JP2023510853A - Methods of Treating Cancer Using Polynucleotides Encoding GM-CSF and Additional Agents - Google Patents

Abstract

Disclosed herein are compositions and methods for preventing recurrence of ovarian cancer and for treating BRCA1/2-wild-type ovarian cancer. In some embodiments, the composition comprises an autologous tumor cell vaccine comprising cells genetically modified for furin knockdown and GM-CSF expression. In some embodiments, the method comprises administering an autologous tumor cell vaccine followed by administering a combination of said autologous tumor cell vaccine and atezolizumab. Also disclosed herein are methods of treating cancer in individuals identified as homologous recombination repair deficient (HRD)-negative that contain a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof. there is

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application is based on U.S. Provisional Application No. 62/960,583 filed January 13, 2020; U.S. Provisional Application No. 63/034,868 filed June 4, 2020; Claims priority and benefit of U.S. Provisional Application No. 63/061,634, filed Aug. 5, 2005. All of the above provisional applications are incorporated herein by reference for all purposes.

Ovarian cancer has a high mortality rate among malignant tumors in women. High mortality results from chemotherapy resistance and frequent recurrences of ovarian cancer. Although drugs are being developed to treat ovarian cancer, ovarian cancer mortality and recurrence rates remain high. Treatment of advanced ovarian cancer is typically based on a combination of surgery and chemotherapy. Surgery is followed by adjuvant platinum-based chemotherapy. The two most important prognostic factors for patients with advanced ovarian cancer are the amount of residual disease after surgery and response to platinum-based chemotherapy.

Disclosed herein are methods of administering cancer therapy to an individual in need thereof, comprising: a. a first insert comprising a nucleic acid sequence encoding a granulocyte macrophage colony stimulating factor (GM-CSF) sequence; b. Two stem-loop structures each with a miR-30a loop (the first stem-loop structure has the perfectly complementary guide and passenger strands, whereas the second stem-loop structure has the passenger strands administering to said individual an expression vector comprising a second insert comprising three base pair (bp) mismatches at positions 9-11 of said individual, wherein said individual is homologous recombination repair deficient (HRD) negative , and/or the individual has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof.

In some embodiments, said guide strand in said first stem-loop structure comprises the sequence of SEQ ID NO:6 and said passenger strand in said first stem-loop structure has the sequence of SEQ ID NO:5 have.

In some embodiments, said guide strand in said second stem-loop structure comprises the sequence of SEQ ID NO:6 and said passenger strand in said second stem-loop structure has the sequence of SEQ ID NO:7 have.

In some embodiments, said miR-30a loop comprises the sequence of SEQ ID NO:8.

Disclosed in certain embodiments herein is a method of treating cancer in an individual in need thereof, comprising: a. a first insert comprising a nucleic acid sequence encoding a granulocyte macrophage colony stimulating factor (GM-CSF) sequence; b. administering to said individual an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4). In some embodiments, the individual is homologous recombination repair defective (HRD) negative. In some embodiments, the individual has substantially eradicated ovarian cancer, and the method prevents or delays recurrence or relapse of the substantially eradicated ovarian cancer. The term "relapse" is used interchangeably with "relapse".

Disclosed in certain embodiments herein are methods of preventing recurrence or prophylactic treatment of recurrence of substantially eradicated ovarian cancer in an individual in need thereof, comprising: (a) a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and (b) a second insert comprising a sequence according to SEQ ID NO:2 or 4 (SEQ ID NO:4). administering to said individual autologous tumor cells transfected with an expression vector containing an insert of In some embodiments, the substantially eradicated ovarian cancer is stage III or stage IV ovarian cancer. In some embodiments, the individual comprises a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof. In some embodiments, recurrence-free survival (RFS) of said individual is prolonged compared to an individual whose ovarian cancer has been substantially eradicated but has not been administered said transfected tumor cells. .

In some embodiments, the individual received initial therapy. In some embodiments, said initial therapy comprises cytoreductive surgery, chemotherapy, or a combination thereof. In some embodiments, said chemotherapy comprises administering a platinum agent and a taxane. In some embodiments, the platinum agent comprises carboplatin. In some embodiments, the taxane comprises paclitaxel.

In some embodiments, said GM-CSF is a human GM-CSF sequence. In some embodiments, said expression vector further comprises a promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) mammalian promoter. In some embodiments, the expression vector further comprises a CMV enhancer sequence and a CMV intron sequence. In some embodiments, said first insert and said second insert are operably linked to said promoter. In some embodiments, said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skip peptide between said first and said second nucleic acid inserts.

In some embodiments, the autologous tumor cells are administered to the individual at a dose of about 1×10 ⁶ cells to about 5×10 ⁷ cells. In some embodiments, said autologous tumor cells are administered to said individual once a month. In some embodiments, the autologous tumor cells are administered to the individual for 1-12 months (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months). ). In some embodiments, the autologous tumor cells are administered to the individual by intradermal injection.

Disclosed in certain embodiments herein is a method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising: (a) granulocyte macrophages transfected with an expression vector containing a first insert containing a nucleic acid sequence encoding a colony stimulating factor (GM-CSF) sequence and (b) a second insert containing a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4). administering autologous tumor cells to said individual. In some embodiments, the ovarian cancer is stage III or stage IV ovarian cancer. In some embodiments, said ovarian cancer is recurrent ovarian cancer. In some embodiments, said ovarian cancer is refractory ovarian cancer. In some embodiments, said refractory ovarian cancer is refractory to chemotherapy. In some embodiments, said chemotherapy comprises a platinum agent or a taxane. In some embodiments, the platinum agent comprises carboplatin. In some embodiments, the taxane comprises paclitaxel. In some embodiments, the ovarian cancer is relapsed/refractory (r/r) ovarian cancer. In some embodiments, recurrent or recurrent/refractory ovarian cancer is referred to as recurrent ovarian cancer.

In some embodiments, the method further comprises administering an additional therapeutic agent. In some embodiments, said additional therapeutic agent selection is for said individual from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor. In some embodiments, said angiogenesis inhibitor is a vascular endothelial growth factor (VEGF) inhibitor. In some embodiments, said VEGF selection is from the group consisting of sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, and levatinib. In some embodiments, said VEGF is bevacizumab. In some embodiments, the PARP inhibitor selection is from the group consisting of niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, and pamiparib. In some embodiments, the PARP inhibitor is niraparib. In some embodiments, said checkpoint inhibitor selection is made from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors. In some embodiments, said checkpoint inhibitor selection is made from the group consisting of pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab.

In some embodiments, said GM-CSF is a human GM-CSF sequence. In some embodiments, said expression vector further comprises a promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) mammalian promoter. In some embodiments, the expression vector further comprises a CMV enhancer sequence and a CMV intron sequence. In some embodiments, said first insert and said second insert are operably linked to said promoter. In some embodiments, said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skip peptide between said first and said second nucleic acid inserts.

In some embodiments, the autologous tumor cells are administered to the individual at a dose of about 1×10 ⁶ cells to about 5×10 ⁷ cells. In some embodiments, said autologous tumor cells are administered to said individual once a month. In some embodiments, the autologous tumor cells are administered to the individual for 1-12 months. In some embodiments, the autologous tumor cells are administered to the individual by intradermal injection.

Disclosed in certain embodiments herein are methods of preventing recurrence or prophylactic treatment of recurrence of substantially eradicated ovarian cancer in an individual in need thereof, comprising: The method is a. i. a first insert comprising a nucleic acid sequence encoding a granulocyte macrophage colony stimulating factor (GM-CSF) sequence; ii. at least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4); b. administering at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent to said individual. In some embodiments, the substantially eradicated ovarian cancer is stage III or stage IV ovarian cancer. In some embodiments, the individual has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof. In some embodiments, recurrence-free survival (RFS) of said individual is prolonged compared to an individual whose ovarian cancer has been substantially eradicated but has not been administered said transfected tumor cells. .

In some embodiments, the individual received initial therapy. In some embodiments, said initial therapy comprises cytoreductive surgery, chemotherapy, or a combination thereof. In some embodiments, said chemotherapy comprises administering a platinum agent and a taxane. In some embodiments, the platinum agent comprises carboplatin. In some embodiments, the taxane comprises paclitaxel. In some embodiments, said GM-CSF is a human GM-CSF sequence.

In some embodiments, said expression vector further comprises a promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) mammalian promoter. In some embodiments, the expression vector further comprises a CMV enhancer sequence and a CMV intron sequence. In some embodiments, said first insert and said second insert are operably linked to said promoter. In some embodiments, said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skip peptide between said first and said second nucleic acid inserts.

In some embodiments, said additional therapeutic agent selection is for said individual from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor. In some embodiments, said angiogenesis inhibitor is a vascular endothelial growth factor (VEGF) inhibitor. In some embodiments, said VEGF selection is from the group consisting of sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, and levatinib. In some embodiments, said VEGF is bevacizumab. In some embodiments, the PARP inhibitor selection is from the group consisting of niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, and pamiparib. In some embodiments, the PARP inhibitor is niraparib. In some embodiments, said checkpoint inhibitor selection is made from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors. In some embodiments, said checkpoint inhibitor selection is made from the group consisting of pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab. In some embodiments, said checkpoint inhibitor is atezolizumab.

In some embodiments, said dose of said at least one of said additional therapeutic agents is between 1100 mg and 1300 mg. In some embodiments, said at least one first dose of said autologous tumor cell vaccine comprises from about 1×10 ⁶ cells to about 5×10 ⁷ cells. In some embodiments, said at least one second dose of said autologous tumor cell vaccine comprises from about 1×10 ⁶ cells to about 5×10 ⁷ cells. In some embodiments, said at least one first dose of said autologous tumor cells is administered to said individual by intradermal injection. In some embodiments, said at least one second dose of said autologous tumor cell vaccine is administered to said individual by intradermal injection. In some embodiments, said at least one dose of said additional therapeutic agent is administered to said individual by intradermal injection.

In some embodiments, said at least one first dose of said autologous tumor cell vaccine comprises two doses (2, 3, 4, or 5 doses, or more). In some embodiments, each dose of said at least one first dose of said autologous tumor cell vaccine is administered to said individual once a month. In some embodiments, each dose of said at least one second dose of said autologous tumor cell vaccine is administered to said individual once a month. In some embodiments, each dose of said at least one dose of said additional therapeutic agent is administered to said individual at least once a month. In some embodiments, said at least one first dose of said autologous tumor cell vaccine and said at least one second dose of said autologous tumor cell vaccine comprise a total of at least 12 doses.

Disclosed in certain embodiments herein is a method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising: a. i. a first insert comprising a nucleic acid sequence encoding a granulocyte macrophage colony stimulating factor (GM-CSF) sequence; ii. at least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4); b. administering at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent to said individual. In some embodiments, the ovarian cancer is stage III or stage IV ovarian cancer. In some embodiments, said ovarian cancer is refractory ovarian cancer. In some embodiments, said refractory ovarian cancer is refractory to chemotherapy. In some embodiments, said chemotherapy comprises a platinum agent or a taxane. In some embodiments, the platinum agent comprises carboplatin. In some embodiments, the taxane comprises paclitaxel. In some embodiments, said GM-CSF is a human GM-CSF sequence.

In some embodiments, said expression vector further comprises a promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) mammalian promoter. In some embodiments, the expression vector further comprises a CMV enhancer sequence and a CMV intron sequence. In some embodiments, said first insert and said second insert are operably linked to said promoter. In some embodiments, said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skip peptide between said first and said second nucleic acid inserts.

In some embodiments, said additional therapeutic agent selection is for said individual from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor. In some embodiments, said angiogenesis inhibitor is a vascular endothelial growth factor (VEGF) inhibitor. In some embodiments, said VEGF selection is from the group consisting of sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, and levatinib. In some embodiments, said VEGF is bevacizumab. In some embodiments, the PARP inhibitor selection is from the group consisting of niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, and pamiparib. In some embodiments, the PARP inhibitor is niraparib. In some embodiments, said checkpoint inhibitor selection is made from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors. In some embodiments, said checkpoint inhibitor selection is made from the group consisting of pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab. In some embodiments, said checkpoint inhibitor is atezolizumab.

In some embodiments, said dose of said at least one of said additional therapeutic agents is between 1100 mg and 1300 mg. In some embodiments, said at least one first dose of said autologous tumor cell vaccine comprises from about 1×10 ⁶ cells to about 5×10 ⁷ cells. In some embodiments, said at least one second dose of said autologous tumor cell vaccine comprises from about 1×10 ⁶ cells to about 5×10 ⁷ cells. In some embodiments, said at least one first dose of said autologous tumor cells is administered to said individual by intradermal injection. In some embodiments, said at least one second dose of said autologous tumor cell vaccine is administered to said individual by intradermal injection. In some embodiments, said at least one dose of said additional therapeutic agent is administered to said individual by intravenous infusion.

In some embodiments, said at least one first dose of said autologous tumor cell vaccine comprises two doses. In some embodiments, each dose of said at least one first dose of said autologous tumor cell vaccine is administered to said individual once a month. In some embodiments, each dose of said at least one second dose of said autologous tumor cell vaccine is administered to said individual once a month. In some embodiments, each dose of said at least one dose of said additional therapeutic agent is administered to said individual at least once a month. In some embodiments, said at least first dose of said autologous tumor cell vaccine and said at least second dose of said autologous tumor cell vaccine comprise a total of at least 12 doses.

In some embodiments, the disclosure features a method of treating cancer in an individual in need thereof, comprising: a) a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; administering to said individual an expression vector comprising a first insert comprising a nucleic acid sequence encoding and b) a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4), said individual comprising: Has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination of these and has been identified as negative for homologous recombination repair defects (HRD).

In some embodiments, said GM-CSF is a human GM-CSF sequence.

In some embodiments, said expression vector further comprises a promoter. In some embodiments, the promoter is a cytomegalovirus (CMV) mammalian promoter. In some embodiments, the expression vector further comprises a CMV enhancer sequence and a CMV intron sequence. In some embodiments, said first insert and said second insert are operably linked to said promoter. In some embodiments, said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skip peptide between said first and said second nucleic acid inserts.

In some embodiments, the cancer is HRD-negative wild-type BRCA1/2 cancer. In some embodiments, the selection of cancer is solid tumor cancer, ovarian cancer, adrenocortical cancer, bladder cancer, breast cancer, cervical cancer, cholangiocarcinoma, colorectal cancer, esophageal cancer, Glioblastoma, glioma, hepatocellular carcinoma, head and neck cancer, renal cancer, leukemia, lymphoma, lung cancer, melanoma, mesothelioma, multiple myeloma, pancreatic cancer, pheochromocytoma, plasmacytoma , neuroblastoma, prostate cancer, sarcoma, gastric cancer, uterine cancer, thyroid cancer, and blood cancer. In a particular embodiment, said solid tumor cancer selection comprises endometrial cancer, cholangiocarcinoma, bladder cancer, hepatocellular carcinoma, gastric/esophageal cancer, ovarian cancer, melanoma, breast cancer, pancreatic cancer. cancer, colorectal cancer, glioma, non-small cell lung cancer, prostate cancer, cervical cancer, kidney cancer, thyroid cancer, neuroendocrine cancer, small cell lung cancer, sarcoma, head and neck cancer, brain It is made up of the group consisting of carcinoma, renal clear cell carcinoma, skin cancer, endocrine tumor, thyroid cancer, tumor of unknown primary, and gastrointestinal stromal tumor. In one embodiment, the cancer is ovarian cancer.

In some embodiments, the methods prevent or delay recurrence of substantially eradicated ovarian cancer. In a specific embodiment, said substantially eradicated ovarian cancer is stage III or stage IV ovarian cancer. In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is melanoma. In some embodiments, the cancer is lung cancer.

In some embodiments, the expression vector is in autologous cancer cells transfected with the expression vector. In a specific embodiment, said autologous tumor cells are administered to said individual in a dose of about 1×10 ⁶ cells to about 5×10 ⁷ cells. In some embodiments, said autologous tumor cells are administered to said individual once a month. In some embodiments, the autologous tumor cells are administered to the individual for 1-12 months. In some embodiments, the autologous tumor cells are administered to the individual by intradermal injection.

In some embodiments, the individual received initial therapy. In a specific embodiment, said first therapy comprises cytoreductive surgery, chemotherapy, or a combination thereof. In one embodiment, said chemotherapy comprises administering a platinum agent and a taxane. In one embodiment, the platinum agent comprises carboplatin. In some embodiments, the taxane comprises paclitaxel.

In some embodiments, the method further comprises administering an additional therapeutic agent. In certain embodiments, said additional therapeutic agent is a member selected from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor for said individual.

The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure may be obtained by reference to the following detailed description and accompanying drawings, which illustrate illustrative embodiments in which the principles of the disclosure are employed.

Figure 1 is a schematic representation of a bi-shRNA ^furin (SEQ ID NO: 2) containing two stem-loop structures each carrying miR-30a; The second stem-loop structure has three base pair (bp) mismatches in positions 9-11 of the passenger strand, whereas it has a passenger strand.

Figures 2A-2D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 2A shows RFS from surgery/harvest in the BRCA1/2 wild type (wt) population. FIG. 2B shows RFS from randomization of BRCA1/2 wild-type (wt) population with Vigil® and placebo. FIG. 2C shows RFS from surgery/collection regardless of BRCA1/2 status. FIG. 2D shows RFS from the Vigil® versus placebo randomization regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 2A-2D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 2A shows RFS from surgery/harvest in the BRCA1/2 wild type (wt) population. FIG. 2B shows RFS from randomization of BRCA1/2 wild-type (wt) population with Vigil® and placebo. FIG. 2C shows RFS from surgery/collection regardless of BRCA1/2 status. FIG. 2D shows RFS from the Vigil® versus placebo randomization regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 2A-2D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 2A shows RFS from surgery/harvest in the BRCA1/2 wild type (wt) population. FIG. 2B shows RFS from randomization of BRCA1/2 wild-type (wt) population with Vigil® and placebo. FIG. 2C shows RFS from surgery/collection regardless of BRCA1/2 status. FIG. 2D shows RFS from the Vigil® versus placebo randomization regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 2A-2D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 2A shows RFS from surgery/harvest in the BRCA1/2 wild type (wt) population. FIG. 2B shows RFS from randomization of BRCA1/2 wild-type (wt) population with Vigil® and placebo. FIG. 2C shows RFS from surgery/collection regardless of BRCA1/2 status. FIG. 2D shows RFS from the Vigil® versus placebo randomization regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 3A-3B show the percentage of any recurrent disease for Vigil ® and placebo. FIG. 3A shows the percentage of all recurrent disease in BRCA1/2-wt patients on Vigil® (n=24) and placebo (n=24). FIG. 3B shows the percentage of all recurrent disease on Vigil® (n=46) and placebo (n=45) for all n=91 protocol adherent patients.

FIG. 4 shows forest plot key demographics for Vigil®/placebo patients.

Figure 5 is a schematic representation of a bi-shRNA ^furin (SEQ ID NO: 2) containing two stem-loop structures each with miR-30a; The second stem-loop structure has three base pair (bp) mismatches in positions 9-11 of the passenger strand, whereas it has a passenger strand.

Figures 6A-6F show recurrence-free survival (RFS) or overall survival (OS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. Figure 6A shows the RFS of all patients from randomization. FIG. 6B shows the RFS of all patients from surgery/sampling. Figure 6C shows the RFS of the BRCA1/2 wild-type (wt) population from randomization. Figure 6D shows the RFS of the BRCA1/2 wild type (wt) population from surgery/harvesting. FIG. 6E shows OS of the BRCA1/2 wild-type (wt) population from randomization. FIG. 6F shows OS of BRCA1/2 wild type (wt) population from surgery/harvesting. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 6A-6F show recurrence-free survival (RFS) or overall survival (OS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. Figure 6A shows the RFS of all patients from randomization. FIG. 6B shows the RFS of all patients from surgery/sampling. Figure 6C shows the RFS of the BRCA1/2 wild-type (wt) population from randomization. Figure 6D shows the RFS of the BRCA1/2 wild type (wt) population from surgery/harvesting. FIG. 6E shows OS of the BRCA1/2 wild-type (wt) population from randomization. FIG. 6F shows OS of BRCA1/2 wild type (wt) population from surgery/harvesting. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 6A-6F show recurrence-free survival (RFS) or overall survival (OS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. Figure 6A shows the RFS of all patients from randomization. FIG. 6B shows the RFS of all patients from surgery/sampling. Figure 6C shows the RFS of the BRCA1/2 wild-type (wt) population from randomization. Figure 6D shows the RFS of the BRCA1/2 wild type (wt) population from surgery/harvesting. FIG. 6E shows OS of the BRCA1/2 wild-type (wt) population from randomization. FIG. 6F shows OS of BRCA1/2 wild type (wt) population from surgery/harvesting. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 6A-6F show recurrence-free survival (RFS) or overall survival (OS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. Figure 6A shows the RFS of all patients from randomization. FIG. 6B shows the RFS of all patients from surgery/sampling. Figure 6C shows the RFS of the BRCA1/2 wild-type (wt) population from randomization. Figure 6D shows the RFS of the BRCA1/2 wild type (wt) population from surgery/harvesting. FIG. 6E shows OS of the BRCA1/2 wild-type (wt) population from randomization. FIG. 6F shows OS of BRCA1/2 wild type (wt) population from surgery/harvesting. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 6A-6F show recurrence-free survival (RFS) or overall survival (OS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. Figure 6A shows the RFS of all patients from randomization. FIG. 6B shows the RFS of all patients from surgery/sampling. Figure 6C shows the RFS of the BRCA1/2 wild-type (wt) population from randomization. Figure 6D shows the RFS of the BRCA1/2 wild type (wt) population from surgery/harvesting. FIG. 6E shows OS of the BRCA1/2 wild-type (wt) population from randomization. FIG. 6F shows OS of BRCA1/2 wild type (wt) population from surgery/harvesting. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 6A-6F show recurrence-free survival (RFS) or overall survival (OS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. Figure 6A shows the RFS of all patients from randomization. FIG. 6B shows the RFS of all patients from surgery/sampling. Figure 6C shows the RFS of the BRCA1/2 wild-type (wt) population from randomization. Figure 6D shows the RFS of the BRCA1/2 wild type (wt) population from surgery/harvesting. FIG. 6E shows OS of the BRCA1/2 wild-type (wt) population from randomization. FIG. 6F shows OS of BRCA1/2 wild type (wt) population from surgery/harvesting. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 7A-7B show forest plots. FIG. 7A shows forest plots of major subgroups of PPs with RFS calculated from the time of randomization to the date when relapse or death was first documented. FIG. 7B shows a forest plot of major subgroups of the BRCA-wt population with RFS calculated from the time of randomization to the date when relapse or death was first documented.

Figures 7A-7B show forest plots. FIG. 7A shows forest plots of major subgroups of PPs with RFS calculated from the time of randomization to the date when relapse or death was first documented. FIG. 7B shows a forest plot of major subgroups of the BRCA-wt population with RFS calculated from the time of randomization to the date when relapse or death was first documented.

FIG. 8 shows all atezolizumab-related adverse events (AEs) for Vigil®-1 ^st and Atezo-1 ^st in Study Part 2. There were 24 grade 1 and 2 atezolizumab-related AEs in the Atezo-1 ^st arm and 50 in the Vigil®-1 ^st arm. Grade 1 and 2 Vigil®-related AEs were 1 in the Atezo-1 ^st arm and 31 in the Vigil®-1 ^st arm. There were 5 grade 3, 4 atezolizumab-related AEs in the Atezo-1 ^st arm and 1 in the Vigil®-1 ^st arm. There were 0 grade 3, 4 Vigil®-related AEs in the Atezo-1 ^st arm and 1 in the Vigil®-1 ^st arm.

Figures 9A-9D show the efficacy analysis from the randomization time point in the study. Figure 9A shows the overall survival (OS) for all study subjects in Vigil®-1 ^st (n=11) and Atezo-1 ^st (n=10), with a median OS (mOS) of NR vs. 10.8 months, hazard ratio (HR) 0.33 (95% CI [0.064 to 1.7], p = 0.097). Figure 9B shows OS for BRCA1/2-wt comparing Vigil®-1 ^st (n=6) and Atezo-1 ^st (n=7), median OS NR vs. 5.2 months , HR is 0.16 (95% CI [0.026 to 1.03], p = 0.027). Figure 9C depicts progression-free survival (PFS) for all study subjects in Vigil®-1 ^st (n=11) and Atezo-1 ^st (n=10) as assessed by RECIST 1.1 by investigator with a median PFS (mPFS) of 3.4 vs. 2.8 months and an HR of 0.76 (95% CI [0.28–2.0], p = 0.29). Figure 9D shows BRCA1/2-wt PFS comparing Vigil®-1 ^st (n=6) with Atezo-1 ^st (n=7), median PFS of 3.5 months vs. 2.8 months, HR is 0.60 (95% CI [0.16 to 2.2], p = 0.22).

Figures 9A-9D show the efficacy analysis from the randomization time point in the study. Figure 9A shows overall survival (OS) for all study subjects in Vigil®-1 ^st (n=11) and Atezo-1 ^st (n=10) with median OS (mOS) of NR vs. 10.8 months, hazard ratio (HR) 0.33 (95% CI [0.064 to 1.7], p = 0.097). Figure 9B shows OS for BRCA1/2-wt comparing Vigil®-1 ^st (n=6) and Atezo-1 ^st (n=7), median OS NR vs. 5.2 months , HR is 0.16 (95% CI [0.026 to 1.03], p = 0.027). Figure 9C depicts progression-free survival (PFS) for all study subjects in Vigil®-1 ^st (n=11) and Atezo-1 ^st (n=10) as assessed by RECIST 1.1 by investigator with a median PFS (mPFS) of 3.4 months vs. 2.8 months and an HR of 0.76 (95% CI [0.28–2.0], p = 0.29). Figure 9D shows BRCA1/2-wt PFS comparing Vigil®-1 ^st (n=6) with Atezo-1 ^st (n=7), median PFS of 3.5 months vs. 2.8 months, HR is 0.60 (95% CI [0.16 to 2.2], p = 0.22).

Figures 10A-10D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 10A shows RFS of BRCA1/2 wild-type (wt) population from surgery/harvesting. FIG. 10B shows the RFS of the BRCA1/2 wild type (wt) population from randomization with Vigil® and placebo. FIG. 10C shows RFS from surgery/harvest regardless of BRCA1/2 status. FIG. 10D shows RFS from randomization on Vigil® versus placebo, regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 10A-10D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 10A shows RFS of BRCA1/2 wild-type (wt) population from surgery/harvesting. FIG. 10B shows the RFS of the BRCA1/2 wild type (wt) population from randomization with Vigil® and placebo. FIG. 10C shows RFS from surgery/harvest regardless of BRCA1/2 status. FIG. 10D shows RFS from randomization on Vigil® versus placebo, regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 10A-10D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 10A shows RFS of BRCA1/2 wild-type (wt) population from surgery/harvesting. FIG. 10B shows the RFS of the BRCA1/2 wild type (wt) population from randomization with Vigil® and placebo. FIG. 10C shows RFS from surgery/harvest regardless of BRCA1/2 status. FIG. 10D shows RFS from randomization on Vigil® versus placebo, regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 10A-10D show recurrence-free survival (RFS) of patients from surgery/harvesting or randomization on Vigil ® versus placebo. FIG. 10A shows RFS of BRCA1/2 wild-type (wt) population from surgery/harvesting. FIG. 10B shows the RFS of the BRCA1/2 wild type (wt) population from randomization with Vigil® and placebo. FIG. 10C shows RFS from surgery/harvest regardless of BRCA1/2 status. FIG. 10D shows RFS from randomization on Vigil® versus placebo, regardless of BRCA1/2 status. Number at risk means the number of patients who are still recurrence-free and/or alive in the survival curve and have been followed up at least that far in the curve.

Figures 11A and 11B show the percentage of total recurrent disease for Vigil ® and placebo. FIG. 11A shows the proportion of total recurrent disease in BRCA1/2-wt patients on Vigil® (n=24) and placebo (n=24). FIG. 11B shows the percentage of all recurrent disease for Vigil® (n=46) and placebo (n=45) for all n=91 protocol adherent patients.

Figures 11A and 11B show the percentage of total recurrent disease for Vigil ® and placebo. FIG. 11A shows the proportion of total recurrent disease in BRCA1/2-wt patients on Vigil® (n=24) and placebo (n=24). FIG. 11B shows the percentage of all recurrent disease for Vigil® (n=46) and placebo (n=45) for all n=91 protocol adherent patients.

FIG. 12 shows forest plot key demographics for Vigil®/placebo patients.

FIG. 13 shows the BRCA mutation status and HRD status of individuals who received placebo and those who received Vigil®.

Figures 14 and 15 show forest plot key demographics in Vigil®/placebo patients.

Figures 14 and 15 show forest plot key demographics in Vigil®/placebo patients.

FIG. 16 shows the BRCA mutation status and HRD status of individuals who received placebo and those who received Vigil®.

Figures 17-20 show forest plot key demographics in Vigil®/placebo patients.

Figures 17-20 show forest plot key demographics in Vigil®/placebo patients.

