; US Pat. No. 7,745,608; and US Pat. No. 7,833; No. 992, all of which are incorporated herein by reference in their entirety. In another embodiment, the ligand includes a folate moiety. Polynucleotides conjugated with folate moieties can be taken up into cells via receptor-mediated endocytic pathways. Such folic acid-polynucleotide conjugates are described in US Pat. No. 8,188,247, which is incorporated herein by reference in its entirety.

Given that ASGR1 is expressed on the surface of liver cells (e.g., hepatocytes) as a component of the asialoglycoprotein receptor (ASGR), in certain embodiments, RNAi constructs may be directed specifically to liver cells. It is desirable to deliver to Thus, in certain embodiments, the ligand targets specific delivery of the RNAi construct to liver cells (eg, hepatocytes) using various means as described in more detail below. In certain embodiments, the RNAi construct is targeted to liver cells with a ligand that binds to surface expressed ASGR, ASGR1 and/or ASGR2. In these embodiments, ASGR1 expression is reduced due to the effects of the previously delivered RNAi construct, so this targeting means reduces the amount of RNAi construct delivered to the liver cells. It is envisioned that a regulatory system can be provided.

In some embodiments, RNAi constructs can be specifically targeted to the liver by employing a ligand that binds or interacts with proteins expressed on the surface of liver cells. For example, in certain embodiments, the ligand is an antigen-binding protein (e.g., an antibody or binding fragment thereof) that specifically binds to a receptor expressed in hepatocytes, such as the asialoglycoprotein receptor and the LDL receptor , Fab, scFv)). In one particular embodiment, the ligand comprises an antibody or binding fragment thereof that specifically binds ASGR1 and/or ASGR2. In another embodiment, the ligand comprises a Fab fragment of an antibody that specifically binds ASGR1 and/or ASGR2. A "Fab fragment" is composed of one immunoglobulin light chain (ie, light chain variable region (VL) and constant region (CL)) and one immunoglobulin heavy chain CH1 region and variable region (VH). In another embodiment, the ligand comprises a single chain variable antibody fragment (scFv fragment) of an antibody that specifically binds ASGR1 and/or ASGR2. A "scFv fragment" comprises the VH and VL regions of an antibody, which regions are present in a single polypeptide chain and, if necessary, allow the Fv to form the desired structure for antigen binding. It contains a peptide linker between the VH and VL regions that allows for. Exemplary antibodies and binding fragments thereof that specifically bind ASGR1 that can be used as ligands to target the RNAi constructs of the invention to the liver are described in U.S. Patent Application No. 62/234,546. and WO 2017/058944, both of which are incorporated herein by reference in their entirety. Other antibodies or binding fragments thereof that specifically bind to ASGR1, the LDL receptor, or other liver surface expressed proteins that are suitable for use as ligands in the RNAi constructs of the invention are commercially available. .

In some embodiments, the ligand comprises a cys monoclonal antibody (mAb) or antigen-binding fragment thereof. "cys mAb" means a monoclonal antibody or its antigen in which at least one amino acid in the light or heavy chain is substituted with a cysteine amino acid or at least one cysteine amino acid is inserted into the primary sequence of the light or heavy chain. It is a combined fragment. The free thiol group in the side chain of the cysteine amino acid provides a conjugation site to which the sense strand of the RNAi constructs of the invention can be covalently attached. Cysteine substitutions/additions can be present at the amino or carboxy terminus of the light or heavy chain of the antibody or antigen binding fragment. Alternatively or in addition, cysteine substitutions/additions may occur internally in the light or heavy chain, as long as the cysteine substitutions/additions do not affect the binding affinity of the antibody or antigen-binding fragment to its target (e.g., ASGR1). It can be located at the site of Exemplary amino acids within heavy and light chains of antibodies that may be substituted with cysteine residues are described in WO 2006/034488 and WO 2007/022070, both of which is incorporated herein by reference in its entirety. In certain embodiments, the ligand comprises a cys mAb or antigen-binding fragment thereof that specifically binds human ASGR1. Exemplary anti-ASGR1 cys mAbs are described in Example 10. In one embodiment, the ligand comprises an anti-ASGR1 antibody having a heavy chain and a light chain, the heavy chain comprising the sequence of SEQ ID NO: 4696, and the light chain comprising the sequence of SEQ ID NO: 4697. The anti-ASGR1 cys mAb or antigen-binding fragment thereof is covalently linked to the 5' or 3' end of the sense strand of the RNAi constructs of the invention, optionally via any of the linkers described herein. can be done. In some embodiments, the anti-ASGR1 antibody-RNA molecule conjugate comprises one copy of an interfering RNA molecule (eg, siRNA or shRNA) (ie, the RNAi to antibody ratio is 1). In other embodiments, the anti-ASGR1 antibody-RNA molecule conjugate comprises two copies of an interfering RNA molecule (eg, siRNA or shRNA) (ie, the RNAi to antibody ratio is 2).

In certain embodiments, the ligand includes a carbohydrate. A "carbohydrate" is composed of one or more monosaccharide units having at least 6 carbon atoms (which may be chained, branched or cyclic) with an oxygen, nitrogen or sulfur atom attached to each carbon atom. Refers to compounds that Carbohydrates include sugars (e.g. monosaccharides, di-saccharides, trisaccharides, tetrasaccharides and oligosaccharides containing about 4, 5, 6, 7, 8 or 9 monosaccharide units) as well as starches, glycogen, cellulose and polysaccharides. including, but not limited to, polysaccharides such as sugar gums. In some embodiments, the carbohydrate incorporated into the ligand is a monosaccharide selected from a pentose, hexose or heptose, as well as di- and trisaccharides containing such monosaccharide units. In other embodiments, the carbohydrate incorporated into the ligand is an amino sugar such as galactosamine, glucosamine, N-acetylgalactosamine, and N-acetylglucosamine.

In some embodiments, the ligand includes a hexose or hexosamine. Hexoses may be selected from glucose, galactose, mannose, fucose or fructose. Hexosamine may be selected from fructosamine, galactosamine, glucosamine or mannosamine. In certain embodiments, the ligand comprises glucose, galactose, galactosamine or glucosamine. In one embodiment, the ligand comprises glucose, glucosamine or N-acetylglucosamine. In another embodiment, the ligand comprises galactose, galactosamine or N-acetyl-galactosamine. In certain embodiments, the ligand comprises N-acetyl-galactosamine. Ligands containing glucose, galactose, and N-acetyl-galactosamine (GalNAc) are particularly effective in targeting compounds to liver cells because such ligands bind ASGR expressed on the surface of liver cells. . For example, D'Souza and Devarajan, J. Control Release, Vol. 203:126-139, 2015. Examples of GalNAc or galactose-containing ligands that can be incorporated into RNAi constructs of the invention are described in U.S. Pat. No. 7,491,805; U.S. Pat. No. 8,106,022; US Patent Application Publication No. 20030130186; and WO 2013166155, all of which are incorporated herein by reference in their entirety.

In certain embodiments, the ligand includes a polyvalent carbohydrate moiety. As used herein, "polyvalent carbohydrate moiety" refers to a moiety that includes two or more carbohydrate units that can independently bind or interact with other molecules. For example, a polyvalent carbohydrate moiety includes two or more binding domains comprised of carbohydrates that can bind to two or more different molecules or to two or more different sites on the same molecule. The valence of a carbohydrate moiety refers to the number of individual binding domains within the carbohydrate moiety. For example, the terms "monovalent," "bivalent," "trivalent," and "tetravalent" with respect to carbohydrate moieties refer to carbohydrate moieties having 1, 2, 3, and 4 binding domains, respectively. Polyvalent carbohydrate moieties include polyvalent lactose moieties, polyvalent galactose moieties, polyvalent glucose moieties, polyvalent N-acetyl-galactosamine moieties, polyvalent N-acetyl-glucosamine moieties, polyvalent mannose moieties or polyvalent fucose moieties. obtain. In some embodiments, the ligand includes a multivalent galactose moiety. In other embodiments, the ligand includes a multivalent N-acetyl-galactosamine moiety. In these and other embodiments, the polyvalent carbohydrate moiety is divalent, trivalent or tetravalent. In such embodiments, the polyvalent carbohydrate moiety can be diantennary or triantennary. In one particular embodiment, the multivalent N-acetyl-galactosamine moiety is trivalent or tetravalent. In another specific embodiment, the polyvalent galactose moiety is trivalent or tetravalent. Exemplary trivalent or tetravalent GalNAc-containing ligands for incorporation into the RNAi constructs of the invention are detailed below.

A ligand can be attached or conjugated directly or indirectly to an RNA molecule of an RNAi construct. For example, in some embodiments, the ligand is directly covalently attached to the sense or antisense strand of the RNAi construct. In other embodiments, the ligand is covalently attached to the sense or antisense strand of the RNAi construct via a linker. A ligand can be attached to a nucleobase, sugar moiety, or internucleotide linkage of a polynucleotide (eg, sense or antisense strand) of an RNAi construct of the invention. Conjugation or attachment to the purine nucleobase or derivative thereof can occur at any position, including endocyclic and exocyclic atoms. In certain embodiments, positions 2, 6, 7, or 8 of the purine nucleobase are attached to the ligand. Conjugation or attachment to a pyrimidine nucleobase or derivative thereof can also occur at any position. In some embodiments, positions 2, 5, and 6 of the pyrimidine nucleobase may be attached to a ligand. Conjugation or attachment of the nucleotide to the sugar moiety can occur at any carbon atom. Exemplary carbon atoms of sugar moieties that can be attached to a ligand include 2', 3' and 5' carbon atoms. The 1' position can also be attached to a ligand, such as at an abasic residue. Internucleotide bonds also facilitate ligand binding. For phosphorus-containing bonds (eg, phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, etc.), the ligand can be attached directly to the phosphorus atom or to the O, N or S atom attached to the phosphorus atom. For amine- or amide-containing internucleoside linkages (eg, PNA), the ligand can be attached to the nitrogen atom or adjacent carbon atom of the amine or amide.

In certain embodiments, a ligand may be attached to the 3' or 5' end of either the sense or antisense strand. In certain embodiments, the ligand is covalently attached to the 5' end of the sense strand. In other embodiments, the ligand is covalently attached to the 3' end of the sense strand. For example, in some embodiments, the ligand is attached to the 3' terminal nucleotide of the sense strand. In certain such embodiments, the ligand is attached at the 3' position of the 3' terminal nucleotide of the sense strand. In alternative embodiments, the ligand is attached near the 3' end of the sense strand, but before one or more terminal nucleotides (ie, before 1, 2, 3 or 4 terminal nucleotides). In some embodiments, the ligand is attached at the 2' position of the sugar of the 3' terminal nucleotide of the sense strand.

In certain embodiments, the ligand is attached to the sense or antisense strand via a linker. A "linker" is an atom or group of atoms that covalently attaches a ligand to the polynucleotide component of an RNAi construct. The linker has a length of about 1 to about 30 atoms, about 2 to about 28 atoms, about 3 to about 26 atoms, about 4 to about 24 atoms, about 6 to about 20 atoms, about 7 atoms. and about 20 atoms in length, about 8 to about 20 atoms in length, about 8 to about 18 atoms in length, about 10 to about 18 atoms in length, and about 12 to about 18 atoms in length. In some embodiments, the linker may include a bifunctional linking moiety, typically comprising an alkyl moiety with two functional groups. One of the functional groups is selected to bind to a compound of interest (e.g., the sense or antisense strand of an RNAi construct), and the other is selected to bind any selected compound, such as a ligand as described herein. Basically, it binds to a given group. In certain embodiments, the linker comprises a chain structure or oligomer of repeating units, such as ethylene glycol or amino acid units. Examples of functional groups commonly employed in bifunctional binding moieties include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, bifunctional binding moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturation (eg, double or triple bond), and the like.

Linkers that can be used to attach a ligand to the sense or antisense strand in the RNAi constructs of the invention include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane. -1-carboxylate, 6-aminohexanoic acid, substituted C ₁ -C ₁₀ alkyl, substituted or unsubstituted C ₂ -C ₁₀ alkenyl or substituted or unsubstituted C ₂ -C ₁₀ alkynyl. Preferred substituents for such linkers include, but are not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

In certain embodiments, the linker is cleavable. A cleavable linker is one that is sufficiently stable outside the cell, but is cleaved after entry into the target cell, releasing the two parts it holds together. In some embodiments, the cleavable linker is present in the target cell or in the subject's blood under a first reference condition (e.g., which may be selected to mimic or correspond to intracellular conditions). or at least 10 times, 20 times, 30 times, 40 times, 50 times less than under a second reference condition (which may be selected to mimic or correspond to, for example, conditions found in blood or serum); Cuts 60 times, 70 times, 80 times or more than 90 times or at least 100 times faster.

