JP2023529567A - Nucleic Acid Amplification Assay Using 3-D Magnetic Resonance Imaging Detection for Screening Large Populations - Google Patents

Abstract

The present invention provides methods for high-throughput screening and detection of nucleic acids from pathogens such as SARS CoV-2 using nucleic acid amplification and MRI or NMR detection by nanoparticle binding complex formation. In certain embodiments, the MRI is three-dimensional MRI that detects multiple amplified nucleic acid-nanoparticle complexes simultaneously. In certain embodiments, nucleic acids are amplified by isothermal LAMP technology. In other embodiments, nucleic acids are amplified by PCR. The methods of the invention are particularly useful for rapid screening of large numbers of samples in pandemic situations. [Selection diagram] Fig. 1

Description

This application claims priority benefit under 35 USC §119 of U.S. Provisional Patent Application Nos. 62/704,540 (filed May 14, 2020) and 63/133,431 (filed January 4, 2021) do. These are incorporated herein by reference.

FIELD OF THE INVENTION The present invention relates to methods and systems for simultaneously detecting the presence or absence of one or more target nucleic acid sequences in multiple samples using three-dimensional imaging. Specifically, the present invention relates to large-scale, sensitive and rapid detection of nucleic acid sequences in human clinical specimens using three-dimensional (3-D) magnetic resonance detection. The methods of the present invention can be used in large numbers of human and/or non-human animals to test biological specimens (e.g., nasal swabs, saliva, sputum, blood, etc.) as needed in endemic, epidemic, particularly pandemic situations. ) for the presence of microbiological agents (eg, viruses, bacteria, fungi).

Detecting the presence of specific nucleic acid sequences using nucleic acid amplification methods is a powerful diagnostic tool. Polymerase chain reaction (PCR), Loop Mediated Isothermal Amplification (LAMP) and other methods can rapidly amplify specific target DNA sequences present in large numbers of samples. The discovery and clinical use of reverse transcription (RT) amplification has enabled the detection of RNA viruses (influenza, SARS, MERS, COVID-19, dengue virus, hepatitis C) in bacteria, fungi, plants and animals, including humans, and organisms. , hepatitis E, West Nile, Ebola virus, rabies, polio, mumps, and measles viruses), and DNA viruses (e.g., papillomaviruses, poxviruses, herpesviruses, and adenoviruses). became possible.

The recent SARS-CoV-2 pandemic demonstrated the urgent need and importance of rapid, high-throughput, large-scale surveillance of viral pathogens. The rapid spread of the SARS-CoV-2 virus and related coronaviruses (causing Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS)) has proven to be extremely dangerous, and the virus Large parts of the world have been shut down for an extended period of time to stop the spread of the virus. Controlling the spread of such deadly viruses requires rapid detection so that infected individuals can be identified, tracked and isolated.

COVID-19 is a newly emerging coronavirus first recognized in Wuhan, Hubei Province, China in December 2019, severe acute respiratory syndrome coronavirus 2 (SARS). CoV-2) is a respiratory tract infection. The sequence of this virus suggests that SARS-CoV-2 is a betacoronavirus closely related to SARS-coronavirus-1. See Wu et al., “A new coronavirus associated with human respiratory disease in China” Nature 579:265 (2020).

Cleaning and diagnosing the hundreds of millions of people worldwide infected with SARS-CoV-2 requires methods and systems that can process millions of clinical samples per day at low cost. As the conventional system was slow to reach these goals, infections surged and many died from COVI-19.

A standard molecular diagnostic test for RNA viruses such as SARS-CoV-2 is a multi-step process involving viral RNA extraction and quantitative reverse transcriptase PCR (RT-qPCR). Many companies produce RT-PCR kits that amplify viral RNA, but RNA extraction is difficult at any scale. Diagnostic labs use automated platforms that require specific reagents and consumables to run on a limited number of samples at a time. This inflexibility has led to the construction of large new laboratories with existing laboratory equipment to increase testing capacity and to allow the use of non-specific reagents and plastic RNA extraction on a more open platform. involved a great deal of effort to

Large-scale, rapid screening of human samples, such as nasal swabs and oral saliva samples collected over a short period of time from millions of people living in urban centers, will undoubtedly help prevent pandemics. It will help prevent the spread. Large-scale screening requires multiple steps that require coordinated efforts and systems to automate the process. These steps are:

a. sample collection,
b. Sample packaging and transportation to the processing site,
c. virus inactivation and sample lysis to kill pathogens and release genetic material;
d. purification and concentration of nucleic acids,
e. reverse transcription of viral RNA,
f. nucleic acid amplification using LAMP or PCR;
g. detection of amplified DNA,
h. Visualization of results from data processing i. identification of positive and negative samples in the collected samples and translation into individual diagnoses;
j. Optionally, identification of virus strains and their variants.

These processes must be well orchestrated to provide fast, reliable, accurate and actionable results from samples in a timely and cost-effective manner, thereby Intervention is needed to stop the spread of the disease through isolation, treatment and contact tracing.

In the current COVID-19 pandemic, traditional RT-PCR prior art methods offered limited capacity to screen only a small number of human samples per day per system. Conventional disease surveillance has not required mass screening, but its limitations have proven fatal for many victims of COVID-19. With available technology, screening large populations took more than a day, and up to more than a week, in the early days of the pandemic. By the time available screening methods identified infected individuals, the virus had spread to more people and the pandemic spiraled out of control and spread worldwide.

Several bottlenecks have been identified that have prevented testing capacity from meeting demand and need, including; Extracting nucleic acids from human clinical samples requires many steps, requiring complex automated equipment, a large amount of consumables, and a large number of scientifically trained technicians. was required, and a large number of medical workers were required to collect human samples. Also, there was no suitable means for self-collection. Processing hundreds of millions of human samples daily worldwide required expensive and sophisticated real-time PCR and real-time LAMP instruments, large amounts of reagents, large amounts of personal protective equipment, and large amounts of lab space.

The use of PCR methods slowed down the process significantly. This is because specially designed instruments must rapidly change the temperature of samples every minute or during tens of amplification cycles, and such instruments are especially equipped with detectors dedicated to every sample. , each using sophisticated and expensive instruments that track sample volume in real time and graphically plot results, sample volumes are limited when real-time PCR is used. Simpler methods such as LAMP perform nucleic acid amplification at a single temperature and may overcome this bottleneck.

In light of the COVID-19 experience, there continues to be a need for pathogen detection methods that are rapid, high-throughput, and agile enough to be rapidly adapted and deployed for when new pathogens emerge.

SUMMARY OF THE INVENTION The present invention provides a method for detecting a target nucleic acid comprising the steps of: a.
a) providing a sample containing a target nucleic acid;
b) amplifying a target nucleic acid with at least one primer, said at least one primer being biotinylated, thereby preparing a biotinylated target nucleic acid;
c) reacting the biotinylated target nucleic acid with streptavidin-nanoparticles, thereby forming amplified target nucleic acid-nanoparticle complexes; and ,
d) detecting the nucleic acid-nanoparticle complex by MRI or NMR.

In certain embodiments, the target nucleic acid amplification step can comprise LAMP or PCR, RT-LAMP or RT-PCR, and reverse transcription.

In certain embodiments, the sample is a human clinical sample such as saliva or nasal swabs.

In certain aspects, treatment with at least one of a chelating agent, proteinase K, guanidinium hydrochloride, guanidinium compositions, and combinations thereof to lyse or dissociate cells or release nucleic acids from associated proteins, although typically does not require nucleic acid isolation or purification.

The target nucleic acid can be the nucleic acid of a pathogen such as a pathogenic virus or bacteria such as SARS-CoV-2 or variants thereof.

The invention also provides a method for screening a plurality of samples as described above for the presence of a target nucleic acid, comprising the steps of:
a) providing a plurality of clinical samples containing the target nucleic acid;
b) amplifying a target nucleic acid in each of a plurality of clinical samples using at least one primer, wherein at least one primer is biotinylated, thereby preparing a plurality of biotinylated target nucleic acid samples; the step of
c) reacting each of a plurality of biotinylated target nucleic acid samples with streptavidin-conjugated nanoparticles, thereby forming a plurality of amplified target nucleic acid-nanoparticle complexes; and
d) detecting multiple nucleic acid-nanoparticle complexes by MRI or NMR.

Amplification of the target nucleic acid can include LAMP or PCR or RT-LAMP or RT-PCR. In certain aspects, amplification of the target nucleic acid includes reverse transcription.
In certain embodiments, the MRI is 3-D MRI that detects multiple nucleic acid-nanoparticle complexes simultaneously.

FIG. 1 is a representative MRI image obtained from a LAMP reaction of positive and negative samples shown in one embodiment of the present invention. FIG. 2 is a representative MRI image obtained from a LAMP reaction of positive and negative samples shown in another second embodiment of the invention. FIG. 3 is an image showing magnetic nanoparticles binding to virgin primers and forming strong associations between the nanobeads after the LAMP reaction, an embodiment that yields the MRI image of FIG. FIG. 4 is an MRI image showing MRI-detected PCR and RT-PCR detection. FIG. 5 shows a process for detecting DNA analytes according to one embodiment of the invention. Panel A shows the template, primers and nanoparticles used. Panel B shows the method steps of the process. B = biotin. S = streptavidin. NP = nanoparticle core. FIG. 6A shows the random orientation of the spins of non-zero spin NMR active nuclei. FIG. 6B shows the effect of a uniform magnetic field on the NMR-active nuclei of FIG. 6A. FIG. 6C shows the effect of a high frequency RF pulse on the oriented NMR-active nuclei of FIG. 6B. FIG. 7 shows spin-lattice relaxation (T1) (top panel) and spin-spin relaxation (T2) (bottom panel) for NMR-active nuclei. In panel A, nuclei are shown in a uniform magnetic field oriented in the direction of the bulk magnetization vector. The nuclei reorient in response to the radio frequency pulse (B panel) and eventually "relax" towards the bulk magnetization vector (C panel).

DETAILED DESCRIPTION DEFINITIONS It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. As used herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, "or" means "and/or" unless stated otherwise. As used herein, terms such as “comprising,” or any other variation thereof, are to be understood as non-limiting, processes, methods, compositions, reaction mixtures, kits, or devices comprising , are intended to cover non-exclusive inclusion rather than including only those elements, not expressly recited in such processes, methods, compositions, reaction mixtures, kits, or devices. May contain other unique elements. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

Unless specific definitions are provided, the nomenclature and laboratory procedures and techniques used in connection with molecular biology, biochemistry and organic chemistry described herein are known in the art. It is. Standard chemical and biological symbols and abbreviations are used interchangeably with the full names represented by such symbols and abbreviations. Thus, for example, the terms "deoxyribonucleic acid" and "DNA" are understood to have the same meaning. Standard techniques for chemical synthesis, chemical analysis, recombinant DNA methods, and oligonucleotide synthesis can be used. Reactions and purification techniques can be performed using kits according to manufacturer's specifications, eg, as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in the various general or more specific references cited and discussed throughout this specification. can be See, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)); Maniatis et al. ., 1982 Molecular Cloning, Cold Spring Harbor Laboratory, Plainview, New York; Harlow & Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988)); Rieger et al, 1991 Glossary of genetics : classical and molecular, 5th Ed., Berlin: Springer-Verlag; Current Protocols in Molecular Biology, F.M. Ausubel et al, Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. , (1998 Supplement); Wu (Ed.) 1993 Meth. Enzymol. 218, Part I; Wu (Ed.) 1979 Meth. Enzymol. Grossman and Moldave (Eds.) 1980 Meth. Enzymol. 65; Miller (ed.) 1972 Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Old and Primrose, 1981 Principles of Gene Manipulation, University of California Press, Berkeley; Schleif and Wensink, 1982 Practical Methods in Molecular Biology; Glover (Ed.) 1985 DNA Cloning Vol. I and II, IRL Press, Oxford, UK; Hames and Higgins (Eds.) 1985 Nucleic Acid Hybridization, IRL Press , Oxford, UK; and Setlow and Hollaender 1979 Genetic Engineering: Principles and Methods, Vols. 1-4, Plenum Press, New York.

Definitions of common terms in chemistry can be found in Compendium of Chemical Terminology (IUPAC recommendations), ^2nd Ed., 1997, Blackwell Science Inc, Oxford, UK (McNaught, ed.). It is available in a searchable online form on the World Wide Web at goldbook (dot) iupac (dot) org, which is incorporated herein by reference. For principles, methods, calculations and terminology related to NMR, see Levitt, 2008, Spin Dynamics: Basics of Nuclear Magnetic Resonance John, ^2nd Ed., which is incorporated herein by reference. John Wiley & Sons, Inc., West Sussex, England; Palmer, III, et al., 2005, Protein NMR Spectroscopy, Second Edition: Principles and Practice, Elsevier Academic Press, San Diego, CA; Ernst et al. (eds. ), 1990, Principles of Nuclear Magnetic Resonance in One and Two Dimensions, Oxford University Press, Oxford, UK; Mehring et al., 2001, Object-Oriented Magnetic Resonance: Classes and Objects, Calculations and Computations, Academic Press, San Diego, CA; Abragam, 1961, The Principles of Nuclear Magnetism, (International Series of Monographs on Physics, Book 32), Oxford: Clarendon Press, Clarendon, UK; Slichter, 1990, Principles of Magnetic Resonance, Springer, Berlin; Fukushima et al, 1981, Experimental Pulse NMR: A Nuts and Bolts Approach, Addison-Wesley, London.

It should be understood that "a" or "an" as used in the specification and claims can mean one or more depending on the context in which it is used. Thus, for example, reference to "a cell" can mean at least one cell, two cells, or multiple (three or more) cells.

As used herein, "about" means that the number referred to as "about" includes the stated number plus or minus 1-10%. For example, "about" 50 nucleotides means 45-55 nucleotides, or 49-51 nucleotides, as the case may be. Whenever written herein, a numerical range such as "45-55" refers to each integer within the specified range. For example, "45-55 nucleotides" means that the nucleic acid contains 45, 46 to 55 nucleotides. Where the range to be described includes fractional values such as "1.2%-10.5%", the range is shown with a given range referring to each fractional value in the smallest increment. For example, "1.2%-10.5%" would change the percentage from 1.2%, 1.3%, 1.4%, 1.5%, etc. up to 10.5% to 10.5%. means. "1.20%-10.50%" indicates that the percentage is 1.20%, 1.21%, 1.22%, 1.23%, etc. and is less than or equal to 10.50%.

As used herein, "transcription" refers to the enzymatic synthesis of RNA copies of one strand of DNA (ie, the template) catalyzed by an RNA polymerase (eg, a DNA-dependent RNA polymerase). "Reverse transcription" refers to the enzymatic synthesis of DNA copies of one strand of RNA (ie, template), catalyzed by a reverse transcriptase polymerase (eg, an RNA-dependent DNA polymerase).