Figures 17-20 show forest plot key demographics in Vigil®/placebo patients.

Figures 17-20 show forest plot key demographics in Vigil®/placebo patients.

Figures 21 and 22 show the RFS of patient populations from surgery/harvesting (Figure 13) and randomization (Figure 14).

Figures 21 and 22 show the RFS of patient populations from surgery/harvesting (Figure 13) and randomization (Figure 14).

Figures 23 and 24 show the overall survival (OS) of the patient population from surgery/harvesting (Figure 15) and randomization (Figure 16).

Figures 23 and 24 show the overall survival (OS) of the patient population from surgery/harvesting (Figure 15) and randomization (Figure 16).

Figure 25 shows the probability of RFS for the patient population from randomisation.

Figure 26 shows the probability of OS for the patient population from randomization.

FIG. 27 shows BRCA status, HRD status, and OS for patients receiving Vigil® and other agents.

Figure 28 shows HR-DDR mutation frequencies in various types of cancer.

Figure 29 shows the relationship between BRCA status, HRD status, and other protein expression.

Figures 30 and 31 show forest plot key demographics of HRD-negative and HRD-positive patients.

Figures 30 and 31 show forest plot key demographics of HRD-negative and HRD-positive patients.

Figures 32 and 33 show forest plot key demographics of BRCA1/2-WT and HRD positive patients.

Figures 32 and 33 show forest plot key demographics of BRCA1/2-WT and HRD positive patients.

Figure 34 shows the profile of the study patient. BRCA ^WT = BRCA wild type. BRCA ^mut = BRCA mutation.

Figures 35A-35F show recurrence-free survival for all patients from randomization (35A) and tissue sampling (35B). Recurrence-free survival of patients with BRCA wild-type disease from randomization (35C) and tissue sampling (35D). Overall survival for all patients from randomization (35E) and tissue sampling (35F). HR = hazard ratio.

Figures 36A and 36B show the non-recurrence calculated from the time of randomization to the date of first documented Recurrence survival time is shown. Unless otherwise stated, data are number of events/number of patients. HR = hazard ratio. * Over 30% knockdown. † Exceeds release threshold of 30 pg per 10 ⁶ cells.

Figures 36A and 36B show the non-recurrence calculated from the time of randomization to the date of first documented Recurrence survival time is shown. Unless otherwise stated, data are number of events/number of patients. HR = hazard ratio. * Over 30% knockdown. † Exceeds release threshold of 30 pg per 10 ⁶ cells.

Figures 37A-37D show Kaplan-Meier analysis of the ITT population. Recurrence-free survival of BRCA wild-type patients willing to treat from tissue sampling (A) and randomization (B). Recurrence-free survival in all willing-to-treat patients from tissue sampling (C) and randomization (D).

Figures 37A-37D show Kaplan-Meier analysis of the ITT population. Recurrence-free survival of BRCA wild-type patients willing to treat from tissue sampling (A) and randomization (B). Recurrence-free survival in all willing-to-treat patients from tissue sampling (C) and randomization (D).

Figure 38 shows a forest plot of overall survival for the patient population from the time of randomization.

Figure 39 shows overall survival forest plots for protocol adherent and BRCA wild type populations.

Figures 40A-40D show the overall survival of BRCA wild-type patients from the time of randomization (Figure 40A) and tissue sampling (Figure 40B). Overall survival of BRCA-mutant patients from the time of randomization (Fig. 40C) and tissue sampling (Fig. 40D).

Figures 40A-40D show the overall survival of BRCA wild-type patients from the time of randomization (Figure 40A) and tissue sampling (Figure 40B). Overall survival of BRCA-mutant patients from the time of randomization (Fig. 40C) and tissue sampling (Fig. 40D).

Figures 41A and 41B show recurrence free survival of BRCA mutated patients from the time of randomization (Figure 41A) and the time of tissue sampling (Figure 41B).

Most women diagnosed with cancer of the ovary are in an advanced stage. Optimal standard therapy achieves 5-year survival rates that vary by stage, ranging from 41% (stage IIa) to 20% (stage IV). Standard treatment for newly diagnosed ovarian cancer (stage III/IV) includes optimal cytoreductive surgery and frontline chemotherapy with paclitaxel and carboplatin. Most patients achieve a complete remission, but approximately 75% relapse within approximately 12 months, including 70% of patients who achieve a complete pathologic response. A number of studies have attempted to improve outcomes in initially treated ovarian cancer by giving maintenance therapy after patients have achieved a complete response, followed by intensification with paclitaxel and carboplatin. However, no study has been able to demonstrate significant benefit in recurrence-free survival (RFS) or overall survival (OS).

Disclosed in certain embodiments herein is a method of treating cancer in an individual in need thereof, comprising: a. a first insert comprising a nucleic acid sequence encoding a granulocyte macrophage colony stimulating factor (GM-CSF) sequence; b. Two stem-loop structures each with a miR-30a loop (the first stem-loop structure has the perfectly complementary guide and passenger strands, whereas the second stem-loop structure has the passenger strands administering to said individual an expression vector comprising a second insert comprising three base pair (bp) mismatches at positions 9-11 of said individual, wherein said individual is homologous recombination repair deficient (HRD) negative , and/or the individual has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof. Descriptions of miR-30a loops and their sequences are known in the art, see, for example, Rao et al., Cancer Gene Ther. 17(11):780-91, 2010; Jay et al., Cancer Gene Ther. 12):683-9, 2013; Rao et al., Mol Ther. 24(8):1412-22, 2016; Phadke et al., DNA Cell Biol. 30(9):715-26, 2011; al., Mol Ther. 23(6):1123-1130, 2015; Rao et al., Methods Mol Biol. 942:259-78, 2013; and Senzer et al., Mol Ther. 20(3):679- 86, 2012. In some embodiments, the miR-30a loop comprises the sequence GUGAAGCCACAGAUG (SEQ ID NO:8). In some embodiments, the guide strand in the first stem-loop structure comprises SEQ ID NO:6 and the passenger strand in the first stem-loop structure has SEQ ID NO:5. In some embodiments, the guide strand in the second stem-loop structure comprises SEQ ID NO:6 and the passenger strand in the second stem-loop structure has SEQ ID NO:7.

Disclosed in certain embodiments herein is a method of preventing recurrence of substantially eradicated ovarian cancer in an individual in need thereof, comprising: a) an expression vector comprising a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and b) a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4). administering the transfected autologous tumor cells to said individual. Further disclosed in certain embodiments herein is a method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising: a) granulocyte macrophages transfected with an expression vector comprising a first insert comprising a nucleic acid sequence encoding a colony stimulating factor (GM-CSF) sequence; b) a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4); administering autologous tumor cells to said individual.

Most women diagnosed with cancer of the ovary are in an advanced stage. Optimal standard therapy achieves 5-year survival rates that vary by stage, ranging from 41% (stage IIa) to 20% (stage IV). Standard treatment for newly diagnosed ovarian cancer (stage III/IV) includes primary cytoreductive surgery followed by adjuvant chemotherapy with paclitaxel and carboplatin, or neoadjuvant chemotherapy followed by cytoreductive surgery. Most patients achieve complete remission, but nearly 75% relapse within 2 years. Numerous studies have attempted to improve outcomes in frontline-treated ovarian cancer by administering maintenance therapy after patients have achieved a complete response, but progression-free survival (PFS) No study has been able to demonstrate significant benefit in RFS or OS, and toxicity is dose-limiting. Poly(ADP-ribose) polymerase (PARP) inhibitors have provided a new clinical platform for frontline maintenance, but activity was prominent in BRCA-m patients. PARP inhibitors are also approved for relapsing platinum-sensitive maintenance regardless of BRCA status, but the magnitude of benefit is greatest in patients who are BRCA-m or exhibit homologous recombination repair defects (HRD).

Disclosed in certain embodiments herein are methods of preventing recurrence or prophylactic treatment of recurrence of substantially eradicated ovarian cancer in an individual in need thereof, comprising: a) a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and b) a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4). administering to said individual autologous tumor cells transfected with an expression vector comprising Further disclosed in certain embodiments herein is a method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising: a) granulocytes transfecting an expression vector containing a first insert comprising a nucleic acid sequence encoding a macrophage colony stimulating factor (GM-CSF) sequence; b) a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4) administering to said individual the autologous tumor cells that have been obtained. In some embodiments, the BRCA1/2 wild-type ovarian cancer does not have a germline mutation in the BRCA gene. In some embodiments, the BRCA1/2 wild-type ovarian cancer does not have somatic mutations in the BRCA gene. In some embodiments, the BRCA gene is the BRCA1 gene, the BRCA2 gene, or the BRCA1 gene and the BRCA2 gene.

Disclosed in certain embodiments herein is treatment of cancer in an individual in need thereof comprising: a) a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; b) a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4), wherein the individual is a wild type Has the BRCA1 gene, wild-type BRCA2 gene, or a combination of these and has been identified as negative for homologous recombination repair defect (HRD).

DEFINITIONS Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs.

Ranges and amounts are expressed herein as "about" a specific value or range. About also includes exact amounts. Thus "about 5 μg" means "about 5 μg" and also means "5 μg". Generally, the term "about" includes an amount expected to be within experimental error. In some embodiments, "about" means a stated number or value, "+" or "-" 20%, 10%, or 5% of that number or value.

The phrases "effective amount" or "therapeutically effective amount," as used herein, refer to an agent or compound that is administered to alleviate to some extent one or more of the symptoms of the disease or condition being treated, or to treat the disease or condition being treated. It means an amount sufficient to prevent the onset or recurrence of one or more of the symptoms of the condition. In some embodiments, the result is a reduction and/or alleviation of a sign, symptom, or cause of disease, or any other desired change in a biological system. For example, an "effective amount" for therapeutic purposes is that amount of autologous tumor cell vaccine required to provide clinically significant alleviation of disease symptoms without undue adverse side effects. In another example, an "effective amount" for therapeutic purposes is the amount of an autologous tumor cell vaccine disclosed herein necessary to prevent recurrence of disease symptoms without undue adverse side effects. is. An appropriate "effective amount" in any individual case can be determined using techniques such as dose escalation studies. The phrase "therapeutically effective amount" includes, for example, prophylactically effective amounts. An "effective amount" of a compound disclosed herein is an amount effective to achieve the desired effect or therapeutic improvement without undue adverse side effects. In some embodiments, an "effective amount" or "therapeutically effective amount" refers to the subject's autologous tumor cell vaccine metabolism, age, weight, overall condition, condition being treated, severity of condition being treated , and prescribing physicians' judgments vary from subject to subject.

The terms "subject," "individual," and "patient" are used interchangeably herein. None of the terms should be construed as requiring the direction of a medical professional (eg, doctor, nurse, physician's assistant, ward worker, hospice employee). As used herein, a subject is an animal, including mammals (eg, human or non-human animals) and non-mammals. In one embodiment of the methods and autologous tumor cell vaccines presented herein, the mammal is human.

As used herein, non-limiting examples of the terms "treat," "treating," or "treatment" and other grammatically equivalent terms include: alleviating, reducing, or ameliorating one or more symptoms; ameliorating, preventing, or ameliorating the occurrence, severity, or frequency of one or more additional symptoms of a disease or condition; one of a disease or condition ameliorating or preventing the metabolic cause(s) underlying one or more symptoms, inhibiting the disease or condition (e.g. halting the progression of the disease or condition, ameliorating the disease or condition, the disease or cause regression of a condition, alleviate the condition caused by the disease or condition, prevent the recurrence of the disease or condition, or treat prophylactically, or reduce the symptoms of the disease or condition prophylactically and /or therapeutically inhibiting, etc.). In one non-limiting example, an autologous tumor cell vaccine disclosed herein may be administered to an individual at risk of developing a particular disease or condition, or prone to developing a particular disease or condition, for prophylactic benefit. is administered to an individual who has or has previously suffered from or been treated for the disease or condition. In some embodiments, the disease or condition is ovarian cancer.

As used herein, the term "prevention" is practiced before a subject develops a disease or before a previously diagnosed disease worsens, thereby preventing the subject from experiencing symptoms of the disease or the likelihood of a related disease. means prophylactic treatment that avoids, prevents, or alleviates A subject can be at increased risk of developing a disease or at increased risk of exacerbation of a previously diagnosed disease.

As used herein, the term "intradermal injection" is the superficial injection of a substance into the dermis, which is located between the epidermis and the subcutaneous tissue.

As used herein, the term "transfection" means introducing foreign DNA into a eukaryotic cell. In some embodiments, any technique suitable for transfection (e.g., calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion). , lipofection, protoplast fusion, retroviral infection, or biolistics).

As used herein, the term "nucleic acid" or "nucleic acid molecule" refers to polynucleotides (such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA)), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and ligated , splitting, endonucleolytic, and exonucleolytic fragments. In some embodiments, nucleic acid molecules are monomers that are naturally occurring nucleotides (DNA, RNA, etc.), or analogs of naturally occurring nucleotides (eg, α-enantiomeric forms of naturally occurring nucleotides), or consist of combinations. In some embodiments, modified nucleotides have changes in the sugar moieties and/or the pyrimidine or purine base moieties. Sugar modifications include replacement of one or more hydroxyl groups with, for example, halogens, alkyl groups, amines, azido groups. Alternatively, sugars can be functionalized as ethers or esters. Furthermore, in some embodiments, the entire sugar moiety is replaced with sterically or electronically similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples of base moiety modifications include alkylated printed pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substituents. In some embodiments, nucleic acid monomers are linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioates, phosphorodithioates, phosphoroselenoates, phosphorodiselenoates, phosphoroanilothioates, phosphoroaniridates, phosphoramidates, and the like. In some embodiments, the term "nucleic acid" or "nucleic acid molecule" also includes so-called "peptide nucleic acids," which comprise natural or modified nucleobases attached to a polyamide backbone. In some embodiments, nucleic acids are single-stranded or double-stranded.

As used herein, the term "expression vector" refers to a nucleic acid molecule that encodes a gene for expression in a host cell. In some embodiments, an expression vector includes a transcriptional promoter, gene, and transcriptional terminator. In some embodiments, gene expression is placed under the control of a promoter, and such a gene is said to be "operably linked" to that promoter. In some embodiments, a regulatory element and a core promoter are operably linked if the regulatory element modulates the activity of the core promoter. As used herein, the term "promoter" refers to a promoter sequence whose 1) transcription, 2) translation, or 3) mRNA stability, when associated with a structural gene in a host yeast cell, is controlled under appropriate growth conditions. Any DNA sequence that increases (longer half-life of mRNA) relative to transcription, translation, or mRNA stability in the absence of.

As used herein, the term "bifunctional" refers to shRNAs that have two mechanistic pathways of action, the siRNA pathway and the miRNA pathway. The term "traditional" shRNA refers to RNA-derived DNA transcription that acts through the action of the siRNA machinery. The term "dual" shRNA refers to two shRNAs that each prevent expression of two different genes but act in the "traditional" siRNA mode.

The additional therapeutic agent can be 1100 mg to 1300 mg (such as 1100, 1125, 1150, 1175, 1200, 1225, 1250, 1275, or 1300 mg).

Autologous tumor cell vaccines range from 1×10 ⁶ cells to about 5×10 ⁷ cells (1×10 ⁶ cells, 2×10 ⁶ cells, 3×10 ⁶ cells, 4×10 ⁶ cells, 5 x ¹⁰⁶ cells, 6 x ¹⁰⁶ cells, ^{7 x 106 cells, 8 x 106 cells, 9 x 106 cells ,} 1 x ¹⁰⁷ cells cells, 2×10 ⁷ cells, 3×10 ⁷ cells, 4×10 ⁷ cells, or 5×10 ⁷ cells, etc.).

Stage III ovarian cancer refers to cancer that is found in one or both ovaries and has spread outside the pelvis to other parts of the abdomen and/or near lymph nodes. Stage III ovarian cancer is also considered when it has spread to the surface of the liver. In Stage IV ovarian cancer, cancer has spread beyond the abdomen to other parts of the body, such as the lungs or tissues in the liver. Cancer cells in the fluid around the lungs are also considered stage IV ovarian cancer.

Methods of Treating Ovarian Cancer Disclosed in certain embodiments herein is the prevention of recurrence or prophylactic treatment of recurrence of substantially eradicated ovarian cancer in an individual in need thereof. A method of performing, wherein the method comprises a first nucleic acid encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) and at least one region of an mRNA transcript encoding furin. administering to said individual an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second nucleic acid encoding one short hairpin RNA (shRNA), thereby inhibiting furin expression through RNA interference; Including inhibiting. Further disclosed in certain embodiments herein is a method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, the method comprising granulocyte-macrophage colony stimulation. a first nucleic acid encoding a factor (GM-CSF) and a second nucleic acid encoding at least one short hairpin RNA (shRNA) capable of hybridizing to a region of a furin-encoding mRNA transcript administering to said individual an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising , thereby inhibiting expression of furin through RNA interference. In some embodiments, the second nucleic acid comprises a sequence according to SEQ ID NO:2 or 4 (SEQ ID NO:4). In some embodiments, the expression vector is a bishRNA ^furin /GMCSF expression vector. In some embodiments, inhibition of furin expression inhibits expression of transforming growth factor beta (TGFβ). TGFβ includes TGFβ isoforms, namely TGFβ1 and TGFβ2.

Further disclosed in certain embodiments herein are methods of preventing recurrence of substantially eradicated ovarian cancer, or prophylactic treatment in an individual in need thereof, comprising: The method comprises hybridizing to (a) (i) a first nucleic acid encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) and (ii) a region of an mRNA transcript encoding furin. At least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second nucleic acid encoding at least one short hairpin RNA (shRNA) (thereby resulting in an autologous tumor cell vaccine through RNA interference) (b) administering at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent to said individual. Further disclosed in certain embodiments herein is a method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising: (a) (i ) a first nucleic acid encoding granulocyte-macrophage colony-stimulating factor (GM-CSF) and (i) at least one short hairpin RNA capable of hybridizing to a region of an mRNA transcript encoding furin ( at least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second nucleic acid encoding a shRNA), thereby inhibiting expression of furin through RNA interference; (b) administering at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent to said individual.

In some embodiments, the second nucleic acid comprises a sequence according to SEQ ID NO:2 or 4 (SEQ ID NO:4). In some embodiments, the expression vector is a bishRNA ^furin /GMCSF expression vector. In some embodiments, inhibition of furin expression inhibits expression of transforming growth factor beta (TGFβ). In some embodiments, TGFβ includes the TGFβ isoforms TGFβ1 and TGFβ2.

Disclosed in certain embodiments herein is treatment of cancer in an individual in need thereof comprising: a) a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; by administering to said individual autologous tumor cells transfected with an expression vector comprising a first insert; and b) a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4). Yes, the individual is Has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination of these and has been identified as negative for homologous recombination repair defects (HRD).

Homologous recombination (HR) is a mechanism that cells use to repair double-stranded DNA breaks using homologous templates. HR repair defects may affect DNA repair. However, when HR alone is defective in repair, the activity of other DNA repair mechanisms can prevent the accumulation of excessive DNA damage and apoptosis. As used herein, the terms "homologous recombination repair deficient-positive," "HRD-positive," and "HRD" are used interchangeably to refer to a condition in which HR is defective in repair. Conversely, the terms "homologous recombination-negative", "HRD-negative", "homologous recombination proficient" and "HRP" are used interchangeably to refer to a condition in which HR is not repair defective.

In some embodiments, HRD can be assessed by screening for germline or somatic mutations in genes involved in HR repair. For example, DNA from blood or other tissue can be analyzed by next generation sequencing.

In some embodiments, an HRD score can be determined to characterize an individual as being HRD-positive or HRD-negative. In some embodiments, the HRD score can be calculated based on loss of heterozygosity (LOH), telomere allelic imbalance (TAI), and large state transition (LST) scores. In some embodiments, LOH is indicated by the presence of a single allele. In some embodiments, LOH is defined as the number of chromosomal losses of heterozygous regions longer than 15 Mb. In some embodiments, TAI is indicated by a one-to-one allelic ratio mismatch at the ends of the chromosome. In some embodiments, an LST is marked by a transition point between a region of DNA that is abnormal and normal, or between two different regions that are abnormal. In some embodiments, LST is defined as the number of breakpoints between regions longer than 10 Mb after excluding regions shorter than 3 Mb. In certain embodiments, the HRD score is calculated as the sum of the LOH score, TAI score, and LST score. Methods for determining HRD scores are available in the art, e.g. Takaya et al., Sci Rep. 10(1):2757, 2020, Telli et al., Clin Cancer Res 22(15):3764-73, 2016 and Marchetti and McNeish, Cancer Breaking News 5(1):15-20, 2017. In addition, commercial services that determine HRD scores are also available (eg, services provided by Ambry Genetics, Caris Life Sciences, Counsylgenetic, Foundation Medicine, GeneDX, Integrated Genetics, Invitae, Myriad Genetics, and Neogenomics).

In the methods described herein, the individual has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof. In some embodiments, an individual with a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof can be HRD-negative or HRD-positive. In another embodiment, mutations in the BRCA1/2 genes can lead to HRD. In other words, mutations in the BRCA1/2 genes can lead to individuals with HRD-positive status. In particular embodiments, individuals identified as having an HRD-positive status are 42 or more (e.g., 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55 , 56, 57, 58, 59, 60, or higher). Other mechanisms, such as germline and somatic mutations in other homologous recombination genes and epigenetic modifications, may also be involved in homologous recombination.

Expression Vectors In some embodiments, at least one shRNA is at least one bifunctional shRNA (bi-shRNA). In some embodiments, the bi-shRNA comprises a first stem-loop structure comprising an siRNA component and a second stem-loop structure comprising a miRNA component. In some embodiments, a bifunctional shRNA has two mechanistic pathways of action, the siRNA pathway and the miRNA pathway. Thus, in some embodiments, the bifunctional shRNAs described herein are different from traditional shRNAs, i.e., RNAs derived from DNA transcription that act through the action of the siRNA machinery, or each of the two Differs from 'double shRNA', which means two shRNAs that block the expression of different genes but act in the 'traditional' siRNA mode. In some embodiments, the bi-shRNA comprises siRNA (cleavage dependent) and miRNA (cleavage independent) motifs.

In some embodiments, the GM-CSF in the expression vector is a human GM-CSF sequence. In some embodiments, the expression vector further comprises a promoter, eg, the promoter is the cytomegalovirus (CMV) mammalian promoter. In some embodiments, the mammalian CMV promoter comprises the CMV immediate early (IE) 5'UTR enhancer sequence and the CMV IE intron A. In further embodiments, the expression vector further comprises a CMV enhancer sequence and a CMV intron sequence.

The first insert and the second insert in the expression vector can be operably linked to a promoter. In a particular embodiment, the expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skip peptide between the first and second nucleic acid inserts.

In some embodiments, the expression vector contains at least one bifunctional shRNA (bi-shRNA). In some embodiments, the bi-shRNA comprises a first stem-loop structure comprising an siRNA component and a second stem-loop structure comprising a miRNA component. In some embodiments, a bifunctional shRNA has two mechanistic pathways of action, the siRNA pathway and the miRNA pathway. Thus, in some embodiments, the bifunctional shRNAs described herein are different from traditional shRNAs, i.e., RNAs derived from DNA transcription that act through the action of the siRNA machinery, or each of the two Differs from 'double shRNA', which means two shRNAs that block the expression of different genes but act in the 'traditional' siRNA mode. In some embodiments, the bi-shRNA comprises siRNA (cleavage dependent) and miRNA (cleavage independent) motifs.

In some embodiments, the at least one bi-shRNA is capable of hybridizing to one of the more regions of the furin-encoding mRNA transcript. In some embodiments, the furin-encoding mRNA transcript is the nucleic acid sequence of SEQ ID NO:1. In some embodiments, the one or more regions of the mRNA transcript encoding furin are base sequences 300-318, 731-740, 1967-1991, 2425-2444, 2827-2851, and Selected from 2834-2852. In some embodiments, the expression vector targets the coding region of the Furin mRNA transcript, the 3'UTR region of the Furin mRNA transcript, or both the coding and 3'UTR sequences of the Furin mRNA transcript simultaneously. In some embodiments, the bi-shRNA comprises SEQ ID NO:2 or 4 (SEQ ID NO:4). In some embodiments, a bi-shRNA capable of hybridizing to one or more regions of an mRNA transcript encoding furin is referred to herein as a bi-shRNA ^furin . In some embodiments, the bi-shRNA ^Furin comprises or consists of two stem-loop structures, each with a miR-30a loop. In some embodiments, the first of said two stem-loop structures comprises complementary guide and passenger strands (Figure 1). In some embodiments, the second of said two stem-loop structures contains 3 mismatches in the passenger strand. In some embodiments, the three mismatches are in positions 9-11 of the passenger strand.

a first nucleic acid encoding GM-CSF and a second encoding at least one bifunctional short hairpin RNA (bi-shRNA) capable of hybridizing to a region of a furin-encoding mRNA transcript. is referred to as a bishRNA ^furin /GMCSF expression vector.

In some embodiments, the first nucleic acid and the second nucleic acid are operably linked to a promoter. In some embodiments, the promoter is the cytomegalovirus (CMV) promoter. In some embodiments, the CMV promoter is a mammalian CMV promoter. In some embodiments, the mammalian CMV promoter comprises the CMV immediate early (IE) 5'UTR enhancer sequence and the CMV IE intron A.

In some embodiments, GM-CSF is human GM-CSF. In some embodiments, a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide sequence is intercalated between the first and second nucleic acid inserts.

In some embodiments, the expression vector plasmid is at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) matching sequences. The vector plasmid comprises a first nucleic acid insert operably linked to a promoter (the first nucleic acid insert encodes the GM-CSF cDNA) and a second nucleic acid insert operably linked to the promoter. wherein the second nucleic acid insert encodes one or more short hairpin RNAs (shRNAs) capable of hybridizing to a region of a furin-encoding mRNA transcript); Furin expression can thereby be inhibited through RNA interference.
Sequence number 3
GGCCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCGGGAACGGTGCATTGGAACGCGGATTCCCCGTGCCAAGAGTGACGTAAGTACCGCCTATAGACTCTATAGGCACACCCCTTTGGCTCTTATGCATGCTATACTGTTTTTGGCTTGGGGCCTATACACCCCCGCTTCCTTATGCTATAGGTGATGGTATAGCTTAGCCTATAGGTGTGGGTTATTGACCATTATTGACCACTCCAACGGTGGAGGGCAGTGTAGTCTGAGCAGTACTCGTTGCTGCCGCGC GCGCCACCAGACATAATAGCTGACAGACTAACAGACTGTTCCTTTCCATGGGTCTTTTCTGCAGTCACCGTCGTCGACGGTATCGATAAGCTTGATATCGAATTCCGCTGGAGGATGTGGCTGCAGAGCCTGCTGCTCTTGGGCACTGTGGCCTGCAGCATCTCTGCACCCGCCCGCTCGCCCAGCCCCAGCACGCAGCCCTGGGAGCATGTGAATGCCATCCAGGAGGCCCGGCGTCTCCTGAACCTGAGTAGAGACACTGCTGCTGAGATGAATGAAACAGTAGAAGTCATCTCAGAAATGTTTGACCTCCAGGAGCCGACCTGCCTACAGACCCGCCTGGAGCTGTACAAGCAGGGCCTGCGGGGCAGCCTCACCAAGCTCAAGGGCCCCTTGACCATGATGGCCAGCCACTACAAGCAGCACTGCCCTCCAACCCCGGAAACTTCCTGTGCAACCCAGACTATCACCTTTGAAAGTTTCAAAGAGAACCTGAAGGACTTTCTGCTTGTCATCCCCTTTGACTGCTGGGAGCCAGTCCAGGAGTGAGACCGGCCAGATGAGGCTGGCCAAGCCGGGGAGCTGCTCTCTCATGAAACAAGAGCTAGAAACTCAGGATGGTCATCTTGGAGGGACCAAGGGGTGGGCCACAGCCATGGTGGGAGTGGCCTGGACCTGCCCTGGGCCACACTGACCCTGATACAGGCATGGCAGAAGAATGGGAATATTTTATACTGACAGAAATCAGTAATATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTATTTAAGTTCATATTCCATATTTATTCAAGATGTTTTACCGTAATAATTATTATTAAAAATATGCTTCTAAAAAAAAAAAAAAAAAAAAAAACGGAATTCACGTGGGCCCGGTACCGTATACTCTAGAAGATCTGGCAGCGGAGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTAGGATGTCTA GAGCGGCCGCGGATCCTGCTGTTGACAGTGAGCGCGGAGAAAGGAGTGAAACCTTAGTGAAGCCACAGATGTAAGGTTTCACTCCTTTCTCCTTGCCTACTGCCTCGGAAGCAGCTCACTACATTACTCAGCTGTTGACAGTGAGCGCGGAGAAAGATATGAAACCTTAGTGAAGCCACAGATGTAAGGTTTCACTCCTTTCTCCTTGCCTACTGCCTCGGAAGCTTAATAAAGGATCTTTTATTTTCATTGGATCCAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGCTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTTGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCCATTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCA CTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCGGGGGGGGGGGGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATCGCCCCATCATCCAGCCAGAAAGTGAGGGAGCCACGGTTGATGAGAGCTTTGTTGTAGGTGGACCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCGCCGTCCCGTCAAGTCAGCGTAATGCTCTGCCAGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCA CCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTCCCCCCCCCCCCATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGG GCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGATTGGCTATT

a first nucleic acid encoding GM-CSF and a second encoding at least one bifunctional short hairpin RNA (bi-shRNA) capable of hybridizing to a region of a furin-encoding mRNA transcript. is referred to as a bishRNA ^furin /GMCSF expression vector.