Cleavable linkers are sensitive to cleavage agents such as pH, redox potential or the presence of degradable molecules. Generally, cleaving agents are found predominant or at higher levels or activity inside cells than in serum or blood. Examples of such degradable agents include, for example, certain oxidizing or reducting enzymes or reducing agents, such as mercaptans, which are present within the cell and are capable of degrading redox-cleavable linkers by reduction. redox agents selected for the substrate or without substrate specificity; esterases; endosomes or agents capable of creating an acidic environment, e.g. those that result in a pH below 5; general acids, peptidases (substrate specific ) and enzymes that can hydrolyze or degrade acid-cleavable linkers by acting as phosphatases.

The cleavable linker can include a pH-sensitive portion. The pH of human serum is 7.4, but the average intracellular pH is slightly lower, ranging from about 7.1 to 7.3. Endosomes have a more acidic pH ranging from 5.5 to 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers have cleavable groups that are cleaved at a preferred pH, thereby releasing the RNA molecule from the ligand into the interior of the cell or desired compartment of the cell.

The linker can include a cleavable group that is cleavable by a particular enzyme. The type of cleavable group incorporated into the linker may depend on the cells targeted. For example, a liver targeting ligand can be attached to an RNA molecule via a linker that includes an ester group. Liver cells are rich in esterases, so the linker will be cleaved more efficiently in liver cells than in cell types that are not rich in esterases. Other cell types rich in esterases include the lungs, renal cortex and testis. Linkers containing peptide bonds can be used when targeting peptidase-rich cells such as liver cells and synovial cells.

Generally, the suitability of a candidate cleavable linker can be assessed by testing the ability of a degradable agent (or condition) to cleave the candidate linker. It may also be desirable to test candidate cleavable linkers for their ability to resist cleavage when in contact with blood or other non-target tissues. Therefore, there is a difference between a first condition selected to indicate cleavage in the target cell and a second condition selected to indicate cleavage in other tissues or biological fluids, such as blood or serum. susceptibility can be determined. Evaluations can be performed in cell-free systems, cells, cell cultures, organ or tissue cultures or whole animals. It may be useful to perform initial evaluation in cell-free or culture conditions and confirm by further evaluation in whole animals. In some embodiments, useful linker candidates are selected to mimic intracellular conditions in cells (or in vitro conditions selected to mimic extracellular conditions) as compared to blood or serum (or in vitro conditions selected to mimic extracellular conditions). cleaved at least 2 times, 4 times, 10 times, 20 times, 50 times, 70 times or 100 times faster under (in vitro conditions).

In other embodiments, redox-cleavable linkers are utilized. A redox-cleavable linker is cleaved upon reduction or oxidation. An example of a reductively cleavable group is a disulfide linking group (-SS-). To determine whether a cleavable linker candidate is a suitable "reductively cleavable linker" or is suitable for use with a particular RNAi construct and a particular ligand, for example, One or more methods described herein can be used. Evaluating linker candidates, for example, by incubation with dithiothreitol (DTT) or other reducing agents known in the art that mimic cleavage rates that would be observed in cells, such as target cells. I can do it. Linker candidates can also be evaluated under conditions selected to mimic blood or serum conditions. In certain embodiments, the linker candidate is cleaved up to 10% in blood. In other embodiments, useful linker candidates include cells (or in vitro conditions selected to mimic intracellular conditions) compared to blood (or in vitro conditions selected to mimic extracellular conditions). lower) at least 2 times, 4 times, 10 times, 20 times, 50 times, 70 times or 100 times faster.

In yet other embodiments, a phosphate-based cleavable linker candidate is cleaved by an agent that degrades or hydrolyzes the phosphate group. An example of an agent that hydrolyzes phosphate groups within a cell is an enzyme such as an intracellular phosphatase. Examples of phosphate-based cleavable groups are -O-P(O)(ORk)-O-, -O-P(S)(ORk)-O-, -O-P(S)(SRk)- O-, -S-P(O)(ORk)-O-, -O-P(O)(ORk)-S-, -S-P(O)(ORk)-S-, -O-P( S)(ORk)-S-, -S-P(S)(ORk)-O-, -O-P(O)(Rk)-O-, -O-P(S)(Rk)-O- , -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S- and -OP(S) (Rk)-S-, where Rk can be hydrogen or alkyl. Certain embodiments include -O-P(O)(OH)-O-, -O-P(S)(OH)-O-, -O-P(S)(SH)-O-, -S -P(O)(OH)-O-, -O-P(O)(OH)-S-, -S-P(O)(OH)-S-, -O-P(S)(OH) -S-, -S-P(S)(OH)-O-, -O-P(O)(H)-O-, -O-P(S)(H)-O-, -S-P (O)(H)-O-, -S-P(S)(H)-O-, -S-P(O)(H)-S- and -O-P(S)(H)-S -including. Another specific embodiment is -OP(O)(OH)-O-. These linker candidates can be evaluated using methods similar to those described above.

In other embodiments, the linker may include an acid-cleavable group, a group that is cleaved under acidic conditions. In some embodiments, the acid-cleavable group acts in an acidic environment at a pH of about 6.5 or less (e.g., about 6.0, 5.5, 5.0 or less) or as a general acid. cleaved by agents such as enzymes that can Within cells, certain low pH organelles such as endosomes and lysosomes can provide a cleavage environment for acid-cleavable groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and esters of amino acids. Acid-cleavable groups can have the general formula -C=NN-, C(O)O or -OC(O). A particular embodiment is when the carbon attached to the oxygen (alkoxy group) of the ester is an aryl group, a substituted alkyl group or a tertiary alkyl group such as dimethyl, pentyl or t-butyl. These candidates can be evaluated using methods similar to those described above.

In other embodiments, the linker may include an ester-based cleavable group that is cleaved by enzymes such as esterases and amidases in the cell. Examples of ester-based cleavable groups include, but are not limited to, alkylene, alkenylene, and esters of alkynylene groups. Ester cleavable groups have the general formula -C(O)O- or -OC(O)-. These linker candidates can be evaluated using methods similar to those described above.

In further embodiments, the linker may include a peptidic cleavable group that is cleaved by enzymes such as peptidases and proteases in the cell. Peptide-based cleavable groups are peptide bonds formed between amino acids to yield oligopeptides (eg, dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable group does not contain an amide group (-C(O)NH-). An amide group can be formed between any alkylene, alkenylene or alkynylene. Peptide bonds are a special type of amide bond that is formed between amino acids to produce peptides and proteins. Peptide-based cleavage groups are generally limited to peptide bonds (ie, amide bonds) that are formed between amino acids to yield peptides and proteins, and do not include the entire amide functionality. The peptide-based cleavable linking group has the general formula -NHCHR ^A C(O)NHCHHR ^B C(O)-, where R ^A and R ^B are the side chains of two adjacent amino acids. . These candidates can be evaluated using methods similar to those described above.

Exemplary linkers that can be employed to attach a ligand, particularly a ligand containing a GalNAc moiety, to the sense strand in the RNAi constructs of the invention are shown in Formulas AK below.

In one embodiment, the linker for attaching a ligand to the 3' end of the sense strand in the RNAi constructs of the invention has the structure of formula A below, where n is 1 or 2, and R is the ligand (eg, a moiety containing 3-4 GalNAc units), and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In another embodiment, the linker for attaching a ligand to the 3' end of the sense strand in the RNAi constructs of the invention has the structure of formula B below, where n is 1, 2 or 3. , R is the ligand (eg, a moiety containing 3-4 GalNAc units), and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In yet another embodiment, a linker for attaching a ligand to the 3' end of the sense strand in an RNAi construct of the invention has the structure of formula C: where n is 1 or 2; , R is a ligand (e.g., a moiety containing 3-4 GalNAc units), R' is the 3' end of the sense strand of the double-stranded RNA molecule, and R'' is H, Alkyl, functional alkyl.

In certain embodiments, a linker for attaching a ligand to the 3' end of the sense strand in an RNAi construct of the invention has the structure of Formula D below, where R is the ligand (e.g., 3 ~4 GalNAc units) and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In certain other embodiments, a linker for attaching a ligand to the 3' end of the sense strand in an RNAi construct of the invention has the structure of Formula E below, where R is the ligand (e.g. , 3-4 GalNAc units), and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In some embodiments, a linker for attaching a ligand to the 3' end of the sense strand in an RNAi construct of the invention has the structure of Formula F below, where R is the ligand (e.g., 3 ~4 GalNAc units) and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In other embodiments, a linker for attaching a ligand to the 3' end of the sense strand in an RNAi construct of the invention has the structure of Formula G below, where R is the ligand (e.g., 3- (a portion containing four GalNAc units) and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In certain other embodiments, the linker for attaching a ligand to the 3' end of the sense strand in the RNAi constructs of the invention has the structure of formula H below, where R is the ligand (e.g. , 3-4 GalNAc units), and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In some embodiments, a linker for attaching a ligand to the 3' end of the sense strand in an RNAi construct of the invention has the structure of Formula J below, where R is the ligand (e.g., 3 ~4 GalNAc units) and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

In other embodiments, a linker for attaching a ligand to the 3' end of the sense strand in an RNAi construct of the invention has the structure of Formula K below, where R is the ligand (e.g., 3- (a portion containing four GalNAc units) and R' is the 3' end of the sense strand of the double-stranded RNA molecule.

Other types of linkers suitable for attaching ligands to the sense or antisense strands in the RNAi constructs of the invention are known in the art and are described in U.S. Pat. No. 7,723,509; 8,017,762; 8,828,956; 8,877,917; and 9,181,551. , all of which are incorporated herein by reference in their entirety.

In certain embodiments, the ligand covalently attached to the sense or antisense strand of the RNAi constructs of the invention comprises a GalNAc moiety, eg, a multivalent GalNAc moiety. In some embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 3' end of the sense strand. In other embodiments, the multivalent GalNAc moiety is a trivalent GalNAc moiety and is attached to the 5' end of the sense strand. In yet other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 3' end of the sense strand. In yet other embodiments, the multivalent GalNAc moiety is a tetravalent GalNAc moiety and is attached to the 5' end of the sense strand. Examples of trivalent and tetravalent GalNAc moieties and linkers that can be attached to double-stranded RNA molecules in RNAi constructs of the invention are provided in Structural Formulas I-XXIX below.

In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula I below, where each n is independently 1-3, k is 1-3, and m is , 1 or 2, j is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula II below, where each n is independently 1-3, k is 1-3, and m is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In yet another embodiment, the RNAi construct comprises a ligand and a linker having the following structural formula III, where each n is independently 1-3, k is 1-3, and m is 1 or 2, j is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In yet another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula IV below, where each n is independently 1-3, k is 1-3, m is 1 or 2, j is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In yet another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula V below, where each n is independently 1-3, k is 1-3, m is 1 or 2, j is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula VI below, where each n is independently 1-3, k is 1-3, and m is 1 or 2, j is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In one particular embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula VII below, where the ligand connects the three sense strands of a double-stranded RNA molecule (represented by the solid wavy line). 'attached to the end.

In another specific embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula VIII below, where the ligand is the linker of the sense strand of a double-stranded RNA molecule (represented by the solid wavy line). It is attached to the 3' end.

In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula IX below, where each n is independently 1-3, k is 1-3, m is 1 or 2 and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In other embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula X below, where each n is independently 1-3, k is 1-3, and m is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XI below, where each n is independently 1-3, k is 1-3, and m is , 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XII below, where each n is independently 1-3, k is 1-3, and m is 1 or 2, and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In yet another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XIII below, where each n is independently from 1 to 3, and k is from 1 to 3; m is 1 or 2 and the ligand is attached to the 3' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula XIV below, where each n is independently 1-3, k is 1-3, and the ligand is attached to the 5' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula (represented by the wavy line) at the 5' end of the sense strand.

In other embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula XVI below, where each n is independently 1-3, k is 1-3, and The ligand is attached to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line).

In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula (represented by the wavy line) at the 5' end of the sense strand.

In certain other embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula XVIII below, where each n is independently from 1 to 3, and k is from 1 to 3. , and the ligand is attached to the 5' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In one particular embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XIX below, where each n is independently 1-3, and the ligand is a double-stranded RNA molecule (represented by the solid wavy line) at the 5' end of the sense strand.

In some embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula XX below, where each n is independently 1-3, k is 1-3, and the ligand is attached to the 5' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XXI below, where each n is independently 1-3, and the ligand is a double-stranded RNA molecule (solid line (represented by the wavy line) at the 5' end of the sense strand.

In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula XXII below, where each n is independently from 1 to 3, and k is from 1 to 3; and the ligand is attached to the 5' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XXIII below, where each n is independently 1-3, and the ligand is a double-stranded RNA molecule (solid line (represented by the wavy line) at the 5' end of the sense strand.

In certain other embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula XXIV below, where each n is independently 1-3, and the ligand is double-stranded. It is attached to the 5' end of the sense strand of an RNA molecule (represented by a solid wavy line).

In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XXV below, where each n is independently 1-3, and the ligand comprises a double-stranded RNA molecule ( (represented by a solid wavy line) at the 5' end of the sense strand.

In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of Formula XXVI below, where the ligand is located at the 5th point of the sense strand of a double-stranded RNA molecule (represented by the solid wavy line). 'attached to the end.