A "target analyte" or "target" as used herein includes, but is not limited to, any molecule, molecular complex, cell or other substance that is desired to be detected in an assay and may be present in a sample. Point. In certain embodiments of the invention, nucleic acid targets can be tagged with biotin, which has exceptional binding affinity for avidin and streptavidin, and the target-specific binding sites coupled to the nanoparticles are avidin or streptavidin, which facilitates target viewing by the methods of the invention. The bond formed between biotin and avidin or streptavidin has the highest affinity of any known non-covalent bond with a Kd of about 10 ⁻¹⁴ to 10 ⁻¹⁵ M. Biotin is a small molecule that can be incorporated into DNA during PCR using end-labeled primers, producing a double-stranded DNA product with biotin at one or both ends. Biotin is a biotinylated deoxyribonucleoside 5'-triphosphate (dNTP) such as biotin-4-dUTP and an exonuclease-free thermostable DNA polymerase (e.g. Vent _R ^R (exo-), New England Biolabs, Ipswich). , MA) can also be used to incorporate into DNA during PCR. See Tasara et al., Nucleic Acids Research, 2003, Vol.

Replacing dTTP with biotin-4-dUTP and combining with the appropriate template facilitates high biotinylation of target analytes. Streptavidin and avidin are multimeric proteins that each bind four molecules of biotin.

In addition, biotin is believed to bind streptavidin cooperatively, so that multiple biotin molecules bind to a single streptavidin to form higher order NPC-A complexes (discussed below). See Sano et al., J. Biol. Chem., 265: 3369-3373, 1990 (incorporated herein by reference). In situations where a high proportion of biotin bound to streptavidin is not desired, monovalent, bivalent, trivalent and recombinant forms of streptavidin can be used. See Fairhead, et al. J. Mol. Biol. 426: 199-214 (2014), incorporated herein by reference.

Thus, in one embodiment of the invention illustrated in Figure 5, the target analyte is nucleic acid or the target is a cell or virus containing nucleic acid, which are amplified using biotinylated primers.

Also contemplated by the term "target analyte" are species derived from the target analyte as surrogates for the intact target. For example, viruses can be detected by detecting virus-specific nucleic acids. Such surrogates (eg, DNA and RNA) can be considered target analytes for purposes of detecting viruses according to certain embodiments of the invention. In such cases, detecting the virus-specific nucleic acid is referred to as "detecting the virus." Those skilled in the art will understand the distinction between target analytes and surrogate molecules, including inferences that can and cannot be made. For example, detection of viral nucleic acid does not indicate whether an infectious and replication-competent virus is present.

As used herein, the term "sample" refers to an aliquot of material, often an aqueous solution or suspension that can be derived from a biological material, that may contain a target analyte. can be something. Samples assayed for the presence of analytes by the methods of the invention include, for example, cells, tissues, homogenates, lysates, extracts, purified or partially purified proteins and other biomolecules, and mixtures thereof. Non-limiting examples of samples typically used in the methods of the invention include whole blood, serum, plasma, cerebrospinal fluid, sputum, bronchial lavage, bronchial aspirate, urine, lymph, and various respiratory fluids. human and animal body fluids such as exocrine secretions, intestinal and urogenital tracts, tears, saliva, milk, leukocytes, myeloma; body fluids such as cell culture supernatants; fixed or unfixed tissue specimens; or unfixed cell specimens; air samples, soil samples, aerosols, hydrosols, wipe samples (wet or dry) obtained from surfaces (wet or dry), water or other liquids, food and clinical specimens such as blood, Examples include environmental samples such as urine, saliva, tissue, sputum, stool and complexes.

Samples used in the methods of the invention will vary based on the nature of the tissue, cell, extract or other material being assayed, particularly the biological material. Methods for preparing, for example, homogenates, suspensions, solutions, extracts and fractions (containing nucleic acids) from cells or other biological material are well known in the art and include the methods described herein. It can be easily adapted to obtain matched samples.

As used herein, "amplification" refers to the process of making identical copies of a polynucleotide, such as a DNA or RNA fragment or region. Amplification can be accomplished by LAMP polymerase chain reaction (PCR), although other methods known in the art may be suitable for amplifying the DNA fragments of this invention.

A "target DNA or RNA sequence" or "target DNA or RNA" is a DNA or RNA sequence of interest that is desired to be detected, characterized, or quantified. The actual nucleotide sequence of target DNA may or may not be known. A "target DNA or RNA fragment" or "target fragment" is a segment of DNA or RNA that contains a target DNA or RNA sequence. Target fragments can be isolated from a sample or generated by any method including, for example, shearing, sonication, or digestion with one or more restriction endonucleases.

As used herein, a "template" is a polynucleotide from which complementary oligo- or poly-nucleotide copies are synthesized.

"Synthesis" generally refers to the process of producing nucleic acids through chemical or enzymatic means. Chemical synthesis is typically used to generate usable single strands of nucleic acid, as well as primers and probes. Enzymatically mediated "synthesis" includes both transcription and replication from a template. Synthesis involves making a single copy or multiple copies of a target. "Multiple copies" means at least two copies. A "copy" does not necessarily imply perfect sequence complementarity or identity with the template sequence. For example, copies may include nucleotide analogues, deliberate sequence alterations (such as sequence alterations introduced via primers containing sequences hybridizable to the template but not complementary), and/or during synthesis. Sequence errors that occur can be included.

The terms "polynucleotide" and "nucleic acid (molecule)" are used interchangeably to refer to polymeric forms of nucleotides of any length. A polynucleotide may comprise deoxyribonucleotides, ribonucleotides and/or analogs thereof. Nucleotides can be modified or unmodified, have any three-dimensional structure, and can perform any known or unknown function. The term "polynucleotide" includes single-, double-, and triple-stranded molecules. The following are non-limiting embodiments of polynucleotides: genes or gene fragments, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, any sequence. isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.

"Oligonucleotide" refers to a polynucleotide of 2 to about 100 nucleotides of single- or double-stranded nucleic acid, typically DNA. Oligonucleotides, also known as oligomers or oligos, can be isolated from genes and other biological material or chemically synthesized by methods known in the art. A "primer" refers to an oligonucleotide containing at least 6 nucleotides, usually single-stranded, that provides a 3'-hydroxyl terminus for initiation of enzyme-mediated nucleic acid synthesis. A "polynucleotide probe" or "probe" is a polynucleotide that specifically hybridizes to a complementary polynucleotide sequence. As used herein, "specifically binds" or "specifically hybridizes" refers to the binding of a molecule to another molecule under defined conditions. , duplex formation, or hybridisation. Thus, a probe or primer will "specifically hybridize" only to its intended target polynucleotide under given binding conditions, and an antibody will only "specifically hybridize" to its intended target antigen under given binding conditions. to “bind”. Conditions given are those indicated for binding or hybridization and include buffers, ionic strength, temperature and other factors within the purview of those skilled in the art. Those skilled in the art are also familiar with the conditions under which specific binding is broken or dissociated, thus allowing, for example, eluting or melting antibody-antigen, receptor-ligand and primer-target polynucleotide combinations. ing.

A "nucleic acid sequence" refers to a sequence of nucleotide bases in an oligonucleotide or polynucleotide such as DNA or RNA. For double-stranded molecules, single strand can be used to refer to both strands, with the complementary strand inferred by Watson-Crick base pairing.

The terms "complementary" or "complementarity" are used in reference to a first polynucleotide (which may be an oligonucleotide) in "antiparallel association" with a second polynucleotide (which may be an oligonucleotide). be done. As used herein, the term "reverse association" refers to two associations such that the individual nucleotides or bases of two associated polynucleotides are substantially paired according to the Watson-Crick base pairing rules. It refers to an alignment of two polynucleotides. Complementarity can be "partial," in which only some of the bases of the polynucleotides are matched according to the base pairing rules. However, there may be "complete" or "total" complementarity between the polynucleotides. Those skilled in the art of nucleic acid technology will know, for example, the length of the first polynucleotide, which can be an oligonucleotide, the base composition and sequence of the first polynucleotide, the ionic strength and the incidence of base pairing errors. Duplex stability can be determined empirically by consideration of a number of variables, including .

As used herein, the term "hybridization" is used in reference to the base-pairing of complementary nucleic acids, including oligonucleotides and polynucleotides containing 6 or more nucleotides. Hybridization and the strength of hybridization (i.e., the strength of association between nucleic acids) are measured by the degree of complementarity between nucleic acids, the stringency of the relevant reaction conditions, the melting temperature (Tm) of the hybrids formed. , and the G:C ratio within the double-stranded nucleic acid. Generally, "hybridization" methods involve annealing a complementary polynucleotide to a target nucleic acid (ie, the sequence detected by direct or indirect means).

The ability of two polynucleotides and/or oligonucleotides containing complementary sequences to be aligned with each other and annealed to each other via base-pairing interactions is a well-recognized phenomenon.

If non-specific hybridization of nucleic acids is observed, the reaction can be performed at higher stringency, such as medium stringency or high stringency instead of low stringency. As used herein, "high stringency" means hybridization at 0.2 to 0.5 x SSC at 60 to 65°C, or 100% refers to the condition requiring complementarity of "Medium stringency" refers to 1 to 2 x SSC at 50 to 60°C, and "low stringency" refers to 4 to 6 x SSC at 40 to 50°C. where 1×SSC is 0.15M NaCl, 0.015M sodium citrate. Some degree of mismatch between nucleic acids is tolerated at medium and low stringency. Those skilled in the art will appreciate other conditions and agents that can be used to further increase or decrease the stringency of nucleic acid hybridization (e.g. elevated temperature, addition of formamide or higher GC content of selected nucleic acid assays). things).

A "complex" is a collection of components. Complexes may or may not be stable and can be detected directly or indirectly. For example, as described herein, the existence of complexes can be inferred given the particular components of the reaction and the type of product of the reaction. For example, in the abortive transcription methods described herein, complexes are generally intermediates for final repetitive synthesis products, such as final abortive transcription or replication products.

As used herein, the term "contacting" (i.e., bringing the target analyte into contact with the nanoparticles) generally refers to bringing one component, reagent, target analyte or sample into close proximity with another. For example, contacting can include mixing a solution containing magnetic nanoparticles with a sample containing a target analyte. "Contacting" is intended to include incubating the target and the nanoparticles together in vitro (eg, adding the nanoparticles to a liquid sample containing the target analyte).

The term "substantially" as used herein refers to a substantial extent or degree. For example, "substantially uniform" can be used to describe a suspension in which the nanoparticles are dispersed to a large extent or to a large extent throughout the liquid, whereas slight variations in the distribution of the nanoparticles can occur within the suspension. May exist in different locations. In other contexts, the term "substantially" when combined with other terms means at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%. For example, "substantially free" (e.g., "substantially free of contaminants", "substantially free of target analytes", "substantially free of nanoparticles" or equivalent expressions) means that a solution, liquid, sample, etc., contains at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least about 100%, a contaminant, target analyte, nanoparticle or equivalent thereof It means that it does not contain the mentioned substances such as In contrast, a "substantially similar" composition, process, method, solution, etc. is at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%, a composition, process, method, solution, etc. Means similar to a method, solution, or composition, process, method, solution previously described herein, or any of the foregoing processes or methods, which are incorporated herein by reference in their entirety.

As used herein, a "binding site" refers to a specific group of atoms within a molecule that participates in the characteristic binding of a molecule to another molecule. Binding sites are a class of functional groups that can be attached or integrated into various base molecules while retaining their functional properties, eg binding to another molecule. In particular, "target analyte-specific binding sites" bind their analogous target analytes and impart target-specific binding to the nanoparticles when incorporated or attached to a base molecule such as a nanoparticle. . Target-specific binding sites suitable for use in the methods of the invention include, but are not limited to, natural and synthetic antibodies, nucleic acids, peptides, polypeptides, proteins, small organic molecules, ligands, receptors, carbohydrates (e.g. monosaccharides, polysaccharides, sugars), aptamers and combinations thereof.

The terms "detect," "detection," and "detected," as used herein, have their ordinary meanings known to those of skill in the art and refer to the molecules (e.g., nucleic acids) to be detected. or the detection of the amount of a molecule.

"Microarray" and "array" are used interchangeably to refer to an arrangement of a collection of compounds, samples, or molecules such as oligos or polynucleotides. Arrays are typically "addressable", with each member of the set having a uniquely identifiable position within the array. Arrays can be formed on solid substrates such as glass slides, on semi-solid substrates such as nitrocellulose membranes, or in containers such as tubes or microtiter plate wells. Common arrangements for arrays are 8 rows by 12 columns, such as in 96-well microtiter plates, and 16 rows by 24 columns, such as in 384 well PCR plates. Use in the methods of the invention is within the knowledge of those skilled in the art.

The term "solid support" refers to any solid phase that can be used, for example, to immobilize capture probes or other oligonucleotides or polynucleotides, polypeptides, antibodies or other molecules or complexes of interest. Suitable solid supports are well known in the art and non-limiting examples include walls of wells in reaction trays such as microtiter plates, walls of test tubes, polystyrene beads, paramagnetic or non-magnetic beads, glass slides. , nitrocellulose membranes, nylon membranes, latex particles and the like. Typical materials for solid supports include, but are not limited to, polyvinyl chloride (PVC), polystyrene, cellulose, agarose, dextran, glass, nylon, latex and derivatives thereof. Additionally, solid supports may be coated, derivatized or modified to promote attachment of desired molecules and/or to determine non-specific binding or other undesirable interactions. The choice of a particular "solid phase" is generally not critical and can be selected by one skilled in the art depending on the method and assay used. Conveniently, the solid support can be selected to accommodate various detection methods. For example, 96-well plates or 384-well plates can be used for assays that are automated, eg, by robotic workstations, and/or detected using, eg, plate readers.

Suitable methods for immobilizing molecules to solid phases include ionic, hydrophobic, covalent bonding, etc., and combinations thereof. However, the method of immobilization is usually not critical and may involve uncharacterized adsorption mechanisms. Accordingly, "solid support" as used herein can refer to any material that is insoluble or can be rendered insoluble by subsequent reaction. Solid supports can be selected for their inherent ability to attract and immobilize capture reagents. Alternatively, the solid support can carry additional molecules that have the ability to attract and immobilize, for example, "capture" reagents. "Detection limit," "threshold," and "detection threshold" are used interchangeably to refer to the lowest amount or concentration of target that can be accurately detected.

As used herein, "communicable disease" means a contagious disease (i.e., transmissible, contagious and/or contagious) that affects a large number of people within a community, population, or area. contagious)). "Pandemic" means an infectious disease that has spread to more than one country or continent. "Endemic" means an epidemic confined to a particular population or geographical area, such as a state or country.