Tumor Cells In some embodiments, the cells are autologous tumor cells, xenograft-grown autologous tumor cells, allogeneic tumor cells, xenograft-grown allogeneic tumor cells, or combinations thereof. In some embodiments, the cells are autologous tumor cells. In some embodiments, the allogeneic tumor cell is an established cell line. In some embodiments, autologous tumor cells are obtained from an individual in need thereof. In some embodiments, the composition is referred to as an autologous tumor cell vaccine when the cells are autologous tumor cells.

In some embodiments, cells are obtained from an individual. In some embodiments, cells are obtained from an individual's tissue. In some embodiments, the tissue is tumor tissue. In some embodiments, the tumor tissue is ovarian tumor tissue. In some embodiments, tumor tissue is obtained during a biopsy or cytoreductive surgery on the individual. In some embodiments, tumor tissue, or cells from tumor tissue, is placed in an antibiotic solution in a sterile container. In some embodiments, the antibiotic solution comprises gentamicin, sodium chloride, or a combination thereof.

Methods of Use In some embodiments, the ovarian cancer is stage III or stage IV ovarian cancer. In some embodiments, the stage III ovarian cancer is stage IIIb or worse. In some embodiments, the ovarian cancer is high grade serous ovarian cancer, clear cell ovarian cancer, endometrioid ovarian cancer, mucinous ovarian cancer, or low grade serous ovarian cancer .

In some embodiments, the individual has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or both a wild-type BRCA1 gene and a wild-type BRCA2 gene. In some embodiments, the wild-type BRCA1 gene does not contain mutations in the germline BRCA1 gene. In some embodiments, the wild-type BRCA2 gene does not contain mutations in the germline BRCA2 gene. In some embodiments, ovarian cancer in individuals with wild-type BRCA1 and wild-type BRCA2 genes is referred to herein as BRCA1/2-wt ovarian cancer, BRCA-wt ovarian cancer, or BRCA1/2 wild. called type ovarian cancer. Conversely, in some embodiments, ovarian cancer in individuals with a mutated BRCA1 gene, mutated BRCA2 gene, or both mutated BRCA1 and BRCA2 genes is herein referred to as BRCA1/2-m ovarian cancer, Or called BRCA-m ovarian cancer. In some embodiments, the mutated BRCA1 gene or the mutated BRCA2 gene comprises a germline mutation. In some embodiments, the mutated BRCA1 gene or mutated BRCA2 gene comprises a somatic mutation. In some embodiments, the individual's recurrence-free survival (RFS) is prolonged compared to an individual who has substantially eradicated ovarian cancer who has never been administered an autologous tumor cell vaccine.

In some embodiments, the cancer is an HRD-negative wild-type BRCA1/2 cancer. In some embodiments, the selection of cancer is solid tumor cancer, ovarian cancer, adrenocortical cancer, bladder cancer, breast cancer, cervical cancer, cholangiocarcinoma, colorectal cancer, esophageal cancer, Blastoma, glioma, hepatocellular carcinoma, head and neck cancer, renal cancer, leukemia, lymphoma, lung cancer, melanoma, mesothelioma, multiple myeloma, pancreatic cancer, pheochromocytoma, plasmacytoma, It is made up of the group consisting of neuroblastoma, prostate cancer, sarcoma, gastric cancer, uterine cancer, thyroid cancer, and blood cancer. Non-limiting examples of solid tumor cancers include endometrial cancer, bile duct cancer, bladder cancer, hepatocellular carcinoma, gastric/esophageal cancer, ovarian cancer, melanoma, breast cancer, pancreatic cancer cancer, colorectal cancer, glioma, non-small cell lung cancer, prostate cancer, cervical cancer, renal cancer, thyroid cancer, neuroendocrine cancer, small cell lung cancer, sarcoma, head and neck cancer, brain tumors, renal clear cell carcinomas, skin cancers, endocrine tumors, thyroid cancers, tumors of unknown primary, and gastrointestinal stromal tumors.

As used herein, "recurrence-free survival" is used interchangeably with the term "regression-free survival" and refers to the state in which the cancer is undetectable after application of initial therapy to treat the cancer. means the time remaining (ie, until cancer recurrence). In some embodiments, the recurrence-free survival of individuals who received the autologous tumor cell vaccine is 5 to 11 months longer than the recurrence-free survival of individuals who did not receive the autologous tumor cell vaccine. In some embodiments, the recurrence-free survival of individuals who have received the autologous tumor cell vaccine is at least 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, or 11 months longer.

As used herein, the term "substantially eradicated" is undetectable in an individual following initial therapy to treat ovarian cancer (e.g., below detectable levels, or below the limit of detection (LOD)). ) means ovarian cancer. In some embodiments, detection of ovarian cancer, or lack thereof, is by chest X-ray, computed tomography (CT) scan, magnetic resonance imaging (MRI), detection of cancer antigen 125 (CA-125) levels. , physical examination, or the presence of symptoms suggestive of active cancer, or any combination of these. In some embodiments, detection of cancer antigen 125 (CA-125) at a level of 35 units/ml or less is indicative of the absence of ovarian cancer in the individual. In some embodiments, a substantially eradicated ovarian cancer is said to have achieved a complete clinical response (cCR). In some embodiments, ovarian cancer that is detected in a subject after the subject's ovarian cancer was previously substantially eradicated is referred to as recurrent or recurrent ovarian cancer.

In some embodiments, recurrence-free survival of individuals administered an autologous tumor cell vaccine is associated with BRCA1, BRCA2, or any combination thereof (i.e., mutant or non-mutant) status. Regardless, it is at least 5 months longer than the recurrence-free survival of individuals not receiving the autologous tumor cell vaccine. In some embodiments, the recurrence-free survival of BRCA-wt individuals who received the autologous tumor cell vaccine is greater than 15 months from the time of cytoreductive surgery and is greater than that of individuals who have not received the autologous tumor cell vaccine. Recurrence survival is less than 15 months from the time of cytoreductive surgery. In some embodiments, the recurrence-free survival of BRCA-wt individuals who received the autologous tumor cell vaccine is at least 11 months longer than the recurrence-free survival of individuals who did not receive the autologous tumor cell vaccine.

In some embodiments, the individual received initial therapy. In some embodiments, the cancer has a complete clinical response to therapy as a result of receiving initial therapy. In some embodiments, initial therapy includes tumor debulking, administration of chemotherapy, administration of therapeutic agents, or a combination thereof. In some embodiments, the chemotherapy comprises platinum agents, taxanes, or combinations thereof. In some embodiments, the platinum agent comprises cisplatin, carboplatin, oxaliplatin, nedaplatin, tripplatin, tetranitrate, phenanthriplatin, picoplatin, satraplatin, or combinations thereof. In some embodiments, the platinum agent comprises carboplatin. In some embodiments, taxanes include paclitaxel, docetaxel, cabazitaxel, or combinations thereof. In some embodiments, taxanes include paclitaxel. In some embodiments, therapeutic agents include angiogenesis inhibitors, PARP inhibitors, checkpoint inhibitors, or combinations thereof. In some embodiments, an angiogenesis inhibitor comprises a vascular endothelial growth factor (VEGF) inhibitor. In some embodiments, the VEGF inhibitor comprises sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, levatinib, or combinations thereof. In some embodiments, the VEGF inhibitor is bevacizumab. In some embodiments, the PARP inhibitor comprises niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, pamiparib, or combinations thereof. In some embodiments, the PARP inhibitor is niraparib. In some embodiments, checkpoint inhibitors include PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof. In some embodiments, the checkpoint inhibitor comprises pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, ipilimumab, or a combination thereof. In some embodiments, the ovarian cancer is resistant or refractory to chemotherapy or therapeutic agents.

In some embodiments, the method further comprises determining the BRCA1 gene, BRCA2 gene, or combination status (ie, wild-type or mutant) in the individual. In some embodiments, determining comprises sequencing the BRCA1 gene, the BRCA2 gene, or a combination thereof. In some embodiments, sequencing comprises Sanger sequencing or next generation sequencing. In some embodiments, next generation sequencing comprises massively parallel sequencing. In some embodiments, the determining comprises hybridizing nucleic acid extracted from the individual to an array. In some embodiments the array is a microarray. In some embodiments, the determining comprises array comparative genomic hybridization of nucleic acids extracted from the individual.

Administration, Formulation, and Dosage In some embodiments, the autologous tumor cell vaccine comprises about 1×10 ⁶ or about 1×10 ⁷ autologous tumor cells transfected as described herein. including. In some embodiments, an autologous tumor cell vaccine comprises at least 1×10 ⁶ or at least 1×10 ⁷ autologous tumor cells transfected as described herein. In some embodiments, an autologous tumor cell vaccine comprises about 1×10 ⁶ to about 1×10 ⁷ autologous tumor cells transfected as described herein. In some embodiments, an autologous tumor cell vaccine comprises about 1×10 ⁶ to about 2.5×10 ⁷ autologous tumor cells transfected as described herein. In some embodiments, an autologous tumor cell vaccine comprises about 1×10 ⁶ to about 5×10 ⁷ autologous tumor cells transfected as described herein.

In some embodiments, the autologous tumor cell vaccine further comprises one or more vaccine adjuvants.

In some embodiments, the autologous tumor cell vaccine is in unit dosage form. The term "unit dosage form," as used herein, is a physically discrete unit containing a predetermined amount of an autologous tumor cell vaccine described herein in combination with other ingredients (e.g., vaccine adjuvants). describe. In some embodiments, the predetermined amount is a number of cells.

In some embodiments, the individual receives one dose of autologous tumor cell vaccine per month. In some embodiments, a dose of autologous tumor cell vaccine is administered to an individual once a month for 1 to 12 months. In some embodiments, the individual is administered at least one dose of an autologous tumor cell vaccine. In some embodiments, the individual receives 12 doses or less of the autologous tumor cell vaccine. In some embodiments, the individual is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 doses of the autologous tumor cell vaccine. In some embodiments, the dose is a unit dosage form of autologous tumor cell vaccine. In some embodiments, a dose of the autologous tumor cell vaccine is administered to the individual every three months, every two months, once a month, twice a month, or three times a month. In some embodiments, the autologous tumor cell vaccine is administered to the individual for up to 1 month, up to 2 months, up to 3 months, up to 4 months, up to 5 months, up to 6 months, up to 12 months, up to 18 months, up to 24 months, or administered up to 36 months. In some embodiments, the autologous tumor cell vaccine is administered to the individual by injection. In some embodiments the injection is an intradermal injection. In some embodiments, a first dose of autologous tumor cell vaccine is administered to an individual after it is confirmed that the individual has achieved a complete clinical response (cCR). In some embodiments, the first dose of autologous tumor cell vaccine is administered to the individual no earlier than the same day as the final treatment of initial therapy. In some embodiments, the first dose of autologous tumor cell vaccine is administered to the individual no later than 8 weeks after the last treatment of initial therapy.

Combinations In some embodiments, an autologous tumor cell vaccine is administered to an individual with an additional therapeutic agent. In some embodiments, at least one first dose of the autologous tumor cell vaccine is administered to the individual without an additional therapeutic agent, and at least one second dose of the autologous tumor cell vaccine is administered to the individual at least one dose of It is administered in combination with additional therapeutic agents. In some embodiments, "in combination with" as used herein means a dose of an additional therapeutic agent within 1 day, within 2 days, within 3 days of a dose of autologous tumor cell vaccine, It means administered within 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, or 4 weeks, or on the same day. The additional therapeutic agent can be administered prior to, concurrently with, or subsequent to the autologous tumor cell vaccine.

In one representative example, an individual is administered two doses of autologous tumor cell vaccine one month apart by intradermal injection and, beginning at month three, by intravenous infusion (i) each one month apart. They will receive both 10 additional doses of tumor cell vaccine spaced apart and (ii) 12 doses of atezolizumab each spaced 3 weeks apart.

In another representative example, an individual is administered two doses of the autologous tumor cell vaccine by intradermal injection one month apart, and from month three onwards, by intravenous infusion: (i) 1 dose each; 10 additional doses of tumor cell vaccine spaced months apart and (ii) 10 doses of atezolizumab on the same day as the additional 10 doses of tumor cell vaccine.

In some embodiments, administration of an autologous tumor cell vaccine to an individual followed by initial administration of a combination of the autologous tumor cell vaccine and an additional therapeutic agent results in reduced toxicity compared to administration of the additional therapeutic agent alone. In some embodiments, administration of an autologous tumor cell vaccine to an individual followed by initial administration of a combination of an autologous tumor cell vaccine and a checkpoint inhibitor results in reduced toxicity compared to administration of the checkpoint alone.

In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 doses of the autologous tumor cell vaccine are administered to the individual before the autologous tumor cells Vaccines are administered in combination with additional therapeutic agents. In some embodiments, at least two doses of the autologous tumor cell vaccine are administered to the individual before the autologous tumor cell vaccine is administered in combination with an additional therapeutic agent.

In some embodiments, additional therapeutic agents include angiogenesis inhibitors, PARP inhibitors, checkpoint inhibitors, or combinations thereof. In some embodiments, an angiogenesis inhibitor comprises a vascular endothelial growth factor (VEGF) inhibitor. In some embodiments, the VEGF inhibitor comprises sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, levatinib, or combinations thereof. In some embodiments, the VEGF inhibitor is bevacizumab. In some embodiments, the PARP inhibitor comprises niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, pamiparib, or combinations thereof. In some embodiments, the PARP inhibitor is niraparib. In some embodiments, checkpoint inhibitors include PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof. In some embodiments, the checkpoint inhibitor comprises pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, ipilimumab, or a combination thereof. In some embodiments, the additional therapeutic agent is a checkpoint inhibitor. In some embodiments, the checkpoint inhibitor is atezolizumab. In some embodiments, the additional therapeutic agent is a VEGF inhibitor. In some embodiments, the VEGF inhibitor is bevacizumab. In some embodiments, the additional therapeutic agent is a PARP inhibitor. In some embodiments, the additional therapeutic agent is administered by intravenous infusion.

In some embodiments, the additional therapeutic agent comprises a therapeutically effective dose of atezolizumab. In some embodiments, a therapeutically effective dose of atezolizumab is from about 900 mg to about 1500 mg, or from about 1100 mg to about 1300 mg. In some embodiments, a therapeutically effective dose of atezolizumab is about 900 mg, 1000 mg, 1100 mg, 1200 mg, 1300 mg, 1400 mg, or 1500 mg. In some embodiments, the therapeutically effective dose of atezolizumab is about 1200 mg. In some embodiments, atezolizumab is administered by intravenous infusion.

In some embodiments, the additional therapeutic agent comprises a therapeutically effective dose of γIFN (gamma interferon). In some embodiments, a therapeutically effective dose of γIFN is about 50 μg/m ² to about 100 μg/m ² . In some embodiments, a therapeutically effective dose of γIFN is about 50 μg/m ² , about 60 μg/m ² , about 70 μg/m ² , about 80 μg/m ² , about 90 μg/m ² , or about 100 μg/m ² .

In some embodiments, the expression vector or autologous tumor cell vaccine is administered with an additional therapeutic agent. In some embodiments, the additional therapeutic agent comprises a therapeutically effective dose of γIFN (gamma interferon). In some embodiments, a therapeutically effective dose of γIFN is about 50 μg/m ² to about 100 μg/m ² . In some embodiments, a therapeutically effective dose of γIFN is about 50 μg/m ² , about 60 μg/m ² , about 70 μg/m ² , about 80 μg/m ² , about 90 μg/m ² , or about 100 μg/m ² . In some embodiments, additional therapeutic agents include angiogenesis inhibitors, PARP inhibitors, checkpoint inhibitors, or combinations thereof. In some embodiments, an angiogenesis inhibitor comprises a vascular endothelial growth factor (VEGF) inhibitor. In some embodiments, the VEGF inhibitor comprises sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, levatinib, or combinations thereof. In some embodiments, the VEGF inhibitor is bevacizumab. In some embodiments, the PARP inhibitor comprises niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, pamiparib, or combinations thereof. In some embodiments, checkpoint inhibitors include PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof. In some embodiments, the checkpoint inhibitor comprises pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, ipilimumab, or a combination thereof.

Manufacturing In some embodiments, the method of manufacturing an autologous tumor cell vaccine described herein comprises the steps of: (i) aseptically harvesting one or more cancer cells from an individual; placing the cells in an antibiotic solution in a sterile container, (iii) forming a cell suspension from the harvest solution, wherein the cells, (iv) forming the suspension, are enzymatically comminuted, mechanically (v) genetically modifying cells by electroporation of said cell suspension to produce a vaccine with a bishRNA ^furin /GMCSF expression vector plasmid, which vector plasmid is A first nucleic acid insert operably linked to a promoter, wherein the first insert encodes a GM-CSF cDNA, and a second nucleic acid insert operably linked to the promoter, wherein the The second insert contains one or more short hairpin RNAs (shRNAs) that can hybridize to a region of the furin-encoding mRNA transcript, thereby allowing furin to pass through RNA interference. (vi) recovering said vaccine; (vii) irradiating said vaccine; and (viii) freezing said vaccine. In some embodiments, the antibiotic solution comprises gentamicin. In some embodiments, the one or more cancer cells are obtained from a patient suffering from ovarian cancer. In some embodiments, the genetically modified cells are rendered proliferation-incompetent by irradiation. In some embodiments, the genetically modified cells are autologous, allogeneic, or xenograft grown cells. In some embodiments, the method further comprises incubating the genetically modified cells with γIFN after transfection. In some embodiments, the dose of γIFN applied to said genetically modified cells after transfection is about 250 U/ml (500 U/ml in 24 hours to 100 U/ml in 48 hours). . In some embodiments, the autologous tumor cell vaccine is frozen after being placed in culture. In some embodiments, the medium in which the autologous tumor cell vaccine is placed prior to freezing comprises DMSO, human serum albumin (HSA), or a combination thereof. In some embodiments, the autologous tumor cell vaccine (optionally comprising DMSO and HSA) is frozen to a final fill volume of 1.1-1.3 mL, or about 1.2 mL. In some embodiments, the autologous tumor cell vaccine is frozen at about -80°C.

Representative Embodiments The following are non-limiting embodiments of the invention.

Embodiment 1. 1. A method of preventing recurrence of substantially eradicated ovarian cancer in an individual in need thereof, comprising:
a. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
b. A method comprising administering to said individual autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4).

Embodiment 2. The method of embodiment 1, wherein said substantially eradicated ovarian cancer is stage III or stage IV ovarian cancer.

Embodiment 3. The method of embodiment 1 or embodiment 2, wherein said individual comprises a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof.

Embodiment 4. of embodiments 1-3, wherein said individual's relapse-free survival (RFS) is prolonged compared to an individual whose ovarian cancer has been substantially eradicated but has not been administered said transfected tumor cells. one way or the other.

Embodiment 5. The method of any one of embodiments 1-4, wherein said individual received initial therapy.

Embodiment 6. 6. The method of embodiment 5, wherein said initial therapy comprises cytoreductive surgery, chemotherapy, or a combination thereof.

Embodiment 7. 7. The method of embodiment 6, wherein said chemotherapy comprises administering a platinum agent and a taxane.

Embodiment 8. 8. The method of embodiment 7, wherein said platinum agent comprises carboplatin.

Embodiment 9. 8. The method of embodiment 7, wherein said taxane comprises paclitaxel.

Embodiment ten. The method of any one of embodiments 1-9, wherein said GM-CSF is a human GM-CSF sequence.

Embodiment eleven. The method of any one of embodiments 1-10, wherein said expression vector further comprises a promoter.

Embodiment 12. 12. The method of embodiment 11, wherein said promoter is a cytomegalovirus (CMV) mammalian promoter.

Embodiment 13. 13. The method of embodiment 12, wherein said expression vector further comprises a CMV enhancer sequence and a CMV intron sequence.

Embodiment fourteen. 14. The method of any one of embodiments 11-13, wherein said first insert and said second insert are operably linked to said promoter.

Embodiment 15. 15. The method of any one of embodiments 1-14, wherein said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide between said first and said second nucleic acid inserts.

Embodiment 16. 16. The method of any one of embodiments 1-15, ^wherein said autologous tumor cells are administered to said individual in a dose of about 1 x 106 cells to about 5 x ¹⁰⁷ cells.

Embodiment 17. 17. The method of embodiment 16, wherein said autologous tumor cells are administered to said individual once a month.

Embodiment 18. 18. The method of embodiment 17, wherein said autologous tumor cells are administered to said individual for 1-12 months.

Embodiment nineteen. The method of any one of embodiments 1-18, wherein said autologous tumor cells are administered to said individual by intradermal injection.

Embodiment 20. A method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising:
a. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
b. A method comprising administering to said individual autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4).

Embodiment 21. 21. The method of embodiment 20, wherein said ovarian cancer is stage III or stage IV ovarian cancer.

Embodiment 22. The method of embodiment 20 or embodiment 21, wherein said ovarian cancer is refractory ovarian cancer.

Embodiment 23. 23. The method of embodiment 22, wherein said refractory ovarian cancer is refractory to chemotherapy.

Embodiment 24. 24. The method of embodiment 23, wherein said chemotherapy comprises a platinum agent or a taxane.

Embodiment 25. 25. The method of embodiment 24, wherein said platinum agent comprises carboplatin.

Embodiment 26. 25. The method of embodiment 24, wherein said taxane comprises paclitaxel.

Embodiment 27. The method of any one of embodiments 20-26, further comprising administering an additional therapeutic agent.

Embodiment 28. 28. The method of embodiment 27, wherein said selection of additional therapeutic agent is for said individual from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor.

Embodiment 29. 29. The method of embodiment 28, wherein said angiogenesis inhibitor is a vascular endothelial growth factor (VEGF) inhibitor.

Embodiment 30. 30. The method of embodiment 29, wherein said selection of VEGF is made from the group consisting of sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, and levatinib.

Embodiment 31. 30. The method of embodiment 29, wherein said VEGF is bevacizumab.

Embodiment 32. 29. The method of embodiment 28, wherein said PARP inhibitor selection is made from the group consisting of niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, and pamiparib.

Embodiment 33. 29. The method of embodiment 28, wherein said PARP inhibitor is niraparib.

Embodiment 34. 29. The method of embodiment 28, wherein said checkpoint inhibitor selection is from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors.

Embodiment 35. 29. The method of embodiment 28, wherein said checkpoint inhibitor selection is from the group consisting of pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab and is administered by intravenous infusion.

Embodiment 36. 36. The method of any one of embodiments 20-35, wherein said GM-CSF is a human GM-CSF sequence.

Embodiment 37. 37. The method of any one of embodiments 20-36, wherein said expression vector further comprises a promoter.

Embodiment 38. 38. The method of embodiment 37, wherein said promoter is a cytomegalovirus (CMV) mammalian promoter.

Embodiment 39. 39. The method of embodiment 38, wherein said expression vector further comprises CMV enhancer sequences and CMV intron sequences.

Embodiment 40. 40. The method of any one of embodiments 37-39, wherein said first insert and said second insert are operably linked to said promoter.

Embodiment 41. 41. The method of any one of embodiments 20-40, wherein said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide between said first and said second nucleic acid inserts.

Embodiment 42. 42. The method of any one of embodiments 20-41, wherein said autologous tumor cells are administered to said individual in a dose of about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells.

Embodiment 43. 43. The method of embodiment 42, wherein said autologous tumor cells are administered to said individual once a month.

Embodiment 44. 44. The method of embodiment 43, wherein said autologous tumor cells are administered to said individual for 1-12 months.

Embodiment 45. The method of any one of embodiments 20-44, wherein said autologous tumor cells are administered to said individual by intradermal injection.

Embodiment 46. 1. A method of preventing recurrence or prophylactic treatment of recurrence of substantially eradicated ovarian cancer in an individual in need thereof, comprising:
a. i. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
ii. at least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4); and
b. administering to said individual at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent.

Embodiment 47. 47. The method of embodiment 46, wherein said substantially eradicated ovarian cancer is stage III or stage IV ovarian cancer.

Embodiment 48. The method of embodiment 46 or embodiment 47, wherein said individual comprises a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof.

Embodiment 49. 49. of embodiments 46-48, wherein the individual's recurrence-free survival (RFS) is prolonged compared to an individual whose ovarian cancer has been substantially eradicated but has not been administered the transfected tumor cells one way or the other.

Embodiment 50. 50. The method of any one of embodiments 46-49, wherein said individual received initial therapy.

Embodiment 51. 51. The method of embodiment 50, wherein said initial therapy comprises cytoreductive surgery, chemotherapy, or a combination thereof.

Embodiment 52. 52. The method of embodiment 51, wherein said chemotherapy comprises administering a platinum agent and a taxane.

Embodiment 53. 53. The method of embodiment 52, wherein said platinum agent comprises carboplatin.

Embodiment 54. 53. The method of embodiment 52, wherein said taxane comprises paclitaxel.

Embodiment 55. 55. The method of any one of embodiments 46-54, wherein said GM-CSF is a human GM-CSF sequence.

Embodiment 56. 56. The method of any one of embodiments 46-55, wherein said expression vector further comprises a promoter.

Embodiment 57. 57. The method of embodiment 56, wherein said promoter is a cytomegalovirus (CMV) mammalian promoter.

Embodiment 58. 58. The method of embodiment 57, wherein said expression vector further comprises CMV enhancer sequences and CMV intron sequences.

Embodiment 59. 59. The method of any one of embodiments 56-58, wherein said first insert and said second insert are operably linked to said promoter.

Embodiment 60. 60. The method of any one of embodiments 46-59, wherein said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide between said first and said second nucleic acid inserts.

Embodiment 61. The method of any one of embodiments 46-60, wherein said additional therapeutic agent selection is for said individual from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor.

Embodiment 62. 62. The method of embodiment 61, wherein said angiogenesis inhibitor is a vascular endothelial growth factor (VEGF) inhibitor.

Embodiment 63. 63. The method of embodiment 62, wherein said selection of VEGF is made from the group consisting of sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, and levatinib.

Embodiment 64. 63. The method of embodiment 62, wherein said VEGF is bevacizumab.

Embodiment 65. 62. The method of embodiment 61, wherein said PARP inhibitor selection is made from the group consisting of niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, and pamiparib.

Embodiment 66. 62. The method of embodiment 61, wherein said PARP inhibitor is niraparib.

Embodiment 67. 62. The method of embodiment 61, wherein said checkpoint inhibitor selection is from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors.

Embodiment 68. 62. The method of embodiment 61, wherein said checkpoint inhibitor selection is made from the group consisting of pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab.

Embodiment 69. 62. The method of embodiment 61, wherein said checkpoint inhibitor is atezolizumab.

Embodiment 70. The method of any one of embodiments 46-69, wherein said at least one dose of said additional therapeutic agent is between 1100 mg and 1300 mg.

Embodiment 71. 71. The method of any one of embodiments 46-70, wherein said at least one first dose of said autologous tumor cell vaccine comprises from about 1×10 ⁶ cells to about 5×10 ⁷ cells.

Embodiment 72. 72. The method of any one of embodiments 46-71, wherein said at least one second dose of said autologous tumor cell vaccine comprises from about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells.

Embodiment 73. 73. The method of any one of embodiments 46-72, wherein said at least one first dose of said autologous tumor cells is administered to said individual by intradermal injection.

Embodiment 74. 74. The method of any one of embodiments 46-73, wherein said at least one second dose of said autologous tumor cells is administered to said individual by intradermal injection.

Embodiment 75. The method of any one of embodiments 46-74, wherein said at least one dose of said additional therapeutic agent is administered to said individual by intravenous infusion.

Embodiment 76. 76. The method of any one of embodiments 46-75, wherein said at least one first dose of said autologous tumor cell vaccine comprises two doses.

Embodiment 77. 77. The method of any one of embodiments 46-76, wherein each dose of said at least one first dose of said autologous tumor cell vaccine is administered to said individual once a month.

Embodiment 78. 78. The method of any one of embodiments 46-77, wherein each dose of said at least one second dose of said autologous tumor cell vaccine is administered to said individual once a month.

Embodiment 79. The method of any one of embodiments 46-78, wherein each dose of said at least one dose of said additional therapeutic agent is administered to said individual at least once a month.

Embodiment 80. 80. Any of embodiments 46-79, wherein said at least one first dose of said autologous tumor cell vaccine and said at least one second dose of said autologous tumor cell vaccine comprise a total of at least 12 doses. one way.

Embodiment 81. A method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising:
a. i. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
ii. at least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4); and
b. administering to said individual at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent.

Embodiment 82. 82. The method of embodiment 81, wherein said ovarian cancer is stage III or stage IV ovarian cancer.