In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XXVII below, where each n is independently 1-3, k is 1-9, and m is , 1 or 2, and the ligand is attached to the 5' end of the sense strand of the double-stranded RNA molecule (represented by the solid wavy line).

In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of Formula XXVIII below, where the ligand is 5′ of the sense strand of a double-stranded RNA molecule (represented by the solid wavy line). Attached to the end.

In one particular embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula XXIX below, where the ligand connects the three sense strands of a double-stranded RNA molecule (represented by the solid wavy line). 'attached to the end.

In some embodiments, RNAi constructs of the invention can be delivered to cells or tissues of interest by administering a vector that encodes and controls intracellular expression of the RNAi construct. A "vector" (also referred to herein as an "expression vector") is a composition of matter that can be used to deliver a nucleic acid of interest inside a cell. A large number of vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides conjugated to ionic or amphiphilic compounds, plasmids and viruses. Thus, the term "vector" includes autonomously replicating plasmids or viruses. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, and the like. Vectors can be replicated in living cells or made synthetically.

Generally, vectors for expressing RNAi constructs of the invention will contain one or more promoters operably linked to the RNAi construct encoding sequence. As used herein, the phrases "operably linked" or "under transcriptional control" mean that the promoter is in the proper location and proper orientation relative to the polynucleotide sequence to initiate transcription by RNA polymerase and to initiate transcription of the polynucleotide. means controlling the expression of a sequence. "Promoter" refers to a sequence recognized by or introduced into a cell's synthetic machinery and required to initiate transcription of a particular gene sequence. Suitable promoters include RNA pol I, pol II, H1 or U6 RNA pol III and viral promoters such as the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter and the Rous sarcoma virus terminal long repeats, but Not limited to these. In some embodiments, H1 or U6 RNA pol III promoters are preferred. The promoter can be a tissue-specific or inducible promoter. Of particular interest are liver-specific promoters such as promoter sequences from the human α1-antitrypsin gene, albumin gene, hemopexin gene and hepatic lipase gene. Inducible promoters include promoters regulated by ecdysone, estrogen, progesterone, tetracycline and isopropyl-PD1-thiogalactopyranoside (IPTG).

In some embodiments where the RNAi construct comprises siRNA, the two separate strands (sense and antisense strands) can be expressed from a single vector or two separate vectors. For example, in one embodiment, the sequence encoding the sense strand is operably linked to the promoter of a first vector and the sequence encoding the antisense strand is operably linked to the promoter of the second vector. . In such embodiments, the first and second vectors are introduced simultaneously into the target cell, e.g., by infection or transfection, such that the sense and antisense strands hybridize within the cell once transcribed. This will form an siRNA molecule. In another embodiment, the sense and antisense strands are transcribed from two separate promoters located in a single vector. In some such embodiments, the sequence encoding the sense strand is operably linked to a first promoter, the sequence encoding the antisense strand is operably linked to a second promoter, and the sequence encoding the antisense strand is operably linked to a second promoter. The first and second promoters are placed in a single vector. In one embodiment, the vector comprises a first promoter operably linked to a sequence encoding the siRNA molecule and a second promoter operably linked to the same sequence in the opposite orientation, such that the first Transcription of a sequence from a second promoter results in synthesis of the sense strand of the siRNA molecule, and transcription of a sequence from a second promoter results in synthesis of the antisense strand of the siRNA molecule.

In other embodiments where the RNAi construct comprises an shRNA, a sequence encoding a single at least partially self-complementary RNA molecule is operably linked to a promoter that produces a single transcript. In some embodiments, the shRNA-encoding sequence includes inverted repeats joined by a linker polynucleotide sequence to generate the shRNA stem and loop structure after transcription.

In some embodiments, vectors encoding RNAi constructs of the invention are viral vectors. Various viral vector systems suitable for expressing the RNAi constructs described herein include adenoviral vectors, retroviral vectors (e.g., lentiviral vectors, Moloney murine leukemia virus), adeno-associated viral vectors; herpes simplex virus vectors; SV40 vectors; polyomavirus vectors; papillomavirus vectors; picornavirus vectors; and poxvirus vectors (eg, vaccinia virus). In certain embodiments, the viral vector is a retroviral vector (eg, a lentiviral vector).

Various vectors suitable for use in the present invention, methods of inserting nucleic acid sequences encoding siRNA or shRNA molecules into the vector, and methods of delivering the vector to cells of interest are within the skill of those in the art. For example, Dornburg, Gene Therap. , Vol. 2:301-310, 1995; Eglitis, Biotechniques, Vol. 6:608-614, 1988; Miller, Hum Gene Therap. , Vol. 1:5-14, 1990; Anderson, Nature, Vol. 392:25-30, 1998; Rubinson D A et al. , Nat. Genet. , Vol. 33:401-406, 2003; Brummelkamp et al. , Science, Vol. 296:550-553, 2002; Brummelkamp et al. , Cancer Cell, Vol. 2:243-247, 2002; Lee et al. , Nat Biotechnol, Vol. 20:500-505, 2002; Miyagishi et al. , Nat Biotechnol, Vol. 20:497-500, 2002; Paddison et al. , Genes Dev, Vol. 16:948-958, 2002; Paul et al. , Nat Biotechnol, Vol. 20:505-508, 2002; Sui
et al. , Proc Natl Acad Sci USA, Vol. 99:5515-5520, 2002; and Yu et al. , Proc Natl Acad
Sci USA, Vol. 99:6047-6052, 2002, all of which are incorporated herein by reference in their entirety.

The invention also includes pharmaceutical compositions and formulations comprising the RNAi constructs described herein and a pharmaceutically acceptable carrier, excipient or diluent. Such compositions and formulations are useful for reducing ASGR1 expression in a subject in need thereof. When considering clinical use, pharmaceutical compositions and formulations will be made in a form appropriate for the intended use. Generally, this will entail creating compositions that are essentially free of pyrogens and other impurities that may be harmful to humans or animals.

The phrases "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce harmful allergic or other untoward reactions when administered to animals or humans. Point. As used herein, "pharmaceutically acceptable carrier, excipient, or diluent" refers to a solvent, buffer, or solvent that is acceptable for use in the formulation of a drug, such as a drug suitable for administration to humans. , solutions, dispersion media, coatings, antibacterial and antifungal agents, tonicity agents and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is known in the art. Unless any conventional media or agents are incompatible with the RNAi constructs of the present invention, their use in therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions, provided they do not inactivate the vector or RNAi construct of the composition.

The composition and method of formulation of a pharmaceutical composition depends on a number of conditions, including, but not limited to, the route of administration, the type and extent of the disease or disorder being treated, or the dose administered. In some embodiments, pharmaceutical compositions are formulated based on the intended route of delivery. For example, in certain embodiments, pharmaceutical compositions are formulated for parenteral delivery. Parenteral delivery forms include intravenous, intraarterial, subcutaneous, intrathecal, intraperitoneal or intramuscular injection or infusion. In one embodiment, the pharmaceutical composition is formulated for intravenous delivery. In such embodiments, the pharmaceutical composition may include a lipid-based delivery vehicle. In another embodiment, the pharmaceutical composition is formulated for subcutaneous delivery. In such embodiments, the pharmaceutical composition may include a targeting ligand (eg, a GalNAc-containing or antibody-containing ligand described herein).

In some embodiments, the pharmaceutical composition comprises an effective amount of an RNAi construct described herein. An "effective amount" is an amount sufficient to produce a beneficial or desired clinical result. In some embodiments, an effective amount is an amount sufficient to reduce ASGR1 expression in hepatocytes of a subject. In some embodiments, an effective amount can be an amount sufficient to only partially reduce ASGR1 expression, eg, to a level corresponding to expression of a wild-type ASGR1 allele in a human heterozygote. Heterozygous human carriers of a loss-of-function ASGR1 variant allele were reported to have lower serum levels of non-HDL cholesterol and a lower risk of coronary artery disease and myocardial infarction compared to non-carriers (Nioi et al. al., New England Journal of Medicine, Vol. 374(22): 2131-2141, 2016). Therefore, without being bound by theory, it is believed that a partial reduction in ASGR1 expression may be sufficient to achieve beneficial serum non-HDL cholesterol reduction and reduced risk of coronary artery disease and myocardial infarction.

Effective amounts of RNAi constructs of the invention include about 0.01 mg/kg body weight to about 100 mg/kg body weight, about 0.05 mg/kg body weight to about 75 mg/kg body weight, about 0.1 mg/kg body weight to about 50 mg/kg body weight. body weight, from about 1 mg/kg to about 30 mg/kg body weight, from about 2.5 mg/kg body weight to about 20 mg/kg body weight, or from about 5 mg/kg body weight to about 15 mg/kg body weight. In certain embodiments, a single effective amount of an RNAi construct of the invention is about 0.1 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about It can be 4 mg/kg, about 5 mg/kg, about 6 mg/kg, about 7 mg/kg, about 8 mg/kg, about 9 mg/kg or about 10 mg/kg. Pharmaceutical compositions containing an effective amount of an RNAi construct can be administered weekly, biweekly, monthly, quarterly or semi-annually. Precise determination of what will be an effective dose and frequency of administration depends on the patient's size, age and general condition, and the type of disorder being treated (e.g., myocardial infarction, heart failure, coronary artery disease, hypercholesterolemia). , may be based on a number of factors including the particular RNAi construct employed as well as the route of administration. Estimates of effective doses and in vivo half-lives for any particular RNAi construct of the invention can be ascertained using conventional methods and/or testing in appropriate animal models.

Administration of the pharmaceutical compositions of the invention may be via any common route so long as the target tissue is available via that route. Such routes include parenteral (e.g. subcutaneous, intramuscular, intraperitoneal or intravenous), oral, nasal, buccal, intradermal, transdermal and sublingual routes or direct injection into liver tissue or hepatic portal. Including, but not limited to, intravenous delivery. In some embodiments, the pharmaceutical composition is administered parenterally. For example, in certain embodiments, pharmaceutical compositions are administered intravenously. In other embodiments, the pharmaceutical composition is administered subcutaneously.

Colloidal dispersion systems such as polymeric complexes, nanocapsules, microspheres, beads and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles and liposomes, encode RNAi constructs of the invention or such constructs. Can be used as a delivery vehicle for vectors. Commercially available fat emulsions suitable for delivering the nucleic acids of the invention include Intralipid® (Baxter International Inc.), Liposyn® (Abbott Pharmaceuticals), Liposyn® II (Hospira), Li posyn (registered trademark) III (Hospira), Nutrilipid (B.Braun
Medical Inc. ) and other similar lipid emulsions. A preferred colloid system for use as a delivery vehicle in vivo is liposomes (ie, artificial membrane vesicles). The RNAi constructs of the invention can be encapsulated within liposomes or can be complexed with liposomes, particularly cationic liposomes. Alternatively, the RNAi constructs of the invention may form complexes with lipids, particularly cationic lipids. Suitable lipids and liposomes include neutral (e.g. dioleoylphosphatidylethanolamine (DOPE), dimyristoyl phosphatidylcholine (DMPC) and dipalmitoylphosphatidylcholine (DPPC)), distearoyl phosphatidylcholine), negative (e.g. dimyristoyl phosphatidylglycerol). (DMPG)) and cationic (e.g., dioleoyltetramethylaminopropyl (DOTAP) and dioleoylphosphatidylethanolamine (DOTMA)). The preparation and use of such colloidal dispersions is well known in the art. Exemplary formulations include U.S. Patent No. 5,981,505; U.S. Patent No. 6,217,900; U.S. Patent No. 6,383,512; U.S. Patent No. 5,783,565. Specifications; U.S. Patent No. 7,202,227; U.S. Patent No. 6,379,965; U.S. Patent No. 6,127,170; U.S. Patent No. 5,837,533 No. 6,747,014; and WO 03/093449.

In some embodiments, the RNAi constructs of the invention are fully encapsulated in a lipid formulation, eg, to form SPLPs, pSPLPs, SNALPs, or other nucleic acid-lipid particles. As used herein, the term "SNALP" refers to stable nucleic acid-lipid particles that include SPLPs. As used herein, the term "SPLP" refers to nucleic acid-lipid particles containing plasmid DNA encapsulated in lipid vesicles. SNALPs and SPLPs typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (eg, PEG-lipid conjugates). SNALP and SPLP are extremely useful for systemic administration because they exhibit a long circulation life after intravenous injection and accumulate at distal sites (eg, sites physically distant from the site of administration). SPLP includes "pSPLP" containing an encapsulated condensing agent-nucleic acid complex as described in WO 00/03683. Nucleic acid-lipid particles typically have an average diameter of about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, or about 70 nm to about 90 nm, and are substantially non-toxic. Additionally, the nucleic acids when present in the nucleic acid-lipid particles are resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and methods for their preparation are described, for example, in U.S. Pat. No. 5,976,567; U.S. Pat. No. 5,981,501; U.S. Pat. , 586,410; 6,815,432; and WO 96/40964.