The present invention is capable of detecting nanoparticles using a magnetic field, and the movement and interaction of nanoparticles, including nanoparticles bound to target-specific binding sites to form "target-analyte-specific nanoparticles." It is based on the observation that it can also be used to influence behavior. In particular, magnetic fields can be used to move nanoparticles, concentrate nanoparticles, and promote aggregation of nanoparticles. This can be used to influence the binding of target-specific sites on target-specific nanoparticles to their analogous targets, forming target-specific nanoparticle complexes in the presence of target.

The present invention provides a very sensitive and rapid method of detecting target analytes, whereby even when the target analytes are highly diluted, within hours, often 30 to 60 minutes. obtain a detectable signal within The present invention is directed to nanoparticles, including nanoparticles that can use magnetic fields to detect nanoparticles and that have bound target analyte-specific binding sites to form "target analyte-specific nanoparticles." It is based on the observation that it can be used to influence particle motion and interactions. In particular, magnetic fields can be used to move nanoparticles, concentrate nanoparticles, and promote aggregation of nanoparticles. This can be used to influence the binding of target-specific sites on target-specific nanoparticles to their analogous targets, forming target-specific nanoparticle complexes in the presence of target.

As known in the art and discussed in detail below, aggregation of nanoparticles can be detected using NMR techniques. According to the present invention, the NMR signal of a sample containing target-specific nanoparticle-target complexes is increased and optimized by subjecting the sample to a controlled magnetic concentration, disruption and resuspension process. can be done.

Accordingly, the present invention provides a method of detecting target analytes based on magnetic resonance measurements. This method uses "nanoparticles", which are nanometer-scale particles with a paramagnetic or superparamagnetic component, usually encased in a non-magnetic shell. It is attached to a site that directly or indirectly binds the analyte (a "target analyte-specific binding site"). In one aspect of the invention, magnetic nanoparticles in the form of magnetic resonance "nanoswitches" are used to detect target analytes. Magnetic resonance nanoswitches are dispersed states and clustered with changes in the spin-spin relaxation time (i.e. spin-spin dephasing time or T2) of adjacent water molecules by the target analyte or various forms of the target analyte. Magnetic nanoparticles that are induced to switch between states. In such embodiments, the measurable T2 value depends on the degree of aggregation of the nanoparticles in the sample.

Nuclear Magnetic Resonance "Nuclear Magnetic Resonance" or "NMR" is the physical phenomenon by which atomic nuclei in a magnetic field absorb and re-emit or "resonate" electromagnetic radiation. Atomic nuclei containing an odd number of protons and/or neutrons have an intrinsic magnetic moment and angular momentum called "non-zero spin" and are NMR active. Atomic nuclei with an even number of protons and neutrons are inert to NMR because their total spin is zero. Advantageously, NMR analysis of water-soluble molecules is frequently performed in aqueous solutions, since hydrogen in water molecules has nuclei with non-zero spin.

When placed in a magnetic field, NMR-active nuclei (ie, “non-zero spin nuclei”) absorb electromagnetic radiation with an isotopic frequency characteristic. Resonant absorption by nuclear spins only occurs when electromagnetic radiation of the correct frequency (ie the Larmor frequency of the isotope) is used. The phenomenon of nuclear magnetic resonance makes magnetization measurable. The resonant frequency and intensity are directly proportional to the strength of the magnetic field.

NMR-based techniques typically involve a series of sequential steps:
1. alignment (“polarization”) of magnetic nuclear spins in an applied spatially and temporally constant (“uniform”) magnetic field;
2. Disordering of nuclear spins (“excitation”) by application of an electromagnetic pulse, usually a radio frequency (RF) pulse; and.
3. Measurement of resonance energy "signal".

In an unmagnetized sample containing non-zero spin atoms, the spins of the ??NMR-active nuclei are randomly oriented. See Figure 6A.

Polarization in the presence of a uniform magnetic field aligns the NMR active nuclei in the direction of the uniform magnetic field. See Figure 6B.

As used herein, a "uniform magnetic field" refers to one that has the same magnitude and direction throughout a volume, such as a sample volume. It should be noted that a uniform magnetic field reorients the spins of atomic nuclei, but does not move magnetizable atoms like an inhomogeneous magnetic field. The magnetic moment of alignment is the vector quantity of the sum of the detectable non-zero spin nuclei in the sample, although the polarization of the individual magnetic nucleus spins is not readily detectable. The sum of these vector quantities in the sample (“bulk magnetization vector” or “bulk magnetization”; dashed arrows in FIG. 6B) is therefore measured using a detector.

Application of appropriate electromagnetic energy perturbeds the spin of individual nuclear vectors and reorients the bulk magnetization vector. A suitable electromagnetic pulse is typically a radio frequency (RF) pulse at the Larmor frequency to the relevant non-zero spin nuclei (e.g. H), typically applied in a plane perpendicular to the direction of the homogeneous magnetic field. . The Larmor frequency of H is 24.58 MHz/T. If the pulse duration is sufficient, the bulk magnetization vector reorients in the plane perpendicular to the uniform magnetic field, as shown in FIG. 6C. The bulk magnetization vector can be detected and recorded over time as it reorients in response to an RF pulse, or when reorientation occurs.

Relaxation Following perturbation of the array (excitation of non-zero spin nuclei), the bulk magnetization vector recovers to its original steady state over time. This process is called nuclear "magnetic relaxation". Two fundamental time constants (T1 and T2) of the single-exponential process are used to describe this relaxation.

T1—Longitudinal or Spin-Lattice Relaxation Recovery of the bulk magnetization vector along the direction of the first magnetic field (z-axis) (see FIG. 7, top panel) is called the “spin-lattice relaxation time” or “longitudinal relaxation time”. time” (T1). T1 quantifies the rate of transfer of energy from the nuclear spin system to its surroundings, including neighboring atoms and molecules (the "lattice"). T1 measurements allow structural characterization of complex biomolecules using NMR. Here, energy transfer to the lattice is affected by the properties of the surrounding atoms within the molecule. T1 is typically on the order of milliseconds to seconds. T1 can be detected by using a detection coil to observe the change in the bulk magnetization vector of the sample as a function of time between the depolarizing pulse and the polarization measurement.

T2—transverse or spin-spin relaxation The recovery of the bulk magnetization vector in the plane perpendicular to the direction of the first magnetic field (xy-plane) (see FIG. 7 lower panel) is called the “spin-spin relaxation time” or “ called the "transverse relaxation time" (T2). T2 quantifies the energy transfer rate between spins in the partially transverse plane without energy transfer to the lattice. For aqueous signals, T2 is typically in the range of 100 milliseconds or more. Solid samples, on the other hand, typically have T2 values in the range of 1 to 100 microseconds.

Spin-spin relaxation is usually measured by a train of RF pulses, giving rise to a "spin echo signal". A spin echo is generated by a 90 degree pulse followed by a small delay time (τ) followed by a 180 degree pulse (90°-τ-180°). The bulk magnetization vector is recorded after a second τ of the same time as the first is used. This sequence of RF pulses and time delays is used to first dephase the nuclear magnetic moment containing the bulk magnetization in the plane perpendicular to the first magnetic field during the first τ, and during the second τ refocus the remaining bulk magnetization in this plane during . This latter refocusing produces an echo signal, which can be detected and recorded.

The most common method for measuring spin-spin relaxation is that described by Carr and Purcell ("Effects of Diffusion on Free Precession in Nuclear Magnetic Resonance Experiments", Physical Rev.94:630-638 (1954)). and this modified method is described by Meiboom and Gill ("Modified Spin-Echo Method for Measuring Nuclear Relaxation Times", Rev. Scientific Instruments 29: 688-691 (1958)). These are incorporated herein by reference.

The Meiboom-Gill (CPMG) method, a modification of the Kerr-Purcell method, used a series of small time delays and applied a 180° pulse after the initial 90°-τ-180° sequence described above. Then follows the resulting bulk magnetization vector −[90x−(τ−180y −τ−record)n]. The amplitude of the spin echo signal is proportional to the bulk magnetization remaining in the echo and decreases continuously over time (usually with increasing values of n). Therefore, measuring the strength of the bulk magnetization vector after various values of n and fitting the data to the monoexponential decay of the relaxation time T2 can provide a direct measure of T2.

Suitable equipment and software for performing NMR and determining relaxation constants (e.g., T1 and T2) is from Bruker Corp. (Tucson, A Z; e.g. Minispec, NanoBay and AVANCE NMR with Dynamics Center software), HTS-110. Available from a variety of vendors including Limited (Lower Hutt, NZ; e.g. Field Cycling Relaxometer), Magritek (San Diego, CA; e.g. KeaNMR), Oxford Instruments (Austin, TX; e.g., Pulsar with SpinFlow software). can. An NMR spectrometer typically operating at 20 MHz can be used. The sample coil should be small enough to fill 100 microliters of sample with a fill factor of 50 to 100%. A CPMG (Car-Purcell-Meiboom-Gill) pulse sequence can be used to measure T2 in a 20 MHz RF field.

MRI versus NMR
MRI utilizes the same physical effects as NMR spectroscopy and is typically used to identify unknown compounds by the resonance properties of their constituent atoms. In both NMR and MRI, a sample is placed in a static magnetic field, briefly excited with radio frequency energy, and re-emitted. NMR detects characteristic frequencies of re-emitted energy. It differs very slightly based on the structure of the molecule. MRI focuses on the disruption of magnetically aligned protons (common in water in the human body) and their realignment after radio frequency excitation, which depends on the thickness and hardness of the tissue in which the protons/water molecules reside. change based on By carefully monitoring the reemitted photons as they reach the MRI detector, the location and shape of various tissues can be determined. MRI equipment has been developed to generate and analyze such shapes and positions in 3D. Therefore, it is suitable for analysis of a three-dimensional array of samples.

The main difference between NMR spectroscopy and MRI imaging is that NMR produces information (a spectrum of light that corresponds to a chemical structure) based on the frequency of the emitted radiation (related to the velocity of vibrating protons). . Instead, MRI uses the intensity of radiation (the amount of re-emitted photons) arriving from different parts of the body to produce information (an image of the body). Protons in high densities or solid structures are more or less prone to misalignment when destructive radio waves are applied to body tissue, resulting in fewer reemitted photons coming from that region. , areas of the resulting image are darkened.

Magnetic Resonance Effect of Nanoparticles In an aqueous medium, which generally has a long T2 (on the order of 2,000 milliseconds), the addition of nanoparticles generally results in a magnetic resonance effect if the nanoparticles are uniformly dispersed or suspended throughout the solution. Characteristic T2 is lowered. This effect is believed to be due to the depolarization of neighboring water molecules, with each nanoparticle acting as a 'depolarizing center'. However, when nanoparticles (of the types and sizes specified herein) in an aqueous environment are clustered by aggregation, condensation, condensation, precipitation, etc., the number of depolarizing centers is reduced, thus leading to T2 The impact is also reduced. As a result, the T2 of the aqueous solution increases relative to the T2 of the medium when the nanoparticles are dispersed. Generally, in the method of the invention, an increase in T2 is proportional to a decrease in depolarization centers dependent on nanoparticle aggregation.

If the aggregation of nanoparticles depends on the interaction of nanoparticles, particularly target-specific nanoparticles, with targets, this effect can be exploited for the detection of targets in solution: in the absence of target, nanoparticles disperses, resulting in a global depolarization of the water in solution and thus a short T2 is observed; in the presence of the target, the target-specific nanoparticles form a complex with the target and Since the number of polarization centers is reduced, the overall depolarization is reduced (compared to dispersed nanoparticle suspensions) and T2 is increased. This effect is illustrated in FIG.

Furthermore, the nanoparticles of the present invention are attracted by magnetic fields and can be concentrated in areas of highest magnetic field strength in non-uniform magnetic fields. As used herein, the term "inhomogeneous magnetic field" refers to a magnetic field that varies with location. Typically, an inhomogeneous magnetic field is strongest closest to the source of the magnetic field (i.e., the magnet) and decreases in magnitude with increasing distance from the source (in a "uniform magnetic field", the magnetic field spreads over a region have the same magnitude and direction throughout).

Paramagnetic materials such as nanoparticles used in the method of the invention move in a non-uniform magnetic field, but not in a homogeneous magnetic field. For example, when an external magnet contacts a test tube containing a suspension of nanoparticles in a liquid, thereby creating a non-uniform magnetic field, the nanoparticles are attracted towards the external magnet, as shown in FIG. Concentrate on the inner surface of the tube adjacent to the magnet (tube D). Since the effect depends on the presence of an external magnet, the nanoparticles are released when the magnet is removed. The concentrated nanoparticles are ultimately redistributed by diffusion and dispersed throughout the liquid, and the process of redistribution can be accelerated by resuspension by mixing, stirring, scraping, etc., as described below. can.

Properties of Nanoparticles Nanoparticles according to the present invention may be monodisperse (single crystal of magnetic material, e.g. single crystal of metal oxide such as superparamagnetic iron oxide per nanoparticle) or polydisperse (multiple crystals, e.g. 2, 3 or 4 crystals per particle). Magnetic metal oxides can also include cobalt, magnesium, zinc, silicon, tin, titanium, bismuth, and/or mixtures of these metals with iron. Important features and properties of nanoparticles contemplated for use in the methods of the present invention include; (i) having high relaxivity, i.e., having a strong effect on water relaxation; (ii) nanoparticles are (iii) a size large enough to allow the nanoparticles to be concentrated using a magnet under the conditions used in the assay method of the invention; and ( iv) stability in solution, ie the nanoparticles do not dissolve or precipitate.

When used in certain embodiments of the present invention, 100 to 200 nm nanoparticles have been found to be very effective at depolarizing adjacent water molecules, resulting in T2 of about It decreases from 2,000 milliseconds to about 100 to about 200 milliseconds. The size is easily concentrated by a non-uniform magnetic field and can remain in suspension for long periods without settling. Advantageously, non-specific binding to smaller nanoparticles can also be minimized. about 75 nm, about 100 nm, about 125 nm, about 150 nm, about 175 nm, about 200 nm, about 225 nm, about 250 nm, 275 nm, about 250 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, 400 nm, about 425 nm, about 450 nm, about Nanoparticles ranging from at least about 60 nm to about 500 nm, such as 450 and 500 nm and larger, are contemplated for use in the methods of the invention. Particularly suitable nanoparticle sizes include at least about 80 nm to about 180 nm, such as about 85 nm, about 90 nm, about 95 nm, about 100 nm, about 105 nm, about 110 nm, about 115 nm, about 120 nm, about 125 nm, about 130 nm, about 135 nm, about 140 nm, about 145 nm, about 150 nm, about 155 nm, about 160 nm, about 165 nm, about 170 nm, about 175 nm.

Preparation of Nanoparticles The synthesis of various polymer-coated metal oxide "core" particles for biological applications has been disclosed in the prior art, particularly for magnetic resonance imaging applications. Examples include less than 200 magnetizable nanoparticles suitable for use in the methods of the invention.