Embodiment 83. 83. The method of embodiment 81 or embodiment 82, wherein said ovarian cancer is refractory ovarian cancer.

Embodiment 84. 84. The method of embodiment 83, wherein said refractory ovarian cancer is refractory to chemotherapy.

Embodiment 85. 85. The method of embodiment 84, wherein said chemotherapy comprises a platinum agent or a taxane.

Embodiment 86. 86. The method of embodiment 85, wherein said platinum agent comprises carboplatin.

Embodiment 87. 86. The method of embodiment 85, wherein said taxane comprises paclitaxel.

Embodiment 88. 88. The method of any one of embodiments 81-87, wherein said GM-CSF is a human GM-CSF sequence.

Embodiment 89. 89. The method of any one of embodiments 81-88, wherein said expression vector further comprises a promoter.

Embodiment 90. 90. The method of embodiment 89, wherein said promoter is a cytomegalovirus (CMV) mammalian promoter.

Embodiment 91. 91. The method of embodiment 90, wherein said expression vector further comprises CMV enhancer sequences and CMV intron sequences.

Embodiment 92. 92. The method of any one of embodiments 89-91, wherein said first insert and said second insert are operably linked to said promoter.

Embodiment 93. 93. The method of any one of embodiments 81-92, wherein said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide between said first and said second nucleic acid inserts.

Embodiment 94. 94. The method of any one of embodiments 81-93, wherein said additional therapeutic agent selection is for said individual from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor.

Embodiment 95. 95. The method of embodiment 94, wherein said angiogenesis inhibitor is a vascular endothelial growth factor (VEGF) inhibitor.

Embodiment 96. 96. The method of embodiment 95, wherein said selection of VEGF is made from the group consisting of sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, and levatinib.

Embodiment 97. 96. The method of embodiment 95, wherein said VEGF is bevacizumab.

Embodiment 98. 95. The method of embodiment 94, wherein said PARP inhibitor selection is made from the group consisting of niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, and pamiparib.

Embodiment 99. 95. The method of embodiment 94, wherein said PARP inhibitor is niraparib.

Embodiment 100. 95. The method of embodiment 94, wherein said checkpoint inhibitor selection is from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors.

Embodiment 101. 95. The method of embodiment 94, wherein said checkpoint inhibitor selection is made from the group consisting of pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab.

Embodiment 102. 95. The method of embodiment 94, wherein said checkpoint inhibitor is atezolizumab.

Embodiment 103. 103. The method of any one of embodiments 81-102, wherein said at least one dose of said additional therapeutic agent is between 1100 mg and 1300 mg.

Embodiment 104. 104. The method of any one of embodiments 81-103, wherein said at least one first dose of said autologous tumor cell vaccine comprises from about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells.

Embodiment 105. 105. The method of any one of embodiments 81-104, wherein said at least one second dose of said autologous tumor cell vaccine comprises from about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells.

Embodiment 106. 106. The method of any one of embodiments 81-105, wherein said at least one first dose of said autologous tumor cells is administered to said individual by intradermal injection.

Embodiment 107. 107. The method of any one of embodiments 81-106, wherein said at least one second dose of said autologous tumor cells is administered to said individual by intradermal injection.

Embodiment 108. 108. The method of any one of embodiments 81-107, wherein said at least one dose of said additional therapeutic agent is administered to said individual by intravenous infusion.

Embodiment 109. 109. The method of any one of embodiments 81-108, wherein said at least one first dose of said autologous tumor cell vaccine comprises two doses.

Embodiment 110. 109. The method of any one of embodiments 81-109, wherein each dose of said at least one first dose of said autologous tumor cell vaccine is administered to said individual once a month.

Embodiment 111. 111. The method of any one of embodiments 81-110, wherein each dose of said at least one second dose of said autologous tumor cell vaccine is administered to said individual once a month.

Embodiment 112. 112. The method of any one of embodiments 81-111, wherein each dose of said at least one dose of said additional therapeutic agent is administered to said individual at least once a month.

Embodiment 113. 113. Any of embodiments 81-112, wherein said at least one first dose of said autologous tumor cell vaccine and said at least one second dose of said autologous tumor cell vaccine comprise a total of at least 12 doses. one way.

Embodiment 114. A method of treating cancer in an individual in need thereof, comprising:
a. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
b. administering to said individual an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4 (SEQ ID NO: 4);
The method wherein said individual comprises a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof and is identified as negative for homologous recombination repair defect (HRD).

Embodiment 115. 115. The method of embodiment 114, wherein said GM-CSF is a human GM-CSF sequence.

Embodiment 116. 115. The method of embodiment 114, wherein said expression vector further comprises a promoter.

Embodiment 117. 117. The method of embodiment 116, wherein said promoter is a cytomegalovirus (CMV) mammalian promoter.

Embodiment 118. 115. The method of embodiment 114, wherein said expression vector further comprises CMV enhancer sequences and CMV intron sequences.

Embodiment 119. 115. The method of embodiment 114, wherein said first insert and said second insert are operably linked to said promoter.

Embodiment 120. 115. The method of embodiment 114, wherein said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide between said first and said second nucleic acid inserts.

Embodiment 121. 115. The method of embodiment 114, wherein said cancer is HRD-negative wild-type BRCA1/2 cancer.

Embodiment 122. said selection of cancer is solid tumor cancer, ovarian cancer, adrenocortical cancer, bladder cancer, breast cancer, cervical cancer, cholangiocarcinoma, colorectal cancer, esophageal cancer, glioblastoma, glioma , hepatocellular carcinoma, head and neck cancer, kidney cancer, leukemia, lymphoma, lung cancer, melanoma, mesothelioma, multiple myeloma, pancreatic cancer, pheochromocytoma, plasmacytoma, neuroblastoma, prostate cancer cancer, sarcoma, gastric cancer, uterine cancer, thyroid cancer, and blood cancer.

Embodiment 123. said selection of solid tumor cancer is endometrial cancer, bile duct cancer, bladder cancer, hepatocellular carcinoma, gastric/esophageal cancer, ovarian cancer, melanoma, breast cancer, pancreatic cancer, colorectal cancer , glioma, non-small cell lung cancer, prostate cancer, cervical cancer, kidney cancer, thyroid cancer, neuroendocrine cancer, small cell lung cancer, sarcoma, head and neck cancer, brain cancer, kidney clear cell 123. The method of embodiment 122, made from the group consisting of cancer, skin cancer, endocrine tumor, thyroid cancer, tumor of unknown primary, and gastrointestinal stromal tumor.

Embodiment 124. 123. The method of embodiment 122, wherein said cancer is ovarian cancer.

Embodiment 125. 125. The method of embodiment 124, wherein recurrence of substantially eradicated ovarian cancer is prevented or delayed.

Embodiment 126. 126. The method of embodiment 125, wherein said substantially eradicated ovarian cancer is stage III or stage IV ovarian cancer.

Embodiment 127. 123. The method of embodiment 122, wherein said cancer is breast cancer.

Embodiment 128. 123. The method of embodiment 122, wherein said cancer is melanoma.

Embodiment 129. 123. The method of embodiment 122, wherein said cancer is lung cancer.

Embodiment 130. 115. The method of embodiment 114, wherein said expression vector is in an autologous cancer cell transfected with the expression vector.

Embodiment 131. 131. The method of embodiment 130, wherein said autologous tumor cells are administered to said individual in a dose of about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells.

Embodiment 132. 132. The method of embodiment 131, wherein said autologous tumor cells are administered to said individual once a month.

Embodiment 133. 132. The method of embodiment 131, wherein said autologous tumor cells are administered to said individual for 1-12 months.

Embodiment 134. 115. The method of embodiment 114, wherein said autologous tumor cells are administered to said individual by intradermal injection.

Embodiment 135. 115. The method of embodiment 114, wherein said individual received initial therapy.

Embodiment 136. 136. The method of embodiment 135, wherein said initial therapy comprises cytoreductive surgery, chemotherapy, or a combination thereof.

Embodiment 137. 136. The method of embodiment 135, wherein said chemotherapy comprises administering a platinum agent and a taxane.

Embodiment 138. 138. The method of embodiment 137, wherein said platinum agent comprises carboplatin.

Embodiment 139. 138. The method of embodiment 137, wherein said taxane comprises paclitaxel.

Embodiment 140. The method of any one of embodiments 1-139, further comprising administering an additional therapeutic agent.

Embodiment 141. 141. The method of embodiment 140, wherein said additional therapeutic agent is a member selected from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor for said individual.

Example 1 - Recurrence-Free Survival and Overall Survival Advantages in BRCA1/2 Wild-Type Frontline Stage III/IV Ovarian Cancer with Vigil® Limitations of Frontline Treatment for Advanced Ovarian Cancer, Vigil® as a frontline maintenance therapy in patients with ovarian cancer because of the relationship between high TGF-β expression and immunosuppression in ovarian cancer and limited treatment options in BRCA1/2-wt patients A study was initiated to examine the use of

Materials and methods Study design and treatment
This Phase 2b, double-blind trial comparing Vigil® to placebo included 25 centers. Patients with stage III/IV high-grade serous ovarian cancer who had a complete clinical response (cCR) after surgery and a combination of chemotherapy containing carboplatin and paclitaxel were included. Patients enrolled could have received either initial cytoreductive surgery followed by adjuvant chemotherapy or neoadjuvant chemotherapy followed by interval cytoreductive surgery and adjuvant chemotherapy. Tissue/blood germline and/or somatic BRCA1/2 molecular profiling was collected and analyzed (Ocean Ridge Biosciences, Deerfield Beach, Fla.). Patients received intradermal injections of 1×10 ⁷ cells/Vigil® or placebo once a month (within 8 weeks after the end of the last chemotherapy) up to 12 doses. Treatment continued until disease recurred or supplies were exhausted. Toxicity was assessed using CTCAE v 4.03.

Patients Women with histologically confirmed stage III or IV high-grade serous ovarian cancer (HGSC) who achieved cCR after a combination of surgery and chemotherapy were included in the study.

Relationship between tumor collection and manufacturing
Gradalis, Inc. (Carrollton, Tex.) manufactured Vigil® from harvested tumor tissue. Identical doses of placebo (frozen media) were prepared based on the number of vials of Vigil®. Ten to thirty grams of tissue was required for vaccine production. Lesions extending into the intestinal lumen were excluded (risk of bacterial infection).

Manufacture of Investigational Drug and Placebo Surgically resected tumor tissue was harvested, cut into 1/4-inch sections, placed in specimen containers supplemented with gentamicin (Fresenius Kabi), and placed on ice for overnight shipping. packed. On day 1, the transport vehicle and tumor samples were checked for sterility (BacT/Alert 3D Microbial Identification System, BioMerieux). Tumor tissue was excised with a scalpel and dissociated, followed by enzymatic dissociation (type I collagenase solution) and incubation at 37°C to facilitate formation of single cell suspensions. The concentration of this suspension was adjusted to 40 million cells/mL and electroporated using a Gene Pulser XL (BioRad) to facilitate plasmid insertion.

On day 2, overnight cultures were harvested and resuspended in fresh X-VIVO medium. A QC sample and a minimum of 4 doses per patient were required before proceeding. Cells were washed with PlasmaLyte (Baxter) supplemented with 1% human serum albumin (HSA) (Octapharma) and QC samples were taken. Cells were placed in freezing medium consisting of PlasmaLyte (Baxter) pH 7.4 containing 10% DMSO (dimethyl sulfoxide; Cryoserv USP; Mylan), 1% HSA (Octapharma) and placed in sterile 2.0 mL borosilicate glass vials. (Algroup Wheaton Pharmaceutical and Cosmetics Packaging) aseptically dispensed at 1×10 ⁷ cells/mL; butyl rubber coated with Flurotec® barrier files (West Pharmaceutical Services) for a final fill volume of 1.2 mL It was sealed with a made stopper. The final manufactured vials were frozen at a controlled rate using CoolCell® freezing containers (Biocision) and placed in a −80° C. freezer (Sanyo).

Placebo consisted of freezing medium consisting of PlasmaLyte (Baxter) pH 7.4 with 10% DMSO (Cryoserv USP; Mylan), 1% HSA (Octapharma). The medium was slowly cooled to −80° C. and frozen, after which the vials were stored in vapor phase liquid nitrogen during release testing for sterility and endotoxin. The placebo vial product matched the dose of available product manufactured for the subjects.

Disease Assessment Subjects continued treatment until disease recurred or the subject's supply of Vigil® or placebo was exhausted. Disease recurrence was assessed by WorldCare Clinical (WCC) (Boston, MA) using the Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST 1.1).

Endpoints and Statistical Evaluation The primary endpoint was recurrence-free survival (RFS) from randomization comparing Vigil® to placebo. All planned statistical analyzes before unblinding were performed independently (Stat Beyond Consulting, Irvine, CA. Secondary endpoints in order of priority included BRCA-wt RFS from time of collection , BRCA-wt RFS from the time of randomization, RFS of all patients from the time of sampling, OS of all patients from the time of randomization, and OS of all patients from the time of sampling. BRCA-wt OS from the time of randomization and sampling was a preplanned partial analysis.All patients (received at least one dose of Vigil® or placebo) was included in the analysis.For protocol adherents, a one-sided p-value of ≤0.05 (stratified log-rank test) was considered to indicate statistical significance in the analysis.Based on sample size calculations A total of 54 events were required for this analysis. ], the distribution of RFS was assessed using the Kaplan-Meier method, and planned subgroup analyzes were assessed by forest plot for all patients and patients with BRCA-wt. Groups included number of injections, age, ECOG, BRCA-wt/m, race, stage, and market release criteria (TGFβ1, GMCSF, survival) to check balance of baseline demographic variables. The p-value for is calculated using the two-tailed Fisher's exact test for categorical data and the two-tailed t-test for continuous data without multiplicity adjustment. Proportional hazards estimates for stratified Cox models were checked.

result patient
From February 2015 to March 2017, 310 patients consented at 22 centers. 128 patients were considered ineligible because of histology or screen dropout parameters. Of the remaining 181 manufactured subjects, 92 subjects (56%) were successfully manufactured and randomized, but 1 individual was in good health after randomization and before treatment. I resigned for some reason. 17 did not sign consent for randomization and 72 did not meet product release criteria (65 had insufficient cells). Ninety-one subjects received Vigil® (n=46) or placebo (n=45) and were analyzed for safety and efficacy. Sixty-seven subjects were BRCA-wt (Vigil®: 39 BRCA-wt, placebo: 28 BRCA-wt) and 24 were BRCA-m. Fifty-five recurrent events were observed in this trial through August 2019 by an independent third-party radiological review (WCC). Demographics are shown in Table 2. No significant differences were detected between the cohorts, with the exception of 45.7% of Vigil® patients with an ECOG of 1 performance status compared to 20% on placebo.

Efficacy The primary endpoint of median RFS calculated from randomization of all patients was 12.7 vs. 8.4 months comparing Vigil® to placebo (HR 0.67, 90% CI [0.432 1.042], one-sided p = 0.065). RFS from time of surgery/harvest was 18.3 vs. 15.9 months (Vigil® vs. placebo) HR was 0.63 (90% CI [0.403-0.971], one-sided p=0.038) (FIGS. 6A-6B). Vigil® vs placebo recurrence was 54% vs. 76% (Fisher's exact probability p=0.048). Furthermore, the 1-year RFS rate from randomization was 51% for Vigil vs. 38% for placebo (p 0.13, one-tailed Z-test), and the 2-year RFS rate was ® versus 25% for placebo (p 0.22, one-tailed Z-test). Median follow-up from the first dose of Gemogenovatucel-T was 38.5 months and placebo was 38.6 months. Both PP and ITT analyzes revealed the same results. The median time from surgery to randomization was 7.0 vs. 6.7 months, and the median time from end of chemotherapy to initiation of treatment was 1.6 and 1.5 months (Gemogenovatucel-T, placebo, respectively). .

Stratification by BRCA status demonstrated improvement in Vigil® BRCA-wt patients. Median RFS from randomization (Figure 6C) in Vigil® BRCA-wt was 12.7 months compared to 8.0 months with placebo (HR 0.493, 90% CI [0.287 to 0.846]; 19.4 months on Vigil and 14.4 months on placebo from time of surgery/harvest (HR 0.459, 90% CI [0.268-0.787], 1-sided p=0.007) (Fig. 6D) ). Disease recurred in 79% of placebo BRCA1/2-wt patients compared with 51% of Vigil® BRCA-wt1/2 patients who had disease relapse (Fisher's exact probability p=0.039). An overall survival advantage was observed compared to placebo in a planned partial analysis of Vigil® BRCA-wt patients from the time of randomization and surgery/collection (FIGS. 6E-6F). Analysis of RFS and survival calculated from the time of randomization and surgery/sampling revealed similar results. Median RFS from randomization of BRCA-m patients was 10.5 months for Vigil® and 13.3 months for placebo. Preliminary study demographics (planned subanalyses) related to disease effect, including pre-identified stratification (residual disease, chemotherapy schedule) and product release criteria, were consistent with BRCA for RFS from the time of randomization. The effects of -wt and all patients are shown in Figures 7A-7B to explore.

The secondary endpoint of median RFS from time of surgery/harvest in BRCA-m patients comparing Vigil to placebo was 19.4 months for Gemogenovatucel-T and 14.4 months for placebo (HR 0.459 , 90% CI [0.268–0.787], one-sided p 0.007) (Fig. 6D). At the time of efficacy assessment, 51% of Vigil® BRCA1/2-wt patients had recurrent disease compared with 79% of placebo BRCA-wt patients (p 0.0195, unilateral Fisher's direct probability t-test). The 1-year RFS rate from the time of surgery/harvest was 80% in Vigil® BRCA-wt patients versus 64% in placebo BRCA-wt patients (p 0.075, one-tailed Z-test); The 2-year RFS rate was 43% with Vigil® versus 23% with placebo (p 0.5, one-tailed Z test). Median RFS for Vigil® BRCA-wt patients from randomization was 12.7 months compared to 8.0 months for placebo (HR 0.493, 90% CI [0.287 to 0.846], one-sided p 0.014) (Fig. 6C). In BRCA-wt patients, the 1-year RFS rate from randomization was 52% for Vigil vs. 27% for placebo (p 0.02, one-tailed Z test), and 2-year RFS was The rate was 34% with Vigil® versus 13% with placebo (p 0.035, one-tailed Z test). Analysis of RFS calculated from randomization and surgery/collection time points revealed similar results (Fig. 5A-D). Median RFS from time of surgery/harvest in all patients was 18.3 vs. 15.9 months (Vigil vs. placebo) HR was 0.63 (90% CI [0.403 to 0.971], one-sided p 0.038) (Fig. 6B).

When an RMST-based sensitivity analysis was performed for BRCA-wt patients comparing Vigil® to placebo, the results were consistent with those based on the stratified log-rank test. The RMST difference between Vigil® and placebo was 7.8 months (p 0.021) for RFS and 7.1 months (p 0.020) for OS from randomization of BRCA-wt patients. A cut-point equal to the minimum of the longest follow-up time in either group was used in the RMST analysis.

Safety A median of 6 Vigil® (range 1-12) or 6 placebo (range 3-12) injections were administered per patient. One treatment delay in placebo patients, possibly due to documented pelvic infection related to study drug. Two placebo patients experienced grade 3-related toxicities; no grade 3 treatment-related adverse events were observed with Vigil®. Nine percent of reported adverse events were grade 2, 3 adverse events with Vigil® compared to 2.9% with placebo. Eleven serious adverse events (SAEs) were reported in seven (4 placebo; 3 Vigil®) patients. All but one were likely or not related to study treatment.

Product shipping result
Eighty-four (92%) subjects met all product release criteria. The median mass of tumors harvested was 52 grams (range 8-137 grams). The median survival rate for product shipments was 88% (72%–98%, n = 91). Seven of 91 (8%, 5 Vigil®, RFS randomized 7.4 months/2 placebo) did not show a significant increase in GMCSF expression after plasmid transfer. However, 6 of these 7 patients (6/7) showed sufficient TGFβ1 knockdown. Additional product release results are shown in Table 3. The median evaluable GMCSF production (pg/ ¹⁰⁶ cells) was 860 (36-37669, n=84) and the median evaluable TGFβ1 knockdown was 100% (66-100%, n=84). The outcome of TGFβ1 knockdown was equivocal in 7 patients (6 with full GMCSF expression, 3 with Vigil, RFS randomized 5.6 months/4 with placebo), but 78 86% of patients had >90% TGFβ1 knockdown, demonstrating robust activity associated with furin bi-shRNAi knockdown. However, there was no significant difference in RFS. Median TGFβ1 expression of 164 pg/10 ⁶ cells (mean 241, range 52-882) with detectable levels of baseline TGFβ1 production in all patients before plasmid transfection It became clear. BRCA1/2-wt TGFβ1 expression was found to be median 181 (mean 249, range 60-662) pg/10 ⁶ cells in both groups and BRCA1/2-m TGFβ1 median was found to be 146 (mean 219, range 52-882) pg/10 ⁶ cells. (Table 4)

Effectiveness
Of the 91 evaluable patients, 62 patients had a BRCA1/2 molecular profile by local site analysis. A subgroup of BRCA1/2-wt patients showed an RFS benefit in the Vigil® cohort compared to the placebo cohort. Results are shown in Figures 2A-2B. Median RFS, calculated from the time of surgery/harvest, was not reached in BRCA-wt ovarian patients in the Vigil cohort compared to 14.8 months in the placebo cohort (HR = 0.49, 90% CI, 0.25–0.97, one-sided p=0.038). Similarly, when RFS was calculated from the time of randomization, the median RFS in the BRCA-wt subgroup was 8.0 months in the placebo group compared with 19.4 months in the Vigil® group (HR = 0.51, 90% CI, 0.26–1.01, one-sided p = 0.050). Thirty-eight percent of Vigil-treated BRCA1/2-wt patients had recurrent disease compared with 71% of placebo BRCA1/2-wt patients (chi-squared 0 = 0.021) ( Figure 3A). Sixty-two percent of Vigil® patients are BRCA-wt and have remained relapse-free to date (October 31, 2019).

RFS calculated from the time of cytoreductive surgery and the time of randomization, regardless of BRCA1/2 status, are shown in Figures 2C-2D. The median RFS calculated from the time of randomization was 13.67 months (416 days) in the Vigil cohort compared to 8.38 months (255 days) in the placebo cohort (HR = 0.69, one-sided log-rank p = -.054). RFS calculated from the time of cytoreductive surgery improved to a HR of 0.64 (one-sided p = 0.054). Relapse was reported in 73% of placebo patients compared to 48% of Vigil®-treated patients (chi-square p=0.013) (FIG. 3B). Other factors associated with trends in benefit for Vigil® response were younger age <65 years (p 0.057), late stage IIIb-IV (p 0.075), and microscopic residual disease (<10 mm)/no evidence of disease (p = 0.066) (Figure 4).

consideration
BRCA1/2-wt patients demonstrated a significant (calculated from the time of cytoreductive surgery) RFS advantage with Vigil over placebo (not reached vs. 14.8 months; HR = 0.49, one-sided p = 0.038). ), and less relapses occurred after treatment (38% vs. 71%, p=0.021). These results supported Vigil® being considered maintenance in BRCA1/2-wt ovarian cancer patients after complete cytoreductive surgery and adjuvant or neoadjuvant chemotherapy. Safety analyzes demonstrated no evidence of toxic effects of Vigil® over placebo.

A growing body of evidence suggests that GMCSF is involved in increasing tumor antigen presentation by dendritic cells (DCs). GMCSF has been shown to induce a subset of CDs that are highly phagocytic of apoptotic tumor cells. GMCSF induces higher levels of co-stimulatory molecules, which are characteristic of greater functional maturation and more efficient T cell stimulation, thereby expanding the arsenal of lymphocyte effector mechanisms it induces. do. GMCSF also facilitates the presentation of lipid antigens by dendritic cells, which in turn are a population of lymphocytes that may be important in both the intrinsic and therapeutic response to tumors, natural killer T cells (NKT cells). ). Dendritic cells initiate antigen-specific immune responses and express various receptors that enable recognition and capture of antigens in peripheral tissues such as the dermis. Dendritic cells efficiently process this material into MHC class I and II presentation pathways, upregulate costimulatory molecules upon maturation, and translocate to secondary lymphoid tissues, where dendritic cells Presents antigen to T cells. Vigil® GMCSF protein is upregulated with a robust mean/median of 1806/826 pg/10 ⁶ cells. In 84 of 91 (91%) patients produced, this was associated only with GMCSF plasmid transfer.

It has also been previously shown that expression of TGFβ in ovarian malignant cells is much higher in malignant ovarian cancer tissue than in non-malignant ovarian cancer tissue. A gene expression meta-analysis performed in more than 1500 ovarian cancer patients identified high-risk and low-risk groups based on the expression of several genes, and the results were validated by IHC or qRT-PCR . Pathway analysis of gene signatures showed enrichment of TGFβ in patients with poor prognosis. TGFβ signals are channeled through binding to the serine/threonine kinase receptors TGFβRI and II, leading to phosphorylation and activation of the intracellular effectors Smad2 and Smad3. Smad2/3 forms a transcriptional complex with Smad4, translocates to the nucleus, and regulates gene expression of TGFβ-regulated genes. TGFβ is involved in the progression of noninvasive serous ovarian tumors to aggressive serous ovarian tumors. TGFβ can be activated by Smad-dependent and Smad-independent pathways and is thought to promote tumor metastasis in ovarian cancer. A correlation between TGFβ overexpression and tumor cell proliferation and metastasis has also been described in prostate, colon, and renal cell cancers.

TGFβ secreted by ovarian cancer cells induces immunosuppressive regulatory T cell (Treg) (CD4+CD25+) proliferation in the tumor microenvironment. It has been shown to be associated with poor prognosis in frontline-treated patients with high-grade serous ovarian cancer. TGFβ inhibits GMCSF-induced maturation of bone marrow-derived dendritic cells (DCs) as well as the expression of MHC class II and co-stimulatory molecules. TGFβ inhibits activated macrophages, including their antigen-presenting functions, and PD-L1 ligand expression by ovarian cancer and tumor-associated myeloid cells, which is further associated with poor overall survival and are also connected). Evidence demonstrates that modulation of relevant anti-tumor immunity can restore TGFβ-associated immune surveillance.

TGFβ1 has also been shown to down-regulate the miR181/BRCA1 axis, thereby modulating DNA repair defects and inducing 'BRCA-likeness' in breast cancers with wild-type BRCA genes. The term 'BRCAlikeness' has been used to identify sporadic tumors with clinicopathologic and molecular features similar to tumors associated with BRCA1/2 germline mutations (reduced DNA repair). . In addition, increased TGFβ signaling in low HRD tumors has been demonstrated that can induce NF-kB activation and evoke anti-tumor immune responses in lymphocytes. Therefore, in addition to BRCA molecular signals, homologous recombination repair defect (HRD) scores may also be involved in predicting outcome and response to TGFβ-modulating immunotherapy.

The improved RFS results in the BRCA-wt population in this trial further support a relationship between TGFβ suppression and immune responsiveness, whereby BRCA-wt patients and possibly other histologic types with high TGFβ expression would support the use of Vigil® in other cancer subpopulations such as prostate cancer, renal cell carcinoma, and colorectal cancer. High levels of furin mRNA and furin protein are also widely expressed in ovarian cancer and in many other human tumors where the gene expression differs between malignant (high) and non-malignant (low) cell populations. . Expression of the TGFβ1 and TGFβ2 converting enzyme furin appears to be inversely correlated with survival and likely contributes significantly to the maintenance of tumor-directed TGFβ-mediated peripheral immune tolerance. Downregulation of furin using the bi-shRNAi method induced a marked downregulation of TGFβ1, as verified in this study. Remarkably, 73% of the Vigil® vaccines constructed had >90% TGFβ1 knockdown compared to untransfected tumor cells from the same patient.

BRCA-wt and low HRD ovarian cancers also have elevated percentages of tumor-infiltrating lymphocytes (TILs) in the tumor microenvironment, high PD-L1 expression, high type 1 IFN gamma signaling activity in mononuclear cells, and high perforin-1 expression, which is generally thought to indicate an improved immune response. However, several attempts to enhance both frontline and relapsed/refractory ovarian responses to checkpoint inhibitor therapy have failed. Hypothetically, this may also be related to a high TGFβ-suppressive effect within the local tumor microenvironment, as previously described.