Pharmaceutical compositions suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that they are easily injectable. The preparation should be stable under the conditions of manufacture and storage and should be protected against the contaminating action of microorganisms, such as bacteria and fungi. Suitable solvents or dispersion media may contain, for example, water, ethanol, polyols such as glycerol, propylene glycol and liquid polyethylene glycol, suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, maintenance of the required particle size in the case of dispersions and the use of surfactants. Prevention of microbial action can be brought about by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it will be preferable to include isotonic agents, such as sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the composition of agents that delay absorption, such as aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound in the appropriate amount in a solvent with any other desired ingredients (eg, those enumerated above), followed by filter sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and the desired other ingredients, such as those enumerated above. In the case of sterile powders for the preparation of sterile solutions for injection, preferred methods of preparation include vacuum drying and freeze-drying techniques in which the powder of the active ingredient and any additional desired ingredients is produced from a previously sterile-filtered solution thereof. include.

Compositions of the invention may generally be formulated in neutral or salt forms. Pharmaceutically acceptable salts include, for example, acid addition salts derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.) (formed by free amino groups). including). Salts formed by free carboxyl groups may also be derived from inorganic bases (e.g. sodium, potassium, ammonium, calcium or ferric hydroxide) or organic bases (e.g. isopropylamine, trimethylamine, histidine, procaine, etc.). can.

For parenteral administration in an aqueous solution, for example, the solution is usually suitably buffered and the liquid diluent is initially rendered isotonic, for example with sufficient saline or glucose. Such aqueous solutions can be used, for example, for intravenous, intramuscular, subcutaneous and intraperitoneal administration. Preferably, sterile aqueous media are employed as known to those skilled in the art, especially in light of this disclosure. As an illustration, a single dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection fluid or injected at the proposed injection site (see, eg, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA standards. In certain embodiments, a pharmaceutical composition of the invention comprises or consists of sterile saline and an RNAi construct described herein. In other embodiments, a pharmaceutical composition of the invention comprises or consists of an RNAi construct described herein and sterile water (eg, Water for Injection, WFI). In yet other embodiments, a pharmaceutical composition of the invention comprises or consists of an RNAi construct described herein and phosphate buffered saline (PBS).

In some embodiments, the pharmaceutical compositions of the invention are packaged in or stored in a device for administration. Devices for injectable formulations include, but are not limited to, injection ports, prefilled syringes, automatic injection devices, injection pumps, wearable syringes, and injection pens. Devices for aerosolized or powder formulations include, but are not limited to, inhalers, inhalers, aspirators, and the like. Accordingly, the invention includes administration devices containing the pharmaceutical compositions of the invention for treating or preventing one or more of the disorders described herein.

The present invention provides methods for reducing or inhibiting the expression of ASGR1 in a subject in need thereof, and methods for treating or preventing pathological conditions, diseases, or disorders associated with ASGR1 expression or activity. "A condition, disease or disorder associated with ASGR1 expression" means a condition, disease or disorder in which the expression level of ASGR1 is altered or an increased expression level of ASGR1 is associated with an increased risk of developing the condition, disease or disorder. refers to Conditions, diseases or disorders associated with ASGR1 expression also include conditions, diseases or disorders resulting from abnormal changes in lipoprotein metabolism, such as changes resulting in abnormal levels of cholesterol, lipids, triglycerides, etc. or impaired clearance of these molecules. can be included. Recently, human carriers of a loss-of-function variant allele of the ASGR1 subunit of the asialoglycoprotein receptor have lower serum levels of non-HDL cholesterol and a lower risk of coronary artery disease and myocardial infarction than non-carriers. (Nioi et al., New England Journal of Medicine, Vol. 374(22): 2131-2141, 2016, incorporated herein by reference in its entirety). Thus, in certain embodiments, RNAi constructs of the invention are particularly useful for treating or preventing cardiovascular disease (e.g., coronary artery disease and myocardial infarction) and cholesterol-related disorders (e.g., hypercholesterolemia). .

Conditions, diseases or disorders associated with ASGR1 expression that can be treated or prevented according to the methods of the invention include myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease. (e.g., peripheral artery disease), vulnerable plaque, hypercholesterolemia and dyslipidemia (e.g., elevated total cholesterol, elevated low-density lipoprotein (LDL), elevated very-low-density lipoprotein (VLDL), elevated low levels of triglycerides and/or high-density lipoproteins (HDL)).

In certain embodiments, the invention provides a method of reducing expression of ASGR1 in a patient in need thereof, comprising administering to the patient any of the RNAi constructs described herein. . As used herein, the term "patient" refers to mammals, including humans, and can be used interchangeably with the term "subject." Preferably, the expression level of ASGR1 in the patient's hepatocytes is reduced after administration of the RNAi construct compared to the expression level of ASGR1 in a patient not receiving the RNAi construct.

In some embodiments, the patient in need of reducing ASGR1 expression is a patient at risk of having a myocardial infarction. A patient at risk of having a myocardial infarction can be a patient with a history of myocardial infarction (eg, has previously suffered a myocardial infarction). A patient at risk of having a myocardial infarction may also be a patient who has a familial history of myocardial infarction or has one or more risk factors for myocardial infarction. Such risk factors include, but are not limited to, high blood pressure, elevated levels of non-HDL cholesterol, elevated levels of triglycerides, a history of diabetes, obesity or autoimmune disease (e.g., rheumatoid arthritis, lupus). In one embodiment, the patient at risk of having a myocardial infarction is a patient who has or is diagnosed with coronary artery disease. The risk of myocardial infarction in these and other patients can be reduced by administering to the patient any of the RNAi constructs described herein. Accordingly, the present invention provides a method of reducing the risk of myocardial infarction in a patient in need thereof, comprising administering to the patient an RNAi construct as described herein. In some embodiments, the invention includes the use of any of the RNAi constructs described herein in the preparation of a medicament for reducing the risk of myocardial infarction in a patient in need thereof. In other embodiments, the invention provides RNAi constructs that target ASGR1 for use in methods of reducing the risk of myocardial infarction in a patient in need thereof.

In certain embodiments, the patient in need of reducing ASGR1 expression is a patient diagnosed with or at risk for cardiovascular disease. Accordingly, the invention includes methods of treating or preventing cardiovascular disease in a patient in need thereof by administering any of the RNAi constructs of the invention. In some embodiments, the invention includes the use of any of the RNAi constructs described herein in the preparation of a medicament for the treatment or prevention of cardiovascular disease in a patient in need thereof. . In other embodiments, the invention provides RNAi constructs that target ASGR1 for use in methods of treating or preventing cardiovascular disease in a patient in need thereof. Cardiovascular disease includes myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (eg, peripheral artery disease), and vulnerable plaque. In some embodiments, the cardiovascular disease treated or prevented according to the methods of the invention is coronary artery disease. In other embodiments, the cardiovascular disease treated or prevented according to the methods of the invention is myocardial infarction. In certain embodiments, administration of the RNAi constructs described herein is effective for non-fatal myocardial infarction, fatal and non-fatal stroke, certain types of cardiac surgery (e.g., angioplasty, bypass), Hospitalization for heart failure, chest pain in patients with heart disease and/or cardiovascular events in patients with specified heart disease (e.g., previous myocardial infarction, previous cardiac surgery and/or chest pain with signs of arterial occlusion) reduce the risk of In some embodiments, administration of the RNAi constructs described herein according to the methods of the invention can be used to reduce the risk of recurrent cardiovascular events.

In certain other embodiments, the patient in need of reducing ASGR1 expression is a patient with elevated levels of non-HDL cholesterol. Accordingly, in some embodiments, the present invention provides a method of reducing non-HDL cholesterol in a patient in need thereof by administering to the patient any of the RNAi constructs described herein. do. In some embodiments, the invention includes the use of any of the RNAi constructs described herein in the preparation of a medicament for reducing non-HDL cholesterol in a patient in need thereof. In other embodiments, the invention provides RNAi constructs that target ASGR1 for use in methods of reducing non-HDL cholesterol in a patient in need thereof. Non-HDL cholesterol is a measure of all cholesterol-containing proatherogenic lipoproteins, including LDL cholesterol, very low density lipoproteins, intermediate density lipoproteins, lipoprotein (a), chylomicrons and chylomicron remnants. Non-HDL cholesterol has been reported to be an excellent predictor of cardiovascular risk (Rana et al., Curr. Atheroscler. Rep., Vol. 14:130-134, 2012). Non-HDL cholesterol levels can be calculated by subtracting HDL cholesterol levels from total cholesterol levels. In one embodiment, the patient's LDL cholesterol level is reduced after administration of the RNAi construct. In another embodiment, the patient's lipoprotein(a) levels are reduced after administration of the RNAi construct.

In some embodiments, the patient treated according to the methods of the invention is a patient with elevated levels of non-HDL cholesterol (eg, elevated serum levels of non-HDL cholesterol). Ideally, the level of non-HDL cholesterol should be about 30 mg/dL above the target value of LDL cholesterol for any given patient. In certain embodiments, a patient is administered an RNAi construct of the invention if the patient has a non-HDL cholesterol level of about 130 mg/dL or greater. In one embodiment, a patient is administered an RNAi construct of the invention if the patient has a non-HDL cholesterol level of about 160 mg/dL or greater. In another embodiment, a patient is administered an RNAi construct of the invention if the patient has a non-HDL cholesterol level of about 190 mg/dL or greater. In yet another embodiment, a patient is administered an RNAi construct of the invention if the patient has a non-HDL cholesterol level of about 220 mg/dL or greater. In certain embodiments, the patient is provided with a report of the 2013 ACC/AHA guideline on the assessment of cardiovascular risk: a report of the Ame. rican College of Cardiology /American Heart Association Task Force on Practice Guidelines. Circulation. 2013;00:000-000) and have a non-HDL cholesterol level of about 100 mg/dL or higher. If you have a book An RNAi construct of the invention is administered.

In some embodiments of the methods of the invention, the patient has moderate or greater cardiovascular disease according to the 2013 ACC/AHA Guidelines for the Assessment of Cardiovascular Risk (referred to herein as the "2013 Guidelines"). If at risk, the RNAi constructs described herein will be administered. In certain embodiments, the RNAi constructs of the invention are administered to a patient if the patient's LDL cholesterol level is greater than about 160 mg/dL. In other embodiments, the RNAi constructs of the invention are administered to a patient if the patient's LDL cholesterol level is greater than about 130 mg/dL and the patient is at moderate risk for cardiovascular disease according to the 2013 guidelines. In yet other embodiments, the RNAi constructs of the invention are administered to a patient if the patient's LDL cholesterol level is greater than 100 mg/dL and the patient is at extremely high risk for cardiovascular disease according to the 2013 guidelines.

In certain embodiments, the patient treated according to the methods of the invention is a patient with vulnerable plaque (also referred to as vulnerable plaque). Vulnerable plaques are accumulations of macrophages and primarily cholesterol-containing lipids beneath the endothelial lining of artery walls. These vulnerable plaques can rupture, potentially blocking blood flow through the artery and resulting in the formation of a blood clot that can cause a myocardial infarction or stroke. Vulnerable plaques can be identified by methods known in the art, including but not limited to intravascular ultrasound and computed tomography (Sahara et al., European Heart Journal, Vol. 25:2026-2033 , 2004; Budhoff, J. Am. Coll. Cardiol., Vol. 48: 319-321, 2006; Hausleiter et al., J. Am. Coll. Cardiol., Vol. 48: 312-318, 2006).

In some embodiments of the methods of the invention, the RNAi construct is administered in combination with another therapeutic agent, such as a therapeutic agent for treating or preventing cardiovascular disease. In one embodiment, the RNAi constructs of the invention are administered alone or in combination with other agents useful in treating the condition afflicted by the patient. Examples of such agents include both proteinaceous and non-proteinaceous drugs. When multiple therapeutic agents are administered simultaneously, dosages may be adjusted accordingly as recognized in the relevant art. "Co-administration" and combination therapy are not limited to simultaneous administration, but also include treatment regimens in which an RNAi construct of the invention is administered at least once in a course of treatment that also includes administration of at least one other therapeutic agent to the patient. include. In certain embodiments, an RNAi construct of the invention is administered prior to administration of at least one other therapeutic agent. In other embodiments, the RNAi constructs of the invention are administered concurrently with the administration of at least one other therapeutic agent. In some embodiments, an RNAi construct of the invention is administered after administration of at least one other therapeutic agent.

In certain embodiments of the methods of the invention, the RNAi construct is administered to the patient in combination with a PCSK9 antagonist, such as an anti-hPCSK9 antibody (eg, Repatha® (evolocumab)). In another embodiment, an RNAi construct of the invention is administered to a patient in combination with at least one other cholesterol-lowering (serum and/or systemic cholesterol) agent. In some embodiments, agents that increase expression of LDLR have been observed to increase serum HDL levels, reduce LDL levels, or reduce triglyceride levels. Exemplary drugs include statins (e.g., atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin), nicotinic acid (niacin) (NIACOR, NIASPAN (extended release niacin), SLO-NIACIN (extended release niacin), fibric acid (LOPID (gemfibrozil), TRICOR (fenofibrate)); bile acid scavengers (QUESTRAN (cholestyramine), colesevelam (WELCHOL), COLESTID); cholesterol absorption inhibitors (ZETIA ( ezetimibe)), combinations of nicotinic acid and statins (ADVICOR (LOVASTATIN and NIASPAN), combinations of statins and absorption inhibitors (VYTORIN (ZOCOR and ZETIA)) and/or lipid modifiers.