Nanoparticle cores can be prepared from any type of magnetizable material (e.g. paramagnetic or superparamagnetic) using known techniques, e.g. Fe, Co, Sn, Al, Ni, Ti, Bi, Zr, Pt, Pd, Sr, Ir, Ca, Mg, Mn, Ba and/or Zn can be used. In certain embodiments, the nanoparticles are made from metal oxides, such as iron oxides, such as magnetite (Fe ₃ O ₄ ) and maghemite (γ-Fe ₂ O ₃ ), pure metals such as Fe and Co, alloys such as FePt. , coprecipitation, pyrolysis and/or reduction, micellar synthesis, hydrothermal synthesis, plasma-based and laser pyrolysis techniques. Fu et al., Angewandte Chemie Int'l Ed. 46:1222-44, 2007). This is referenced and incorporated herein. Coprecipitation can be used to synthesize iron oxides such as Fe ₃ O ₄ and γ-Fe ₂ O ₃ from aqueous solutions of Fe ²⁺ /Fe ³⁺ salts. See, for example, PCT Publication No. WO2006/125452. This is referenced and incorporated herein. It discloses the preparation of iron oxide particles by alkaline co-precipitation of ferric chloride and ferrous chloride in aqueous solution.

Monodisperse magnetic nanocrystals can be synthesized by pyrolysis of organometallic compounds in high-boiling organic solvents containing stabilizing surfactants. See U.S. Pat. No. 7,029,514. This US patent is incorporated herein by reference. In another approach, water-in-oil microemulsions containing the desired reactants are mixed and coalesced to form micelles with precipitates therein. Such microemulsions can therefore be used as nanoreactors to form nanoparticles. See, for example, US Pat. No. 8,512,665. This US patent is incorporated herein by reference. Hydrothermal synthesis can synthesize a wide variety of different nanocrystals by exploiting common phase transfer and separation mechanisms that occur at the interfaces of the liquid, solid, and solution phases present during synthesis. See, for example, US Pat. No. 7,732,015. This US patent is incorporated herein by reference. U.S. Patent Publication No. 2004/0009118, incorporated herein by reference, produces an aerosol of solid metal particulates and generates a plasma having a plasma hot zone at a temperature sufficiently high to convert the particulates into a metal vapor. and directing an aerosol into a plasma hot zone to produce metal oxide nanoparticles.

Additional magnetic particles suitable for use in the methods of the present invention are disclosed in U.S. Pat. and US Patent Publication Nos. 2003/0092029, 2003/0124194, 2006/0269965, and 2008/0305048. These disclosures are incorporated herein by reference in their entireties.

Nanoparticle suspensions produced using the techniques described above typically contain particles having various characteristics such as size. The heterogeneous nature of nanoparticle suspensions can reduce the performance of the suspensions in the methods of the invention.

Methods for improving particle homogeneity have been described for the preparation of dispersed aqueous systems intended for use as injectable liquids. Such homogenization methods include rotor-stator methods and high pressure methods. The use of liquid jet or liquid slot nozzle high pressure homogenizers (eg, available from Microfluidics, a division of MFIC, Corp., Newton, Mass.) allows the application of high mechanical energy (see, for example, US Pat. 5,635,206; 5,595,687 (incorporated herein by reference).

A high-pressure homogenizer for the production of metal oxide nanoparticle compositions using controlled agglomeration followed by drying in emulsions in which the non-aqueous component contains oxides, catalyst materials [e.g. No. 5,304,364, incorporated herein by reference), reported in connection with the industrial production of electrophotographic pigment particles, ceramic powders, felt materials, spray layers, active material carriers, and ion exchange resins. (eg, US Pat. No. 5,580,692, incorporated herein by reference). as well as. Emulsions are multiphase dispersions of two or more insoluble liquids. Emulsions are composed of at least one continuous (external) phase (eg water) and one separate (dispersed or internal) phase (eg oil). Emulsions are thermodynamically unstable.

High pressure homogenizers are often used for the preparation or stabilization of emulsions and suspensions in the pharmaceutical, cosmetic, chemical and food industries. It is also known that nanoscale metal oxides can be prepared using high shear forces in fluidizers (eg, US Pat. No. 5,417,956, incorporated herein by reference). For example, pressures up to 200 MegaPas (MPa) or more are used in some applications.

Typically, the nanoparticle core is coated with a polymer or other substance to stabilize the core and provide a material to which target-specific binding sites can be attached. The terms "conjugate" or "bonded" as used herein refer to two molecules that are covalently or otherwise linked together. Conjugation to suitable surface coatings is accomplished by methods well known in the art, such as those described in Wong, et al., Chemistry of Protein and Nucleic Acid Cross-Linking and Conjugation, ^2nd Ed. (CRC Press; Boca Raton, FL) and Hermanson, "Bioconjugate Techniques, ^3rd Ed." Academic Press, New York, 2013i. These are incorporated herein by reference. In general, the ratio of binding sites to nanoparticles can be controlled to give the desired ratio of nanoparticles to binding sites.

The most commonly used coating material is dextran in various forms. Other compatible carbohydrates such as arabinogalactans, starches, glycosaminoglycans, proteins (eg, US Pat. No. 6,576,221, incorporated herein by reference), and silica are also used. One such method is precipitation of Fe(II) and Fe(III) salts in the presence of dextran (e.g., US Pat. No. 4,452,773, incorporated herein by reference). ). A modified method involves the use of sonication followed by heat treatment within the same apparatus (eg, US Pat. No. 4,827,945, incorporated herein by reference). The quality of this method is enhanced by magnetic sorting (eg, PCT International Publication No. WO 90/07380, incorporated herein by reference). Further encapsulation/coating can improve the properties of the nanoparticles through the use of amphiphilic substances for stabilization. This is described in US Pat. No. 5,545,395 and EP 0272091, which are incorporated herein by reference).

Wet-chemical synthesis can be performed either by coating with the polymer components (core-shell method) or in the presence of the polymer (one-pot method). In the core-shell method, iron oxide cores tend to aggregate in an aqueous solution, so it is necessary to add a stabilizing substance to the iron oxide. Amphiphiles (e.g. PCT International Publication No. WO 01/56546, incorporated herein by reference) or additional nanoparticles with charged surfaces can be selected as stabilizers (e.g. (U.S. Pat. No. 4,280,918, incorporated in ).

However, surfactants used as stabilizers can affect and limit nanoparticle surface functionality. The one-pot method coats the polymer directly during iron oxide formation to stabilize the formation process and crystal growth from solution.

In certain embodiments, the coating is functionalized to facilitate binding to target-specific binding sites. Functional groups contemplated for use in the nanoparticle coatings of the present invention include, without limitation, amino, carboxyl, sulfhydryl, amine, imine, epoxy, hydroxyl, thiol, acrylate, and/or isocyano groups. Carboxy-functionalized nanoparticles can be made, for example, according to Gorman's method (see PCT International Publication No. WO 00/61191). More stably coated, amino-functionalized nanosensors have been prepared, for example, by cross-linking the dextran coating of metal oxide particle cores with epichlorohydrin, followed by treatment with ammonia to provide functional amino groups. can. Aminated cross-linked iron oxide nanoparticles (amino-CLIO) are made with 40 amino groups per particle and an average particle size of about 40 to about 50 nm. These particles can withstand harsh treatments such as incubation at 120° C. for 30 minutes without change in size or loss of dextran coat.

Nanoparticles of various sizes and compositions suitable for use in the methods of the invention can be obtained commercially, for example, from Sigma Aldrich (St. Louis, MO), Nanocs Inc. (NY, NY ), NanoComposix (San Diego, CA), MKNano (Missisauga, ON, Canada), Miltenyi Biotec (San Diego, CA), Ademtech (Pessac, France), Chemicell GmbH (Berlin, Germany), Corpuscular Inc. (Cold Spring, New York), Nvigen ^Inc. (Sunnyvale, CA), NanoTherics Ltd. (Staffordshire UK), Cytodiagnostics Inc. (Burlington, Ontario, Canada), Eprui Nanoparticles & Microspheres Co. (Nanjing, China), Polysciences, Inc ^R , SA. (Warrington, PA). Commercially available nanoparticles are coated, uncoated, functionalized, and have common binding sites such as biotin, avidin, streptavidin, secondary antibodies, protein A, protein G, etc. There are also nanoparticles bound to

Target Nucleic Acid Detection Assays In certain embodiments, the present invention is based on the observation that reactions between target-specific nanoparticles and their targets are affected by and can be detected using a magnetic field. Methods are provided for detecting targets in which target-specific nanoparticles specifically bind to the target, thereby forming nanoparticle-target complexes. A magnetic field is applied to the complex in aqueous solution, thereby magnetizing the nanoparticles. The applied magnetic field exerts a force on the nanoparticles if it is not uniform. The nanoparticle-target complex moves in response to the applied magnetic force and the resultant magnetic force of adjacent nanoparticles. Furthermore, the interaction between nanoparticles and their complexes can be enhanced by nanoparticle motion in response to an applied magnetic field.

A magnetic resonance signal is induced from a sample containing the complex and the known liquid by exposing the sample to radio frequency (RF) radiation. Magnetic resonance properties of a sample, such as T2, can be determined from the magnetic resonance signals. The presence of a target can be detected by comparing the magnetic resonance properties of a sample with those of measured or known control samples and standards.

Advantageously, the method of the present invention is effective against biological interferents such as proximity interferences, stains, clutter, cell debris, proteinaceous interferents, paramagnetic interferents such as hemoglobin and humic acid (including chelated iron). Nevertheless, it allows the detection of target nucleic acids with very high specificity.

The methods of the present invention allow target nucleic acids present in liquid media or other forms including, but not limited to, complex media such as aerosols, hydrosols, foods, and clinical specimens such as blood, urine, saliva, tissue, sputum, stool, etc. is useful for the detection of

The liquid in which the target nucleic acid is analyzed can be any fluid material containing nuclei with non-zero spin. Only nuclei with non-zero spin cause NMR phenomena. If the molecules in the liquid have nuclei with non-zero spin, such as hydrogen in water molecules, the liquid contains such nuclei. Alternatively, the liquid can contain non-zero spin nuclei as a solute or suspension, such as a fluorinated solute that produces a magnetic resonance signal at the ¹⁹ F Larmor frequency. However, for the purposes of the present invention, a liquid is typically water or an aqueous solution and unless otherwise specified the terms "liquid", "fluid", "known liquid", "liquid medium" and "solution" are used. refers to water or an aqueous solution.

The present invention provides methods for providing pathogen detection that combine nucleic acid amplification of pathogen-specific nucleic acids (ie, target nucleic acids) with magnetic resonance imaging (MRI) or nuclear magnetic resonance (NMR) detection. The methods of the present invention are useful, in part, because MRI/NMR detection produces measurable signals in the radio frequency range that, unlike more conventional nucleic acid detection methods, are not affected by the optical properties of the sample being measured. Rapid sample preparation is available. The method of the present invention has been approved by the governments of many countries around the world, allowing clinical (e.g., hospital or clinic used for patient diagnosis) and dedicated MRI applications without the need for nucleic acid extraction and purification steps. Both instruments have been employed to detect COVID-19 in saliva and swab samples.

The method of the present invention results from parallel processing steps that allow 100,000 samples per day at a single site using a single MRI system. MRI (or NMR) need not be integrated with other devices and instruments used to prepare samples and perform assays. Furthermore, MRI detection is rapid and can be performed quickly depending on equipment availability. Tens of thousands of sample assays can be measured in minutes. The method of the present invention offers two orders of magnitude greater capacity for the same dollar of investment made, reducing infrastructure and operating costs by 80 to 95% compared to conventional PCR methods used during the COVID-19 pandemic. % savings and the cost of the assay is comparable or less.

The methods described herein allow for rapid, sensitive, large-scale detection of amplified nucleic acid samples corresponding to large numbers of screened individuals. In one embodiment, a LAMP assay is performed followed by MRI and/or NMR detection. Target nucleic acids are detected with high sensitivity and specificity using commercially available NMR systems and a wide variety of MRI imagers.

The detection method of the present invention also includes amplified DNA generated by most known nucleic acid amplification methods, including PCR, RT-PCR, LAMP, RT-LAMP, and any other method using primer sequences available today. It is applicable and employed for detecting modified nucleic acids, which can be modified with biotin (or another binding site).

The method of the invention requires a complementary binding molecule such as biotin in combination with the complementary binding molecule streptavidin. Other complementary binding chemistries can be used instead of biotin-streptavidin, provided they are capable of binding to the primer.

The MRI and NMR detection techniques of the present invention utilize nanometer-scale paramagnetic particles (nanoparticles) that have been used clinically as MRI contrast agents and as in vitro research tools.

In one embodiment, nucleic acid amplification is accomplished using RT-LAMP as described below. Modifications to the method may be required if a different amplification method is used. However, the necessary modifications are well within the capability of those skilled in the art based on the teachings of this disclosure.

The method of the invention comprises the following steps:
a. A sample is provided that contains a target nucleic acid, eg, a virus such as SARS-CoV-2. In certain embodiments, LAMP means for collecting clinical samples are provided, such as collection devices (tubes and funnels for saliva, swabs, tabs for collecting respiratory samples, etc.).
b. Transport the sample to the laboratory under conditions that preserve the nucleic acid and prevent its degradation. Those skilled in the art will appreciate that maintenance of appropriate temperature and treatment with nuclease inhibitors may be required depending on the length of time between sample collection and laboratory processing. .
c. Treating the sample to release the target nucleic acid. This may involve heating the sample in the presence of reagents that lyse cells and/or reagents that dissociate and remove nucleic acid-associated proteins such as Chelex, proteinase K, guanidinium hydrochloride, guanidinium compositions and buffers. included.
d. A region of target nucleic acid is amplified in the presence of target-specific primers.
In certain embodiments, the nucleic acid is first reverse transcribed using a reverse transcriptase and the resulting cDNA is transcribed in the presence of a suitable DNA polymerase, nucleotides, cofactors, and other components well known in the art. and amplified according to LAMP or PCR protocols. When using LAMP, amplification is performed using a strand displacement DNA polymerase such as Bst polymerase, which has 5' to 3' DNA polymerase activity but lacks 5' to 3' exonuclease activity. When PCR is used, a thermostable DNA polymerase such as Taq polymerase is used.
e. In certain embodiments, one or more of the primers are biotinylated. Biotinylation is accomplished by any method known in the art, including synthesizing the primer with one or more biotinylated nucleotides or chemically or enzymatically modifying the primer after synthesis. be able to.
f. Time and temperature conditions will vary depending on the method (eg, PCR or LAMP) used to amplify the target nucleic acid. For example, an isothermal ramp is run at a single temperature while the temperature cycles between about 50°C and about 100°C.
g. The amplified target nucleic acid is contacted with the nanoparticles, and the nanoparticles specifically bind to the amplified target nucleic acid. A target nucleic acid-nanoparticle complex is formed. In some embodiments, the nanoparticles are bound to streptavidin.
h. The target nucleic acid-nanoparticle complex is exposed to a magnetic field device, allowing signal amplification in the presence of target DNA.
i. Signals are detected with an MRI system to identify the presence or absence of specific amplified target nucleic acid-nanoparticle complexes.
j. MRI detection results are collected and analyzed using MRI image processing software.