In addition to blocking the catalytic action of PARP proteins on the DNA surface, PARP inhibitors bind to and capture this protein. This leads to numerous double-stranded DNA breaks and ultimately cell death. Lynparza® (olaparib) was one of the first PARP inhibitors approved for patients with high-grade serous ovarian cancer with germline BRCA mutations. A previous study showed an increase in progression-free survival in BRCA1/2-mu ovarian cancer (HR 0.3, p<0.0001). A recent long-term follow-up of olaparib in patients with platinum-sensitive recurrent ovarian cancer (study 19) showed favorable OS results, with an HR of 0.73 in all patients enrolled (p=0.0138), but activity was BRCA- Appeared to be restricted to the mu population with an HR of 0.62 (p = 0.02140), in contrast to the BRCA-wt population, which showed no benefit with a HR of 0.84 (p = 0.34) in the BRCA-wt population. There is (82). However, some BRCA-wt patients with relapsed or refractory disease with homologous recombination repair defects (HRD) may benefit from PARP inhibitors. Recent reports indicate that some high HRD tumors are associated with better responses to niraparib. Moreover, recent studies have shown that BRCA-wt and low HRD tumors have elevated immunogenic signals, including increased amounts of TILs, suggesting that IFN-gamma signaling It proves a lot. This is consistent with what was observed with Vigil® benefit on RFS being most significantly documented in the BRCA-wt population. It is justified to consider further clinical trials of the PARP inhibitor Vigil® in BRCA-wt ovarian cancer.

Although bevacizumab is the recommended maintenance therapy for frontline-treated ovarian cancer, no evidence of a recurrence-free survival or overall survival advantage involving bevacizumab alone as maintenance has been observed. Vascular endothelial growth factor (VEGF) inhibitors (ie, bevacizumab) target the pleomorphic growth factor VEGF, which is a key regulator of tumor angiogenesis as well as suppressing the immune system. The hypoxic tumor microenvironment is a pro-angiogenic factor that binds the receptor tyrosine kinases VEGF receptors (VEGFR)-1 (FLT1) and -2 (FLK1/KDR) and the VEGFR co-receptors neuropilins (NRP) 1 and 2 Promotes secretion of VEGF-A (known as VEGF). This pro-angiogenic switch in the tumor microenvironment not only promotes tumor angiogenesis, tumor maturation, and metastatic dissemination, but also inhibits dendritic cell (DC) maturation, promotes regulatory T-cell function and tumor-associated macrophage development. It also exerts immunosuppressive effects such as enhancement of cytotoxicity and accumulation of myeloid-derived suppressor cells. PD-1 expression on the surface of CD8+ T cells is also increased. VEGF-A and its receptors VEGFR1, VEGFR2, and NRP1 are commonly upregulated in ovarian cancer.

However, the clinical efficacy of bevacizumab in ovarian cancer is limited not only by its relationship to a limited clinical response and moderate toxicity profile, but also by the relatively rapid development of anticancer resistance after initiation of angiogenesis inhibition. From activation, challenges remain to be faced. However, a possible direction is being explored in the use of anti-angiogenic agents, which is the enhancement of immunotherapeutic activity. Combining bevacizumab with therapeutic vaccines may induce infiltrating T-lymphocyte responses, shifting the immunosuppressive balance from T-regulated suppression to CD8 T-cell activation, leading to T cell-inflamed tumor microenvironments. There is evidence that it creates an environment (a "hot tumor") that will be more immunologically responsive to immunotherapy.

Although results demonstrating benefit in the BRCA1/2-wt population may be associated with clonal neoantigen exposure, it may be associated with subclonal neoantigen exposure in BRCA1/2-m patients in relation to increased repair defects. may be diluted compared to gen exposure. BRCA-wt ovarian cancer has an increased proportion of tumor-infiltrating lymphocytes (TILs) in the tumor microenvironment, high PD-L1 expression, and high type 1 IFN-gamma in mononuclear cells compared with BRCA-deficient ovarian cancer It shows signaling activity and high perforin-1 expression, also consistent with a greater proportion of clonal neoantigens. BRCA1-wt expression also significantly affects the association of autophagy with MHC expression of tumor antigens. BRCA1-m therefore disrupts this process that may limit the visibility of neoantigens and the activity of Vigil®.

GMCSF is involved in increasing tumor antigen presentation by dendritic cells (DCs) and induces higher levels of co-stimulatory molecules, which induce more efficient T cell stimulation. GMCSF also enhances the presentation of lipid antigens by dendritic cells, which in turn leads to activation of natural killer T cells (NKT cells).

In addition, TGFβ is at higher levels in malignant ovarian tissue than in non-malignant ovarian tissue. A gene expression meta-analysis in over 1500 ovarian cancer patients identified high-risk and low-risk groups based on the expression of several genes, and the results were validated by IHC or qRT-PCR. Pathway analysis of gene signatures showed that TGFβ signaling was enriched in patients with poor prognosis. TGFβ is involved in the progression of noninvasive serous ovarian tumors to aggressive serous ovarian tumors. Furthermore, overexpression of TGFβ correlates with tumor cell proliferation and metastasis.

TGFβ secreted by ovarian cancer cells induces immunosuppressive regulatory T cell (Treg) (CD4+CD25+) proliferation in the tumor microenvironment. It has been shown to be associated with poor prognosis in frontline-treated patients with high-grade serous ovarian cancer. TGFβ inhibits GMCSF-induced maturation of bone marrow-derived DCs as well as expression of MHC class II and co-stimulatory molecules. TGFβ inhibits activated macrophages, including their antigen-presenting functions, and PD-L1 ligand expression by ovarian cancer and tumor-associated myeloid cells, which is further associated with poor overall survival and are also connected). Knockdown of TGFβ1 may contribute to suppression of TGFβ effects, which may be more significant in BRCA-wt patients, as demonstrated in this study.

Given that Vigil® is well tolerated, easy to administer, and shows promising efficacy, it would be an ideal maintenance therapy for ovarian cancer patients. The strengths of the presented results include safety and clinically validated RFS and OS benefits in BRCA-wt patients. However, the BRCA-wt subset is a secondary endpoint and the use of autologous tumor collections as one component of product manufacturing poses limitations on product applications. It is reasonable to further evaluate combinations with bevacizumab and/or niraparib.

In conclusion, Vigil demonstrated compelling RFS benefits and low toxic effects as single-agent maintenance therapy in patients with frontline ovarian (stage III/IV) cancer with a BRCA1/2-wt molecular profile bottom. Further investigation as a single agent and in combination with angiogenesis inhibitors, PARP inhibitors and checkpoint inhibitors is warranted.

Example 2 - Proof-of-principle Study of Sequential Combination of Atezolizumab and Vigil® in Relapsed Ovarian Cancer Impression of Immunomodulatory Advantage over Checkpoint Inhibitor (CI) Therapy in Many Cancer Types evidence, but little benefit has been shown for OC. Theory points to this inadequacy most likely due to the lack of CI specificity in OC combined with pronounced heterogeneity and genetic instability. A recent report details how ovarian cancer (OC) cells acquire a potential escape mechanism and can escape host immunity through several immunosuppressive factors (MHC expression). loss and upregulation of immunosuppressive factors, including TGF-beta (TGFβ), indoleamine 2,3-dioxygenase (IDO), and cyclooxygenases (COX-1 and COX-2).

Vigil® is an autologous tumor cell vaccine, in which tumor cells are harvested from a patient during cytoreductive surgery and contain the GMCSF gene, an immunostimulatory cytokine, and a bifunctional short chain hairpin RNA (bi-shRNA) specifically upregulating the expression of furin, a pivotal converting enzyme responsible for the activation of two TGFβ isoforms, TGFβ-1 and TGFβ-2 (tumor immune effector suppressors). knockdown) has been transfected through electroporation. Downregulation of TGFβ expression reduces the ability of cancer cells to evade host immune responses. Vigil® is a personalized “neoantigen-educating” immunotherapy, safely administered at doses up to 2.5×10 ⁷ cells/injection in Phase 2 trials in cancer patients containing OC There is evidence of benefits in It is hypothesized that the improved expression of clonal tumor neoantigens and the reduced tumor suppressive effect of TGFβ synergistically increase the activity of checkpoint inhibitor therapy. Furthermore, preclinical evidence supports that pre-application of neoantigen education therapy before cycle 1 (C1) enhances the immunotherapeutic anticancer activity of C1. To assess safety and preliminary evidence of benefit, the first clinical combination using Vigil and atezolizumab as single agents sequentially at previously clinically validated safe dose levels was initially The use of Vigil® in patients (Vigil®-1 ^st ) was compared with the use of atezolizumab initially (Atezo-1 ^st ).

METHODS Study Design and Treatment The open-label, Parts 1 and 2 trials of this phase were conducted at six centers across the United States. Part 1 investigated the safety of Vigil® and atezolizumab. Part 2 was a randomized study comparing Vigil ® first versus atezolizumab first, followed by Vigil ® plus atezolizumab combination. Patients entering the Vigil® vaccine configuration protocol involving ovarian cancer were eligible for this trial. Tissue and peripheral blood mononuclear cell samples were collected and analyzed for BRCA1/2 molecular profiling using a call quality of 40 and a minimum allele depth of 5 (Ocean Ridge Biosciences, Deerfield Beach, Fla.). Patients received Vigil® (1×10 ⁶ -10 ⁷ cells/dose intradermally) and atezolizumab (1200 mg/dose by intravenous infusion) once every 3 weeks up to 12 doses . Informed consent was obtained prior to collection and prior to main study enrollment/randomization. Full IRB approval of the protocol and written informed consent were required before patients could be enrolled at any site.

Patients Women with recurrent ovarian cancer, stable medical status, and at least one prior failure of systemic therapy in the setting of recurrence or platinum-resistant disease were eligible for the study. . Subjects were required to receive at least 4 vials of manufactured Vigil®, had an ECOG performance status (PS) ≤1, and had normal organ and bone marrow function required for protocol compliance, defined as protocol compliance. (absolute neutrophil count ≥1,500/ ^mm3 ; platelets ≥100,000/ ^mm3 ; hemoglobin ≥5.59 mmol/L; serum bilirubin ≤1.5 x upper limit of institutional normal; AST/ALT ≤2.5 x institutional normal creatinine >50 mL/min; TSH within institutional limits). Patients with previous immunotherapy and active autoimmune disease were excluded.

Tumor harvesting and manufacturing
Gradalis, Inc. (Carrollton, Tex.) manufactured Vigil® from harvested tumor tissue. Manufacturing was a two day process. The equivalent of a "golf ball size" mass (10-30 g of tissue, cumulative) was required for vaccine production (3 cm by radiographic scan). Lesions extending into the intestinal lumen were excluded because of the risk of bacterial infection.

Manufacture of Investigational Drug and Placebo Surgically resected tumor tissue was collected during the cytoreductive procedure, cut into 1/4 to 1/2 inch sections, then sterilized 0.9 supplemented with gentamicin (Fresenius Kabi). Up to four sample containers containing % sodium chloride (Baxter) were placed and packaged on ice for overnight shipment to the manufacturing facility. On day 1, the sterility of the transport medium and tumor samples in each container was checked (BacT/Alert 3D Microbial Identification System, BioMerieux). Tumor tissue was trimmed to remove fat, connective/necrotic tissue, sutures/staples, mechanically dissociated with a scalpel, followed by enzymatic dissociation (type I collagenase solution) and incubation at 37°C for up to 45 minutes. to form a single cell suspension. The cell suspension was filtered through a sterile 100 um strainer (Corning) to separate the cells from cell debris and the freed cells were washed with PlasmaLyte supplemented with 1% human serum albumin (Octapharma). (Baxter) and manually counted by hemocytometer (InCyto). Quality control (QC) samples were taken to retain and monitor immunity and pre-transfection cultures were initiated to obtain baseline cytokine levels by ELISA for GMCSF (R&D Systems) and TGFβ1 (R&D Systems). The concentration of this cell suspension was adjusted to 40 million cells/mL and electroporated using a Gene Pulser XL (BioRad) to insert the plasmid DNA into the cells. The transfected cells were plated at 1×10 ⁶ cells/mL in X-VIVO 10 medium (Lonza) supplemented with gentamicin (Fresenius Kabi) in sterile T-225 cm ² flasks (Corning). and incubated overnight (14-22 hours) at 37°C with a 5% CO ₂ overlay (Sanyo) to allow the incorporation of the bi-shRNA furin and GMCSF mRNAs into the tumor cells.

On day 2, the overnight cultures were harvested by detaching the cells from each flask and the medium containing free floating cells was collected and resuspended in fresh X-VIVO medium. Cells were manually counted to ensure that a minimum of 80 million cells were available for QC samples and a minimum of 4 doses before proceeding. Two 1-mL mycoplasma samples containing cells were taken and frozen at -80°C. Cells were irradiated with 4×25 Gy cycles using a gamma irradiator to arrest replication/proliferation. Cells were washed with PlasmaLyte (Baxter) supplemented with 1% human serum albumin (Octapharma) and QC samples were taken to retain and monitor immunity and post-transfection cultures were initiated and transfected. Cytokine levels were obtained by ELISA (or ELLA machine for one patient) for GMCSF and TGFβ1. Cells were placed in freezing medium consisting of PlasmaLyte (Baxter) at pH 7.4 with 10% DMSO (dimethyl sulfoxide; Cryoserv USP; Mylan), 1% human serum albumin (Octapharma) at 1×10 ⁶ cells/cell. mL or 1 x ¹⁰⁷ cells/mL aseptically dispensed into sterile 2.0 mL borosilicate glass vials (Algroup Wheaton Pharmaceutical and Cosmetics Packaging); It was sealed with a butyl rubber stopper coated with ® Barrier File (West Pharmaceutical Services). Final product vials were frozen at a controlled rate using CoolCell® freezing containers (Biocision) placed in a −80° C. freezer (Sanyo). After freezing, the cells were stored in vapor phase liquid nitrogen tanks during shipping testing. Frozen product vials were used for sterility (USP <71>) and endotoxin testing by gelation (Limulus Amoebocyte Lysate, Lonza).

Atezolizumab was provided by Roche/Genentech and distributed by Gradalis, Inc. Atezolizumab was formulated as 60 mg/mL atezolizumab (pH 5.8) in 20 mM histidine acetate, 120 mM sucrose, 0.04% polysorbate 20 (Phase III formulation). Atezolizumab was preservative-free and offered for single use only. Atezolizumab (1200 mg per vial) in Formulation F03 was administered in 250 mL 0.9% NaCl IV infusion bags, prepared and diluted under aseptic conditions.

Disease Assessment Subjects remained on treatment until disease progression or death, or until product toxic effects. Disease progression was determined radiographically by local investigators using the Response Evaluation Criteria in Solid Tumors Version 1.1 (RECIST 1.1). In Part 1, disease progression was assessed at baseline and every third cycle thereafter. In Part 2, disease was assessed at baseline, at the end of cycle 2 of monotherapy, and every third cycle thereafter.

ENDPOINTS AND STATISTICAL EVALUATIONS The data cut-off date for the main analysis was arbitrarily 20 December 2019. The primary endpoint was safety. Efficacy assessments and endpoints included progression-free survival (PFS) and overall survival (OS) between the Vigil®-1 ^st and Atezo-1 ^st arms. Time to progression was calculated from the date of randomization to the first date on which progression or death was documented. PFS and OS were analyzed sequentially in BRCA1/2-wt subgroups and compared between Vigil®-1 ^st and Atezo-1 ^st . Median follow-up time was calculated from the date of data cut-off subtracted from the time of initiation of treatment. A one-sided p-value of 0.05 or less (log-rank) was considered to indicate statistical significance in the analysis. PFS and OS hazard ratios (HR) were estimated by the Mantel-Haenszel hazard model. The distribution of PFS and OS was estimated using the Kaplan-Meier method. Toxicity was assessed using NCI CTCAE v 4.03.

result patient
From June 2, 2017 to February 13, 2019, 3 patients entered Part 1 of the study and 21 were randomized for Part 2 of the study (n=11 Vigil ( (registered trademark)-1 ^st : n=10 Atezo-1 ^st ). All patients had at least one prior systemic therapy failure (Part 1/Vigil®-1 ^st /Atezo-1 ^st : 0/5/2 received 1 treatment, 1/4 /3 had 2 treatments, 1/2/4 had 3 treatments, and 1/0/1 had 4 treatments), summarized for individuals (part 2 only) and all patients The demographics used are shown in Table 5. Germline and somatic BRCA (g/sBRCA) status was determined for all 24 patients. Median follow-up time was 29.3 months for Part 1 and 21.3 months for Part 2.

Safety No grade 3 or 4 treatment-related toxicities were observed in Part 1. So it could have happened in Part 2. There were 30 treatment-related adverse events in the Atezo-1 ^st group and 83 events in the Vigil®-1 ^st group. Twenty-five of the 30 Atezo-1 ^st events (83.3%) were grade 1, 2 and were mostly attributable to atezolizumab treatment (24/25). Of the 83 events in the Vigil®-1 ^st arm, 81 (97.6%) were grade 1, 2 events, with 61.7% (50/81) attributable to atezolizumab treatment and 38.3% (31/81) were associated with Vigil® treatment.

A comparison of all and grade 3, 4 events related to atezolizumab between the Vigil®-1 ^st and Atezo-1 ^st groups is shown in FIG. Grade 3 and 4 treatment-related events were more common in the Atezo-1 ^st arm (17.2%) than in the Vigil®-1 ^st arm (5.1%). Grade 3 atezolizumab-related events in the Atezo-1 ^st arm included hematological and lymphatic disorders (6.9%), general disorders (3.5%), injuries (3.5%), respiratory, thoracic, and mediastinal disorders (3.5%); %) were included. No Vigil®-related grade 3 events were observed in the Atezo-1 ^st arm. Two grade 3 events were urological disorders in the Vigil®-1 ^st arm (one related to atezolizumab and one to Vigil®). Additionally, atezolizumab-related adverse events (all grades) were significantly more common in the Atezo-1 ^st group (96.7%) than in the Vigil®-1 ^st group (61.3%).

Product shipping results
Vigil® vaccine from 20 subjects (83.3%) met all product release criteria. The median volume of tumors harvested was 51.65 g (11.52 g to 114.23 g). Four subjects (16.7%) did not show a significant increase in GMCSF expression after plasmid transfer, an exception in this study (n=1 part 1, n=3 part 2). Key product release results are shown in Table 6. Significant TGFβ1 knockdown could be detected in 23/24 (95.8%) subjects. Fifteen (62.5%) patients had >90% TGFβ1 knockdown demonstrating robust activity associated with Furin bi-shRNAi knockdown. Detectable levels of baseline TGFβ1 production in all patients before plasmid transfection revealed a median TGFβ1 expression of 158 pg/10 ⁶ cells (mean 206, range 93-445) Became. TGFβ1 expression in BRCA1/2-wt (n=13 part 2) showed a median value of 139 pg/10 ⁶ cells for the Atezo-1 ^st and Vigil®-1 ^st groups (mean 188, TGFβ1 expression on BRCA1/2-m (n=8 part 2) showed a median value of 223 pg/ ¹⁰ cells (mean 215, range 111-361). 307).

Effectiveness
Median OS was not reached in the Vigil®-1 ^st cohort and 10.8 months in the Atezo-1 ^st cohort (HR 0.33; 95% confidence interval (CI) [0.064–1.7]; p=0.097) ( Figure 9A). Median follow-up was 21.3 months for Part 2. A subset analysis by BRCA status demonstrated that ovarian cancer in BRCA1/2-wt patients was improved with Vigil®-1 ^st compared with Atezo-1 ^st (HR 0.16, 95% CI [ 0.026-1.03]; p=0.027, FIG. 9B). In the BRCA-m cohort, there was no OS benefit between the Vigil®-1 ^st and Atezo-1 ^st cohorts. No significant benefit in PFS was observed (Figures 9C-9D).

Discussion Despite the fact that most ovarian cancer patients achieve a complete clinical response with primary surgery and combination chemotherapy, the vast majority of these patients (75%) unfortunately relapse within 16-24 weeks. and eventually succumb to their disease. Treatment of those patients who relapse is mostly based on a relapse-free interval. Women who relapse more than 6 months after completion of platinum-based chemotherapy are traditionally considered platinum-sensitive and are usually treated with maintenance therapy with a platinum doublet and often bevacizumab or a PARP inhibitor. be treated with Patients who relapse (platinum-resistant) within 6 months of completing platinum-based chemotherapy are usually treated with non-platinum-based therapy with or without bevacizumab. PARP inhibitors have shown improved progression-free survival (PFS) after initial chemotherapy and as maintenance therapy after platinum-sensitive relapsed OC therapy. Bevacizumab has been found to improve PFS when combined with initial chemotherapy or chemotherapy after relapse and is commonly used in combination therapy in relapsed OC.

The results demonstrated here justify continued trials of the combination of Vigil® and atezolizumab in recurrent ovarian cancer, and Vigil® followed by Vigil®/atezolizumab combination therapy It was suggested that it has clinical advantages over Atezo-1 ^st . This more favorable toxicity profile with promising clinical benefit suggested a superior therapeutic index for Vigil®-1 ^st delivery, especially in BRCA-wild type patients. This is particularly encouraging, given the limited benefit for single-agent checkpoint inhibitor therapy involving ovarian cancer.

Expression of TGFβ is increased in ovarian cancer tissues compared to many other cancers, particularly in recurrent disease, and Vigil's direct activity knocks TGFβ1 and TGFβ2 through inhibition of furin Because of its down-regulating effect, Vigil® may directly act on mechanisms of resistance mediated through TGFβ1 expression in ovarian cancer. Based on these results, Vigil® may be a viable mechanism to improve neoantigen exposure and T-cell activation, thereby optimally performing checkpoint inhibitor therapy despite TGFβ. make it possible to TGFβ secreted by ovarian cancer cells induces the generation of immunosuppressive Treg cells (CD4+CD25+) from peripheral CD4+CD25- cells within the tumor microenvironment. Treg tumor infiltration is associated with poor prognosis in patients with high-grade serous ovarian cancer treated with neoadjuvant chemotherapy. Therefore, the CD8/Treg ratio is also a prognostic indicator. At the start of this study, Vigil-1 ^st treatment prior to the Vigil + atezolizumab combination allowed visualization of immune effector cells of relevant tumor neoantigens prior to checkpoint functional activity. We hypothesized that the focus would limit off-target toxicity and potentially maximize the availability and response of immune effector cells. These observations support this hypothesis and the work of others in preclinical models, including evidence of selective TGFβ knockdown in overcoming resistance to checkpoint inhibitors.

To generate an effective anti-tumor immune response, it is necessary to educate T cells against the tumor's neoantigen repertoire. T cells further differentiate into memory T cells, thus providing long-term immunological memory and possibly sustainable disease control. Tumors with low neoantigen heterogeneity have been reported to respond better to checkpoint blockade with pembrolizumab. That same report showed that T cells failed to recognize subclonal neoantigens (indicating that abundance of visible neoantigens was important for recognition), diluting the visibility of clonal neoantigens. It was also shown that there is a possibility that The likelihood of T cells recognizing tumor-specific clonal neoantigens for the same patient's disease is greater when using autologous rather than allogeneic tumor tissue (individualized).

Over 1,400 doses of Vigil® have been administered in clinical trials. The most commonly reported adverse reactions attributed to the administration of Vigil®-engineered cells were low to moderate intensity injection site reactions, primarily consisting of redness and swelling at the injection site. This is thought to be related to immune activation at the injection site. There have never been any serious or life-threatening (CTC Grade 3 or 4) adverse events attributable to Vigil® treatment. No new or unexpected toxic effects were observed with Vigil® in combination with atezolizumab.

In conclusion, combining an individualized autologous ovarian cancer vaccine followed by a checkpoint inhibitor (atezolizumab) demonstrated encouraging efficacy with less toxicity.

Example 3 - BRCA1/2 Wild-Type Frontline Stage III/IV Ovarian Cancer Recurrence-Free Survival Advantage Using Vigil® Frontline for Advanced Ovarian Cancer, Especially High TGFβ Expressing Ovarian Cancer Due to the limited treatment options and the involvement of the BRCA1/2-wt population (85% of ovarian cancer patients), cytoreductive surgery in patients with ovarian cancer with stage III/IV disease and a double-blind, placebo-controlled trial of Vigil® as frontline maintenance therapy following the combination of paclitaxel and carboplatin.

1. Materials and Methods Study Design and Treatment This phase IIb double-blind study was conducted at 25 centers. It was classified as a Level 1 category in the NCCN Guidelines (Version 3.2015) and was a complete clinical response (cCR) after surgery and consolidation chemotherapy containing carboplatin and paclitaxel (5-8 cycles) Stage IIIa- It was a placebo-controlled trial of Vigil® in patients with c or IV high-grade serous, clear cell, or endometrioid ovarian cancer. Tumor tissue was obtained at the time of cytoreductive surgery. Tissues were used for vaccine formulation and histological confirmation of disease by local pathology departments. Germline and/or somatic BRCA1/2 molecular profiling was collected when available. Peripheral blood mononuclear cell samples were analyzed for germline BRCA1/2, molecular profiles (Ocean Ridge Biosciences, Deerfield Beach, Fla.). Patients who achieved cCR after primary cytoreductive surgery and platinum/taxane adjuvant chemotherapy were randomized 1:1 into the Vigil® (Vigil® arm, VG) or placebo (control arm, CG) cohorts. artificialized. Randomization was stratified by i) degree of cytoreductive surgery (complete/microscopic NED vs. macroscopic residual disease) and ii) neoadjuvant vs. adjuvant chemotherapy. Patients received intradermal injections of 1×10 ⁷ cells/Vigil® or placebo once a month (within 8 weeks after the last chemotherapy) up to 12 doses. Treatment continued until disease recurred or the patient's supply of vaccine or placebo was exhausted. A Drug Safety Monitoring Board was established prior to study initiation to maintain the safety of all study patients. No unacceptable toxic effects were judged. Informed consent was obtained prior to collection. Full IRB approval of the protocol and written informed consent were required before patients could be enrolled at any site.

Patients Women with histologically confirmed stage IIIa-c or IV high-grade papillary serous, clear cell, or endometrioid ovarian cancer were included in the trial. After completion of cytoreductive surgery and chemotherapy, no evidence of malignancy on chest X-ray (CT scan accepted) and CT scan or MRI of abdomen and pelvis, CA-125 antigen level 35 units/ml and no findings on physical examination or symptoms suggestive of active cancer were required at randomization. Acceptable chemotherapy regimens included 5 to 8 cycles of standard platinum/taxanes divided into neoadjuvant and adjuvant regimens. Subjects had to have started adjuvant chemotherapy within 8 weeks after primary cytoreductive surgery. ECOG performance status (PS) 0–1 and normal organ and bone marrow function were required for protocol adherence and were defined as protocol adherence (absolute granulocyte count ≥1,500/mm3; absolute lymphocyte count ≥500/mm3). platelets ≥ 75,000/mm3; total bilirubin ≤ 2 mg/dL; AST (SGOT)/ALT (SGPT) ≤ 2 x institutional upper limit of normal; creatinine < 1.5 mg/dL). All patients were required to be competent and willing to sign written, protocol-specific informed consent.

Tumor harvesting and manufacturing
Gradalis, Inc. (Carrollton, Tex.) manufactured Vigil® from harvested tumor tissue. Identical doses of placebo (freezing media) were prepared based on the number of vials of Vigil®. Manufacturing was a two day process. The equivalent of a "golf ball size" mass (10-30 g of tissue, cumulative) was required for vaccine production (3 cm by radiographic scan). Lesions extending into the intestinal lumen were excluded because of the risk of bacterial infection.

Manufacture of Investigational Drug and Placebo Surgically resected tumor tissue (mean = 55 g) was collected at debulking, cut into 1/4 inch sections, and 0.9% sodium chloride supplemented with gentamicin (Fresenius Kabi). (Baxter) and packaged in ice for overnight shipment to the manufacturing facility. On day 1, the sterility of the transport medium and tumor samples in each container was checked (BacT/Alert 3D Microbial Identification System, BioMerieux). Tumor tissue was trimmed to remove fat, connective/necrotic tissue, sutures/staples, mechanically dissociated with a scalpel, followed by enzymatic dissociation (type I collagenase solution) and incubation at 37°C for up to 45 minutes. to form a single cell suspension. The cell suspension was filtered through a sterile 100 um strainer (Corning) to separate the cells from cell debris and the freed cells were washed with PlasmaLyte supplemented with 1% human serum albumin (Octapharma). (Baxter) and manually counted by hemocytometer (InCyto). Quality control (QC) samples were taken to retain and monitor immunity and pre-transfection cultures were initiated to measure baseline cytokine levels with GMCSF (R&D Systems) and TGFβ1 (R&D Systems) and TGFβ2 (R&D Systems). was obtained by ELISA. The concentration of this cell suspension was adjusted to 40 million cells/mL and electroporated using a Gene Pulser XL (BioRad) to insert the plasmid DNA into the cells. The transfected cells were plated at 1×10 ⁶ cells/mL in X-VIVO 10 medium (Lonza) supplemented with gentamicin (Fresenius Kabi) in sterile T-225 cm ² flasks (Corning). and incubated overnight (14-22 hours) at 37°C with a 5% CO ₂ overlay (Sanyo) to allow the incorporation of the bi-shRNA furin and GMCSF mRNAs into the tumor cells.