In some embodiments, the RNAi constructs of the invention are PPAR gamma agonists, PPAR alpha/gamma agonists, squalene synthase inhibitors, CETP inhibitors, antihypertensives, antidiabetic agents (sulfonylureas, insulin, GLP-1 analogs, DDPIV inhibitors, etc.), ApoB modulators, MTP inhibitors and/or arteriosclerosis obliterans treatment. In certain embodiments, the RNAi constructs of the invention target LDL receptor (LDLR) proteins in a patient, such as statins, certain cytokines such as oncostatin M, certain herbal ingredients such as estrogen and/or berberine. combined with drugs that increase levels of

In some embodiments, the RNAi constructs of the invention are used to treat drugs that increase serum cholesterol levels in a patient (such as certain anti-psychotic drugs).
agent), certain HIV protease inhibitors, dietary factors such as high fructose, sucrose, cholesterol or certain fatty acids, and certain nuclear receptor agonists and antagonists for RXR, RAR, LXR, FXR). It will be done. In certain embodiments, RNAi constructs of the invention are combined with agents that increase the level of PCSK9 protein in a subject, such as statins and/or insulin. Administration of the RNAi construct in such embodiments may allow the RNAi construct to reduce undesirable side effects of these other drugs, such as increases in serum non-HDL cholesterol.

It is understood that all ribonucleic acid sequences disclosed herein can be converted to deoxyribonucleic acid sequences by replacing uracil bases in the sequence with thymine bases. Similarly, any deoxyribonucleic acid sequence disclosed herein can be converted to a ribonucleic acid sequence by replacing the thymine base in the sequence with a uracil base. Included in the invention are deoxyribonucleic acid sequences, ribonucleic acid sequences, and sequences containing mixtures of deoxyribonucleotides and ribonucleotides of all sequences disclosed herein.

Additionally, any nucleic acid sequence disclosed herein can be modified by any combination of chemical modifications. Those skilled in the art will readily appreciate that such designations of "RNA" or "DNA" to describe modified polynucleotides are optional in certain cases. For example, a polynucleotide containing a nucleotide with a 2'-OH substituent of a ribose sugar and a thymine base can be used as a DNA molecule with a modified sugar (2'-OH for the natural 2'-H of DNA) or an RNA molecule with a modified base. The molecule can be described as thymine (methylated uracil) for the natural uracil of RNA.

Accordingly, the nucleic acid sequences provided herein, including but not limited to those in the Sequence Listing, include those of natural or modified RNA and/or DNA, including but not limited to such nucleic acids with modified nucleobases. It is intended to encompass nucleic acids containing any combination. By way of further example and without limitation, a polynucleotide having the sequence "ATCGATCG", whether modified or unmodified, can contain RNA bases, such as those having the sequence "AUCGAUCG", as well as some DNA bases such as "AUCGATCG". and RNA bases, as well as such compounds, including polynucleotides with other modified bases such as "ATmeCGAUCG"; In the sequence, meC indicates a cytosine base containing a methyl group at the 5th position.

The following examples, including experiments performed and results achieved, are provided for illustrative purposes only and are not to be construed as limiting the scope of the appended claims.

Example 1. Selection and Design of ASGR1 siRNA Sequences Identification and selection of optimal sequences for therapeutic siRNA molecules targeting human asialoglycoprotein receptor 1 (ASGR1) proceeded in two steps. Candidate sequences for inclusion in the initial stage 1 screening set were identified using bioinformatics analysis of two alternatively spliced transcripts for human ASGR1: a transcript variant encoding the longer isoform A. 1 (NCBI Reference SEQ ID NO: NM_001671.4; see Figure 1A) and transcript variant 2 encoding the shorter isoform B (NCBI Reference SEQ ID NO: NM_001197216.2; see Figure 1B). Two human ASGR1 transcript sequences were analyzed using an in-house siRNA design algorithm, thereby identifying 19-base long sequences with specific base content at specific sites or regions within the 19-base long sequences. do. The sequence is for identity with ASGR1 sequences in mouse (NCBI reference number NM_009714.2; see Figure 2), rat (Figure 3) and cynomolgus monkey (NCBI reference number XM_005582698.1; see Figure 4). was also evaluated. The 19 base long sequence was also evaluated for sequence identity with other human gene sequences and overlap with known single nucleotide polymorphisms to predict off-target effects. Based on the results of bioinformatics analysis, 211 sequences were included in the first stage screening set. UU dinucleotides are added to the 3' ends of selected 19 base long sense and antisense sequences to create a 19 base pair duplex region and a 2 nucleotide overhang at the 3' ends of both strands. An siRNA molecule with the following was generated.

The second stage of siRNA sequence selection aimed to identify additional active siRNAs targeting human ASGR1 mRNA that might have been eliminated as a result of bioinformatics analysis. All overlapping 19 base long sequences from human ASGR1 transcript variants 1 and 2 (NCBI Reference SEQ ID NOs: NM_001671.4 and NM_001197216.2; see Figures 1A and 1B) were extracted and A complementary antisense sequence was designed. 1284 sequences that were not included in the first stage were included as part of the second stage sequences. Similar to the first stage sequence, the second stage sequence was converted to 21 bases long by adding UU dinucleotides to the 3' ends of the sense and antisense strands, resulting in a 19 base pair duplex. siRNA molecules were generated with a region and a 2 nucleotide overhang at each 3' end. The second stage also included 55 sequences identified in the first stage for resynthesis and testing. The combined first and second stage screening set included 1495 19 base long sequences spanning the entire human ASGR1 mRNA transcript. The sense and antisense sequences of siRNA molecules included both the first and second stage screening sets as well as eight additional siRNA molecules targeting the terminal regions of the transcripts, which are shown in Table 1 below. is shown. The respective sites of the human ASGR1 transcript targeted by each of the siRNA molecules are also listed in Table 1.

Example 2. In vitro efficacy of ASGR1 siRNA molecules The siRNA molecules in the first and second stage screening sets were synthesized without chemical modification. Each siRNA molecule has a 21 nucleotide sense strand and a 21 nucleotide antisense strand that hybridize to form a 19 base pair duplex region with a 2 nucleotide overhang at the 3' end of each strand. Configured. The effectiveness of each of the siRNA molecules in reducing ASGR1 expression was evaluated using an in vitro immunoassay in a 384-well format that quantified the levels of ASGR1 protein on the cell surface of Hep3B or HepG2 cells.

Transfection complexes of siRNA molecules and RNAiMax transfection reagent (Life Technologies) in EMEM medium (ATCC 30-2003) were prepared in 384-well plates according to the manufacturer's recommendations. Human hepatocellular carcinoma Hep3B (ATCC HB-8064) or HepG2 (ATCC HB-8065) cells in EMEM medium supplemented with 10% fetal calf serum and 1% antibiotic/antimycotic were added to each well. Cells were incubated for 4 days at 37 °C and 5% _CO2 . Four days after siRNA transfection, cells were fixed in formaldehyde to block bovine serum albumin, followed by anti-ASGR1 primary antibody (Amgen clone 7E11, light and heavy chain sequences provided below (SEQ ID NOs: 3 and 4). ) for either 1 hour at room temperature or overnight at 4°C. Plates were washed three times with phosphate buffered saline (PBS). Cells were subsequently incubated in the dark for 45 minutes at room temperature with Alexa488-conjugated anti-human IgG secondary antibody and the nuclear stain reagent DRAQ5 (ThermoFisher #62251) included to assess cell number. After three washes with PBS, plates were imaged with the Opera Phenix High Content Screening System (PerkinElmer) using 488 and 640 channels to measure anti-ASGR1 antibody staining and nuclear staining, respectively. Data were analyzed using Columbus image analysis software and GeneData Screener software to quantify several measurements of ASGR1 protein levels, cell number and cell morphology on each cell and each well basis.
Anti-ASGR1 primary antibody light chain amino acid sequence:
Anti-ASGR1 primary antibody heavy chain amino acid sequence:

The activity of each siRNA molecule was measured using a "normalized Alexa 488 mean intensity" reading that quantifies protein expression of ASGR1 based on analysis of the cell population relative to ASGR1 expression in a control cell population. Cells transfected with non-targeting siRNA duplexes (i.e., siRNAs that do not have a 100% sequence match to any human gene sequence) were used as controls in each plate, and from these control cells " The central reference value was calculated. Specifically, the "center reference value" was the median Alexa 488 intensity of multiple wells containing cells transfected with non-targeting siRNA. "Normalized Alexa 488 average intensity" was calculated for each well as follows. Nuclei and cytoplasm were segmented using DRAQ5 counterstaining. The average fluorescence intensity of Alexa488 was measured for each cell (ie, the entire cell area including the cytoplasm and nucleus). Individual cell values were averaged to generate an average Alexa 488 intensity value for each well. This mean intensity value was then normalized to the central reference value to obtain a "normalized Alexa 488 mean intensity" that represents a measure of ASGR1 expression as a percent of control. Therefore, a negative "normalized Alexa 488 mean intensity" value represents reduced ASGR1 expression relative to control cells. Cell numbers assessed by DRAQ5 staining were also normalized to the cell numbers of control cells and thus represent measurements of cell viability as a percent of control.

The first stage siRNA molecules were tested in duplicate at three different concentrations (0.3 nM, 1.25 nM and 5 nM) in in vitro immunoassays in both Hep3B and HepG2 cells. For each siRNA molecule, the reduction in cell surface expression of ASGR1 relative to expression in cells transfected with non-targeting siRNA in Hep3B cells is shown in Table 2 below. Cell count measurements are also provided. For clarity of illustration, data regarding the lowest concentration (0.3 nM) and data regarding HepG2 cells are not shown. The data shown in Table 2 are results from two independent transfections of each siRNA (eg, Run 1 and Run 2).

Of the 211 unmodified siRNA molecules screened in the first step, at a concentration of 5 nM, approximately 168 siRNA molecules reduced cell surface expression of ASGR1 by at least 30% relative to control cells, and approximately 119 siRNA molecules reduced cell surface expression of ASGR1 by at least 50% relative to control cells, and approximately 30 siRNA molecules reduced cell surface expression of ASGR1 by at least 60% relative to control cells. Some siRNA molecules showed no or only a slight reduction in cell surface expression of ASGR1 relative to control cells.

A subset of siRNA molecules derived from the initial selection of molecules in the first stage was selected for further testing in a 10-point dose-response configuration (0.004 nM to 83 nM) in an in vitro anti-ASGR1 immunoassay in Hep3B cells. IC50 values for each of these 55 siRNA molecules were calculated from the dose response curves and are shown in Table 3 below. Data from two independent transfections (Run 1 and Run 2) of each siRNA molecule are shown. At least 18 of these siRNA molecules had IC50 values of about 0.30 nM or less. Compounds D-1983, D-1098, D-1438, D-1246 and D-1494 were among the most potent with mean IC50 values less than 0.15 nM.

All of the second-stage siRNA molecules, except the eight siRNA molecules targeting the 5' and 3' ends of human ASGR1 transcripts, were used as in vitro antibodies in Hep3B cells at two different concentrations (1.25 nM and 5 nM). Tested in ASGR1 immunoassay. For each siRNA molecule, the reduction in cell surface expression of ASGR1 relative to expression in cells transfected with non-targeting siRNA in Hep3B cells is shown in Table 4 below. Cell count measurements are also provided.

Results from the second stage molecular screening assay revealed an additional 663 potent siRNA molecules that reduced cell surface expression of ASGR1 by at least 50% relative to control cells when tested at 5 nM. did. These siRNA molecules were not included in the first step and were not identified from bioinformatics analysis of transcript sequences. When tested at 5 nM, at least 263 of these new siRNA molecules reduced cell surface expression of ASGR1 by at least 70% versus control cells, and at least 14 siRNA molecules reduced cell surface expression of ASGR1 versus control cells. Cell surface expression was reduced by at least 80%.