In one embodiment, the amplification relies on Reverse Transcription Loop Mediated Isothermal amplification (RT-LAMP) of nucleic acids to amplify COVID-19 RNA in a single step and is semi-automated or automated. It enables rapid, ultra-high-throughput, open-access, or random-access solutions on a sophisticated processing platform to detect these assay products in very large numbers using commercially available MRI imagers.

Random Access Capabilities of the Methods of the Invention The systems and methods of the invention can be used in a variety of sample preparation methods, a variety of nucleic acid amplification methods, a variety of assay types (LAMP assays, RT-LAMP assays, PCR, reverse transcription PCR (RT-PCR). ), immunoassays, ELISAs, etc.) with modifications to the hardware and more importantly to magnetic processing and reagents compatible with MRI or NMR detection, such as primers, nanoparticles, and various probes. make it possible by In one aspect of the invention, random access compatible sub-substrates are used for processing human clinical samples from sample collection to RNA and DNA extraction from pathogen cells, prior to RNA or DNA amplification and magnetic processing steps and prior to MRI detection. It is necessary to assemble the system (random access compatible subsystems).

According to certain aspects, from any sample type such as saliva, swabs, blood, urine, feces, sputum, stool, and any liquid taken from the human body using MRI detection LAMP or RT-LAMP assays. Detects nucleic acids from any pathogen, including viruses, bacteria and fungi. Although sample preparation methods differ for different sample types, the methods of the present invention are substantially the same from LAMP amplification to MRI detection. This feature, also identified by the term "random sample access" or "random access", allows different sample types to be processed in a partially different way without changing most or all of the remaining system elements and components. .

In particular, the present invention avoids most of the above bottlenecks. For example, endpoint amplification (such as RT-LAMP and endpoint RT-PCR) can be performed using low-cost, widely available machines and simple heaters, resulting in high-throughput, open-access, or random-access semi-automation. or implemented on an automated platform and using commercially available MRI systems for detection. In the process of the present invention described above, there is flexibility to change each or any step without changing other steps. This random or open access capability of the different elements of the system and MRI detection method of the present invention helps increase the amount of sample that can be analyzed in a short period of time.

For example, the sampling method can be changed from saliva to swabs without affecting other processes or system components. Random access capabilities also enable rapid alteration of expressed pathogen detection, different clinical and environmental samples and their collection methods, different sample preparation methods, different types of LAMP and PCR primers and probes.

Performing multiple RT-LAMP assays detectable by MRI systems on thousands of SARS-CoV-2 virus specimens using 96- and 384-well heating blocks, 96- or 384-well sonication blocks Meanwhile, a semi-automatic or automatic pipette or robot can deliver reagents and other liquids to the 9 plates for virus lysis, amplification and detection. These steps can be performed simultaneously without waiting for other steps to complete.

Employ random sample access or open access capabilities of various elements of the MRI detection platform: sample collection, sample preparation, and subsequent loop-mediated isothermal amplification (RT-LAMP) method used for viral RNA prior to MRI detection. This streamlines processes and maximizes efficiency. The LAMP method uses 4 to 6 specially designed target-specific primers to rapidly amplify specific nucleic acids with high specificity under isothermal conditions. The LAMP reaction process, unlike the polymerase chain reaction (PCR), does not require a denaturation step and DNA amplification occurs through the strand displacement activity of DNA polymerases. The LAMP method is widely applied to the detection of various microorganisms and pathogens including bacteria and viruses. When detecting RNA genomes of pathogens such as RNA viruses, LAMP was combined with reverse transcription (RT) to provide RT-LAMP analysis of nucleic acid amplification.

Random access capability of LAMP assay endpoint detection using MRI enables detection of a wide variety of pathogens, biomarkers from clinical and environmental samples, all types of sample collection methods, various sample preparation methods and commercial kits. becomes possible. A very flexible random access modality allows the use of different types of primers and probes.

Industry-standard 96- and 384-well heating blocks, 96- and 384-well sonication blocks to perform multiple MRI-detectable RT-LAMP assays on thousands of SARS-CoV-19 virus samples Automated pipettes or robots that can dispense reagents and other liquids into 96- or 384-well plates for viral lysis and RT-LAMP RNA amplification can be used.

3-Dimensional Simultaneous Detection of Assays with 3-D Sensors Nucleic acid amplicons generated using RT-LAMP, LAMP, PCR, or RT-PCR in corresponding reaction tubes/wells are combined with MRI detection. When used and detected simultaneously, all samples can be quantitatively detected simultaneously when placed in the MRI sample coil. MRI is an imaging device for visualizing small parts of the brain or body and qualitatively identifying the presence or absence of abnormal structures such as damaged cells, tissue, and tumors. The same concept applies to in vitro detection of multiple amplicons in PCR and LAMP assays. Images from a single to hundreds or even thousands of sample plates placed in an MRI sample coil (head or body coil or whole body coil), after image processing, all samples placed as a three-dimensional array provides a 3D image of This is analogous to identifying different slices of the human brain in pixels or voxels in an MRI. These 2D pixels and 3D voxels indicate the brain properties corresponding to those pixels or voxels. Relaxation parameters measured in these species regions of brain tissue are reconstructed as 3D images and their 2D slices. Pixels plotted in two dimensions of the three-dimensional array of assays are used to visualize the results and convert positives and negatives represented by 1's and 0's. Relaxation parameters measured in these species regions of brain tissue are reconstructed as 3D images and their 2D slices. Pixels plotted in two dimensions of the three-dimensional array of assays are used to visualize the results and convert positives and negatives represented by 1's and 0's.

The method of the present invention can detect a three-dimensional array of samples, unlike conventional optical detection systems. Each assay is amplified and detected using an optical detector, while light from the sensor is illuminated to each assay using a dedicated light source for several amplification cycles or hours. Unlike prior art methods, the methods disclosed herein use DC and AC magnetic fields and sequences of DC and RF pulses that enable signal detection and sample location or number identification. Prior art methods use a light source and an optical detection system that must be in the immediate vicinity of the sample and which are highly integrated into the overall system, with the aim of handling the detection process from start to finish. is configured.

The method of the invention using MRI technology allows detection of very small volumes in three dimensions and allows processing of signals from each small volume in three-dimensional space. Although MRI has been used for in vivo medical imaging for decades, the use of the same method for pandemic screening has not been previously reported. The present invention relates to genomics, nanotechnology, synthetic gene segments, functionalization and functionalization of gene sequences, conjugation chemistry for rapid assays, magnetic field-enabled assay processes, rapid sample collection methods, rapid detection of human or animal specimens. facilitated by the integration of various latest developments in science and technology such as advanced sample lysis and digestion methods, functionalized and functionalized nanoparticles, image processing methods and software tools, as well as commercially available MRI systems and expertise in the MRI area. provides detection of tens of thousands of samples in 3D format.

The present invention provides methods for MRI detection of nucleic acid amplicons. This is fundamentally different from the current state of the art. This is because the 3D sensing system can identify each sample in a 3D stack of samples placed on top of another 3D array pattern. The radio frequency and magnetic field act synergistically, and each sample is identified using magnetic field gradients and radio frequency phase encoding techniques. These magnetic fields and their properties identify the location of each sample in an image with the characteristics of the sample present using the pixels of the MRI. Pixels of the MRI image collected from each sample tube identify the presence or absence of specific nucleic acid sequences.

Using the methods of the present invention, virtually any MRI system available in healthcare systems can be used "as is" or easily adapted for pathogen detection in human or animal samples. MRI systems with a wide range of magnetic fields have been validated using this method, allowing these systems to be deployed globally to combat the spread of COVID-19 disease around the world. Low-field (between 65 millitesla and 3000 millitesla) MRI systems have been tested with substantially the same results in identifying the presence or absence of pathogens in clinical samples.

MRI-detected nucleic acids give the same results regardless of the magnetic field, as shown by the following comparison of samples detected on a number of MRI systems; Esaote C-Scan, 300 mTesla Esaote O-Scan, medium field 1000 mTsla field ONI MRI system, 1500 mTsla field Siemens Magnetom system, 3 Tesla Varian and GE systems. Additionally, the method of the present invention has been validated on a wide range of MRI systems from various vendors and systems installed worldwide.

Using MRI, the three-dimensional visualization capability for small volumes of assay fluid can be used to simultaneously visualize the data processing of many samples processed over hours or minutes. There is no detection bottleneck in the proposed MRI detection system because there are no subsystems that could sequentially slow down other processes.

Unlike prior art methods, the present MRI method does not require a pure sample as it is not connected to a sample preparation system and the radio frequency signal is not significantly affected by sample purity. Optically detected real-time PCR, which requires very long preparation and processing times due to the need to remove inhibitors from the nucleic acid sample, potentially interfering with PCR and LAMP amplification, as well as for optical signal detection and RT-LAMP systems. Since the method of the present invention is immune to optical inhibitors, all that is required is a rapid dissolution method and a sample processing method that uses chemical treatment or heating of the sample.

The MRI detection method of the present invention relies in part on the prior art of magnetic resonance and magnetic detection technology involving nanometer-scale paramagnetic particles (nanoparticles) used in vivo as MRI contrast agents. In the prior art, these magnetic nanoparticles are injected into patients or animals prior to MRI imaging. Selective binding of the contrast agent to target cells locally alters the spin relaxation parameter and alters the contrast of the MRI image, thus enhancing the image contrast and enabling visualization of tumor and non-tumor cells, etc. in the human body. improves.

The present invention uses similar nanoparticle principles, but they apply to nucleic acids that are difficult to detect due to the low concentrations present in clinical samples. Clinical samples that can be examined using nanoparticle-mediated MRI and NMR detection include non-invasively collected saliva, nasal swabs, sputum, urine and stool samples, and more invasively collected such as blood and tissue. Contains samples that have been

Quantification of a single test using 1D NMR:
In another aspect of the invention, the same basic method known as nuclear magnetic resonance (NMR), the underlying technology behind MRI, is used to detect processed assays using commercially available NMR systems. and further identify, validate, or quantify the viral or bacterial pathogen load, their strains in individual specimens in one dimension. In contrast, embodiments using MRI for high-throughput analysis of large numbers of samples without quantification are defined as detection in three dimensions. This one-dimensional detection also relies on RT-LAMP and RT-PCR assay components such as known primers (synthetic nucleic acid segments) for each strain of the same pathogen or different pathogens. The MRI systems used for detection are in the NMR frequency range of 2.5 MHz to 150 MHz, since the low or medium edge of magnetic field strength has little effect on the magnetic nanoparticles used as sensing probes.

These preferred NMR systems include Bruker minispec systems, Thermo Fisher Pico Spin systems, Magritek bench top NMR systems, Waveguide formula handheld NMR systems, and broad frequency Bruker and Va Includes rian NMR equipment Homemade and commercially available benchtop NMR systems are included.

MRI-Detected LAMP and RT-LAMP Assay Design:
A particular method of the invention detects amplified DNA using a LAMP or RT-LAMP assay, which requires six different primers: F3, B3, FIP, BIP, loop F and loop to approach. LAMP is characterized by the use of the first four primers specifically designed to recognize six different regions of the target gene. The LAMP assay is well known and illustrated graphically on the World Wide Web. See, for example: www [dot] neb [dot] com/applications/dna-amplification-pcr-and-qpcr/isothermal-amplification/loop-mediated-isothermal-amplification-lamp.

The four primers used are as follows:
a. Forward Inner Primer (FIP): FIP consists of the 3′-terminal F2 region and the 5′-terminal Flc region. The F2 region is complementary to the F2c region of the template sequence. The Flc region is identical to the Flc region of the template sequence.
b. Backward Inner Primer (BIP): BIP consists of the B2 region at the 3' end and the Blc region at the 5' end. The B2 region is complementary to the B2c region of the template sequence. The Blc region is identical to the Blc region of the template sequence.
c. Forward Outer Primer (F3): This primer consists of the F3 region complementary to the F3c region of the template sequence. This primer is shorter in length and lower in concentration than FIP.
d. Backward Outer Primer (B3 Primer): This primer consists of the B3 region complementary to the B3c region of the template sequence.

After the critical LAMP primer sets (FIP, BIP, F3, and B3) are determined, loop primers are designed to reduce amplification time and improve specificity.

The stepwise approach used in the LAMP or RT-LAMP prior art has been described in the literature and the prior art, shows relevance to the MRI detection method of the present invention, implements the new invention method, and is detected in MRI. A brief description is provided below for the purpose of highlighting the modifications necessary to understand the elements of the LAMP product produced.

In the prior art of the LAMP method, the components of the reaction solution, including the RNA in the sample solution and the aforementioned MRI-detectable biotinylated primers, are incubated at a constant temperature of 60-65°C. As a result, the following steps were observed. The process is based on the diagram showing the RT-LAMP in RT-LAMP method - Principle: RT-LAMP displayed on the World Wide Web at loopamp [dot] eiken [dot] co [dot] jp/e/lamp/rt_principle.html. Reference is made to the following detailed description.

RT-LAMP STEP-1: The BIP primer anneals to the template RNA, and cDNA is synthesized by the activity of reverse transcriptase. Uniquely biotinylated primers are used for amplification using 16 possible combinations of primers with biotin at their 5' ends. A commercial vendor (IDT Technologies, USA) offers these with different biotin locations and designs. These primers were selectively biotinylated for binding to nanoparticles, which is important for post-processing of RT-LAMP products. Any embodiment using biotin-conjugated primers can participate in LAMP or RT-LAMP assays and can be detected downstream using MRI or NMR methods.

BIP or FIP primers initiate strand displacement as a result of the B2 and F2 sites binding to complementary sections of the target sequence. This process occurs, for example, by displacement by Bst polymerase in the reaction medium.

RT-LAMP STEP-2: The F3 primer anneals to the region outside the BIP primer. The activity of reverse transcriptase synthesizes new cDNA and simultaneously releases the cDNA strand previously formed by the BIP primer.

RT-LAMP STEP-3: Single-stranded cDNA synthesized from BIP is released from step (2). The FIP primer then anneals to this single-stranded cDNA.

RT-LAMP STEP-4: From the reverse transcription step (3), a complementary DNA strand is synthesized from the 3' end of the F2 region of FIP as a starting point by the activity of a DNA polymerase having strand displacement activity.

RT-LAMP STEP-5: The F3 primer anneals to the outer region of FIP and its 3' end becomes the starting point for synthesis, simultaneously releasing the DNA strand previously formed by FIP.

RT-LAMP STEP-6: The DNA strand synthesized by the F3 primer together with the template DNA strand form double-stranded DNA.