On day 2, the overnight cultures were harvested by detaching the cells from each flask and the medium containing free floating cells was collected and resuspended in fresh X-VIVO medium. Cells were manually counted to ensure that a minimum of 80 million cells were available for QC samples and a minimum of 4 doses before proceeding. Two 1-mL mycoplasma samples containing cells were taken and frozen at -80°C. Cells were irradiated with 4×25 Gy cycles using RS-3400 X-rays (RadSource) to arrest replication/proliferation. Cells were washed with PlasmaLyte (Baxter) supplemented with 1% human serum albumin (Octapharma) and QC samples were taken to retain and monitor immunity and post-transfection cultures were initiated and transfected. Cytokine levels were obtained for GMCSF, TGFβ1, and TGFβ2. Cells were placed in freezing medium consisting of PlasmaLyte (Baxter) pH 7.4 with 10% DMSO (dimethyl sulfoxide; Cryoserv USP; Mylan), 1% human serum albumin (Octapharma) and 1×10 ⁷ cells/cell. mL, aseptically dispensed into sterile 2.0 mL borosilicate glass vials (Algroup Wheaton Pharmaceutical and Cosmetics Packaging); ) coated with a butyl rubber stopper. Final product vials were slowly frozen using CoolCell® freezing containers (Biocision) placed in a −80° C. freezer (Sanyo). After freezing, the cells were stored in vapor phase liquid nitrogen tanks during shipping testing. Frozen product vials were used for sterility (USP <71>) and endotoxin testing by gelation (Limulus Amoebocyte Lysate, Lonza). After the study, assay validation for (GMCSF, TGFβ1, TGFβ2) was completed. Data shown are calculated using appropriate validated parameters.

Placebo consisted of freezing medium consisting of PlasmaLyte (Baxter) pH 7.4 with 10% DMSO (dimethyl sulfoxide; Cryoserv USP; Mylan), 1% HSA (Octapharma). The medium was slowly cooled to −80° C. and frozen, after which the vials were stored in vapor phase liquid nitrogen during release testing for sterility and endotoxins only. The placebo vial product matched the dose of available product manufactured for the subjects. Study drug (Vigil® or placebo) was distributed monthly to the site by portable liquid nitrogen containers. After picking up the product, pharmacy staff at the site applied blind tape to the syringe barrel to maintain blindness and all possible visual differences between Vigil® and placebo. instructed to hide.

Disease Assessment Subjects remained on treatment until disease recurred or the subject's supply of Vigil® or placebo was exhausted. Disease relapse was performed by WorldCare Clinical (WCC) (Boston, MA) using the Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST 1.1). Two reviewers were assigned to each case, and an adjudicator when necessary. Data were passed on to a third-party statistician for analysis. Treatment group assignments were discussed between the QA department and the statistician and were blinded to the other departments. Disease recurrence is defined by RECIST 1.1 as the appearance of any measurable or assessable lesion or subclinical CA-125 level >35 U/ml on two consecutive measurements at least 1 month apart. Defined.

Endpoints and Statistical Evaluation The primary endpoint was recurrence-free survival (RFS) in the Vigil® group compared to the placebo group. Tumor assessments were performed by WorldCare Clinical (WCC) (Boston, Massachusetts) at the time of randomization (baseline) and at protocol-defined intervals until disease recurrence or death using Response Evaluation Criteria in Solid Tumors version 1.1. RECIST 1.1). Time to recurrence was calculated from 1) the date of randomization and 2) the date of cytoreductive surgery/collection to the first date of documented relapse or death. RFS was analyzed sequentially in BRCA-wt subgroups and compared between Vigil® and placebo. All patients who received at least one dose of Vigil® or placebo were included in the safety analysis. A one-sided p-value of 0.05 or less (log-rank) was considered to indicate statistical significance in the analysis. Hazard ratios for recurrence-free survival were assessed by a Cox proportional hazards model without covariates. The distribution of RFS was estimated using the Kaplan-Meier method. A chi-square test for goodness of fit was used to assess whether the number of patients who relapsed in the placebo group differed from the number of patients who relapsed in the Vigil® group. Patients in the BRCA-wt subgroup were assessed whether the number of patients who relapsed in the placebo group was significantly different compared to the number of patients who relapsed in the Vigil® group.

2. result patient
From February 2015 to March 2017, 310 ovarian cancer patients consented at 22 centers and had their tissue harvested to manufacture Vigil®. 128 patients were considered ineligible because of pathology or screening dropout parameters (ie, staging). Of the remaining 181 who completed manufacturing, 92 subjects (56%) were successfully manufactured and randomized, 17 opted for other treatment options, and 72 met product release criteria. no match (65 had insufficient cells). One patient withdrew after randomization but before treatment due to individual reasons of good health. This patient was not included in the analysis. Ninety-one subjects were analyzed for safety and response, with 46 patients randomized to Vigil® and 45 patients randomized to placebo. Fifty-five re-worsening events were observed by August 2019 by an independent third-party radiological review (WCC). Demographics are shown in Table 7. No significant differences were detected between the cohorts, with the exception of 21/46, or 45.7% Vigil® patients, who had lower performance status scores (ECOG 1) had (p = 0.0093).

Safety A median of 6 injections of Vigil® (range 1-12) or 6 injections of placebo (range 3-12) was administered per patient. No treatment delays or withdrawals were reported because of treatment-related toxic effects. One patient in the Vigil® group experienced Grade 3 drug-related toxic effects (nausea and vomiting) and two patients in the placebo group experienced Grade 3-related toxicities (1 bone pain, overall experienced muscle weakness, dyspnea, and fainting, while others had joint pain). More grade 2, 3 adverse events were observed in the placebo group compared to Vigil® (18% vs. 8%). 14 serious adverse events (SAEs) were reported in 7 patients (4 placebo, 3 Vigil®). In 2, the SAE was probably related (1 placebo/1 Vigil®). Otherwise, SAE events were likely or unrelated to study treatment.

Product shipping result
Eighty-four (92%) subjects met all product release criteria. The median mass of tumors harvested was 52 grams (range 8-137 grams). Seven of 91 (8%) did not show a significant increase in GMCSF expression after plasmid transfer. However, 6 of these 7 patients showed robust TGFβ1 knockdown. Additional product shipment results are shown in Table 8. Although TGFβ1 knockdown outcome was inconclusive in 7 patients (6 had sufficient GMCSF expression), 66 (73%) patients had >90% TGFβ1 knockdown and furin bi-shRNAi knockdown. Demonstrates robust down-related activity. Median TGFβ1 expression of 166 pg/10 ⁶ cells (mean 241, range 52-882) with detectable levels of baseline TGFβ1 production in all patients prior to plasmid transfection It became clear. BRCA1/2-wt TGFβ1 expression was found to be median 212 (mean 255, range 71-662) pg/10 ⁶ cells in both groups and BRCA1/2-mu TGFβ1 expression was median A value of 122 (mean 231, range 52-882) pg/10 ⁶ cells was found. (Table 9)

Effectiveness
Of the 91 evaluable patients, 62 patients had BRCA1/2 molecular profiles on local site analysis. A subgroup of BRCA1/2-wt patients showed an advantage in RFS in the Vigil® cohort compared to the placebo cohort. Results are shown in Figures 10A-10B. Median RFS, calculated from the time of surgery/harvest, was not reached in BRCA-wt ovarian patients in the Vigil cohort compared to 14.8 months in the placebo cohort (HR = 0.49, 90% CI, 0.25–0.97, one-sided p = 0.038). Similarly, when RFS was calculated from the time of randomization, the median RFS in the BRCA-wt subgroup was 8.0 months in the placebo group compared with 19.4 months in the Vigil® group (HR = 0.51, 90% CI, 0.26–1.01, one-sided p = 0.050). Thirty-eight percent of Vigil-treated BRCA1/2-wt patients had recurrent disease compared with 71% of placebo BRCA1/2-wt patients (chi-squared 0 = 0.021) ( Figure 11A). Sixty-two percent of Vigil® patients are BRCA-wt and have remained relapse-free to date (October 31, 2019).

RFS calculated from the time of cytoreductive surgery and the time of randomization regardless of BRCA1/2 status are shown in Figures 10C-10D. The median RFS calculated from the time of randomization was 13.67 months (416 days) in the Vigil cohort compared to 8.38 months (255 days) in the placebo cohort (HR = 0.69, one-sided log-rank p = -.054). RFS calculated from the time of cytoreductive surgery improved to a HR of 0.64 (one-sided p = 0.054). Relapse was reported in 73% of placebo patients compared to 48% of Vigil®-treated patients (chi-square p=0.013) (FIG. 11B). Other factors associated with trends in benefit for Vigil® response were younger age <65 years (p 0.057), late stage IIIb-IV (p 0.075), and microscopic residual disease (<10 mm)/no evidence of disease (p = 0.066) (Figure 12).

3. consideration
BRCA1/2-wt patients demonstrated a significant (calculated from the time of cytoreductive surgery) RFS advantage with Vigil over placebo (not reached vs. 14.8 months; HR = 0.49, one-sided p = 0.038). ), and less relapses occurred after treatment (38% vs. 71%, p=0.021). These results supported Vigil® being considered maintenance in BRCA1/2-wt ovarian cancer patients after complete cytoreductive surgery and adjuvant or neoadjuvant chemotherapy. Safety analyzes demonstrated no evidence of toxic effects of Vigil® over placebo.

A growing body of evidence suggests that GMCSF is involved in increasing tumor antigen presentation by dendritic cells (DCs). GMCSF has been shown to induce a subset of CDs that are highly phagocytic of apoptotic tumor cells. GMCSF induces higher levels of co-stimulatory molecules, which are characteristic of greater functional maturation and more efficient T cell stimulation, thereby expanding the arsenal of lymphocyte effector mechanisms it induces. do. GMCSF also facilitates the presentation of lipid antigens by dendritic cells, which in turn are a population of lymphocytes that may be important in the therapy of intrinsic and therapeutic responses to tumors, natural killer T cells (NKT cells). ). Dendritic cells initiate antigen-specific immune responses and express various receptors that enable recognition and capture of antigens in peripheral tissues such as the dermis. Dendritic cells efficiently process this material into MHC class I and II presentation pathways, upregulate costimulatory molecules upon maturation, and translocate to secondary lymphoid tissues, where dendritic cells Presents antigen to T cells. Vigil® GMCSF protein is upregulated with a robust mean/median of 1806/826 pg/10 ⁶ cells. In 84 of 91 (91%) patients produced, this was associated only with GMCSF plasmid transfer.

It has also been previously shown that ovarian malignant cell expression of TGFβ is much higher in malignant ovarian cancer tissues than in non-malignant ovarian cancer tissues. A gene expression meta-analysis performed in more than 1500 OvC patients identified high-risk and low-risk groups based on the expression of several genes, and the results were validated by IHC or qRT-PCR. Pathway analysis of gene signatures showed enrichment of TGFβ in patients with poor prognosis. TGFβ signals are channeled through binding to the serine/threonine kinase receptors TGFβRI and II, leading to phosphorylation and activation of the intracellular effectors Smad2 and Smad3. Smad2/3 forms a transcriptional complex with Smad4, translocates to the nucleus, and regulates gene expression of TGFβ-regulated genes. TGFβ is involved in the progression of noninvasive serous ovarian tumors to aggressive serous ovarian tumors. TGFβ can be activated by Smad-dependent and Smad-independent pathways and is thought to promote tumor metastasis in ovarian cancer. A correlation between TGFβ overexpression and tumor cell proliferation and metastasis has also been described in prostate, colon, and renal cell cancers.

TGFβ secreted by ovarian cancer cells induces proliferation of immunosuppressive Treg cells (CD4+CD25+) in the tumor microenvironment. It has been shown to be associated with poor outcomes in patients with high-grade serous ovarian cancer treated with frontline cytoreductive surgery/chemotherapy. TGFβ inhibits GMCSF-induced maturation of bone marrow-derived dendritic cells (DCs) as well as the expression of MHC class II and co-stimulatory molecules. TGFβ inhibits activated macrophages, including their antigen-presenting functions, and PD-L1 ligand expression by ovarian cancer and tumor-associated myeloid cells, which is further associated with poor overall survival and are also connected). Evidence demonstrates that modulation of relevant anti-tumor immunity can restore TGFβ-associated immune surveillance.

TGFβ1 has also been shown to downregulate the miR181/BRCA1 axis, thereby modulating DNA repair defects and inducing 'BRCA-likeness' in breast cancers with wild-type BRCA genes. The term 'BRCAlikeness' has been used to identify sporadic tumors with clinicopathologic and molecular features similar to tumors associated with BRCA1/2 germline mutations (reduced DNA repair). . In addition, it has been demonstrated that increased TGFβ signaling in low HRD tumors induces NF-kB activation and induces anti-tumor immune responses in lymphocytes. Therefore, in addition to BRCA molecular signals, homologous recombination repair defect (HRD) scores may also be involved in predicting outcome and response to TGFβ-modulating immunotherapy.

The improved RFS results in the BRCA-wt population in this trial further support a relationship between TGFβ suppression and immune responsiveness, whereby BRCA-wt patients and possibly other histologic types with high TGFβ expression would support the use of Vigil® in other cancer subpopulations such as prostate cancer, renal cell carcinoma, and colorectal cancer. High levels of furin mRNA and furin protein are also widely expressed in ovarian cancer and in many other human tumors where the gene expression differs between malignant (high) and non-malignant (low) cell populations. . Expression of the TGFβ1 and TGFβ2 converting enzyme furin appears to be inversely correlated with survival and likely contributes significantly to the maintenance of tumor-directed TGFβ-mediated peripheral immune tolerance. Downregulation of furin using the bi-shRNAi method induced a marked downregulation of TGFβ1, as verified in this study. Remarkably, 73% of the Vigil® vaccines constructed had >90% TGFβ1 knockdown compared to untransfected tumor cells from the same patient.

BRCA-wt and low HRD ovarian cancers also have elevated percentages of tumor-infiltrating lymphocytes (TILs) in the tumor microenvironment, high PD-L1 expression, high type 1 IFN gamma signaling activity in mononuclear cells, and high perforin-1 expression, which is generally thought to indicate an improved immune response. However, several attempts to enhance both frontline and relapsed/refractory ovarian responses to checkpoint inhibitor therapy have failed. Hypothetically, this may also be related to a high TGFβ-suppressive effect within the local tumor microenvironment, as previously described.

In addition to blocking the catalytic action of PARP proteins on the DNA surface, PARP inhibitors bind to and capture this protein. This leads to numerous double-stranded DNA breaks and ultimately cell death. Lynparza® (olaparib) was one of the first PARP inhibitors approved for patients with high-grade serous ovarian cancer with germline BRCA mutations. A previous study showed an increase in progression-free survival in BRCA1/2-mu ovarian cancer (HR 0.3, p<0.0001). A recent long-term follow-up of olaparib in patients with platinum-sensitive recurrent ovarian cancer (study 19) showed favorable OS results, with an HR of 0.73 in all patients enrolled (p=0.0138), but activity was BRCA- Appeared to be restricted to the mu population with an HR of 0.62 (p = 0.02140), in contrast to the BRCA-wt population, which showed no benefit with a HR of 0.84 (p = 0.34) in the BRCA-wt population. There is (82). However, some BRCA-wt patients with relapsed or refractory disease with homologous recombination repair defects (HRD) may benefit from PARP inhibitors. Recent reports indicate that some high HRD tumors are associated with better responses to niraparib. Moreover, recent studies have shown that BRCA-wt and low HRD tumors have elevated immunogenic signals, including increased amounts of TILs, suggesting that IFN-gamma signaling It proves a lot. This is consistent with what was observed with Vigil® benefit on RFS being most significantly documented in the BRCA-wt population. It is justified to consider further clinical trials of the PARP inhibitor Vigil® in BRCA-wt ovarian cancer.

Although bevacizumab is the recommended maintenance therapy for frontline-treated ovarian cancer, no evidence of a recurrence-free survival or overall survival advantage involving bevacizumab alone as maintenance has been observed. Vascular endothelial growth factor (VEGF) inhibitors (ie, bevacizumab) target the pleomorphic growth factor VEGF, which is a key regulator of tumor angiogenesis as well as suppressing the immune system. The hypoxic tumor microenvironment is a pro-angiogenic factor that binds the receptor tyrosine kinases VEGF receptors (VEGFR)-1 (FLT1) and -2 (FLK1/KDR) and the VEGFR co-receptors neuropilins (NRP) 1 and 2 Promotes secretion of VEGF-A (known as VEGF). This pro-angiogenic switch in the tumor microenvironment not only promotes tumor angiogenesis, tumor maturation, and metastatic dissemination, but also inhibits dendritic cell (DC) maturation, promotes regulatory T-cell function and tumor-associated macrophage development. It also exerts immunosuppressive effects such as enhancement of cytotoxicity and accumulation of myeloid-derived suppressor cells. PD-1 expression on the surface of CD8+ T cells is also increased. VEGF-A and its receptors VEGFR1, VEGFR2, and NRP1 are commonly upregulated in ovarian cancer.

However, the clinical efficacy of bevacizumab in ovarian cancer is limited not only by its relationship to a limited clinical response and moderate toxicity profile, but also by the relatively rapid development of anticancer resistance after initiation of angiogenesis inhibition. From activation, challenges remain to be faced. However, a possible direction is being explored in the use of anti-angiogenic agents, which is the enhancement of immunotherapeutic activity. Combining bevacizumab with a therapeutic vaccine could potentially induce an infiltrating T lymphocyte response, shifting the immunosuppressive balance from T-regulated suppression to CD8 T-cell activation, leading to a T cell-infiltrating tumor microenvironment (" There is evidence that it creates a "hot tumor") that will be more immunologically responsive to immunotherapy.

In conclusion, Vigil demonstrated compelling RFS benefits and low toxic effects as single-agent maintenance therapy in patients with frontline ovarian (stage III/IV) cancer with a BRCA1/2-wt molecular profile bottom. Further investigation as a single agent and in combination with angiogenesis inhibitors, PARP inhibitors and checkpoint inhibitors is warranted.

Example 4 - Homologous Recombination Proficiency (HRP) Ovarian Cancer: One Option in the Search for Efficient Maintenance Therapy Gemogenovatucel-T (Vigil®)
A recent meta-analysis of ovarian cancer patients (Xu et al., Oncotarget, 8(1):285-302, 2017) showed that the resulting inefficient repair mechanism in BRCA-mutated (-m) tumors was associated with BRCA wild-type Confirmed to predict improved response rate to platinum chemotherapy compared to (-wt) tumors. Counterintuitively, genetic instability as a result of germline mutations in BRCA and other homologous recombination (HR) genes significantly increases the likelihood of developing ovarian cancer. However, patients with HR repair defect (HRD) cancers (both BRCA-m and HR-m) also show improved survival. This is attributed not only to an impaired ability to repair chemotherapy-induced DNA damage, but also to disruption of BRCA-regulated autophagy, which subsequently contributes to cancer stem cell maintenance and drug resistance. It is also due to its effect. Therapeutic application of PARP inhibition (PARP-i) exploits the synthetic lethality predicted by network biomolecular analysis in HRD cancer and represents an important positive shift in ovarian cancer therapy. Despite its significant contribution to the therapeutic paradigm, PARP-i selectively benefits patients with HRD cancers, with lesser survival benefits in patients with HR-proficient (HRP) ovarian cancers (Gonzalez- Martin et al., New England Journal of Medicine, 381(25):2391-2402, 2019). Problematically, up to 65% of patients show grade 3/4 adverse events because PARP inhibitors induce moderate toxicity and narrow the therapeutic index for long-term maintenance therapy with some agents . In addition, drug reduction rates of 71% and drug discontinuation rates of 12% have been observed, making the toxicity:benefit ratio therapeutic index more unfavorable, especially for patients with HRP tumors (Gonzalez-Martin et al. ., N Engl J Med, 381(25):2391-2402, 2019). As a consequence, HRP tumors remain a subset of ovarian cancer with poor efficacy of first-line treatment and maintenance on survival.

Bevacizumab also demonstrated statistically improved progression-free survival in patients with ovarian cancer with recurrent disease and newly diagnosed patients with resectable stage III/IV disease as consolidation and maintenance after cytoreductive surgery Long-term follow-up failed to demonstrate an OS benefit, although demonstrated to show survival time (PFS). Interestingly, regarding the limited recognition of the relationship between HRD and HRP and bevacizumab activity, in the GOG-0218 trial (NCT00262847), the BRCA-wt/HRP ovarian cancer cohort received bevacizumab in both consolidation and maintenance. Limited efficacy with bevacizumab, including in BRCA-wt/HRP ovarian cancer, by demonstrating almost 20 months shorter survival compared to BRCA-wt/HRD cohorts with or without is also supported (Tewari et al., J Clin Oncol, 37(26):2317-2328, 2019).

We previously described the use of a novel autologous tumor cell vaccine, Gemogenovatucel-T (Vigil®), composed of tissue harvested during cytoreductive surgery, as maintenance in newly diagnosed ovarian cancer. (Oh et al., Gynecol Oncol, 143(3):504-510, 2016). Vigil® incorporates a polygenic plasmid encoding the human immunostimulatory GMCSF gene and a bifunctional short hairpin RNA construct, the proprotein convertase furin and its downstream targets. specifically knocks out TGFβ1 and TGFβ2 (Maples et al., BioProcessing Journal, 8:4-14, 2010; Senzer et al., Mol Ther, 20(3):679-86, 2012; and Senzer et al. , Journal of Vaccines & Vaccination, 4(8):209, 2013). Vigil® is designed to enhance the expression of cancer-associated neoantigens through MHC-II upregulation and dendritic cell processing, thereby increasing afferent immune responses and promoting systemic anti-tumor immune responses. give rise to

In a Phase 2, randomized, double-blind, placebo-controlled maintenance trial involving 25 centers, Vigil further demonstrated a favorable therapeutic index, with no significant grade 3/4 therapy-related adverse effects No events were recorded (Rocconi et al., Lancet Oncology, 2020). All patients receiving Vigil® were judged to have a statistically non-significant improvement in the primary endpoint of recurrence-free survival (RFS) compared to placebo; 11.5 and 8.4 months, respectively ( n = 91, HR = 0.688, 90% CI 0.443 to 1.068; p = 0.078). However, a prospective secondary endpoint, preplanned measurement of RFS in BRCA-wt patients, revealed a hypothetical improvement with RFS of 12.7 vs. 8.0 months (n = 67, HR = 0.514; 90% CI 0.3-0.88; p=0.020). In addition, in a planned subset analysis of BRCA-wt patients, the median overall survival (OS) was not reached, compared with 41.4 months with placebo (n = 67, HR = 0.493; CI 0.24–1.009; p=0.049). Furthermore, among 27 placebo BRCA-wt patients, only 21 (52%) of BRCA-wt patients showed recurrent disease after Vigil at the time of analysis. 20 (78%) (p = 0.021, Fisher's exact probability). The 2-year RFS rate from randomization was observed with Vigil® (33%) and placebo (14%) (p=0.045, one-tailed Z-test), Vigil® compared with placebo (67%) ) (90%) 2-year OS advantage (p=0.020, one-tailed Z-test) was also demonstrated.

Because the enhanced immune response to Vigil immunotherapy in the BRCA-wt population is associated with the limited benefit of standard therapy in the HRP population, we enrolled in a recently published phase 2 trial. determined the homologous recombination status (HRD and HRP) of all patients treated with pneumonia (Rocconi et al., Lancet Oncology, 2020). In this study, to determine the effect of Vigil on the HRP population, Vigil and placebo were combined with cytoreductive surgery and adjuvant treatment with platinum-based chemotherapy to resectable stage. It was evaluated as maintenance therapy in newly diagnosed ovarian cancer patients with III/IV disease.

Recently, Vigil® improved progression-free survival and overall survival in a pre-planned subgroup analysis in patients with stage III/IV newly diagnosed ovarian cancer with a BRCA wild-type molecular profile showed significant clinical benefit with Here, we analyze the homologous recombination status of patients enrolled in the Phase 2b VITAL study and demonstrate the clinical benefit of Vigil® in HRP patients.

1. Method
1.1 Patient population and study design
Vigil® plasmid construction, cGMP production, tissue processing, and transfection were performed as previously described (Maples et al., BioProcessing Journal, 8:4-14, 2010; Senzer et al. , Mol Ther, 20(3):679-86, 2012; and Oh et al., Gynecologic Oncology, 143(3):504-510, 2016). The VITAL study was a randomized, phase 2b, double-blind, placebo-controlled trial. The patient population and study design have been published previously (Rocconi et al., Lancet Oncology, 2020). Briefly, patients had a complete response after surgical debulking and 5–8 cycles of chemotherapy for stage III/IV high-grade serous, endometrioid, or clear cell ovarian cancer . Patients were required to have an Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1 and adequate organ and bone marrow function at the time of study entry. Patients received monthly injections of 1×10 ⁷ cells/Vigil® or placebo for a minimum of 4 doses and a maximum of 12 doses. Treatment was continued until the product was exhausted or disease progressed. Adverse events were recorded after the first dose of treatment and continued for 30 days after the last treatment. Disease recurrence was assessed by a blinded independent reviewer and defined as any measurable lesion on two consecutive measurements or an elevated CA-125 level above 35 U/mL.

1.2 HRP analysis
BRCA1/2 mutation status was determined as previously described (Rocconi et al., Lancet Oncology, 2020). Patients identified as BRCA1/2 wild-type were sent for homologous recombination repair defect testing using MyChoice® CDx (Myriad, Inc, Salt Lake City, Utah). A score of 42 or greater per assay guideline was used to identify patients with HRD and >42 with HRP.

1.3 Statistical analysis
The primary endpoint of the VITAL study was recurrence-free survival from the time of randomization. Post hoc analyzes of recurrence-free survival and overall survival between Vigil ® and placebo in HRP patients were performed by Kaplan-Meier analysis. Hazard ratios and confidence intervals were calculated using 90% CIs and p-values were one-sided. Stratification factors included residual disease and chemotherapy schedule. A bounded mean survival time difference (RMST) analysis was performed as a sensitivity analysis with a censoring point equal to the minimum of the longest follow-up time for each group and without adjustment for covariates.

2. result
2.1 Baseline Characteristics and Demographics In this evaluation, 67 patients with BRCA-wt tumors (60% of patients in the Vigil® group and 40% in the placebo group) underwent HRD analysis. From HR analysis of tumor tissue, 62.5% (n = 25) in the Vigil group and 74.1% (n = 20) in the placebo group were determined by the assay [threshold <42 (Myriad MyChoice ))] was found to have an HRP tumor. Patient demographics are listed in Table 10. Demographics revealed that more patients with poor performance status scores (ECOG of 1) were randomized to receive Vigil®.

2.2 Safety Adverse events for each treatment group are shown in Table 11. No patients with grade 3 or higher adverse events were reported in the Vigil® arm. There were no treatment-related deaths, no patients withdrew from the study due to adverse events, and no dose changes occurred. Patients received an average of 7.12 doses of Vigil® (range 1.00-12.00) compared to 6.90 (range 3.00-12.00) doses of placebo.

2.3 Endpoint Analysis Kaplan-Meier analysis revealed RFS HR = 0.386 (90% CI 0.199 to 0.750), p = 0.007 and OS HR = 0.342 (90% CI 0.141) from randomization in the HRP Vigil® treatment subset. ∼0.832), both showed favorable improvement with p = 0.019 (Figures 22 and 24). Further assessment of OS and RFS using the RMST, which provides a surrogate assessment comparing exposures over a specified time period, unlike the hazard proportionality, which varies over time and compares relative risk based on the number of events, also includes RFS (p = 0.017) and OS (p = 0.008) in favor of Vigil® over placebo (Figures 25 and 26).

3. Results The relationship of BRCA-wt expression to BRCA-m in malignant tissues (Morand et la., JNCI Cancer Spectrum, 2020) suggests that more clonal neoantigens (McGranahan et al., Science, 351(6280): 1463-9, 2016) expression and therefore more appropriate neoantigen targeting of induced immune effector responses characterized by a tumor microenvironment that is 'hot' with respect to Vigil induced immune activation. may be identified (Kraya, AA, et al. Clin Cancer Res, 25(14):4363-4374, 2019). Greater tumor mutational burden and greater median neoantigen load are observed in high-grade ovarian cancers with HRD compared with HRP, but at the lower end of the pantumor spectrum. However, high clonal neoantigen tumors associated with a 'hot' infiltrated tumor microenvironment and increased tumor infiltrating cells are associated with a high subclonal mutation rate (~40%) and greater intratumoral heterogeneity in HRD. The immunogenic effects described in are probably reduced (McGranahan et al., Science, 351(6280):1463-9, 2016). This is especially true in the setting of HRP tumors with high neoantigen/high human leukocyte antigen (HLA) expression. These HRP tumors are also enriched in effector memory T cells and enhance IFNγ responses, whereas BRCA1-mutant tumors are associated with decreased type I/II IFN responses (McGranahan et al., Science, 351 (6280):1463-9, 2016). Mechanistic evaluation of Vigil® supports increased ability to induce anti-tumor responses by circulating mononuclear cells after Vigil® treatment that correlates with clinical benefit, as assessed by ELISPOT assays ( Oh et al., Gynecol Oncol, 143(3):504-510, 2016). Moreover, circulating CD3+/CD8+ mononuclear cells were shown to be systemically upregulated after Vigil® treatment, especially in a small group of treated patients (Herron et al., Cancer Science and Research 2020). In addition, greater subclonal neoantigen expression in BRCA-m expressing cancers results in a greater proportion of the 'nest' subpopulation of malignant cells (enhanced in the BRCA-wt population). likely) may dilute the visibility of clonal neoantigens and the efficiency of immune responses that target them (McGranahan et al., Science, 351(6280):1463-9 2016). Sustained expression of increased ELISPOT activity after Vigil® has also been observed, with induced anti-tumor activity persisting for months beyond Vigil® discontinuation (Senzer et al., Journal of Vaccines & Vaccinations, 4(8):209, 2013). These results suggest induction of memory T cells (Craig et al., Vaccines (Basel), 8(4), 2020).