Example 3. Efficacy of Selected ASGR1 siRNA Molecules in RNA FISH Assays To evaluate the efficacy of a subgroup of ASGR1 siRNA molecules to reduce ASGR1 expression at the mRNA level, IC50 values were determined in fluorescence in situ hybridization (FISH) assays of RNA for ASGR1. was determined for each siRNA. Hep3B cells (ATCC HB-8064) were transfected with siRNA using Lipofectamine RNAiMax transfection reagent (ThermoFisher Scientific 13378-150) at 0.035 μL/reaction. Human ASGR1 siRNA was tested in a 10-point dose-response configuration ranging from 0 to 83.3 nM final concentration at 3-fold dilution. Control siRNAs were tested at a final concentration of 5 nM, neutral control (used for normalization): untargeted RcsC2 (UUACAUCGUUAAUGCGUUA (SEQ ID NO: 4316), inhibitor positive control: human ASGR1 (ACUUCACAGCGAGCACGGA (SEQ ID NO: 4317)) and transfected RcsC2 (UUACAUCGUUAAUGCGUUA (SEQ ID NO: 4316)). Transfection control: Human EIF4A3 (GCAUCUUGGUGAAACGUGA (SEQ ID NO: 4318) was included. Cells were plated onto the transfection complex at 2000 cells per reaction in Perkin Elmer Cell Carrier PDL coated 384 well assay plates (Perkin Elmer #6007580). sowing The transfection time was 96 hours, after which cells were fixed with formaldehyde at a final concentration of 4% without methanol. Immediately after fixation, Affymetrix QuantiGene View RNA HC screening assay was performed within the manufacturer's protocol for the Affymetrix QuantiGene View RNA HC screening assay. Cells were dehydrated in ethanol according to Cell Dehydration Protocol for Storage or Shipping. Plates were sealed and stored at -20°C.

Cells were rehydrated according to the manufacturer's protocol and processed in the Affymetrix QuantiGene View RNA HC screening assay, an in situ hybridization method to quantify messenger RNA levels. In this example, the multiplex assay detected human ASGR1 (NM_001671.4; SEQ ID NO: 1), human ASGR2 (NM_0080912.3 or NM_001181.4) and human PPIB (NM_000942.4). This assay is compatible with the QG ViewRNA HC Screening Assay Kit and QG ViewRNA HC Screening Signal Amplification Kit (3-plex) (Affymetrix QVP0011 and QVP0213, respectively) and the probe set for the detection of human ASGR1, ASGR2, and PPIB (Affymetrix, VA6-19401-01, respectively). , a custom Type 4 probe, VA1-10148-01). Each probe set was labeled with a different fluorophore. Protease for the digestion step was added at a final concentration of 1:8000. After the assay, the nucleus and cytoplasm were counterstained with Hoechst 33342 nuclear stain reagent and Cell Mask Blue reagent (ThermoFisher Scientific H3570 and H32720 at final concentrations of 10 ng/μL and 4 ng/μL, respectively). Plates were imaged on a Perkin Elmer Phenix reading Hoechst and Cell Mask Blue in the UV channels (PPIB/Type 1 for the 488 channel, ASGR2/Type 4 for the 550 channel and ASGR1/Type 6 for the 650 channel). Image acquisition and data analysis were performed in Perkin Elmer's Columbus software package, and well normalization/IC50 value generation was performed in the Genedata Screener.

The results of the assay are shown in Table 5. The IC50 values determined in the RNA FISH assay correlate with those determined in the immunoassay for protein levels of ASGR1 as described in Example 2. However, at the time tested, the IC50 values determined in the RNA FISH assay are higher than those determined in the immunoassay.

Example 4. Design and Synthesis of Modified ASGR1 siRNA Molecules To improve the potency and in vivo stability of ASGR1 siRNA molecules, we selected the most potent ASGR1 from the first stage selection that also had sequence homology with mouse Asgr1 mRNA and cynomolgus macaque ASGR1 mRNA. Chemical modifications were incorporated into a subset of the most potent ASGR1 siRNA molecules from the first and second stage selections, including five of the siRNA molecules. Specifically, 2'-O-methyl and 2'-fluoro modifications of the ribose sugar were incorporated into specific positions within the ASGR1 siRNA. Phosphorothioate internucleotide linkages were also incorporated at the ends of the antisense and/or sense sequences. Table 6 below shows the modifications in the sense and antisense sequences of each of the modified ASGR1 siRNAs. The nucleotide sequences in Table 6 are listed according to the following notation. A, U, G and C = corresponding ribonucleotide; dT = deoxythymidine; a, u, g and c = corresponding 2'-O-methyl ribonucleotide; Af, Uf, Gf and Cf = corresponding 2'- Deoxy-2'-fluoro ("2'-fluoro") ribonucleotides. The insertion of an "s" in the sequence indicates that two adjacent nucleotides are joined by a phosphorothiodiester group (eg, a phosphorothioate internucleotide linkage). Unless otherwise specified, all other nucleotides are attached through 3'-5' phosphodiester groups. Each of the siRNA compounds in Table 6 contains a 19 base pair duplex region with a 2 nucleotide overhang at the 3' end of both strands.

Synthesis of chemically modified siRNA sequences was performed on a GE AKTA OligoPilot 100.

material:
Acetonitrile (DNA synthesis grade, AXO152-2505, EMD)
Capping Reagent A (20% N-methylimidazole in acetonitrile, BI0224-0505, EMD, lot number 56090)
Capping Reagent B1 (20% acetic anhydride in acetonitrile, BI0347-0505, EMD, lot number 55015)
Capping Reagent B2 (30% 2,6-lutidine in acetonitrile, BI0349-0505, EMD, lot number 55176)
Capping reagents B1 and B2 were combined and mixed 1:1 (v/v).
Activator (0.3M benzylthiotetrazole (BTT) in acetonitrile, BI0166-1005, EMD lot number 55106, over molecular sieves)
Detritylation reagent (3% dichloroacetic acid in toluene, BIO832-2505, EMD, lot number 55316)
Oxidation reagent (0.05M iodine in 90:10 pyridine/water, BIO424-1005, EMD, lot number 54323)
Diethylamine solution (20% DEA in acetonitrile, NC0017-0505, EMD, lot number 55202)
Ammonium hydroxide (high concentration, J.T. Baker)
Thiolating reagent, 0.2 M phenylacetic disulfide (PADS, Aldrich) in 50:50 2-methylpyridine (picoline, Aldrich)/N-methylpyrrolidinone (NMP), Aldrich).
Thymidine (Thermo Fisher Scientific) and 2'-O-methyl and 2'-fluorophosphoramidites of adenosine, guanosine, cytosine and uridine (Thermo Fisher Scientific), approximately 10 mL of acetonitrile over molecular sieves (J.T. Baker). 0.15M inside
Primer Support 5G UnyLinker 350, lot number 10236161, 343 μmol/g, 0.60 g (206 μmol) or Primer Support 5G Amino with GalNAc cluster

Synthesis:
Reagent solution, phosphoramidite solution and solvent were connected to the instrument. The solid support was added to the column (6.3 mL) and the column was attached to the instrument. The column was flushed with acetonitrile. Synthesis was initiated using Unicorn software. The phosphoramidite and reagent solution lines were purged. The synthesis was carried out by repeated deprotection/coupling/oxidation/capping synthetic cycles. A detritylating reagent was added to the solid support to remove the 5'-dimethoxytrityl (DMT) protecting group. The solid support was washed with acetonitrile. Phosphoramidite and activator solutions were added to the support and then recycled to couple incoming nucleotides to free 5'-hydroxyl groups. The support was washed with acetonitrile. Oxidizing or thiolating reagents were added to the support to convert the phosphite triesters to phosphotriesters or phosphorothioates. Capping reagents A and B were added to the support to terminate any unreacted oligonucleotide strands. The support was washed with acetonitrile. After the final reaction cycle, the resin was washed with diethylamine solution to remove the 2-cyanoethyl protecting group. The support was washed with acetonitrile.

Cutting:
The synthesis column was removed from the synthesizer and dried under vacuum for 20 minutes. The column was opened and the solid support was transferred to a 100 mL bottle. 40 mL of concentrated ammonium hydroxide was added to the solid support. The cap was tightly attached to the bottle and the mixture was heated at 65° C. overnight. The bottles were moved to the freezer and allowed to cool for 20 minutes before opening in the hood. The mixture was filtered through a 60 mL fritted glass funnel. The bottle and solid support were rinsed with 20 mL of 50:50 ethanol/water, then 40 mL of water.

Analysis and purification:
A portion of the combined filtrate was analyzed and purified by anion exchange chromatography. Pooled fractions were desalted by size exclusion chromatography and analyzed by ion pair reverse phase HPLC. The pooled fractions were lyophilized to obtain a white amorphous powder.

Analytical anion exchange chromatography (AEX):
Column: Thermo DNAPac PA200RS (4.6 x 50 mm, 4 μm)
Equipment: Agilent 1100 HPLC
Buffer A: 20mM sodium phosphate, 10% acetonitrile, pH 8.5
Buffer B: 20mM sodium phosphate, 10% acetonitrile, pH 8.5, 1M sodium bromide Flow rate: 1 mL/min at 40°C Gradient: 20-65% B in 6.2 minutes

Preparative anion exchange chromatography (AEX):
Column: Tosoh TSK Gel SuperQ-5PW, 21 x 150 mm, 13 μm
Equipment: Agilent 1200 HPLC
Buffer A: 20mM sodium phosphate, 10% acetonitrile, pH 8.5
Buffer B: 20mM sodium phosphate, 10% acetonitrile, pH 8.5, 1M sodium bromide Flow rate: 8mL/min Injection volume: 5mL
Gradient: 35-55% B over 20 minutes

Preparative size exclusion chromatography (SEC):
Column: GE Hi-Prep 26/10
Equipment: GE AKTA Pure
Buffer: 20% ethanol aqueous solution Flow rate: 10 mL/min Injection volume: 15 mL using sample loading pump

Ion pair reversed phase (IP-RP) HPLC:
Column: Water Xbridge BEH OST C18, 2.5 μm, 2.1 x 50 mm
Equipment: Agilent 1100 HPLC
Buffer A: 15.7mM DIEA, 50mM HFIP in water
Buffer B: 15.7mM DIEA, 50mM HFIP in 50:50 water/acetonitrile
Flow rate: 0.5 mL/min Gradient: 10-30% B over 6 minutes

annealing:
Small amounts of sense and antisense strands were weighed into individual vials. siRNA reconstitution buffer (Qiagen) was added to the vial to give a concentration of approximately 2 mM on a dry weight basis. Actual sample concentration was measured on NanoDrop One (ssDNA, extinction coefficient = 33 μg/OD260). The two strands were then mixed in equimolar ratios and the sample was heated in a 90°C water bath for 3 minutes and slowly cooled to room temperature. Samples were analyzed by AEX. RNA duplexes were observed to have longer retention times by analytical AEX than single strands. Duplexes were registered and subjected to in vitro (see methods described in Examples 2 and 3) and in vivo (see methods described in Example 6) tests.

Example 5. Synthesis of GalNAc-Containing Ligands This example demonstrates how a tetravalent ligand can be conjugated to a double-stranded RNA molecule in an RNAi construct of the invention to facilitate delivery and uptake of the RNAi construct by the liver (e.g., hepatocytes). We describe the synthesis of the GalNAc moiety of . The synthesis scheme is shown in Figure 5.

Resin-bound four-branched GalNAc
Step 1: (S)-4-(2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(trityloxy)propoxy)-4-oxobutanoic acid (1)
(R)-(9H-fluoren-9-yl)methyl(1-hydroxy-3-(trityloxy)propan-2-yl)carbamate (20g, 36.0mmol), succinic anhydride (7.20g, 72mmol) , polystyrene-supported DMAP (3 mmol/g, 24 g, 72 mmol) and triethylamine (10 mL, 72 mmol) were dissolved in DCM (720 mL). The suspension was stirred at room temperature for 16 hours. The reaction was filtered through Celite (to remove PS-dmap) and the filter cake was rinsed with DCM (200 mL). The combined filtrates were extracted with saturated aqueous NaCl (3 x 100 mL). The organic layer was dried over sodium sulfate and concentrated to give the crude title compound (23.6 g, 36.0 mmol, 100% yield), which was used in the next step without further purification. MS m/z 678.2 (M+Na).

Step 2:
Active hemisuccinic acid was prepared as follows in a 50 mL conical tube. (S)-4-(2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(trityloxy)propoxy)-4-oxobutanoic acid (0.5g, 0.763mmol) and TATU (344 mg, 1.07 mmol) were dissolved in 5 mL of DMF and the tube was swirled for 3 minutes. Hunig's base (0.400 mL, 2.29 mmol) was added. Meanwhile, the resin (GE Lifesciences Primer Support 5G Amino, 0.46 mmol/g, 1.66 g, 0.763 mmol) was swollen in a 50 mL Falcon tube containing 10 mL of DMF. Activated hemisuccinic acid solution was added. The tube was gently shaken at 400 rpm at room temperature. The reaction mixture was filtered, followed by rinsing with DCM (50 mL), 10% MeOH-DCM (50 mL), then DCM (50 mL) and dried under vacuum. The resin was capped by adding a solution of acetic anhydride (5.625 mL, 59 mmol), pyridine (16.65 mL) and triethylamine (0.225 mL) and shaken at 400 rpm for 2 hours at room temperature. The resin was filtered, rinsed with DCM (50 mL), 10% MeOH-DCM (50 mL) and DCM (50 mL) and dried under vacuum to yield intermediate 2 (2.55 g, 0.255 mmol/g, 0.65 mmol). was obtained and used as is in the next step.