RT-LAMP STEP-7: Since the FLP-bound DNA strand released in step (5) contains complementary sequences at both ends, it self-anneals to form a dumbbell-like structure. This structure (7) serves as the starting structure for LAMP cycling amplification.

RT-LAMP STEP-8: The dumbbell-like DNA structure (7) is rapidly converted to stem-loop DNA by self-priming DNA synthesis that unfolds the loop at the 5' end and prolongs DNA synthesis. BIP anneals to single-stranded regions of stem-loop DNA and initiates DNA synthesis in step (8), releasing the previously synthesized strand.

RT-LAMP STEP-9: This released single strand forms a stem-loop structure at the 3'end because the Flc and FI regions are complementary. Next, DNA synthesis is initiated from the 3' end of the FI region using the self-structure as a template, and the BIP-bound complementary strand is released. Structure (9) is formed.

RT-LAMP STEP-10: The released BIP-bound single strands then form a dumbbell-like structure with complementary FI-Flc and Blc-B1 regions at each end. This structure is the inverse of structure (7).

RT-LAMP STEP-11: Similar to step (7), structure (10) allows self-priming DNA synthesis to proceed starting from the 3' end of the FI region. In addition, FIP anneals to the F2c region and initiates DNA strand synthesis. This FIP-bound DNA strand is released by strand displacement of self-priming DNA synthesis. Thus steps (10) and (11) proceed in the same manner as steps (7), (8) and (10) to form structure (7) again.

RT-LAMP STEP-12: The structure generated in step (9) (or step (12)) causes FIP (or BIP) to anneal to the single-stranded F2c region (or B2c region), allowing DNA synthesis to occur in two strands. Continue by releasing strand DNA. As a result of this process, structures of various sizes are formed consisting of alternating inverted repeats of the target sequence on the same strand.

In all the above steps, biotin is conserved and available in the product and residual products, which are utilized in downstream preparation of assays for MRI detection using MRI imaging.

When using the MRI method, a successful LAMP assay after successful amplification is associated with a MR relaxation termed T2 compared to an unsuccessful reaction giving a "bright spot" in the MRI image with a long MR relaxation time termed T2. Shorter times result in "darker spots" in the MRI image. It is also possible to switch from dark to light or vice versa by choosing nanobeads with the ability to change the relaxation time by interacting with functional groups in the presence of a magnetic field.

In one embodiment of the invention, the LAMP primers involved in DNA amplification are biotinylated as shown below. A complementary functional group, streptavidin, binds to nanoparticles added to the assay and is an essential component of magnetic resonance-based detection processes, especially for MRI detection in three dimensions.

In embodiments of the invention using LAMP, biotin is attached to primers BIP, FIP, loop F and loop B at the 5' ends of the primers. Shown below are several different sequences and combinations of primers that allow MRI detection.

1. 5'-F3-3'
2. 5'-B3-3'
3. 5'-biotin-FIP-3'
4. 5'-Biotin-BIP-3'
5. 5'-biotin-loop F-3'
6. 5'-biotin-loop B-3'

Biotinylation of F3 and B3 did not give a successful signal and no difference between positive and negative LAMP assays, therefore F3 and B3 are not biotinylated. Five other possible binding options, from 3 to 6, and all sequences and combinations yield MRI images showing different positive and negative assay intensities.

In the six LAMP primers listed above, primers F3 and B3 do not have functional groups such as biotin at their 5' ends. These two primers, when added with functional groups attached to them, cannot distinguish between the presence and absence of target DNA and are therefore not recognized as MRI-detecting LAMP or RT-LAMP assays of the present invention. can't In the six LAMP primers described above, at least one of the four primers FIP, BIP, loop F, and loop B is iotinylated as a functional group. Streptavidin is a complementary functional group that needs to be attached or coated on the nanobeads that alter their MRI properties to distinguish between positive and negative.

Preferred combinations of LAMP primers with a biotin group added to the 5' end (also referred to as the 5' end of the primer being biotinylated) are listed below in order of preference in the method of the present invention.

biotin at the 5′ end of the FIP primer only,
biotin at the 5' end of the BIP primer only,
biotin at the 5' end of the FIP and BIP primers,
biotin at the 5' end of the loop F primer only,
biotin at the 5' end of the loop B primer only,
biotin at the 5' ends of the loop F and loop B primers,
biotin at the 5' ends of the FIP and Loop F primers,
biotin at the 5′ ends of the FIP and Loop B primers,
biotin at the 5' end of the BIP primer and the loop F primer,
biotin at the 5′ ends of the BIP and Loop B primers;
biotin at the 5' end of FIP primer, BIP primer, loop F primer,
biotin at the 5′ ends of the FIP, BIP and loop B primers;
biotin at the 5′ end of the FIP primer, loop F primer, loop B primer;
biotin at the 5' end of the BIP primer, the loop F primer, the loop B primer;
Biotin at the 5' end of FIB, BIP, Loop B, Loop F primers.

In one embodiment of the MRI detection LAMP assay, biotin is attached to the 5' end of the FIP LAMP primer only, making it the lowest cost primer. In the simplest design the other primers are not biotinylated. Alternatively, the BIP primer can be biotinylated, leaving the FIP unfunctionalized. In the simplest design, one of the two from the FIP and BIP LAMP primers can be one of the two primers that are modified in the LAMP reaction, thus requiring manufacturers to pay large sums for each biotinylated primer. is charged, it becomes inexpensive in terms of primer cost. Since the corresponding magnetic nanoparticles are streptavidin-coated, the 'virgin' biotinylated FIP primers bind strongly to the streptavidin bound to the magnetic nanoparticles, and even without a specific LAMP reaction the nanoparticles Allows easy capture.

In one embodiment, biotin is attached to the 5' end of the BIPLAMP primer. This design is very simple because the FIP primer is not biotinylated. The BIP LAMP primer is the only primer that needs to be changed in the LAMP reaction. Since the corresponding magnetic nanoparticles are streptavidin-coated, the 'virgin' biotinylated BIP primers bind strongly to streptavidin within the magnetic nanoparticles, allowing easy activation of the nanoparticles without a specific LAMP reaction. Allow capture.

In one embodiment, biotin is attached to the 5' ends of both the FIP and BIP LAMP primers. Modifications to the two primers FIP and BIP LAMP primers increase the cost of the primers as the manufacturer charges a large amount for each primer with attached binding molecules such as biotin. Since the corresponding magnetic nanoparticles are coated with streptavidin, the 'virgin' biotinylated FIP and BIP primers bind strongly to streptavidin within the magnetic nanoparticles, leading to FIP and BIP activation even in the absence of a specific LAMP reaction. It allows for strong affinity and easy capture of nanoparticles by both primers.

In one embodiment, biotin is attached to the 5' end of the BIP LAMP primer. This design is very simple because the FIP primer is not biotinylated. The BIP LAMP primer is the only primer that needs to be changed in the LAMP reaction. Since the corresponding magnetic nanoparticles are streptavidin-coated, the 'virgin' BIP primer conjugated to biotin binds strongly to streptavidin within the magnetic nanoparticles, leading to the activation of the nanoparticles without a specific LAMP reaction. Allows easy capture.

In one embodiment, biotin is attached to the 5' ends of both the FIP and BIP LAMP primers. Modifications to the two primers FIP and BIP LAMP primers increase the cost of the primers as the manufacturer charges a large amount for each primer with attached binding molecules such as biotin. Since the corresponding magnetic nanoparticles are streptavidin-coated, 'virgin' FIP and BIP primers conjugated to biotin bind strongly to streptavidin within the magnetic nanoparticles, allowing FIP to occur even in the absence of a specific LAMP reaction. It allows strong affinity and facile capture of the nanoparticles by both the and BIP primers.

In one embodiment of the invention, 20-200 nanometer streptavidin-conjugated Super Mag nanoparticles are used for maximum flexibility, speed and sensitivity. The size of the nanobeads and the binding capacity of the nanoparticles are determined by the optimal concentration of nanobeads in the assay.

The size of nanoparticles used for detection varies in MRI detection. Small nanobeads are used in high-field MRI and large nanobeads are used in low-field MRI systems, making the detection process simpler and more sensitive.

In one embodiment of the invention, a Super Mag nanoparticle with a monolayer of streptavidin covalently attached to the surface of the nanoparticle leaves most of the biotin binding sites unused and not participating in the LAMP reaction. sterically available binding of the primer. Due to its large surface area, excellent colloidal stability, and unique surface coating, Streptavidin Super Mag exhibits high binding capacity, low non-specific binding, and fast magnetic binding for capture.

The MRI detection method described herein is an endpoint detection approach that allows for rapid, large-scale, extraction-free sample processing by MRI detection systems. This is in contrast to prior art detection techniques that detect the presence of nucleic acid amplicons from DNA and RNA using a wide range of physical and chemical principles such as real-time quantitative polymerase chain reaction (rt-qPCR). is. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) is most often detected by fluorescence spectroscopy using a dedicated sensor to monitor the sample. For the isothermal amplification methods LAMP or RT-LAMP, endpoints less frequently use turbidity, calorimetry, fluorescence, and most amplicons are detected in near-real-time detection mode.

against different gene segments of COVID-19 viral RNA, as well as other viruses influenza A and B viral RNA segments, many other viruses, various strains of COVID-19 and other viral variants emerging , and also to various gene segments that are mutated, with approaches similar to those described above have been tested, validated and applied.

The most important element of the method of the invention is to bring any RT-LAMP or LAMP assay detected by any other detection method into an MRI-detectable 3-D format. In certain embodiments of the invention, a selective LAMP primer is combined with a binding molecule on a specific LAMP primer, the selective LAMP primer is coated with a matching binding molecule, and these specific LAMP Designed to bind to specific binding molecules used to bind to coated magnetic nanoparticles with binding sites that match those on the primers.

MRI signal generation is generated by the binding of nanoparticles attached to biotin sites present in various primers and amplification products, which together lead to changes in the relaxation parameters, T2 and T1, which lead to changes in contrast. is an essential element of this method, resulting in Here, T2 is the most important parameter in both MRI images and NMR, known as T2-weighted images, and detection and quantification are performed using T2 measurements. Image intensities detected by 3-D MRI have variations produced by these magnetic nanoparticles in the presence and absence of specific target nucleic acids, such as target RNA and DNA, and also in reaction tubes. It also varies due to the presence of unused specific LAMP primers.

At the end of a successful LAMP reaction, the specific target LAMP primer is mostly consumed by the amplification process in the presence of the target nucleic acid to be amplified by the reaction. If no specific target nucleic acid is present, the primer remains in the reaction tube. These components of the reaction allow unique identification of these reaction products, resulting in changes in signal strength of the MRI signal.

For specific LAMP amplification, specific LAMP primers containing binding molecules are protected by a successful LAMP reaction process. In a successful LAMP reaction, nanoparticles added later to the reaction mixture will not detect binding molecules that are "masked" or "hidden" by the specificity LAMP amplification step. In the absence of LAMP-specific reaction, primers float freely. This is because all "leftover" primers whose binding molecules effectively bind to the functionalized nanoparticles are included in the reaction. Binding of the "remainder" primer via the binding molecule binds to a nanoparticle probe molecule coated with complementary binding chemistry, forming a strong bond that cannot be separated during the reaction.

Thus, a successful LAMP reaction that results in 'primer consumption' deprives the nanoparticles of the primer binding sites so that the nanoparticles remain dispersed and the weak bonds between the nanoparticles are easily broken by mechanical forces. be done. Therefore, when the specific LAMP reaction is successful, the magnetic nanoparticles are evenly dispersed within the LAMP reaction tube. Furthermore, large amounts of specific LAMP products lead to further dispersion of magnetic nanoparticles in the assay. A failed LAMP reaction therefore leads to a uniform distribution of magnetic nanoparticles in the reaction medium leading to a defined nuclear spin relaxation in the case of a specific LAMP reaction.

Alternatively, binding of magnetic nanoparticles to 'virgin' primers results in effective capture of the nanoparticles by these primers allowing magnetic separation and non-uniform distribution of the magnetic nanoparticles. If there is a strong bond between the specific 'virgin' primer and the nanoparticles, the magnetic nanoparticles cannot be easily dispersed by mechanical forces, resulting in a non-uniform distribution of the magnetic nanoparticles in the assay medium. Become. This results in signals with significantly different relaxation times, making the LAMP assay more reliable, rapid and large scale.

??
When using MRI, a successful LAMP assay after specific amplification is a 'black hole' or 'darker' compared to the absence of non-specific or more product resulting in a 'bright spot' with a longer relaxation time. bring the spot. In another embodiment, the opposite result was demonstrated by chemically altering the surface properties of the nanoparticles that bind biotin present in the RT-LAMP primer and product. That is, "dark spots" represent the absence of viral RNA, and "bright spots" represent the presence of viral RNA. This opposite signal was achieved by the addition of chemicals capable of altering surface properties within the assay medium prior to the RT-LAMP amplification step.

MRI Detection PCR or RT-PCR Assays In another embodiment of the invention, RT-PCR amplicons are synthesized for detection using MRI using primers of specific design. RT-PCR requires two primers, a forward primer and a reverse primer, that can target COVID-19 gene segments that are also detected by RT-LAMP. The RT-PCR and RT-LAMP amplicons are qualitatively very different. The RT-PCR primers are also biotinylated at the 5' ends of both PCR primers.

Additional Systems and Subsystems for MRI Detection Assays One or more of the following processes, methods and subsystems are methods of the invention for the rapid and sensitive detection of nucleic acids using LAMP or RT-LAMP assays. is connected with.

The mixed products undergo a unique process in the presence of a magnetic array of large numbers of magnets, which drives the reaction to occur faster, dramatically increasing the signal by magnetically enhancing the nuclide signal. Let More precisely, this process increases the contrast or intensifies the signal or the difference in signal between negative and positive assays.

MRI images are acquired using clinical MRI equipment, and an array of all processed samples are used to visually view them and/or read, transfer and process the MRI data at a later time. We use a software program that shows linear data from 3D and shows positives and negatives very quickly.

Available for signal measurement from reaction tubes using available image processing software tools such as Fiji (ImageJ) and the Matlab program developed for this purpose on all available MRI machines. Software is used to process the MRI images and automatically present test results.

example example-1
A detailed description of the process of the preferred embodiment and the saliva used worldwide to detect COVID-19, approved by various governments around the world, including the Americas, Africa, Asia, etc. A commercially available assay for pandemic screening to detect COVID-19 samples.

Specimen collection:
Saliva and swab specimens were collected at multiple locations in India, Nigeria, and the United States, and a comparative study was performed with the gold standard RT-PCR test method, showing 95-100 detection using MRI for RT-LAMP and RT-PCR. %, indicating that the results are comparable to the standardized test.