As previously described, the addition of PARP-i to our therapeutic opportunities in ovarian cancer had implications. However, because the molecular profiles of individual ovarian cancers are diverse, the relationships between RFS, PFS, and OS and molecular profiles are being evaluated in detail across the cancer spectrum, including ovarian cancer. Several therapeutic indications were funded based on this report and other PARP-i reports on newly diagnosed ovarian cancer treatment and second-line ovarian cancer regimens, but the majority of the benefits are seen in ovarian cancer patients with BRCA-m HRD tumors or BRCA-wt HRD tumors.

In the BRCA-wt/HRP population, compared with the BRCA-m/HRD and BRCA-wt/HRD populations, both antiangiogenic agents and PARP-i have moderate toxicity profiles and limited efficacy resulting in clinical These challenges warrant consideration of Vigil® in the HRP ovarian cancer population. PARP-i is associated with a significant proportion of grade 3/4 drug-related toxic effects, which can result in discontinuation in as many as 75% of patients (Gonzalez-Martin et al., N Engl J Med, 381(25):2391-2402, 2019). Although the toxicity profile is less for antiangiogenic agents, toxicity can be severe if not fatal, with risks of hemorrhage, hypertension, intestinal perforation, as well as venous and arterial thrombosis. Considering the recent approval of niraparib as maintenance for “all-wishers,” including patients with HRP tumors (Gonzalez-Martin et al., N Engl J Med, 381(25):2391-2402, 2019) As well as weighing both quantitative and qualitative toxicity limitations against limited benefit in the HRP population, Vigil and other potentially effective broader therapeutic index approaches, as well as other Further development of a susceptible molecular subset population of is justified.

Vigil® immunotherapy is the first randomized, proof-of-principle study of immunotherapy efficacy in HRP epithelial ovarian cancer (Rocconi et al., Lancet Oncology, 2020). The simplicity of monthly intradermal injections in addition to achieving both a delay in recurrent disease and an overall survival advantage with a broad therapeutic index are key components of optimal maintenance therapy in clinically disease-free patients. is. Investigation of Vigil® vaccine maintenance therapy in primary HRP ovarian cancer corresponds to an area of encouragement from NRG Oncology to develop and apply therapies that target this subset of ovarian cancer. Phase 3 studies of Vigil® are therefore warranted specifically in the HRP ovarian cancer population and possibly in other solid tumor populations with an HRP profile.

Example 5: Gemogenovatucel-T (Vigil®) Immunotherapy (VITAL) as Maintenance in Frontline Stage III/IV Ovarian Cancer: A Randomized, Double-Blind, Placebo-Controlled Phase 2b Study Previous Evidence We searched PubMed from 1 January 1999 to 1 March 2020 with the search term 'current standard of care' to find clinical trials, studies, and research articles published in English. looked for.

"Ovarian cancer maintenance", "PARP inhibitors", "BRCA mutation status ovarian cancer", and "Homologous recombination repair defect". Our search yielded 21,159 articles. A review of the literature reveals several studies involving poly(ADP-ribose) polymerase (PARP) inhibitors showing improved progression-free survival, although frontline ovarian therapy, including systemic maintenance therapy, has There was no recurrence-free survival or overall survival advantage in cancer. There are few options for the management of advanced frontline ovarian cancer. Delayed but persistent relapse within the first 2 years of management with either primary cytoreductive surgery followed by adjuvant chemotherapy or neoadjuvant chemotherapy followed by cytoreductive surgery occurs approximately 75% of the time. Consolidation or maintenance therapy did not show an improvement in recurrence-free survival or overall survival compared with standard management. Although several studies have shown a progression-free survival benefit in patients who are proficient in homologous recombination, the survival benefit of ARP inhibitors includes both germline and somatic BRCA mutations or homologous recombination repair defect molecular profiles. Preference is given to patients with ARP inhibition also showed little benefit on overall survival, with the greatest benefit observed in patients with BRCA mutations or homologous recombination repair defects, and a smaller benefit in patients who were proficient in homologous recombination. In addition, toxic effects associated with myelosuppression and, although rare, treatment-related leukemias limit dose administration. Five-year survival rates for patients with ovarian cancer are even lower, indicating an unmet medical need. Therefore, supported by the robust results on safety and immune response mechanisms in Phase 1 and significant evidence of benefit in Phase 2a clinical trials, we are a candidate for primary cytoreductive surgery for stage III disease. We initiated the VITAL trial to evaluate the safety and efficacy of Gemogenovatucel-T in newly diagnosed patients with /IV ovarian cancer.

Additional Value of the Study To our knowledge, the VITAL study is the first to examine the efficacy of a triple-mechanism immunomodulatory autologous tumor vaccine as a frontline maintenance treatment for ovarian cancer, and the first to benefit from immunotherapy in this population. show evidence of The results of this study demonstrate that Gemogenovatucel-T is non-toxic and treatment improves recurrence-free survival and overall survival in patients with advanced ovarian cancer who are wild-type for BRCA1 and BRCA2 (BRCA). It shows that they are connected. Most newly diagnosed patients with ovarian cancer have BRCA.

Meaning of all available evidence
Gemogenovatucel-T is a breakthrough immunotherapy platform technology with single-agent activity. Future studies of Gemogenovatucel-T are warranted in combination with checkpoint inhibitors, PARP inhibitors, and angiogenesis inhibitors.

background
Gemogenovatucel-T, an autologous tumor cell vaccine produced from harvested tumor tissue, specifically reduces furin and downstream TGF-I31 and TGF-I32 expression. The aim of this study was to determine the safety and efficacy of Gemogenovatucel-T in maintaining frontline ovarian cancer.

METHODS: This randomized, double-blind, placebo-controlled, phase 2b trial involved 25 hospitals in the United States. Stage III/IV high-grade serous, with clinical complete response and Eastern Cooperative Oncology Group status 0 or 1 after surgery and a combination of chemotherapy including carboplatin and paclitaxel for 5 to 8 cycles; Women aged 18 years or older with endometrioid or clear cell ovarian cancer were eligible for inclusion in the study. Patients were randomly assigned (1:1) to Gemogenovatucel-T or placebo by an independent third-party autoresponder system after being successfully screened with randomized block sizes of 2 and 4, and to receive surgical debulking. Stratified by degree and neoadjuvant versus adjuvant chemotherapy. Gemogenovatucel-T (1×10 ⁷ cells per injection) or placebo (once a month) was administered intradermally at a minimum of 4 and up to 12 doses. Patients, investigators, and clinical staff were blinded to patient allocation until after statistical analysis. The primary endpoint was recurrence-free survival, analyzed in the protocol-adherent population. All patients who received at least one dose of Gemogenovatucel-T were included in the safety analysis. This study is registered with ClinicalTrials NCT02346747.

Knowledge
Between February 11, 2015 and March 2, 2017, 310 patients consented to this study at 22 centers. 217 were excluded. Ninety-one patients received Gemogenovatucel-T (n=47) or placebo (n=44) and were analyzed for safety and efficacy. Median follow-up was 40.0 months (IQR 35.0 to 44.8) from the first dose of Gemogenovatucel-T and 39.8 months (35.5 to 44.6) from the first dose of placebo. Relapse-free survival was 11.5 months (95% CI 7.5 to not reached) in patients assigned to Gemogenovatucel-T compared to 8.4 months (7.9-15.5) in patients assigned to placebo (HR 0.69, 90% CI 0.44 to 1.07; one-sided p = 0.078). There were no grade 3 or 4 toxic effects with Gemogenovatucel-T. There were five grade 3 toxicity events in two patients in the placebo group, including joint pain, bone pain, general muscle weakness, syncope, and dyspnea. There were 11 serious adverse events in 7 patients (4 in the placebo group and 3 in the Gemogenovatucel-T group). No treatment-related deaths were reported in either group.

Interpretive frontline use of Gemogenovatucel-T immunotherapy as maintenance was well tolerated, but the primary endpoint was not achieved. Further investigation of Gemogenovatucel-T in patients stratified by BRCA mutation status is warranted.

Most women diagnosed with ovarian cancer are in an advanced stage. Optimal standard therapy can achieve 5-year survival rates that vary by stage, ranging from 41% (stage IIIa) to 20% (stage IV). Standard treatment for newly diagnosed ovarian cancer (stage III or IV) includes primary cytoreductive surgery followed by adjuvant chemotherapy with paclitaxel and carboplatin, or neoadjuvant chemotherapy followed by cytoreductive surgery. Most patients achieve complete remission with either approach, but about 75% will relapse within 2 years.

Several studies involving bevacizumab and poly(ADP-ribose) polymerase (PARP) inhibitors have attempted outcomes in ovarian cancer treated frontline by applying maintenance therapy after patients have achieved a complete response. have improved, but despite the benefit in progression-free survival, to our knowledge, no study has shown a significant benefit in recurrence-free survival or overall survival. In addition, moderate drug-related toxic effects of both bevacizumab and PARP inhibitors limit dosing. PARP inhibitors have provided clinicians with a new platform for frontline maintenance of ovarian cancer, but activity has been seen primarily in patients with BRCA germline and somatic mutations. PARP inhibitors are also approved for relapsed maintenance platinum sensitivity regardless of BRCA status. However, the magnitude of benefit is greatest in patients with BRCAmutated (BRCAmut) tumors or evidence of homologous recombination repair defects.

Gemogenovatucel-T is an autologous tumor cell vaccine manufactured from harvested tumor tissue containing the human granulocyte-macrophage colony-stimulating factor (GMCSF) gene, an immunostimulatory cytokine, and a bifunctional short hairpin RNA (bi-shRNA). A multigenic plasmid encoding construct has been transfected in vitro to specifically reduce expression of furin and downstream TGβ1 and TGFβ2.4. Activation of TGFβ1 and TGFβ2 is not the only function of furin. Furin cleavage activates several other proteins, including growth factors, cytokines, hormones, and receptors. However, TGF-β protein is much more expressed in malignant ovarian tissue than in non-malignant ovarian tissue. Pathway analysis of a five-gene signature showed increased TGF-β signaling in patients with poor prognosis ovarian cancer (6). TGF-β is involved in the progression of noninvasive serous ovarian tumors to aggressive serous ovarian cancer.

Furthermore, overexpression of TGF-β is associated with germline and somatic mutations in BRCA. PARP inhibitor tumor cell growth and metastasis, increasing, is also approved for recurrent platinum-sensitive tumors in patients with suboptimal tumour-debulking ovarian cancer.

In early clinical trials examining TGF-β DNA products, GMCSF DNA products, the magnitude of benefit was higher in patients with BRCA (including a phase 1 trial of Gemogenovatucel-T in mutated (BRCAmut) tumors), or relapsed or Largest in patients with evidence of refractory solid tumors, enzyme-linked immunospot assay showed safe intradermal administration to be 1 x ¹⁰⁷ cells per dose per month and against autologous tumor antigens. showed that the autologous peripheral blood mononuclear cell gamma interferon response was upregulated in response to (9-11). A recurrence-free survival benefit and a correlated treatment-related immune response were demonstrated in a phase 2a trial of Gemogenovatucel-T as frontline maintenance therapy in patients with stage III or IV resectable ovarian cancer. We initiated the VITAL study because of the limitations of frontline treatment of advanced ovarian cancer, especially in patients with BRCA wild-type (BRCA) disease. The purpose of this study was to determine the safety and efficacy of Gemogenovatucel- in maintaining frontline ovarian cancer.

Methods Study Design and Participants This phase 2b, randomized, double-blind, placebo-controlled trial involved 25 hospitals in the United States, of which 22 hospitals enrolled patients. The other three sites did not enroll patients after Institutional Review Board approval). Having stage III/IV high-grade serous, endometrioid, or clear cell ovarian cancer with a complete clinical response after surgery and a combination of chemotherapy containing carboplatin and paclitaxel for 5 to 8 cycles Women aged 18 years or older were eligible for inclusion in the study. Patients had to have an Eastern Cooperative Oncology Group (ECOG) performance status of 0 to 1 and normal organ and bone marrow function. Concurrent maintenance therapy with a PARP inhibitor or bevacizumab was not considered an adherent protocol. Patients were ineligible for study enrollment if they required a chronic steroid regimen or an immunosuppressive regimen and had congestive heart failure, unstable angina, ventricular or hemodynamically significant atrial arrhythmias, cardiovascular If you have or have a history of disease, myocardial infarction, brain metastases, HIV, chronic hepatitis B or C infection, previous solid organ or bone marrow transplantation, or active autoimmune disease. Patients with histologically confirmed papillary serous adenocarcinoma of the uterus, any disease involving the myometrium or endothelium, or brain metastases are also excluded.

Tumor harvesting for vaccine production was done during laparoscopic debulking prior to neoadjuvant therapy or during debulking surgery in patients not receiving neoadjuvant therapy. All tumor harvest procedures were performed prior to any chemotherapy.

A washout period of 3 weeks was required after chemotherapy, 4 weeks after surgery including general anesthesia, radiation therapy, immunotherapy, or investigational drug, and 14 days after immunosuppressive therapy. All patients gave written informed consent prior to tissue collection. A Drug Safety Monitoring Board (BSMB) was established prior to study initiation to maintain the safety of all district patients. No grade 3 or 4 or higher toxic effects were observed. The DSMB's recommendation was to continue the study as planned. At each site, written institutional review board and protocol ethical approval and written informed consent were required before patients could be enrolled.

Randomization and Masking Eligible study participants were randomly assigned (1:1) to receive Gemogenovatucel-T or placebo. Patients were randomized into two and four random permutation block sizes throughout the study by Clinipace (Morrisville, NC, USA) through an automated response system (Tempo system; Clinipace; Morrisville, NC, USA). assigned to act. This was performed 3-8 weeks after chemotherapy was completed. Randomization was stratified by degree of surgical cytoreduction (microscopic or macroscopic) and neoadjuvant vs. adjuvant chemotherapy. To ensure masking was maintained, the facility pharmacist had to wrap masking tape around the syringe barrels used for therapeutic administration to make the drug indistinguishable from the placebo. Study staff, investigators, and patients were all blinded to which study they were assigned to. The sponsor research team was blinded to patient treatment assignments, with the exception of quality assurance staff.

procedure
Gradalis (Carrollton, Tex., USA) produced Gemogenovatucel-T from harvested tumor tissue. Tumor harvesting for vaccine production was done before any chemotherapy. The same dose placebo was manufactured based on the number of vials of Gemogenovatucel-T. 10-30 g of tumor tissue was required for vaccine production. Lesions extending into the intestinal lumen were excluded because of the risk of bacterial infection. Placebo consisted of freezing medium and was dispensed into sterile 2.0 mL borosilicate glass vials to a final fill volume of 1.2 mL. After the medium was slowly cooled to −80° C. and frozen, the vials were stored in vapor phase liquid nitrogen during release testing for sterility and endotoxin. The placebo vial product matched the available product dose manufactured for the patient. Exceptions to protocol entry were granted on the basis of increased GMCSF expression or decreased (knockdown) TGF-β1 expression with the partial plasmid, which is sufficient evidence of plasmid transfer. Further details are shown in Table 12 below.

Patients received (within 8 weeks after the last chemotherapy) Gemogenovatucel-T at 1 x 10 cells per intradermal injection or placebo once monthly for at least 4 doses and up to 12 doses . Protocol-defined treatment was discontinued after the following events. These included unacceptable (Grade ≥3) toxic effects that the patient's physician considered to be treatment-related, Grade 3 or 4 toxic effects unrelated to treatment that did not resolve within 4 weeks, and Grade ≥3 toxic effects to study drug. Allergic reactions, grade 2 autoimmune reactions unless there is evidence of clinical benefit, grade 3 or greater autoimmune reactions, any illness that might affect the assessment of study endpoints, non-protocol therapies (chemotherapy) therapy), patient non-compliance, or patient withdrawal of consent. Criteria for dose modification included toxic effects graded or worse by the National Cancer Institute Common Toxicity Criteria, but excluded injection site reactions (grade 2 or 3) related to study treatment (at that time the dose would be reduced by 50%).

A treatment delay of up to 4 weeks was acceptable to allow recovery. Injections were given within 3 days in case of treatment delay due to other factors unrelated to the toxic event. A delay of 2 weeks was allowed if the delay was due to infection or disease symptoms.

A baseline examination consisting of differential complete blood count, C-125, and serum chemistry was performed along with CT of the chest, abdomen, and pelvis. Germline or somatic BRCA1 and BRCA2 molecular profiling data were collected for whole tissue and blood samples and centralized using next-generation sequencing (Ocean Ridge Biosciences; Deerfield Beach, Fla., USA). analyzed with

Patients were monitored for disease progression by CT of the chest, abdomen, and pelvis every 3 months for the first 3 years and at the end of treatment or upon recurrence. During follow-up, CT scans were performed every 6 months and planned for 5 years. Patients will be screened until disease progression as defined by a masked independent central reviewer (World Care Clinical; Boston, Mass., USA; using Response Evaluation Criteria in Solid Tumors version 1.1) or receiving Gemogenovatucel-T or placebo They remained on study treatment until 2000 was depleted (minimum of 4 doses based on previous clinical immune responses). All 12 laboratory assessments (complete blood differential count, C-125, and serum chemistry) were performed monthly during study enrollment. Laboratory assessments were repeated when disease recurred or treatment was terminated, and continued every 6 months thereafter during follow-up.

Adverse events were recorded after the first dose of Gemogenovatucel-T and continued for 30 days after the last study treatment. Adverse events were graded and reported using the Common Toxicity Criteria for Adverse Events version 4.03. All adverse events were recorded regardless of whether they were causally related to study treatment.

Outcomes The primary endpoint was recurrence-free survival from the time of randomization. Secondary endpoints in priority were recurrence-free survival from the time of tumor sampling in patients with BRCA disease, recurrence of BRCA disease from the time of randomization, and relapse from the time of tumor sampling for all patients. They were recurrence-free survival, overall survival from the time of randomization for all patients, and overall survival from the time of tumor tissue sampling for all patients. The time point of collection was the time of autologous tumor cell collection after surgery. Recurrence-free survival from the time of randomization or tumor tissue sampling is measured from the date of randomization or sampling to the first time patients had disease recurrence (even if they discontinued treatment because of toxic effects). Defined as the time to the date of recording, or the date of death if the subject died of any cause prior to disease recurrence. Disease recurrence was defined as the appearance of any measurable or assessable lesion or non-syndromic CA-125 levels >35 U/ml on two consecutive measurements at least 1 month apart . Overall survival was defined as the time from the date of randomization or tumor tissue sampling to the date of death.

Statistical analysis
Based on sample size calculations, 54 relapse-free survival events were required for 90% efficacy, an estimated true hazard ratio (HR) of 0.45, and a unilateral alpha level of 0.05 . After analyzing the primary endpoints, secondary endpoints will be examined using a hierarchical testing approach in the order listed in the statistical analysis plan. This method was utilized for multiplicity control. The primary efficacy analysis was based on a protocol adherent population, in which at least 80% of study visitors were randomly assigned to receive one or more doses of their assigned study treatment included patients who had no major protocol deviations. All patients who received at least one dose of Gemogenovatucel-T or placebo were included in the safety analysis. As a sensitivity analysis, we also analyzed recurrence-free survival from randomization and overall survival in the intention-to-treat population (92 patients in total randomly assigned). Distributions of recurrence-free survival and overall survival were estimated using the Kaplan-Meier method and compared using the stratified log-rank test. A one-sided p-value of 0.05 or less (stratified log-rank test stratified by the randomization stratification factor of residual disease and chemotherapy schedule) was considered to indicate significance. 90% CIs are shown for comparing treatment effects and 95% CIs for individual statistics. HR was assessed by a stratified Cox proportional hazards model with randomized stratification factors. A Grambsch and Therneau test was performed at the two-sided 0.05 significance level to check proportional hazards estimates for stratified Cox models.

Additional exploratory post hoc analyzes of recurrence-free survival and overall survival at 1 and 2 years were estimated with the Kaplan-Meier method and compared using the asymptotic Z-test, with the Greenwood method for the variance of the proportion differences. was estimated as A marginal mean survival difference was calculated as a sensitivity analysis (censoring equal to the minimum of the longest follow-up for either study arm). Within-boundary mean survival differences were calculated without adjustment for covariates. Recurrence-free survival and overall survival from randomization or tumor sampling in patients with germline and somatic BRCA1 or BRCA2 mutations and those with BRCA (non-mutated group) It was a group analysis. The reason for including both survival endpoints was to more accurately reflect previous maintenance trials that included both arms with and without maintenance therapy. The proportion of patients with relapsed disease was analyzed by Fisher's exact t-test. Forest plots were constructed for planned subgroup analyzes for all patients and those with BRCA disease (age, disease stage, ECOG performance status, timing of chemotherapy, residual disease status, BRCA mutation status, TGF-β1 (% knockdown), granulocyte-macrophage colony-stimulating factor expression, survival rate, and number of vaccines manufactured). P interactions were calculated to assess effect modification between BRCA subgroups. To assess the effects of changes across BRCA subgroups on recurrence-free survival, a post hoc analysis of the p-value of the interaction term between BRCA status and treatment was performed by including the interaction term in the Cox proportional hazards model. .

All statistical analyzes planned before blinding were performed independently (Stat Beyond Consulting, Irvine, CA, USA). All statistical analyzes were done with R version 4.0.0. This study is registered with ClinicalTrials.gov, NCT02346747.

result
Between February 11, 2015 and March 2, 2017, 310 patients consented to this study at 22 centers, from which 309 samples were manufactured. 217 were excluded (Figure 34). Ninety-one patients received Gemogenovatucel-T (n=47) or placebo (n=44) and were analyzed for safety and efficacy. Sixty-seven patients had BRCA and 24 had BRCAmut (Appendix page 16). Patient baseline characteristics are shown in Table 13.

Eighty-four of the 91 patients (92%) met all product release criteria. The median mass of tumors harvested was 50 g (IQR 31-75). Median product release survival was 88% (IQR 83–90; assessed in 91 patients). Seven of 91 patients (8%) (5 patients assigned to Gemogenovatucel-T and 2 patients assigned to placebo) had GMCSF expression in ¹⁰⁶ cells after plasmid transfer did not show an increase greater than 30 pg/mL per dose. However, 6 of these 7 patients (86%) had sufficient TGF-β1 knockdown of at least 30%. Median evaluable GMCSF production was 860 pg/mL per 10 ⁶ cells (IQR 254–2506, 84 patients; 7 patients were below threshold) and evaluable TGF-β1 The median was 100% (100-100, 84 patients; Table 12). The outcome of TGF-β1 knockdown could not be determined in 7 patients (6 with sufficient GMCSF expression; 4 patients assigned to Gemogenovatucel-T and 3 to placebo). Seventy-eight (86%) of the 91 patients had at least 80% TGF-β1 knockdown. Since TGF-β1 signaling is downstream of furin expression, these results support robust activity associated with furin bi-shRNA knockdown. Baseline TGF-β1 production before plasmid transfection showed a median TGF-β1 expression of 164 pg per 10 ⁶ cells (IQR 119-336; mean 241 [SD 162]). BRCA1 and BRCA2 wild-type (BRCA) patients showed a median TGF-β1 expression of 164 pg/10 ⁶ cells (IQR 125–350; mean 249 [154]). Patients with BRCA1 or BRCA2 mutations (BRCAmut) had a median TGF-β1 expression of 146 pg/10 ⁶ cells (IQR 115–267; mean 219 [183]).

Median follow-up was 40.0 months from first dose of Gemogenovatucel-T (IQR 35.0 to 44.8) and 39.8 months from first dose of placebo (35.5 to 44.6). The median time from surgery to random assignment was 7.0 months (IQR 6.5-7.4) for patients in the Gemogenovatucel-T group and 6.7 months (5.9-7.1) for patients in the placebo group. The median time from the end of previous chemotherapy treatment to the start of treatment was 1.6 months (IQR 1.4-1.8) for patients in the Gemogenovatucel-T group and 1.5 months (1.2-1.9) for patients in the placebo group . By January 21, 2020, 59 recurrent events were observed in the study by independent third-party radiographic assessment. Relapse-free survival calculated from the time of randomization for patients assigned to Gemogenovatucel-T compared to patients assigned to placebo was 11.5 months (95% CI 7.5 to not reached) vs. 8.4 months (7.9 to 15.5). HR 0.69, 90% CI 0.44 to 1.07; one-sided p = 0.078; Figure 2A). There were recurrent events in 26 patients in the Gemogenovatucel-T group and 33 patients in the placebo group.

Proportional hazards estimates were met based on the Grambsch and Thernau test. At the time of efficacy evaluation, 33 of 44 patients (75%) had relapsed disease in the placebo group compared with 26 of 47 patients in the Gemogenovatucel-T group ( 55%). In a post hoc test, the 1-year recurrence-free survival from the time of randomization was 49% (95% CI 36-68) for patients in the Gemogenovatucel-T group compared to 39% for patients in the placebo group (27-58) (p=0.18). In a post hoc test, the 2-year recurrence-free survival from the time of randomization was 32% (95% CI 19-53) for patients in the Gemogenovatucel-T group compared to 25% for patients in the placebo group (15-44) (p=0.26).

Recurrence-free survival from the time of tissue sampling in all patients was longer in patients receiving Gemogenovatucel-T than in those receiving placebo (Fig. 35B).

The secondary endpoint of recurrence-free survival calculated from the time of tissue sampling in patients with BRCA disease was significantly longer in patients receiving Gemogenovatucel-T than in those receiving placebo (Figure 35D). . Twenty-one of the 40 patients with BRCA disease in the Gemogenovatucel-T group (52%) at the time of efficacy 21 (78%) of the 27 patients with In a post hoc analysis, the 1-year recurrence-free survival from the time of surgery or tissue sampling was 81% (95% CI 69-95) for patients with BRCA disease in the Gemogenovatucel-T arm, compared with 63% (47-84) of patients with BRCA disease in the placebo group (p=0.056). The 2-year recurrence-free survival from the time of surgery or tissue sampling in patients with BRCA disease was 42% (95% CI 28-64) for patients in the Gemogenovatucel-T group compared with placebo patients was 24% (11–49) in the (p = 0.073). Recurrence-free survival from randomization in patients with BRCA disease was significantly longer in those who received Gemogenovatucel-T than in those who received placebo (out of 40 patients in the Gemogenovatucel-T group Twenty-one of the 27 patients [78%] in the placebo group had a recurrence-free survival event compared to 21 [52%] in the placebo group; FIG. 35C). or patients with BRCA disease, in a post hoc analysis, the 1-year recurrence-free survival from randomization was 51% (95% CI 36 to 71) for patients in the Gemogenovatucel-T arm, compared with 28% (15-53) of patients in the placebo group (p=0.036). In a post hoc analysis, the 2-year recurrence-free survival from randomization in patients with BRCA disease was 33% (95% CI 20 to 57) for patients in the Gemogenovatucel-T arm compared with placebo. 14% (5-39) of patients in the group (p=0.048).

Recurrence-free survival from the time of randomization and the time of surgery or tissue sampling in patients with post hoc BRCA1 or BRCA2 mutation disease are shown in Figures 41A and 41B. A preplanned intention-to-treat analysis calculated from the time of random assignment and the time of surgery or tissue collection showed similar results to the per protocol analysis (FIGS. 37A-37D).

Overall survival from the time of randomization or time of collection was not significantly longer with Gemogenovatucel-T than with placebo (FIGS. 35E, 35F). Thirteen of 47 patients (28%) died in the Gemogenovatucel-T group compared with 17 of 44 patients (39%) in the placebo group. An intention-to-treat analysis of overall survival calculated from the time of randomization and the time of surgery or tissue collection showed similar results to the protocol adherence analysis. All proportional hazards estimates in the secondary endpoint analyzes were met based on the Grambsch and Thernau test.

We compared overall survival from randomization (median overall survival not reached, 95% CI 35.6 to not HR 0.49, 90% CI 0.24 to 1.01; p = 0.049) and overall duration from the time of tissue sampling (median overall survival to 48.3 months, 32.3 to not reached vs. 95% 41.6 to not reached; 0.49, 0.24 to 1.00; p=0.047). Post-hoc testing showed that the 1-year overall survival from randomization was 100% (95% CI 100–100) in patients with BRCA disease in the Gemogenovatucel-T group compared with BRCA in the placebo group. 89% (78-100) in those with disease (p=0.033). In a post hoc test, the 2-year overall survival from the time of random assignment was 90% (95% CI 79–100) for patients with BRCA disease in the Gemogenovatucel-T group compared with 67% (51-89) in those with BRCA disease (p=0.021). In patients with BRCAmut disease, no difference in overall survival was observed between patients in the Gemogenovatucel-T and placebo groups (Figures 40A-40D). The p- _interaction value between patient's BRCA status and treatment to assess the change in effect between BRCA subgroups was 0.173 for recurrence-free survival from the time of randomization; The overall survival from the time point was 0.072 and the OS from the time of tissue sampling was 0.090. Baseline demographics (including pre-identified stratification factors and product release criteria) for disease response (planned subanalysis) were relapse-free from the time of randomization in patients with BRCA disease and in all patients Survival (Figures 36A-36B) and overall survival from the time of randomization (Figures 38 and 39) are shown.