Step 3:
Intermediate 2 (2.55 g, 0.65 mmol) was suspended in a 20% 4-methylpiperidine solution in DMF (15 mL) and stirred for 5 minutes. The solution was drained and the process was repeated two more times to obtain the deprotected intermediate. Fmoc-protected 6-aminohexanoic acid was prepared by dissolving Fmoc-protected 6-aminohexanoic acid (1.41 g, 4.0 mmol) and TATU (1.288 g, 4.0 mmol) in DMF (10 mL). An active solution was prepared. After 5 minutes, Hunig's base (1.05 mL, 6.05 mmol) was added. This solution was added to the deprotected resin. The mixture was shaken at 400 rpm overnight at room temperature. The reaction was filtered and the resin was washed with DMF (3 x 30 mL). The same procedure (deprotection, active acid preparation and coupling) was repeated to obtain crude intermediate 3 (2.40 g, 0.184 mmol/g, 0.442 mmol), which was used in the next step.

Step 4:
Intermediate 3 was suspended in a 20% 4-methylpiperidine solution in DMF (15 mL) and stirred for 5 minutes. The solution was drained and the process was repeated two more times to obtain the deprotected intermediate. Bis-Fmoc protected lysine (2.07 g, 3.5 mmol) and TATU (1.13 g, 3.5 mmol) were dissolved in DMF (10 mL) and stirred for 5 min. An active solution of lysine was prepared. Hunig's base (0.96 mL, 5.5 mmol) was added. This solution was added to the deprotected resin. The suspension was shaken at 400 rpm overnight at room temperature. The reaction mixture was filtered and the resin was subsequently washed with DMF (3 x 30 mL). The resin was deprotected using the procedure described above. An active solution of bis-Fmoc-protected lysine was prepared as described above, except that the amount of bis-Fmoc-protected lysine was 2.96 g (5.0 mmol) and the amount of TATU was 1. The amount of Hunig's base was 1.31 mL (7.5 mmol), and the deprotected resin was bound to the active acid by shaking at 400 rpm overnight at room temperature. The resin was washed with DMF (3 x 30 mL) followed by DCM (3 x 30 mL) and dried to yield crude intermediate 4 (2.28 g, 0.165 mmol/g, 0.376 mmol).

Step 5:
Intermediate 4 (0.4 mmol) was suspended in a 20% 4-methylpiperidine solution in DMF (25 mL) and stirred for 5 minutes. The solution was drained and the process was repeated one more time to obtain the deprotected intermediate. 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy) in DMF (20 mL) TATU (1.92 g, 6.0 mmol) was added to a solution of pentanoic acid (5, 2.68 g, 6 mmol) and the solution was stirred for 5 minutes. Hunig's base (1.57 mL, 9.0 mmol) was added to this solution followed by addition of the mixture to the deprotected intermediate. The suspension was kept at room temperature overnight and the solvent was drained. The resin was washed with DMF (3 x 30 mL) and DCM (3 x 30 mL). The resin was treated with 3% dichloroacetic acid in Tol with 5% TIPS (25 mL) and the solvent was drained after 5 minutes. This process was repeated two more times to obtain intermediate 6, which was used directly in the next step (eg, conjugation reaction to the 5' or 3' end of the sense strand of the RNAi construct of the invention).

Chemically modified ASGR1 siRNA or conjugated GalNAc moieties alone were tested for efficacy in reducing ASGR1 expression by the in vitro immunoassay described in Example 2, the RNA FISH assay described in Example 3, or the in vivo mouse model described in Example 6. Gated chemically modified ASGR1 siRNA was evaluated.

Example 6. In Vivo Efficacy of ASGR1 siRNA Molecules To evaluate the efficacy of chemically modified ASGR1 siRNA molecules for reducing hepatic expression of ASGR1 in vivo, modified ASGR1 siRNA molecules (conjugated with Invivofectamine® reagent) or GalNAc-siRNA conjugates are administered intravenously or subcutaneously to C57BL/6J mice. Specifically, mice are injected on day 0 with buffer, the indicated siRNA and the corresponding control siRNA at 1-5 mg/kg body weight in 0.25 ml of buffer. Animals are collected on days 2, 4 and 7 for further analysis. Total animal liver RNA collected is processed for qPCR analysis. The efficacy of ASGR1 siRNA was determined by comparing the amount of Asgr1 mRNA and ASGR1 protein in liver tissue of siRNA-treated animals with the amount of Asgr1 mRNA and ASGR1 protein in liver tissue of animals injected with buffer or control siRNA. It is evaluated by

Serum levels of alkaline phosphatase and LDL cholesterol can also be measured in mice at various time points after injection of ASGR1 siRNA molecules or corresponding controls to assess the in vivo efficacy of ASGR1 siRNA molecules. Elevated serum alkaline phosphatase levels correlate with reduced serum levels of non-HDL cholesterol and reduced risk of coronary artery disease (Nioi et al., New England
Journal of Medicine, Vol. 374(22):2131-2141, 2016, incorporated herein by reference in its entirety). Therefore, serum alkaline phosphatase levels can be used as a surrogate biomarker of serum non-HDL cholesterol levels or the effectiveness of a particular ASGR1 siRNA in reducing the risk of coronary artery disease. An effective ASGR1 siRNA molecule results in decreased serum non-HDL cholesterol (e.g., LDL cholesterol) levels or increased serum alkaline phosphatase levels in treated animals compared to levels in animals injected with buffer or control siRNA. It is something that brings.

Example 7. In Vitro Efficacy of Chemically Modified siRNA Molecules of ASGR1 Selected chemically modified siRNA molecules listed in Table 6 were conjugated to the triantennary GalNAc moiety shown in Formula VII, the structure reproduced below. A GalNAc moiety was conjugated to the 3' end of the sense strand of each duplex via a phosphodiester bond.

GalNAc-siRNA conjugates were evaluated for their ability to inhibit ASGR1 expression in Hep3B cell transfection assays and human ASGR1 CHO cell free uptake assays. A Hep3B cell transfection immunoassay is described in Example 2 above. A free uptake assay utilizing Chinese hamster ovary (CHO) cells stably expressing human ASGR1 was performed as follows. GalNAc conjugated siRNA molecules in F-12K medium (Corning Cellgro #10-025-CV) were prepared in 384-well plates. CHO cells stably expressing human ASGR1 in F-12K medium supplemented with 10% fetal calf serum and 1% antibiotic/antimycotic were added to each well. Cells were incubated for 4 days at 37 °C and 5% _CO2 . Four days after siRNA delivery, cells were fixed in formaldehyde to block bovine serum albumin, followed by anti-ASGR1 primary antibody (Amgen clone 7E11, light and heavy chains provided in SEQ ID NO: 3 and 4, respectively). Staining was performed either for 1 hour at room temperature or overnight at 4°C. Plates were washed three times with phosphate buffered saline (PBS). Cells were subsequently incubated with Alexa488-conjugated anti-human IgG secondary antibody and the nuclear stain Hoechst 33342 (Invitrogen #H3570) to assess cell number for 45 minutes at room temperature in the dark. After three washes with PBS, plates were imaged on an Opera Phenix high-content screening system (PerkinElmer) using excitation/emission filter settings of 488/500-550 and 375/435-480 for anti-ASGR1 antibody staining. and nuclear staining were measured, respectively. Data were analyzed using Columbus image analysis software and GeneData Screener software to quantify several measurements of ASGR1 protein levels, cell number and cell morphology on each cell and each well basis.

GalNAc-siRNA conjugates were tested at 22 different doses ranging from 0.000012 to 25 μM in each of the assays and dose-response curves were generated. IC50 values and maximum antagonist activity values (relative to control cells; a maximum antagonist activity of −1.0 represents complete inhibition) were calculated from the dose-response curves. The results of the assay are shown in Table 7 below.

When transfected into Hep3B cells, some GalNAc-siRNA conjugates knocked down ASGR1 expression by more than 80%. Specifically, targeting nucleotides 692-710 of human ASGR1 transcript variant 1 (NM_001671.4; SEQ ID NO: 1) with various chemical modification patterns (e.g. duplex nos. 3026, 3037, 3051, 3053 and 3057) The GalNAc-siRNA conjugate showing low nanomolar IC50 values when transfected into Hep3B cells and maximum knockdown activity of approximately 50% in free uptake assays in CHO cells. Varying the GalNAc moiety in the conjugate to other triantennary GalNAc structures described herein (eg, Formula XVI) improved the performance of the GalNAc-siRNA conjugate in free uptake assays (data not shown).

Example 8. Design and Efficacy of Additional GalNAc-ASGR1 siRNA Molecules Additional GalNAc-ASGR1 siRNA conjugates with various patterns of chemical modification, different sequences and different GalNAc moieties were generated. Table 8 below lists the modifications in the sense and antisense sequences and the structure and site of conjugation for the GalNAc moiety for each of the GalNAc-ASGR1 siRNA conjugates. The nucleotide sequences in Table 8 are listed according to the following notation. A, U, G and C = corresponding ribonucleotide; dT, dA, dG, dC = corresponding deoxyribonucleotide; a, u, g and c = corresponding 2'-O-methylribonucleotide; Af, Uf, Gf and Cf = corresponding 2'-deoxy-2'-fluoro ("2'-fluoro") ribonucleotide; Phos = terminal nucleotide having a monophosphate group at its 5'end; invAb = reverse abasic A nucleotide (ie, an abasic nucleotide (3'-3' bond) bonded to an adjacent nucleotide through a substituent at its 3' position). The insertion of an "s" in the sequence indicates that two adjacent nucleotides are joined by a phosphorothiodiester group (eg, a phosphorothioate internucleotide linkage). Unless otherwise specified, all other nucleotides are attached through 3'-5' phosphodiester groups. The GalNAc structure is shown in the referenced formula, which is shown above.

Testing the efficacy of GalNAc-siRNA conjugates for inhibition of ASGR1 expression in a Hep3B cell transfection immunoassay (described in Example 2) and/or a human ASGR1 CHO cell free uptake immunoassay (described in Example 7) did. The results of the assay are shown in Table 9 below.

Several GalNAc-ASGR1 siRNA conjugates were further evaluated for efficacy in knocking down ASGR1 mRNA levels in hepatocytes. Human primary hepatocytes (Xenotech/Sekisui donor lot number HC3-38) were thawed in OptiThaw medium (Xenotech catalog number K8000) according to the manufacturer's protocol. Cells were centrifuged and, after medium aspiration, resuspended in OptiPlate hepatocyte medium (Xenotech Cat. No. K8200) and plated in 96-well collagen-coated plates (Greiner Cat. No. 655950). After a 2-4 hour incubation period, the medium was removed and replaced with OptiCulture hepatocyte medium (Xenotech Cat. No. K8300). Two to four hours after adding OptiCulture medium, GalNAc-conjugated siRNA was delivered to cells by free uptake (no transfection reagent). Cells were incubated for 24-72 hours at 37°C and 5% _CO2 . Cells were subsequently lysed with Qiagen's RLT buffer (79216) supplemented with 1% 2-mercaptoethanol (Sigma, M-3148) and the lysate was stored at -20°C. RNA was purified using Qiagen's QIACube HT instrument (9001793) and Qiagen's RNeasy 96 QIACube HT kit (74171) according to the manufacturer's instructions. Samples were analyzed using the QIAxpert system (9002340).

cDNA was synthesized from RNA samples using Applied Biosystems' High Capacity cDNA Reverse Transcription Kit (4368813), reactions were assembled according to the manufacturer's instructions, and the input RNA concentration varied from sample to sample. Reverse transcription was performed on a BioRad quadruple thermal cycler (model number PTC-0240G) with the following conditions: 10 min at 25°C, 120 min at 37°C, 5 min at 85°C, then (optional) ) Continue to hold at 4°C. Droplet digital PCR (ddPCR) was performed using BioRad's QX200 AutoDG Droplet Digital PCR System according to the manufacturer's instructions. BioRad's ddPCR supermix for probes (1863010), ASGR1 (IDT Hs.PT.56a.24725395, primer-to-probe ratio 3.6:1, 9 nmoles of each forward and reverse primer (sequences listed below), 2 ordered with .5 nmoles of 6-FAM/ZEN/IBFQ labeled probe (probes listed below) as well as GUSB (IDT Hs.PT.58v.27737538, primer-to-probe ratio 3.6:1, 9 nmoles) Forward and reverse primers (ordered with 2.5 nmoles of HEX/ZEN/IBFQ labeled probe (probes listed below)) and RNase-free water (Ambion, AM9937) to assemble reactions into Eppendorf clear 96-well PCR plates (951020303). Final primer/probe concentrations were 900 nM/250 nM, respectively, and input cDNA concentrations varied between wells.