More than 1,000 human saliva and nasal swab samples were collected from visitors to Indian hospitals and medical colleges (SVS Medical College, Mevvnagar, India), and these samples were tested in multiple ways with inter-results. showed a correlation of The RT-qPCR assay kit was purchased from Thermo Fisher and is known as the TaqPath® COVID-19 Combo Kit. Real-time quantitative RT-PCR tests were performed on RNA extracted from swab and saliva samples using Qiagen RNA Extraction Kits. A commercial system that employs conventional technology to perform RT-qPCR assays is called Quant Studio 5 and was purchased from Thermo Fisher, USA.

The number of saliva samples tested and compared in India was 250, of which 119 samples were negative for COVID-19 virus and 131 samples were positive saliva samples. Comparative studies using RT-qPCR detected using Quant Studio (fluorescence-based optical detection) and RT-LAMP using MRI, NMR and gel electrophoresis were detected. The same saliva and swab samples from the same patient were also tested using all these methods and the results showed near perfect agreement between the techniques with 97% concordance for positive samples and 99% concordance for negative samples. rice field.

Widely used molecular tests for COVID-19 (RT-PCR and RT-LAMP) were initially performed on nasal swab samples. Collecting two to three million nasal swabs each day required hundreds of thousands of medical workers and nurses. One of the bottlenecks in increasing the number of tests to tens of millions has been overcome by collecting saliva samples. The method used self-collected saliva. Saliva collection was performed using a low-cost device consisting of a plastic funnel and a 5 mL tube screwed to the funnel. Those who self-collect saliva replace the funnel with a screw cap after draining saliva. The amount of saliva required to practice the method of the invention is less than 10 microliters. The volume of saliva collected was between 100 microL and 1 mL. After collecting saliva in collection tubes or vials, the saliva is transported to the testing facility, which may be a fixed or mobile lab. The temperature of saliva is maintained at about 4-8°C. Saliva samples were kept at a temperature of 20-30° C. for 1-2 days without adversely affecting the quality and initial quantity of COVID-19 virus in the vials. As another option, nasal swab specimens were processed. Swab samples stored in viral transport medium (VTM) were processed directly following the same process employed for saliva. The amount of VTM in processed saliva and swabs is approximately 4 to 6 microL for a 25 microL RT-LAMP reaction.

b. Packing and Shipping of COVID-19 Specimens Saliva samples were delivered to the study site on the same day and did not require preservative solutions. Sample shipments in secure decontamination packages can be sent by mail or delivered in person by collection staff.

c. COVID-19 virus present in saliva was inactivated and lysed using the simple process of the method of the present invention. Hot water at a temperature of 85-98° C. was added for safe and easy addition to 250 microL RT-LAMP reaction tubes. The amount of water added is about the same as the amount of saliva collected. This inactivation also kills the virus, and a lysis step is performed using saliva processing buffers and chemicals to release the RNA from the virus.

Following the addition of the lysis buffer, the saliva processing buffer and chemical mixture is heated at a temperature of 90-98° C. for 2-10 minutes. The higher the hearing temperature, the shorter the heating time. In a preferred embodiment, it was heated at 95°C for 10 minutes. In a preferred embodiment of the method of the present invention, the chaotropic agent and the strongest denaturant guanidinium salt are used in liquid form at concentrations ranging from 10 microM to 100 microM to reduce the activity of salivary enzymes, Increased solubility and decreased saliva viscosity.

d. RT-LAMP reactions were performed using RT-LAMP master mixes readily available from three vendors: Lucigen, USA New England Bio Labs (NEB), USA and Optigene, UK. CatLog Nos. 1700 and 1804 commercial ready-to-use master mixes were used. Primer design for RT-LAMP for COVID detection using MRI method was performed using several sets of RT-LAMP primers. Each primer set targets a specific region of the COVID-19 genome. Primers available in the published literature were used. All biotinylated sequences and combinations were verified using the primers listed below, as described in the previous section of the patent.

Several LAMP primers from the literature were validated and in some cases new primers were designed and optimized (against different COVID-19 gene segments, variants and other targets). The primer sets listed below for the preferred embodiment of the MRI-detection RT-LAMP were obtained from a publication (ref. 1), with modifications to the primers to enable MRI detection primarily by biotinylation, and commercially available. Optionally purification was performed using the purification process provided by the vendor (Integrated DNA technologies (IDT), USA).

Reference-1: Rabe, B. A. & Cepko, C. SARS-CoV-2 detection using isothermal amplification and a rapid, inexpensive protocol for sample inactivation and purification. Proc. Nat. Acad. Sci.(PNAS) 117, 24450-24458 (2020).

Primer Selection and Synthetic DNA Design Biotinylated oligos for the Orflab gene segments, namely F3, B3, biotin-FIP, and biotin-BIP, were designed by modifying the primers available in the above references. A set of loop primers (LF and LB with or without biotin at the 5' end) were also designed by gap-filling selected gene segments by gap-filling with linkers. Synthetic DNA was generated using the same software and synthesized with the help of a commercial vendor (IDT, USA).

All oligos were ordered from IDT and resuspended in TE water provided by IDT at a concentration of 100 microM. The oligos were combined to make 100 microL of 10x primer mix as follows: 4 microL biotin-FIP, 4 microL biotin-BIP, 0.5 microL F3, 0. 5 microL B3, 1 microL Biotin-LF, and 1 microL Biotin-LB, and nuclease-free water to make 100 microL.

All RT-LAMP reactions were set up as described by the NEB protocol (E1700 and M1804) and performed at 62°C.

All viral RNA sequences used in this study were purified RNA, and various virus controls were received from BEI Resources for various COVID-19 strains serially diluted in nuclease-free water.

Preferred embodiments of MRI detection RT-LAMP primer combinations are validated and presented using the following primer-biotin combinations. Primers were designed with biotin conjugated according to the above 18 combinations and MRI images were recorded showing the presence or absence of amplified COVID-19 gene segments.

The present invention was validated for COVID-19 virus with RNA converted to cDNA amplified using the LAMP method, and also using laboratory-killed CIVID-19 virus and post-COVID-19 virus infection. It has been validated in a clinical laboratory using thousands of samples collected from individuals. Matching target COVID virus, matching target RNA, and matching cDNA resulted in darker images when MRI images were recorded after post-processing of LAMP amplicons validating the present invention.

A synthetic cDNA that was designed and synthesized commercially with the help of IDT, USA is shown below.

ORFlab gene target sequence (nucleotides 2101-2581 of Genbank Accession No. NC 045512.2):
2101 gctaactaac atctttggca ctgtttatga aaaactcaaa cccgtccttg attggcttga
2161 agagaagttt aaggaaggtg tagagtttct tagagacggt tgggaaattg ttaaatttat
2221 ctcaacctgt gcttgtgaaa ttgtcggtgg acaaattgtc acctgtgcaa aggaaattaa
2281 ggagagtgtt cagacattct ttaagcttgt aaataaattt ttggctttgt gtgctgactc
2341 tatcattatt ggtggagcta aacttaaagc cttgaattta ggtgaaacat ttgtcacgca
2401 ctcaaaggga ttgtacagaa agtgtgttaa atccagagaa gaaaactggcc tactcatgcc
2461 tctaaaagcc ccaaaagaaa ttatcttctt agagggagaa acacttccca cagaagtgtt
2521 aacagaggaa gttgtcttga aaactggtga tttacaacca ttagaacaac ctactagtga
(SEQ ID NO: 10)

The six COVID-19 LAMP primers targeting the ORFlab gene of this preferred embodiment are shown below. FIP and BIP primers were designed with a biotin molecule at their 5-end.

F3 Primer: 5'-CGGT GGAC AAATT GTC AC-3' (SEQ ID NO:l)
B3 Primer: 5'-CTT CTCT GGATTT AAC AC ACTT-3' (SEQ ID NO:2)
FIP Primer: 5'-Biotin-TC AGC AC AC A AAGCC AAAAATTT ATTTTCT GT G CAAAGGAAATTAAGGAG-3' (SEQ ID NO:3)
BIP Primer: 5'-Biotin-T ATT GGT GGAGCT AAACTT AAAGCCTTTTCT GT AC AA TCCCTTTGAGTG-3' (SEQ ID NO:4
Loop F Primer: 5 ' -TT AC AAGCTT A AAGAAT GTCT GAAC ACT -3 ' (SEQ ID NO:5)
Loop B Primer: 5 '-TT GAATTTAGGT GAAACATTT GTC ACG-3 ' (SEQ ID NO:6)

In this embodiment of the COVID-19 RT-LAMP primer sequence, both the FIP and BIP primers were designed with a biotin molecule attached to their 5-end.

Designs of the same six LAMP primers targeting the same ORFlab gene with other sequences and combinations are shown below: BIP, FIP, loop B and loop F are attached to the biotin molecule at the 5' ends of the primers.

Below are four selected primers (FIP, BIP, loop B and loop F) has at least one biotin in one or more. Having biotin in all four primers is less preferred, but this embodiment also provides a contrast difference between positive and negative samples. It is not necessary to attach biotin to all four identified primers. Since it is a qualitative detection method and not a quantitative method, more biotin sites are added to more primers, with no additional advantage when using MRI in 3-D to detect positives and negatives. It is not preferable to do so because it causes an increase in cost.

F3 Primer: 5'-CGGT GGAC AAATT GTC AC-3' (SEQ ID NO:l)
B3 Primer: 5'-CTT CTCT GGATTT AAC AC ACTT-3' (SEQ ID NO:2)
FIP Primer: 5' -Biotin- TC AGC AC AC AAAGCC AAAAATTT ATTTT CT GT GC AAAGGAA ATT AAGGAG-3' (SEQ ID NO:3)
BIP Primer: 5 ' -Biotin-T ATT GGT GGAGCT AAACTT AAAGCCTTTTCT GTAC AAT CCCTTT GAGT G-3 ' (SEQ ID NO:4)
Loop F Primer: Biotin-5' TT AC AAGCTTAAAGAATGTCTGAAC ACT-3' (SEQ ID NO:5)
Loop B Primer: 5' -Biotin-TT GAATTT AGGT GAAAC ATTT GTC ACG-3' (SEQ ID NO:6)

Sixteen embodiments derived from biotin-conjugated four primers are applicable to all LAMP and RT-LAMP assays containing the six primers used in the assay.

In a preferred embodiment, the above primers with biotin combinations are obtained from New England Bio Labs (catalog number NEB 1700 series and/or NEB 1804 series) or OptiGene RT-LAMP master mix, or the commercially available Lucigen RT-LAMP master mix. Add to single tube RT-LAMP master mix. This is mixed with an optimized primer mix of the above six primers at varying concentrations (4-16 microM FIP and BIP, 1-4 microM Loop B and Loop F primers, and 0. 5 to 2.0 microM F3 and B3 primers). This master mix is added to heat-treated, buffered and homogenized saliva to perform RT-LAMP amplification of COVID-19 virus and other RNA viruses described above. The amplification step includes the addition of enzymes and other components used to perform reverse transcription (RT). The amplification step also includes nucleic acid amplification using other enzymes present in the reaction reagents and buffers. The LAMP reaction is carried out at a temperature of 60-67°C. RT-LAMP reactions run at 60-65° C. for NEB and OptiGene master mixes and 67° C. for Lucigen RT-LAMP master mixes were completed. A preferred assay uses the same temperature to perform steps RT and LAMP, which are performed at the same temperature. After the amplification step, which can generally last between 10 and 60 minutes, in preferred embodiments it is limited to 15 to 30 minutes. The time is adjusted according to application-defined performance prediction parameters. Once amplification is complete, the RT-LAMP assay reagents are heated to 85° C., an optional step to prevent or stop possible unintended reactions after amplification is complete. Amplified sample trays containing 8, 96, or 384 samples are then removed from the heater and stored at refrigerated temperatures.

Although steps a through d are valid for both embodiments (RT-PCR and RT-LAMP), the steps described above for RT-LAMP are equivalent but different in making MRI-detected RT-PCR amplicons. have elements or steps. RT-PCR primers targeting a gene segment of the ORFlab gene are shown below with only one configuration of biotin attached to both primers.

The RT-PCR parameters used to detect MRI-detected amplicons are as follows. Bright images with long T2 represent positive samples and dark spots with short T2 represent negative samples. PCR primers for RT-PCR testing were synthesized by IDT and are shown below. Each PCR reaction mixture contained 1XPrimeTime® Gene Expression Master Mix (purchased from IDT, USA), 0.25 microM concentration of PCR primers, and 10 fg of synthetic COVID-19 target (from IDT, USA). It was PCR was performed using an Applied Biosystems Veriti 9902 4375786 PCR 96-well thermal cycler with a temperature profile of 95°C for 3 minutes followed by 50 cycles of amplification (95°C for 15 seconds, 60°C for 1 minute).

References for PCR primers:
Mohamed El-Tholotha, b, Haim H. Baua, and Jinzhao Songa,, A Single and Two-Stage, Closed-Tube, Molecular Test for the 2019 Novel Coronavirus (COVID-19) at Home, Clinic, and Points of Entry” , Pre-Print published at doi: 10.26434/chemrxiv.11860137.vl

Forward primer: 5' -Biotin- CCCTGTGGGTTTTACACTTAA- 3' (SEQ ID NO:7)
Reverse primer: 5' -Biotin- ACGATTGTGCATCAGCTGA- 3' (SEQ ID NO:8)

The synthetic gene segment used to validate the assay is shown below and was generated with the help of IDT, USA.

5 ' -CTGCT AAAGCTT AC AAAGATT ATCTAGCT AGTGGGGGAC AACC AATC ACTAATTGTGTTA AGAT GTT GT GT AC AC AC AC ACT GGT ACT GGT C AGGC AAT A AC AGTT AC ACCGGAAGCC AAT AT GGAT C AAGAATCCTTT GGT GGT GC ATCGT GTT GT CT GT ACT GCCGTT GCC AC AT AGAT C ATCC AAAT CCT AAAGGATTTT GT GACTT AAAAGGT AAGT AT GT AC AA AT ACCT AC AACTT GT GCT AAT GA CCCT GT GGGTTTT AC ACTT AA AAAC AC AGTCT GT ACCGTCT GCGGT AT GT GGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCC GTCTTACACCGTGCGGC AC AGGC ACT AGT ACT GAT GTCGT AT AC AGGGCTTTT GAC ATCT AC AAT GATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGAC AATTT AATT GATT CTT ACTTT GT AGTT AAGAGAC AC ACTTT CT CT AACT ACC AAC AT GAAGA AACAATTTATAATTTACTT- 3' (SEQ ID NO:9)

Amplification products mixed with MRI-sensitive probes are produced for maximum signal and are specific for products produced during the LAMP process.

MRI-sensitive streptavidin-conjugated Super Mag nanoparticles of size 50 to 150 nanometers are used in this study, depending on the magnetic field of the MRI machine used. Small nanobeads of 50 nm are used in high field MRI and large nanobeads of 100 nm are used in low field MRI systems (up to 300 millitesla).