The marginal mean survival difference between patients with BRCA ^WT disease in the Gemogenovatucel-T and placebo groups was 7.2 months relapse-free survival from the time of randomization (90% CI 0.8-13.5; p=0.032) , the total duration from the time of random assignment was 5.6 months (0.2-11.5; p=0.057). A cut-point equal to the minimum of the longest follow-up time in either study group was used in the within bounds mean survival analysis.

A median of 6 (range 1-12, IQR 5-10) Gemogenovatucel-T injections or 6 (3-12, 6-9) placebo injections were administered per patient. One patient treatment delay was recorded in the placebo group, probably due to an study drug-related pelvic infection. During the trial, there were 2 disease-related deaths in the Gemogenovatucel-T group compared with 8 deaths in the placebo group, and no treatment-related deaths in either group. No patients were excluded from the study as no adverse events or dose modifications were reported. No major protocol deviations affecting patient safety were reported.

The number of adverse events by grade in each treatment group is reported in Table 14. Grade 3 treatment-related toxicity in 2 patients in the placebo group (arthralgia in 1 patient, bone pain in 1 patient, general muscle weakness, syncope, and dyspnea [these were serious adverse events]. There was]). No grade 3 treatment-related adverse events were reported with Gemogenovatucel-T. There were 11 serious adverse events in 7 patients (4 in the placebo group and 3 in the Gemogenovatucel-T group). All but one of these events were reported as unlikely or irrelevant to study treatment.

consideration
Gemogenovatucel-T did not improve the primary endpoint of recurrence-free survival. However, several secondary endpoints were considered hypothesis-generating, showing significant improvements in recurrence-free survival and overall survival with Gemogenovatucel-T compared to placebo, particularly in patients with BRCA tumors. . These results suggest that patients with BRCA ovarian cancer may be more sensitive to Gemogenovatucel-T than those with BRCA-mutated ovarian cancer.

The current landscape for frontline treatment of advanced-stage ovarian cancer has remained virtually unchanged over the past 25 years. Despite great efforts, the addition of alternative approaches, either as combination therapy or as maintenance therapy, for the most part has not led to an overall change in standard of care for all patients with ovarian cancer. One exception, however, is the development of PARP inhibitors. For example, niraparib as maintenance therapy in patients with stage III or IV ovarian cancer is associated with better progression-free survival (HR 0.62, 95% CI 0.50 to 0.76; p<0.001) and 2-year overall survival compared to placebo (HR 0.70, 95% showed improvement compared to 0.44-1.11). However, there was concern about the high rate of grade 3 or 4 drug-related toxic effects and toxicity-related dose interruptions.

GMCSF is involved in increasing tumor antigen presentation by dendritic cells, leading to greater concentrations of co-stimulatory molecules and thereby inducing more efficient cell stimulation. GMCSF also enhances the presentation of lipid antigens by dendritic cells, which in turn leads to activation of natural killer T cells. TGF-β secreted by ovarian cancer cells induces proliferation of immunosuppressive regulatory T cells (CD4+, CD25+) in the tumor microenvironment. (26) This response has been associated with poor prognosis in patients with front-line, high-grade serous ovarian cancer. TGF-β inhibits GMCSF-induced dendritic cell-derived myeloid maturation and expression of MHC-II and co-stimulatory molecules. TGF-β inhibits activated macrophages, including their antigen-presenting function, and PD-L1 expression by ovarian cancer and tumor-associated myeloid cells, which is associated with improved overall survival in patients with ovarian cancer. shortness) is also inhibited. Knockdown of TGF-β1 may contribute to suppressing the effects of TGFβ, as shown in this study, which may be more important in patients with BRCA disease.

Few studies have examined immunotherapy in ovarian cancer. More recently, there is evidence from case reports and phase 1/2 trials of responses in ovarian cancer with checkpoint inhibitors, but several trials involving the combination of front-line avelumab and recurrent ovarian cancer No benefit was shown. Yet in another trial, 11 of 38 women with recurrent ovarian cancer achieved an objective response to the combination of nivolumab plus bevacizumab. Further studies involving checkpoint inhibitor therapy in patients with ovarian cancer are ongoing.

Given that Gemogenovatucel-T is well tolerated, easy to administer, and shows promising efficacy, it would be an ideal maintenance therapy for patients with ovarian cancer. One strength of our study results is the observation of safety and clinical recurrence-free survival and overall survival advantages in patients with BRCA disease. However, the BRCA subset is a secondary endpoint, and the use of autologous tumor harvests as one component of product manufacturing imposes timing and manufacturing success limits on product use. Inadequate tumor tissue has been associated with manufacturing failures, but there is no evidence to suggest that the number of vaccines manufactured correlates with the number of vaccines administered to patients or their health status. The failure rate of insufficient cells increased with smaller weights of resected tumor tissue.

As only a small subset of patients with BRCAmut disease received Gemogenovatucel-T, our conclusions regarding negative effects in such patients require further investigation. Further evaluation of Gemogenovatucel-T in combination with bevacizumab or other PARP inhibitors is planned. Furthermore, combination with checkpoint inhibitor therapy would further increase the Gemogenovatucel-T immune response.

In conclusion, Gemogenovatucel-T showed benefit as a frontline maintenance therapy in patients with ovarian cancer with a BRCA tumor molecular profile. This finding warrants further research.

Example 6: Supplementary Information Study Design and Participants Normal organ and bone marrow function was required for protocol adherence and was defined as protocol adherence (absolute granulocyte count ≥1,500/ ^mm3 ; absolute lymphocyte count ≥500/mm3; platelets ≥ 75,000/mm ³ ; total bilirubin ≤ 2 mg/dL; AST (SGOT)/ ^ALT (SGPT) ≤ 2 x institutional upper limit of normal; creatinine < 1.5 mg/dL). All patients were required to be competent and willing to sign a written informed protocol-specific consent form.

Procedure Surgically resected tumor tissue is harvested, cut into 1/4- to 1/2-inch sections, placed in specimen containers supplemented with gentamicin (Fresenius Kabi), and packaged in ice for overnight shipping. bottom. On day 1, the sterility of the transport vehicle and tumor samples was checked (BacT/Alert 3D Microbial Identification System, BioMerieux). On day 1, tumor tissue was trimmed with a scalpel and dissociated, followed by enzymatic dissociation (type I collagenase solution) and incubation at 37° C. to form a single cell suspension. The cell suspension was filtered through a sterile 100 um strainer (Corning) to separate the cells from cell debris and the freed cells were washed with PlasmaLyte supplemented with 1% human serum albumin (Octapharma). (Baxter) and manually counted by hemocytometer (InCyto). Quality control (QC) samples were taken to retain and monitor immunity and pre-transfection cultures were initiated to determine baseline cytokine levels for GMCSF (R&D Systems), TGFβ1 (R&D Systems), and TGFβ2 (R&D Systems). ) was obtained by ELISA. The suspension was adjusted to a concentration of 40 million cells/mL and electroporated using a Gene Pulser XL (BioRad) to facilitate plasmid insertion. The transfected cells were grown at 1×10 ⁶ cells/mL in X-VIVO 10 medium (Lonza) supplemented with gentamicin (Fresenius Kabi) in sterile T-225 cm ² flasks (Corning). and incubated overnight (14-22 hours) at 37°C with a 5% CO ₂ overlay (Sanyo) to allow the incorporation of the bi-shRNA furin and GMCSF mRNAs into the tumor cells.

On day 2, overnight cultures were harvested and resuspended in fresh X-VIVO medium. A QC sample and a minimum of 4 doses per patient were required before proceeding.

Two 1-mL mycoplasma samples containing cells were taken and frozen at -80°C. Cells were irradiated with 4×25 Gy cycles using a gamma irradiator to arrest replication/proliferation. Cells were washed with PlasmaLyte (Baxter) supplemented with 1% human serum albumin (Octapharma) and QC samples were removed for retention. Cells were plated in freezing medium consisting of PlasmaLyte (Baxter), pH 7.4, containing 10% DMSO (dimethyl sulfoxide; Cryoserv USP; Mylan), 1% HSA (Octapharma), at 1 x ¹⁰⁶ cells/mL or Aseptically dispensed at 1 x ¹⁰⁷ cells/mL into sterile 2.0 mL borosilicate glass vials (Algroup Wheaton Pharmaceutical and Cosmetics Packaging); It was sealed with a butyl rubber stopper coated with a Trademark barrier file (West Pharmaceutical Services). Final product vials were frozen at a controlled rate using CoolCell® freezing containers (Biocision) placed in a −80° C. freezer (Sanyo). Specifications for production testing are given in Table 3 in the appendix. After freezing, the cells were stored in vapor phase liquid nitrogen tanks during shipping testing. Vials of frozen product were used for sterility (USP <71>) and endotoxin testing by gelation (Limulus Amoebocyte Lysate, Lonza). Product release test specifications for individual patients are summarized in Table 12 above. Assay validation for (GMCSF, TGFβ1, TGFβ2) was completed post-study and data shown were calculated using appropriately validated parameters. As a result, TGFβ2 knockdown is no longer used as a product release standard.

Placebo consisted of freezing medium consisting of Plasma-Lyte A (Baxter) at pH 7.4 with 10% DMSO (Cryoserv USP; Mylan), 1% HSA (Octapharma). The medium was slowly cooled to −80° C. and frozen, after which the vials were stored in vapor phase liquid nitrogen during release testing for sterility and endotoxin. The placebo vial product matched the dose of available product manufactured for the subjects.

Sample Processing for NGS Sequencing High molecular weight (HMW) DNA was isolated from cryogenically stored samples using the Qiagen MagAttract HMW DNA kit. Fragmentation of HMW DNA was performed using dsDNA Fragmentase targeting nucleic acids in the 200-300 nt range. A DNA library was generated using the fragmented HMW DNA. The SMARTer ThruPLEX DNA-Seq Kit was then utilized with 5 ng of input. These libraries were combined into 5-6 fold pools, hybridized, and several gene sequences were extracted using the SeqCap EZ Human Oncology Panel (981 genes, 2.75 Mb of exonic regions) with the HyperCap Target Enrichment Kit. Selected. Gene-selected libraries were pooled and sequenced using the NextSeq 500 Mid Output v2.5 (300 cycles) kit.

Samples were run on the NextSeq 500. Variant cells were generated using GATK HaplotypeCaller v 4.1.2.0. The .vcf file was split into SNP and Indel parts using GATK SelectVariants v 4.1.2.0 and each file was counted using GATK CountVariants v 4.1.2.0. After retrieving the list of variants from the IVA software, the variants were further filtered and assigned to specific classes based on the American College of Medical Genetics and Genomics (ACMGG) classification guidelines implemented in IVA (33) and supplemented by ClinVar1. Retained polymorphism. The ACMGG classification guidelines group predicted aggravating variants into five possible categories: pathogenic, most likely pathogenic, uncertain significance, most likely benign, and benign. Divide. Classification is based on missense predictions, splice site predictions, nucleotide conservation predictions, well-established functional studies, and many other factors. The Predicted Aggravation column of Table IV contains the total number of BRCA and non-BRCA HRD mutations identified in each of the 17 samples belonging to all five IVA pathogenic classes described above. This final classification assigned by the ORB is based on selecting the most stringent classification from IVA or ClinVar for variants originally assigned by IVA as pathogenic, likely pathogenic, or of uncertain significance. was Variants called likely or benign by IVA were retained in the ORB classification. Variants seen in >20% of samples (both PBMC samples and tumor samples) occur in >5% of the general population in the Allele Frequency Community (AFC), 1000 Genomes, EXac, or GnomAD databases Filtered out with variant. Variants were classified as germline or somatic by comparing the proportion of alleles of each variant in tumor samples to PBMC samples. If a variant had a proportion of tumor sample alleles of 0, the variant was classified as germline. A variant was classified as somatic if it had a tumor sample allele percentage greater than zero and a PBMC sample allele percentage of zero. Variants were classified as germline if the proportion of both alleles was greater than zero, whereas variants were classified as somatic if the proportion of alleles in tumor samples was greater than 10-fold.

1. Markman M, Liu PY, Wilczynski S, et al. Phase III randomized trial of 12 versus 3 months of maintenance paclitaxel in patients with advanced ovarian cancer after complete response to platinum and paclitaxel-based chemotherapy: a Southwest Oncology Group and Gynecologic Oncology Group trial. J Clin Oncol 2003; 21: 2460-65.

2. LaFargue CJ, Dal Molin GZ, Sood AK, Coleman RL. Exploring and comparing adverse events between PARP inhibitors. Lancet Oncol 2019; 20: e15-28.

3. Coleman RL, Oza AM, Lorusso D, et al. Rucaparib maintenance treatment for recurrent ovarian carcinoma after response to platinum therapy (ARIEL3): a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 2017; 390: 1949-61.

4. Maples P, Kumar P, Oxendine I, et al. TAG vaccine: autologous tumor vaccine genetically modified to express GM-CSF and block production of TGFB2. BioProcess J 2009; 8: 38-44.

5. Bristow RE, Baldwin RL, Yamada SD, Korc M, Karlan BY. Altered expression of transforming growth factor-beta ligands and receptors in primary and recurrent ovarian carcinoma. Cancer 1999; 85: 658-68.

6. Riester M, Wei W, Waldron L, et al. Risk prediction for late-stage ovarian cancer by meta-analysis of 1525 patient samples. J Natl Cancer Inst 2014; 106: dju048.

7. Kang Y, Massague J. Epithelial-mesenchymal transitions: twist in development and metastasis. Cell 2004; 118: 277-79.

8. Roane BM, Arend RC, Birrer MJ. Review: targeting the transforming growth factor-beta pathway in ovarian cancer. Cancers (Basel) 2019; 11: e668.

9. Senzer N, Barve M, Nemunaitis J, et al. Long term follow up: phase 1 trial of “bi-shRNA furin/GMCSF DNA/autologous tumor cell” immunotherapy (FANGTM) in advanced cancer. J Vaccines Vaccin 2013; 4 : 209.

10. Olivares J, Kumar P, Yu Y, et al. Phase 1 trial of TGF-beta 2 antisense GM-CSF gene-modified autologous tumor cell (TAG) vaccine. Clin Cancer Res 2011; 17: 183-92.

11. Nemunaitis J, Dillman RO, Schwarzenberger PO, et al. Phase 2 study of belagenpumatucel-L, a transforming growth factor beta-2 antisense gene-modified allogeneic tumor cell vaccine in non-small-cell lung cancer. J Clin Oncol 2006 24:4721-30.

12. Oh J, Barve M, Matthews CM, et al. Phase 2 study of Vigil® DNA engineered immunotherapy as maintenance in advanced stage ovarian cancer. Gynecol Oncol 2016; 143: 504-10.

13. Gonzalez-Martin A, Pothuri B, Vergote I, et al. Niraparib in patients with newly diagnosed advanced ovarian cancer. N Engl J Med 2019; 381: 2391-402.

14. Ison G, Howie LJ, Amiri-Kordestani L, et al. FDA approval summary: niraparib for the maintenance treatment of patients with recurrent ovarian cancer in response to platinum-based chemotherapy. Clin Cancer Res 2018; 24: 4066-71.

15. Kim G, Ison G, McKee AE, et al. FDA approval summary: olaparib monotherapy in patients with deleterious germline BRCA-mutated advanced ovarian cancer treated with three or more lines of chemotherapy. Clin Cancer Res 2015; 21: 4257-61. .

16. Konstantinopoulos PA, Caccaldi R, Shapiro GI, D'Andrea AD. Homologous recombnination deficiency: exploiting the fundamental vulnerability of ovarian cancer. Cancer Discov 2015; 5: 1137-54.

17. Thiese MS, Ronna B, Ott U. P value interpretations and considerations. J Thorac Dis 2016; 8: e928-31.

18. Goodman SN. Multiple comparisons, explained. Am J Epidemiol 1998; 147: 807-12.

19. Drachman D. Adjusting for multiple comparisons. J Clin Res Best Pract 2012; 8: 1-3.

20. McGranahan N, Furness AJ, Rosenthal R, et al. Clonal neoantigens elicit T cell immunoreactivity and sensitivity to immune checkpoint blockade. Science 2016; 351: 1463-69.

21. Kraya AA, Maxwell KN, Wubbenhorst B, et al. Genomic signatures predict the immunogenicity of BRCA-deficient breast cancer. Clin Cancer Res 2019; 25: 4363-74.

22. Esteve JM, Armengod ME, Knecht E. BRCA1 negatively regulates formation of autophagic vacuoles in MCF-7 breast cancer cells. Exp Cell Res 2010; 316: 2618-29.

23. Folkerts H, Hilgendorf S, Vellenga E, Bremer E, Wiersma VR. The multifaceted role of autophagy in cancer and the microenvironment. Med Res Rev 2019; 39: 517-60.

24. Dranoff G, Jaffee E, Lazenby A, et al. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc Natl Acad Sci USA 1993 90: 3539-43.

25. Smyth MJ, Crowe NY, Hayakawa Y, Takeda K, Yagita H, Godfrey DI. NKT cells - conductors of tumor immunity? Curr Opin Immunol 2002; 14: 165-71.

26. Li X, Ye F, Chen H, Lu W, Wan X, Xie X. Human ovarian carcinoma cells generate CD4(+)CD25(+) regulatory T cells from peripheral CD4(+)CD25(-) T cells through secreting TGF-beta. Cancer Lett 2007; 253: 144-53.

27. Polcher M, Braun M, Friedrichs N, et al. Foxp3(+) cell infiltration and granzyme B(+)/Foxp3(+) cell ratio are associated with outcome in neoadjuvant chemotherapy-treated ovarian carcinoma. Cancer Immunol Immunother 2010; 59: 909-19.

28. Geissmann F, Revy P, Regnault A, et al. TGF-beta 1 prevents the noncognate maturation of human dendritic Langerhans cells. J Immunol 1999; 162: 4567-75.

29. Curiel TJ, Wei S, Dong H, et al. Blockade of B7-H1 improves myeloid dendritic cell-mediated antitumor immunity. Nat Med 2003; 9: 562-67.

30. Hamanishi J, Mandai M, Iwasaki M, et al. Programmed cell death 1 ligand 1 and tumor-infiltrating CD8+ T lymphocytes are prognostic factors of human ovarian cancer. Proc Natl Acad Sci USA 2007; 104: 3360-65.

31. Pujade-Lauraine E, Fujiwara K, Ledermann JA, et al. Avelumab alone or in combination with pegylated liposomal doxorubicin versus pegylated liposomal doxorubicin alone in platinum-resistant or refractory epithelial ovarian cancer: primary and biomarker analysis of the phase 3 JAVELIN Ovarian 200 trial. Gynecol Oncol 2019; 154: 21-22.

32. Liu JF, Herold C, Gray KP, et al. Assessment of combined nivolumab and bevacizumab in relapsed ovarian cancer: a phase 2 clinical trial. JAMA Oncol 2019; 5: 1731-38.

33. Richards, S., et al.,Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med, 2015. 17(5) : p.405-24

While preferred embodiments of the present disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are presented by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from this disclosure. It should be understood that the present disclosure may be practiced using various alternatives to the embodiments of the disclosure described herein. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Claims (65)

1. A method of treating cancer in an individual in need thereof, comprising:
a. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
b. It contains two stem-loop structures each with a miR-30a loop, the first stem-loop structure having perfectly complementary guide and passenger strands, while the second stem-loop structure a second insert with three base pair (bp) mismatches in positions 9-11 of the passenger strand;
administering to said individual an expression vector comprising
A method wherein said individual is homologous recombination repair defective (HRD) negative and/or said individual has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof. 2. The method of claim 1, wherein the guide strand in the first stem-loop structure comprises the sequence of SEQ ID NO:6 and the passenger strand in the first stem-loop structure has the sequence of SEQ ID NO:5. described method. 10. or wherein said guide strand in said second stem-loop structure comprises the sequence of SEQ ID NO:6 and said passenger strand in said second stem-loop structure has the sequence of SEQ ID NO:7 The method described in 2. 1. A method of treating cancer in an individual in need thereof, comprising:
a. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
b. administering to said individual an expression vector comprising a second insert comprising the sequence set forth in SEQ ID NO: 4 or 2;
A method wherein said individual is homologous recombination repair defective (HRD) negative and/or said individual has a wild-type BRCA1 gene, a wild-type BRCA2 gene, or a combination thereof. said selection of cancer is solid tumor cancer, ovarian cancer, adrenocortical cancer, bladder cancer, breast cancer, cervical cancer, bile duct cancer, colorectal cancer, esophageal cancer, glioblastoma, glioma , hepatocellular carcinoma, head and neck cancer, renal cancer, leukemia, lymphoma, lung cancer, melanoma, mesothelioma, multiple myeloma, pancreatic cancer, pheochromocytoma, plasmacytoma, neuroblastoma, prostate cancer 5. The method of claim 1 or 4, which is made from the group consisting of carcinoma, sarcoma, gastric cancer, uterine cancer, thyroid cancer, and blood cancer. said selection of solid tumor cancer is endometrial cancer, bile duct cancer, bladder cancer, hepatocellular carcinoma, gastric/esophageal cancer, ovarian cancer, melanoma, breast cancer, pancreatic cancer, colorectal cancer , glioma, non-small cell lung cancer, prostate cancer, cervical cancer, kidney cancer, thyroid cancer, neuroendocrine cancer, small cell lung cancer, sarcoma, head and neck cancer, brain cancer, kidney clear cell 6. The method of claim 5, consisting of the group consisting of cancer, skin cancer, endocrine tumor, thyroid cancer, tumor of unknown primary, and gastrointestinal stromal tumor. 6. The method of claim 5, wherein the cancer is ovarian cancer, breast cancer, melanoma, or lung cancer. 8. The method of claim 7, wherein ovarian cancer is substantially eradicated in said individual and said method prevents or delays recurrence of said substantially eradicated ovarian cancer. The method of any one of claims 1-8, wherein said expression vector is in an autologous cancer cell transfected with said expression vector. 9. The method of claim 8, wherein the substantially eradicated ovarian cancer is stage III or stage IV ovarian cancer. 11. The method of claims 1-10, wherein the individual's recurrence-free survival (RFS) is prolonged compared to an individual whose ovarian cancer has been substantially eradicated but who has not received the transfected tumor cells. A method according to any one of paragraphs. 12. The method of any one of claims 1-11, wherein the individual received a first therapy. 13. The method of claim 12, wherein said initial therapy comprises cytoreductive surgery, chemotherapy, or a combination thereof. 14. The method of claim 13, wherein said chemotherapy comprises administering a platinum agent and a taxane. 15. The method of claim 14, wherein said platinum agent comprises carboplatin. 15. The method of claim 14, wherein said taxane comprises paclitaxel. 17. The method of any one of claims 1-16, wherein said GM-CSF is a human GM-CSF sequence. 18. The method of any one of claims 1-17, wherein said expression vector further comprises a promoter. 19. The method of claim 18, wherein said promoter is a cytomegalovirus (CMV) mammalian promoter. 20. The method of claim 19, wherein said expression vector further comprises CMV enhancer sequences and CMV intron sequences. 21. The method of any one of claims 18-20, wherein said first insert and said second insert are operably linked to said promoter. 22. The method of any one of claims 1-21, wherein said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide between said first and said second nucleic acid inserts. . 23. The method of any one of claims 1-22, wherein the autologous tumor cells are administered to the individual in a dose of about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells. 24. The method of claim 23, wherein said autologous tumor cells are administered to said individual once a month. 25. The method of claim 24, wherein said autologous tumor cells are administered to said individual for 1-12 months. 26. The method of any one of claims 1-25, wherein the autologous tumor cells are administered to the individual by intradermal injection. A method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, said method comprising:
a. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
b. A method comprising administering to said individual autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence set forth in SEQ ID NO:2 or 4. 28. The method of claim 27, wherein the ovarian cancer is stage III or stage IV ovarian cancer. 29. The method of claim 27 or 28, wherein said ovarian cancer is refractory ovarian cancer. 30. The method of claim 29, wherein said refractory ovarian cancer is refractory to chemotherapy. 31. The method of claim 30, wherein said chemotherapy comprises platinum agents or taxanes. 32. The method of claim 31, wherein said platinum agent comprises carboplatin. 32. The method of claim 31, wherein said taxane comprises paclitaxel. 34. The method of any one of claims 27-33, further comprising administering an additional therapeutic agent. 35. The method of Claim 34, wherein said additional therapeutic agent is selected from the group consisting of an angiogenesis inhibitor, a PARP inhibitor, and a checkpoint inhibitor to said individual. 36. The method of claim 35, wherein said angiogenesis inhibitor is a vascular endothelial growth factor (VEGF) inhibitor. 37. The method of claim 36, wherein said VEGF inhibitor is selected from the group consisting of sorafenib, sunitinib, bevacizumab, pazopanib, axitinib, cabozantinib, and levatinib. 37. The method of claim 36, wherein said VEGF inhibitor is bevacizumab. 36. The method of claim 35, wherein said PARP inhibitor is selected from the group consisting of niraparib, olaparib, rucaparib, niraparib, talazoparib, veliparib, and pamiparib. 36. The method of claim 35, wherein said PARP inhibitor is niraparib. 36. The method of claim 35, wherein said checkpoint inhibitor is selected from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, and CTLA-4 inhibitors. 36. The method of claim 35, wherein the checkpoint inhibitor is selected from the group consisting of pembrolizumab, nivolumab, semiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab and is administered by intravenous infusion. 43. The method of any one of claims 27-42, wherein said GM-CSF is a human GM-CSF sequence. 44. The method of any one of claims 27-43, wherein said expression vector further comprises a promoter. 45. The method of claim 44, wherein said promoter is a cytomegalovirus (CMV) mammalian promoter. 46. The method of claim 45, wherein said expression vector further comprises CMV enhancer sequences and CMV intron sequences. 47. The method of any one of claims 44-46, wherein said first insert and said second insert are operably linked to said promoter. 48. The method of any one of claims 27-47, wherein said expression vector further comprises a nucleic acid sequence encoding a picornavirus 2A ribosome skipping peptide between said first and said second nucleic acid inserts. 49. The method of any one of claims 27-48, wherein the autologous tumor cells are administered to the individual in a dose of about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells. 50. The method of claim 49, wherein said autologous tumor cells are administered to said individual once a month. 51. The method of claim 50, wherein said autologous tumor cells are administered to said individual for 1-12 months. 52. The method of any one of claims 27-51, wherein the autologous tumor cells are administered to the individual by intradermal injection. A method of preventing recurrence of substantially eradicated ovarian cancer in an individual in need thereof, said method comprising:
a. i. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
ii. at least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4; and
b. administering to said individual at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent. 54. The method of any one of claims 1-53, wherein said at least one dose of said additional therapeutic agent is between 1100 mg and 1300 mg. 55. The method of any one of claims 53-54, wherein said at least one first dose of said autologous tumor cell vaccine comprises from about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells. 56. The method of any one of claims 53-55, wherein said at least one second dose of said autologous tumor cell vaccine comprises from about 1 x ¹⁰⁶ cells to about 5 x ¹⁰⁷ cells. 57. The method of any one of claims 53-56, wherein said at least one first dose of said autologous tumor cells is administered to said individual by intradermal injection. 58. The method of any one of claims 53-57, wherein said at least one second dose of said autologous tumor cell vaccine is administered to said individual by intradermal injection. 59. The method of any one of claims 53-58, wherein said at least one dose of said additional therapeutic agent is administered to said individual by intradermal injection. 60. The method of any one of claims 53-59, wherein said at least one first dose of said autologous tumor cell vaccine comprises two doses. 61. The method of any one of claims 53-60, wherein each dose of said at least one first dose of said autologous tumor cell vaccine is administered to said individual once a month. 62. The method of any one of claims 53-61, wherein each dose of said at least one second dose of said autologous tumor cell vaccine is administered to said individual once a month. 63. The method of any one of claims 53-62, wherein each dose of said at least one dose of said additional therapeutic agent is administered to said individual at least once a month. 64. Any of claims 53-63, wherein said at least one first dose of said autologous tumor cell vaccine and said at least one second dose of said autologous tumor cell vaccine comprise a total of at least 12 doses. The method according to item 1. A method of treating BRCA1/2 wild-type ovarian cancer in an individual in need thereof, comprising:
a. i. a first insert comprising a nucleic acid sequence encoding a granulocyte-macrophage colony-stimulating factor (GM-CSF) sequence; and
ii. at least one first dose of an autologous tumor cell vaccine comprising autologous tumor cells transfected with an expression vector comprising a second insert comprising a sequence according to SEQ ID NO: 2 or 4; and
b. administering to said individual at least one second dose of said autologous tumor cell vaccine in combination with at least one dose of an additional therapeutic agent.

Images