The droplets are supplied with consumables recommended by the manufacturer (BioRad's DG32 Cartridge 1864108, BioRad's Chip 864121, Eppendorf's Blue 96-well PCR Plate 951020362, BioRad's Droplet Generation Oil for Probes 1864110 and BioRad's Droplet Plate Assembly ) was created using a BioRad Auto DG droplet generator (1864101) installed with Droplets were amplified on a BioRad C1000 touch thermal cycler (1851197) using the following conditions: enzyme activation at 95°C for 10 min, denaturation at 94°C for 30 s, followed by annealing/extension at 60°C for 1 min. , 40 cycles using a ramp rate of 2°C/sec, enzyme deactivation at 98°C for 10 minutes, then (optional) continue holding at 4°C. Samples were subsequently read on a BioRad QX200 droplet reader that measures the FAM/HEX signal correlated to ASGR1 or GUSB concentration, respectively. Data were analyzed using BioRad's QuantaSoft software package. Samples were gated by channel (fluorescent label) to determine concentration per sample. Each sample was then expressed as the ratio of the concentration of the gene of interest (ASGR1)/housekeeping gene (GUSB) concentration relative to the control for different sample loadings. Data were subsequently imported into Genedata Screener where each test siRNA was normalized to the median value of neutral control wells (buffer only) and expressed as POC (percent of control). IC50 and maximum activity are reported in Table 10 below.
ddPCR assay sequence ASGR1:
Primer 1: CAGGCTGGAGTGATCTTCA (SEQ ID NO: 4688)
Primer 2: TTCAGCAACTTCACAGCGA (SEQ ID NO: 4689)
Probe: 56-FAM/TCTTTCTTC (SEQ ID NO: 4690)/ZEN/CCACATTGCCTCCCTG (SEQ ID NO: 4691)/3IABkFQ/
GUSB:
Primer 1: GTTTTTGATCCAGACCCAGATG (SEQ ID NO: 4692)
Primer 2: GCCCATTATTCAGAGCGAGTA (SEQ ID NO: 4693)
Probe: 5HEX/TGCAGGGTT (SEQ ID NO: 4694)/ZEN/TCACCAGGATCCAC (SEQ ID NO: 4695)/3IABkFQ/

Most of the GalNAc-siRNA conjugates tested reduced ASGR1 mRNA levels in human primary hepatocytes indicating that the conjugates were efficiently delivered to the cells and the siRNAs were active. Compounds D-3780, D-3782, D-3791, D-3795 and D-3800 were the most potent and had the highest maximal inhibitory activity of the conjugates evaluated in this assay. These compounds also showed potent inhibition of ASGR1 protein expression when transfected into Hep3B cells. See Hep3B transfection assay data in Table 9.

Example 9. In Vivo Efficacy of GalNAc-ASGR1 siRNA Conjugate To evaluate whether the GalNAc-ASGR1 siRNA conjugate was able to efficiently stop ASGR1 expression in vivo, it showed the highest inhibition in vitro as measured by ddPCR. The conjugate (Table 10) was administered to ASGR1 knockout mice expressing the human ASGR1 gene. 10-12 week old ASGR1 knockout mice (The Jackson Laboratory) were intravenously injected with adeno-associated virus (AAV) encoding the human ASGR1 gene (AAV-hASGR1) at a dose of 1 x 10 ¹² genome copies (GC) per animal. Injected intravenously. Two weeks after AAV-hASGR1 injection, mice were treated with buffer or the indicated GalNAc-siRNA conjugates (compounds D-3752, D-3779, D-3780, D-3782, D-3784, D-3785, D- 3788, D-3791, D-3795, D-3797, D-3799, D-3800 and D-3801) at 5 mg/kg body weight in 0.25 ml buffer (each group received n= 6). Eight days after compound administration, three animals in each treatment group were euthanized and collected for further analysis. The remaining three animals in each treatment group were collected on day 15 after compound administration. Serum and liver were collected from all animals. Total RNA isolated from animal livers was processed for qPCR analysis to assess human ASGR1 mRNA levels. Serum levels of alkaline phosphatase (ALP) were measured by a clinical analyzer (AU400 chemical analyzer, Olympus). Elevated levels of ALP in serum have been reported to correlate with reduced serum levels of non-HDL cholesterol and reduced risk of coronary artery disease (Nioi et al., New England Journal of Medicine, Vol. 374 (22 ): 2131-2141, 2016), and therefore functions as a useful biomarker.

As shown in Figure 6A, some GalNAc-siRNA conjugates reduced human ASGR1 mRNA levels at day 8 post-administration. Compounds D-3752, D-3779, D-3782, D-3788, D-3799 and D-3800 were particularly effective. Suppression of hASGR1 mRNA levels 15 days after compound administration was observed for some of the compounds. Compounds D-3752 and D-3788 were particularly effective at this point. Figure 6B shows serum ALP levels at the same time points. In general, increased serum ALP levels correlated with hASGR1 mRNA knockdown. Some of the compounds (eg, D-3752, D-3782) caused an increase in serum ALP to levels similar to those observed in ASGR1 knockout animals, indicating maximal inhibition of ASGR1 expression. The results of in vivo experiments showed that the GalNAc-ASGR1 siRNA conjugate efficiently suppressed ASGR1 gene expression in the liver when administered subcutaneously and modulated serum ALP, a biomarker of efficacy in treating coronary artery disease. has been demonstrated.

Example 10. ASGR1 Antibodies as an Alternative Delivery Mechanism for siRNA Molecules The purpose of the experiments described in this example was to determine whether monoclonal antibodies against ASGR1 could be used to deliver ASGR1 siRNA molecules to the liver. . An anti-ASGR1 monoclonal antibody (anti-ASGR1 cyc mAb, 200 mg) with the E272C mutation in the heavy chain according to the EU numbering scheme was prepared in a 50 mL solution of 2.5 mM cystamine and 2.5 mM cysteamine in 40 mM HEPES buffer at pH 7.5-8.5. and incubated at room temperature for 15-20 hours. The heavy chain and light chain amino acid sequences of the anti-ASGR1 antibody are provided below as SEQ ID NOs: 4696 and 4697, respectively. The reaction mixture was filtered using a 0.22 μm filter and diluted to 250 mL with 100 mM sodium acetate buffer, pH 5. Cation exchange chromatography was performed to purify the bis-cysteamine-capped anti-ASGR1 cys mAb from the reaction mixture. First, 250 mL of the reaction mixture diluted in 100 mM sodium acetate buffer at pH 5 was loaded onto a 25 mL SP HP column (GE Healthcare Life Sciences) at 5 mL/min. The column was washed with 2 column volumes (CV) of 100 mM sodium acetate, pH 5, followed by a 0-20% gradient of 100 mM sodium acetate with 1.2 M sodium chloride (NaCl), pH 5, over 10 CV. The main peak containing the bis-cysteamine-capped anti-ASGR1 cys mAb was collected and buffer exchanged by dialysis into 10 mM sodium acetate, pH 5.2 containing 9% sucrose.

siRNA duplex containing a sense strand having the sequence (5'-3') of GfsusGfgGfaAfgAfAfAfgAfuGfaAfgUfuUf (SEQ ID NO: 4698) and an antisense strand having the sequence (5'-3') of asCfsuUfcAfuCfuuuCfuUfcCfcAfcsUfsu (SEQ ID NO: 4699) using mAb-siRNA conjugates were generated. The notation for sense and antisense sequences is the same as that used for the nucleotide sequences in Tables 6 and 8 above. The siRNA duplex had a 19 base pair duplex region with a 2 nucleotide overhang at the 3' ends of the sense and antisense strands. The sense strand of the siRNA duplex had a homoserine-aminohexanoic acid (hSer-Ahx) modification at its 3' end. siRNA duplexes were formed in 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4 by heating at 90° C. for 5 minutes immediately followed by cooling to room temperature for 30 minutes. The 3'hSer-Ahx siRNA duplex was further functionalized with bromoacetyl groups using succinimidyl bromoacetate (SBA) (Figure 7A). The 3'hSer-Ahx siRNA duplex in 100mM potassium acetate, 30mM HEPES-KOH, pH 7.4 was incubated with 10-20 equivalents of SBA for 1 hour at room temperature. Subsequently, another 10-20 equivalents of SBA were added and the reaction mixture was incubated for an additional hour at room temperature. The reaction was monitored using LC-TOF. Excess SBA was removed from 3'-bromoacetyl-siRNA by buffer exchange using an Amicon-15 3k spin concentrator with 50mM sodium phosphate, 2mM ethylenediaminetetraacetic acid (EDTA), pH 7.5.

Bis-cysteamine-capped anti-ASGR1 cys mAb (approximately 5 mg/mL in 10 mM sodium acetate containing 9% sucrose) was added to 3-4 equivalents of tris(2-carboxyethyl)phosphine (TCEP) or triphenylphosphine-3, Partial reduction was performed using 3',3''-trisulfonic acid trisodium salt (TPPTS) for 60-90 min at room temperature (Figure 7B). The reaction was monitored using analytical cation exchange chromatography. TCEP or TPPTS was removed and the partially reduced cys mAb was buffer exchanged into 50mM sodium phosphate, pH 7.5 containing 2mM EDTA. 6-10 equivalents of dehydroascorbic acid (DHAA) were added to the partially reduced cys mAb and oxidation was performed at room temperature until only trace amounts of reduced mAb species were observed (30-180 min). . Six equivalents of bromoacetyl-siRNA duplex were added to the reaction mixture without removing DHAA, and alkylation was carried out at room temperature for 15-48 hours (Figure 7B). Excess siRNA duplexes and small molecule reagents were removed by size exclusion chromatography (SEC) using an isocratic flow of 0.17 M potassium phosphate, 0.21 M potassium chloride, 10% (v/v) isopropanol, pH 7. Removed. Anti-ASGR1 mAb-siRNA conjugates with RNA-antibody ratios (RAR) of 1 and 2 were separated using anion exchange chromatography. The SEC pool was diluted in 20mM Tris-HCl, pH 7, 100mM NaCl and loaded onto a Q HP column (GE Healthcare Life Sciences). The column was washed with 5 CV of 20mM Tris-HCl pH 7, 100mM NaCl, followed by gradient elution with 20mM Tris-HCl pH 7 containing 0.4-1M NaCl over 20CV. Purified RAR1 (Compound 3549) and RAR2 (Compound 3550) products were buffer exchanged into Dulbecco's phosphate buffered saline (DPBS) using spin concentration.

The mAb-siRNA conjugates were evaluated for activity in a free uptake assay to determine whether the antibodies were able to efficiently deliver siRNA to human primary hepatocytes and inhibit ASGR1 expression. Various concentrations (0.18 nM to 400 nM) of anti-ASGR1 mAb conjugated to one or two ASGR1 siRNA molecules (compounds 3549 and 3550, respectively) were incubated with human primary hepatocytes for 4 days. RNA was isolated from cells and processed for droplet digital PCR analysis to assess ASGR1 mRNA levels as described in Example 8. The results of the in vitro assay are shown in FIG. Anti-ASGR1 mAb conjugated to one or two ASGR1 siRNA molecules demonstrated 40-60% knockdown of ASGR1 mRNA. Unconjugated anti-ASGR1 cys mAb (PL-53515) was used as a control.

The anti-ASGR1 mAb-siRNA conjugate was then tested for in vivo efficacy. Nine-week-old C57Bl/6 wild type mice were injected subcutaneously or intravenously with compound 3550 (30 mg/kg or 60 mg/kg) or GalNAc conjugated siRNA control. The GalNAc conjugated siRNA control had a sense strand with the sequence SEQ ID NO: 4698 and an antisense strand with the sequence SEQ ID NO: 4699, and was conjugated to the triantic GalNAc moiety at the 3' end of the sense strand. Serum and liver were collected from animals on days 2, 4, 8 and 15 after compound administration. Total RNA isolated from animal livers was processed for qPCR analysis to assess ASGR1 mRNA levels. ASGR1 protein expression in the liver was measured by ELISA. Serum levels of alkaline phosphatase (ALP) were measured by a clinical analyzer (AU400 chemical analyzer, Olympus).

mAb-siRNA conjugate 3550 efficiently delivered siRNA to its mRNA target in vivo. The highest knockdown level (approximately 80%) was obtained from intravenous administration of 3550 mpk in wild-type mice measured on day 8 (Fig. 9A). ASGR1 protein expression in the liver was also measured, and more than 80% reduction of ASGR1 protein was achieved in the 30 mpk intravenously administered group (Figure 9B), consistent with the level of mRNA knockdown. The nadir of protein knockdown was at day 8 for anti-ASGR1 mAb-siRNA conjugates administered either intravenously or subcutaneously and at day 4 for GalNAc-siRNA conjugates. mAb-siRNA conjugate 3550 resulted in a 2-4-fold increase in ALP at day 8, corresponding to a reduction in ASGR1 mRNA levels and protein expression (FIG. 10). Anti-ASGR1 antibody alone did not induce any increase in ALP even at 100 mg/kg (data not shown).

Collectively, the results of these experiments demonstrate that an anti-ASGR1 antibody can be used in place of the GalNAc moiety to efficiently deliver siRNA duplexes to the liver. The mAb-siRNA conjugate showed comparable efficacy to the GalNAc-siRNA conjugate in terms of inhibiting ASGR1 expression in the liver and increasing serum ALP levels, a biomarker of target inhibition.

All publications, patents and patent applications discussed and cited herein are incorporated by reference in their entirety. It is understood that the disclosed invention is not limited to the particular methodologies, protocols and materials described, which may vary. It is also understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the claims.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be covered by the appended claims.

Claims (1)

Invention described in the drawings.