The mixed product undergoes preferred processes under a non-uniform magnetic field, a uniform magnetic field, or both within an MRI system. This is done in a preferred embodiment of a magnetic separation device used in separating beads for other applications. Arrays of multiple magnets assembled in 96-well and 384-well formats in the presence of heterogeneous magnetism are optimized for the detection method of the present invention using MRI. This process encourages the binding reaction to occur faster, and this process dramatically increases the signal by magnetically enhancing the nucleic acid signal. More precisely, this process increases the contrast, or intensity of the signal, or the difference in signal between negative and positive.

MRI images were imaged in 96-well plates using a Hyperfine MRI system and an Easote O-scan. The Hyperfine MRI system can also measure T2 values of processed samples. T2 values were measured using a Hyperfine MRI system and compared to benchtop NMR measurements made using a 60 MHz Nanalysis Benchtop NMR Spectrometer. T2 values measured on various NMR systems available at the University of Washington NMR Facility (Bruker and Varian) confirmed the difference in T2 values at various NMRs between positive and negative samples. NMR measurements and MRI images and measurements showed T2 values in the following range.

For both RT-FAMP and RT-PCR amplicons, T2 values were measured between 100 ms and 1800 ms. A T2 value less than 300 ms indicates a 'dark spot' and a T2 value greater than 500 ms indicates a 'bright spot'. The contrast varies with values between 300 ms and 500 ms. Brightness of known viral RNA or DNA (positive) and no viral or RNA (negative), positive and negative control samples were measured on MRI for unknown samples using software to aid in data processing. Used as a reference for determining positives and negatives. Image processing software is used to make decisions about the MRI data. It was developed using MATFAB and Fiji (ImageJ) to allow automated processing of MRI images collected from samples.

This example shows how NMR can be used to identify the same amplicon, and the nanoparticles used are the same for both NMR and MRI. The present invention can be practiced using NMR in situations where the number of available samples is small.

NMR gives values for T2 when measurements are made using a custom pulse sequence provided by the manufacturer (Nanalysis). These pulse sequences are named differently on different machines, and One was used in Nanalysis. The method used to determine T2 is the CPMG (Carr-Purcell-Meiboom-Gill) experiment. This is because the sequence allows us to focus on the effects of field inhomogeneities in the presence of inhomogeneities in the system.

The T2 value gives not only qualitative information, but also quantitative information to some extent, depending on the RT-LAMP and RT-PCR amplification time and the viral load in the sample. The invention is also used to quantify RT-PCR and RT-LAMP products with short amplification times between 10 and 90 minutes to quantify varying amounts of viral load or DNA.

MRI images were collected using clinical MRI equipment using arrays of all processed samples, viewed visually and/or read, transferred and processed MRI data from 3D. We used a software program that shows linear data from 3D in a very fast way to indicate positive or negative. MRI images were processed using available image processing software tools developed for this purpose, such as Fiji (ImageJ) and Matlab programs, and all available to measure the signal from the reaction tubes. The results of the test are automatically presented using software available on the MRI machine.

The illustrations in Figures 2a and 2b show MRI images obtained from RT-LAMP and Figure 2c shows an MRI image obtained from RT-PCR. There is no qualitative difference between MRI images obtained from RT-LAMP and RT-PCR.

Drawing Description:
The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

Figure 1: Representative MRI images from LAMP reactions for positive and negative samples are shown in one embodiment of the present invention. In the present invention, a biotin function is added to the 5' end of the primer, requiring a list of LAMP primers and their respective positions identified above. Dark images represent positives and light images represent negative assays. This embodiment also relates to the size of the nanoprobes attached to the product during the end-to-end assay process. Darker positives and brighter negatives are achieved with primers of specific size less than 100 nm size (eg 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 100 nm and values in between). The same can be extended to other sizes, but it gives the best contrast between the above sizes, ideally around 50nm

FIG. 1, showing darker or blacker positives and lighter or brighter negatives, is not only shown visually, but is also measured and processed using software. These intensities can be varied and different MRI pulse sequences, pulse parameters can be used to emphasize the difference between positive and negative. These parameters are adjusted based on measured or known relaxation parameters, such as T1 and T2, and other relaxation parameters associated with them. MRI pulse sequences and magnetic field pulse gradients play an important role in adjusting the relative brightness or intensity and size of dark and bright spots. Thus, MRI image contrast is determined by these magnetic resonance relaxation parameters in the presence of MRI static magnetic fields, pulsed magnetic fields, and magnetic field gradients.

Figure 2: Representative MRI images obtained from LAMP reactions of positive and negative samples are shown in another second embodiment of the invention. This invention requires a biotin function added to the 5' end of the primer and a list of LAMP primers and their respective positions identified above. Dark images represent negatives and bright imagers represent positive assays. This embodiment is also related to the large size of the nanoprobes that bind to the product during the end-to-end assay process. Brighter positives and darker negatives are primers of a specific size between 50 and 400, ideally a size of about 100 nm (e.g. 50 nm, 75 nm, 100 nm, 125 nm, 150 nm, 200 nm, 250 nm, 300 nm, 400 nm and values in between). The same could be extended to other sizes, but optimum contrast was achieved between the above sizes, ideally in the range of 50 to 150 nm.

Figure 2 showing bright positives and darker negatives The assay is also processed using specific reagents that can alter or switch the binding process between negatives and positives, but enhance binding leading to bright positives. requires additional reagents that are used to These special reagents affect the primer-bound biotin and magnetic bead-bound streptavidin and their relative interaction and binding in the presence of a magnetic field. "Nano-switching" between positives and negatives occurs because the three elements work together as a system to give different relative times and ultimately different brightness/contrast to the positives. The reason for this switch between the embodiment described in Figure 1 and the embodiment described in Figure 2 is due to the multiple forces acting and their relative strengths, the size of the nanobeads, the primers, the LAMP products. This is further modified by pH values, viscosities, invasiveness, and the presence of buffers and reagents with interactions between the above parameters and properties. A second embodiment was successful due to the optimization of the above parameters in a systematic way in a multidimensional experimental approach. The use of LAMP and sample processing buffers also interfered with these processes, all of which were optimized, validated, and finalized in this embodiment, and the consistency of results was demonstrated under this complex parameter space. .

According to an exemplary embodiment of the invention, Figures 11, 1 and 2 show each assay processed from an individual sample identified by one black or white spot represented by a circular disc. Fig. 3 shows a three-dimensional image acquired using an MRI apparatus, representing; According to this preferred embodiment of MRI detection, the goal is to develop a high-throughput detection modality that can simultaneously screen hundreds or thousands of assays for viruses and bacteria. Such modalities can be used for applications such as large-scale population screening, rapid diagnosis during pandemic outbreaks, and real-time tracking of disease spread during such outbreaks. High-throughput detection also generally helps reduce diagnostic time. The present invention is based on a novel technique for measuring changes in magnetic resonance relaxation time T2 in assays for determining the presence of specific target pathogens. Here, we use T2-weighted images to distinguish between those that carry a target virus, such as the Covid-19 coronavirus, and those that do not, using a commercially available magnetic resonance imaging (MRI) system available in hospitals. It has been proposed to read multiple assays simultaneously using This MRI-based method can leverage the existing installed base of MRI scanners, including fixed systems in hospitals and MRI centers, systems mounted on mobile trailers, and small, inexpensive portable systems that enable wide patient access. .

Preferred embodiments of the present invention allow an average MRI system to detect up to 4000 assays every 5 to 15 minutes, including loading and unloading time. There is no limit to the number of samples that can be processed simultaneously in preprocessing the number of samples to detectable assays. A LAMP or RT-LAMP assay can be processed in 20 to 30 minutes (excluding pre- and post-treatment steps such as sample lysis and magnetic treatment). The time taken for MRI detection when calculated per sample is relatively short and faster than most polymerase chain reaction (PCR) assays.

According to a preferred embodiment of the present invention, Magnetic Resonance Imaging (MRI) involves acquiring images with spatially resolved signals from a sample using a suitable combination of magnetic field gradients and RF pulses. . In two-dimensional imaging, magnetic gradients are applied, for example in the Z direction, to select slices of the sample in the XY plane for measurement.

According to a preferred embodiment of the invention, Figure 3 shows the main steps of an MRI-detected RT-LAMP amplification assay.

According to an exemplary embodiment of the present invention, the description and figures presented below illustrate the major steps of an MRI-detected RT-LAMP amplification assay. These procedures are similar to optically detected RT-LAMP and are applied to the detection of pathogens. Although the MRI detection assay is similar to the optically detected RT-LAMP assay, it differs significantly because nanoparticles are used as MRI-sensitive probes. The chemistry of conjugation between MRI-sensitive nanoparticles and primers, and the assay products vary widely. The procedure is illustrated with representative figures showing expected alterations in synthesized RNA and cDNA sequences prior to MRI detection of target pathogens.

After the LAMP or RT-LAMP reaction, the surface-bearing magnetic nanoparticles or supermagnetic nanoparticles are modified with streptavidin to bind biotin molecules present in the reaction medium. Binding is strong for LAMP primers, especially when the two primers FIP and/or BIP are biotinylated (biotin attached to the 5' end). Various sequences are listed above as sites to which biotin can be added to the primers, all combinations were tested and the results demonstrate the inventive approach shown in FIGS.

FIG. 3 shows how magnetic nanoparticles bind to unused primers after a LAMP reaction that forms strong associations between the nanobeads, one of the embodiments leading to the MRI images of FIG. These nanobeads in the absence of LAMP products enabled MRI detection by forming large clusters by biotin-streptavidin binding-induced aggregation in the presence of gradient or strong magnetic fields, resulting in long T1 and/or T2. and provide bright MRI images.

Figure 3 shows how nanobead hybridization occurs between segments of LAMP amplicons with hidden/used primers attached with biotin molecules, and steric hindrance at the nanobead surface by the amplicons leads to nanobead hybridization. Bridization brings a bit of backlash between them. Thus, the nanobeads remain uniformly distributed and dispersed in the reaction medium and short T1 and/or T2 give dark images. In a final step, the LAMP product is mixed with the magnetic nanobead solution and incubated in the presence of a string gradient magnetic field for about 5-10 minutes to allow rapid binding of the nanobeads to "unused" or remaining LAMP primers. .

FIG. 3 shows how magnetic nanoparticles bind to unused primers after a LAMP reaction that forms strong associations between the nanobeads, one of the embodiments leading to the MRI images of FIG. These nanobeads in the absence of LAMP products enabled MRI detection by forming large clusters by biotin-streptavidin binding-induced aggregation in the presence of gradient or strong magnetic fields, resulting in long T1 and/or T2. and provide bright MRI images.

Figure 3 shows how nanobead hybridization occurs between segments of LAMP amplicons with hidden/used primers bound by biotin molecules, reduced by steric hindrance on the nanobead surface by the amplicons. , resulting in a backlash between them. Thus, the nanobeads remain uniformly distributed and dispersed in the reaction medium and short T1 and/or T2 give dark images. In a final step, the LAMP product is mixed with the magnetic nanobead solution and incubated in the presence of a string gradient magnetic field for about 5-10 minutes to allow rapid binding of the nanobeads to "unused" or remaining LAMP primers. .

Influenza A and B have been validated in the endpoint RT-LAMP assay. MRI-based LAMP and RT-LAMP detection of various strains of COVID-19, COVID-19 by stacking RT-LAMP in an MRI coil and processing the MRI images using automated software. Enables multiple assays in minutes. Analytical sensitivities of 20 to 100 RNA copies per reaction and diagnostic sensitivities and specificities of 98.3% and 100%, respectively, were achieved by this approach for COVID and influenza viruses.

MRI detection PCR and RT-PCR detection were also validated for COVID-19 and are shown in Figure 4

Claims (23)

A method of detecting a target nucleic acid comprising the steps of:
a) providing a sample containing a target nucleic acid;
b) amplifying a target nucleic acid using at least one primer, wherein said at least one primer is biotinylated, thereby preparing a biotinylated target nucleic acid;
c) reacting the biotinylated target nucleic acid with streptavidin-nanoparticles, thereby forming amplified target nucleic acid-nanoparticle complexes; and d) analyzing said nucleic acid-nanoparticle complexes by MRI or NMR. The step of detecting. 2. The method of claim 1, wherein amplification of the target nucleic acid comprises LAMP or PCR. 2. The method of claim 1, wherein amplification of the target nucleic acid comprises reverse transcription. 4. The method of claim 3, wherein said method is performed with RT-LAMP or RT-PCR. 2. The method of claim 1, wherein the sample is a human clinical sample. 6. The method of claim 5, wherein the human clinical sample is saliva or a nasal swab. 2. The sample of claim 1, wherein the sample is treated with at least one of a chelating agent, proteinase K, guanidinium hydrochloride, guanidinium compositions, and combinations thereof to lyse or dissociate cells or release nucleic acids from associated proteins. Method. 8. The method of claim 7, which does not require isolation or purification of nucleic acids. 2. The method of claim 1, wherein the target nucleic acid is a pathogen nucleic acid. 10. The method of claim 9, wherein the pathogen is a pathogenic virus or bacterium. 11. The method of claim 10, wherein the virus is SARS-CoV-2 or variants thereof. A method of screening multiple samples for the presence of a target nucleic acid comprising the steps of:
a) providing a plurality of clinical samples containing the target nucleic acid;
b) amplifying a target nucleic acid in each of a plurality of clinical samples using at least one primer, wherein at least one primer is biotinylated to prepare a plurality of biotinylated target nucleic acid samples; the step of
c) reacting each of a plurality of biotinylated target nucleic acid samples with streptavidin-conjugated nanoparticles, thereby forming a plurality of amplified target nucleic acid-nanoparticle complexes; and d) reacting a plurality of nucleic acids by MRI or NMR. - Detecting nanoparticle complexes. 13. The method of claim 12, wherein amplifying the target nucleic acid comprises LAMP or PCR. 13. The method of claim 12, wherein amplifying the target nucleic acid comprises reverse transcription. 13. The method of claim 12, wherein the amplification of target nucleic acid is RT-LAMP or RT-PCR. 13. The method of claim 12, wherein the plurality of samples are human clinical samples. 17. The method of claim 16, wherein the human clinical sample is saliva or a nasal swab. 4. The plurality of clinical samples are treated with at least one of chelating agents, proteinase K, guanidinium hydrochloride, guanidinium compositions and combinations thereof to lyse or dissociate cells or release nucleic acids from associated proteins. 12. The method according to 12. 19. The method of claim 18, which does not require nucleic acid isolation or purification. 13. The method of claim 12, wherein the target nucleic acid is a pathogen nucleic acid. 21. The method of claim 20, wherein the pathogen is a pathogenic virus or bacterium. 22. The method of claim 21, wherein the virus is SARS-CoV-2 or a variant thereof. 13. The method of claim 12, wherein the MRI that simultaneously detects the plurality of nucleic acid-nanoparticle complexes is 3-D MRI.

Images