JP2023100186A - Method for predicting prognosis of canid animal afflicted with breast adenocarcinoma - Google Patents

Abstract

To provide a method for predicting the prognosis of a canid animal afflicted with breast adenocarcinoma, and a method for selecting a therapeutic method.SOLUTION: The present invention provides a method for predicting the prognosis of a canid animal afflicted with breast adenocarcinoma, including the step of measuring the copy number of HER2 gene in the mammary tissue taken from an animal subject. The present invention also provides a method for selecting a therapeutic method for a canid animal afflicted with breast adenocarcinoma, including the steps of: conducting the prognosis prediction method; and selecting a proper therapeutic method on the basis of the predicted prognosis of the animal subject.SELECTED DRAWING: Figure 2

Description

There is an application for the application of Article 30, Paragraph 2 of the Patent Law Posting date: January 19, 2021, Posting address: https://www. j stage. jst. go. jp/article/jvms/advpub/0/advpub_20-0483/_article/-char/en, publication name and corresponding page: J.P. Vet. Med. Sci. 83(3):370-377, 2021 (doi:10.1292/jvms.20-0483)

The present invention relates to a prognosis prediction method for canines with mammary adenocarcinoma.

Mammary adenocarcinoma is the most common malignant tumor occurring in dogs. The prognosis is often favorable if complete surgical resection is performed early, but recurrence is common after surgery.

In canines, a method for detecting cancer using a urine sample has been known (Patent Document 1). Not established. In some cases, metastasis has already occurred at the first visit, and in such a situation, it is necessary to select an appropriate therapeutic method such as medical therapy using drugs.

JP 2019-126295 A

An object of the present invention is to provide a method for predicting the prognosis of canines with mammary adenocarcinoma. Another object of the present invention is to provide a method for selecting a treatment method for a canine animal suffering from mammary adenocarcinoma.

The present inventors have recently found that in dogs with breast cancer, there is a difference between increased copy number of HER2 gene in mammary gland tissue samples (hereinafter sometimes simply referred to as "increased HER2 copy number") and protein overexpression of HER2. It was found that no significant correlation was observed. The present inventors also found that in dogs with breast cancer, a group in which HER2 copy number increase was observed had a significantly shorter survival period and a poorer prognosis than a group in which HER2 copy number increase was not observed. , found no significant difference in survival between the group with HER2 protein overexpression and the group without HER2 protein overexpression. The present invention is based on these findings.

According to the present invention, the following inventions are provided.
[1] A method for predicting the prognosis of a canine animal suffering from mammary adenocarcinoma, comprising the step of measuring the copy number of the HER2 gene in mammary gland tissue obtained from the subject animal.
[2] The method according to [1] above, wherein the HER2 gene copy number is measured by PCR.
[3] The method of [1] or [2] above, wherein an increase in the copy number of the HER2 gene in the subject animal is used as an indicator of poor prognosis of the subject animal.
[4] The method according to any one of [1] to [3] above, which further comprises the step of measuring the copy number of the control gene in the test animal.
[5] When the ratio of the copy number of the HER2 gene to the copy number of the control gene in the test animal (copy number ratio) exceeds the copy number ratio (cutoff value) of healthy canids, the prognosis of the test animal is poor. The method according to [4] above, which is shown to be
[6] The method according to any one of [1] to [5] above, which is a method for predicting cancer recurrence.
[7] A method for selecting a treatment method for a canine animal suffering from mammary adenocarcinoma, comprising a step of performing the prognosis prediction method according to any one of [1] to [6] above, and the prognosis prediction method. selecting an appropriate treatment method based on the prognosis of the subject animal predicted by the method.

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to predict the prognosis of a canine animal suffering from breast cancer, which is advantageous in that an appropriate therapeutic method for the subject animal can be selected based on the prediction results.

FIG. 1 plots the HER2:CFA8 ratio in canine mammary tissue for normal tissue samples (n=11), mammary tumor tissue samples (n=14) and breast cancer tissue samples (n=34), respectively. The dashed line is the universal threshold (>1.12) for detecting HER2 copy number gain. N. S. indicates no significant difference. FIG. 2 is a Kaplan-Meier curve showing the effects of HER2 copy number gain (A) and HER2 protein overexpression (B) on survival in dogs with breast cancer.

Specific description of the invention

The methods of the invention can be practiced on canines. Examples of animals belonging to the canine family include domestic dogs. In this specification, "domestic dog", "dog" and "dog" are synonymous.

Subject animals whose prognosis or cancer recurrence can be predicted by the method of the present invention are canines suffering from mammary adenocarcinoma. The presence of mammary adenocarcinoma is determined by a veterinarian based on, for example, histopathological evaluation. In the present specification, "breast cancer" is synonymous with "breast cancer" and "mammary gland malignant tumor".

The method of the present invention can be carried out by measuring the copy number of the HER2 gene in mammary tissue obtained from a subject animal. In the method of the present invention, since the ratio of the copy number of the HER2 gene to the copy number of the control gene is calculated as described below, the copy number of the control gene in the mammary tissue of the test animal can also be measured. .

The copy numbers of the HER2 gene and control gene can be measured by known methods such as PCR, next-generation sequencing, comparative genomic hybridization (CGH), fluorescence in situ hybridization (FISH), and the like. , the PCR method is preferable from the viewpoint of highly sensitive detection, and digital PCR and real-time PCR are more preferable from the viewpoint of rapid and simple detection. In particular, digital PCR and real-time PCR are advantageous in that the copy numbers of the HER2 gene and the control gene can be simultaneously measured in samples collected from test animals, and the ratio can be easily calculated. Both digital PCR and real-time PCR can be performed using commercially available equipment, reagents and kits. Probes and primers required for measuring the copy numbers of the HER2 gene and the control gene can be designed based on known sequence information described below.

In the method of the present invention, the HER2 gene that serves as an indicator for predicting prognosis and predicting cancer recurrence can be the HER2 gene of a canine animal to be tested. The nucleotide sequence of the HER2 gene is well known in this technical field. For example, the nucleotide sequence of the HER2 gene of domestic dogs is given to NCBI as Gene ID: 403883 (ERBB2 erb-b2 receptor tyrosine kinase 2 [Canis lupus familiaris (dog)]). registered and available.

The control gene can be selected from a gene whose copy number does not change due to the presence of cancer (especially mammary adenocarcinoma) or a chromosome or a region thereof. SG et al., Chromosome Res. 2015 Jun;23(2):311-331). As the base sequence of the control gene, base sequences registered in known databases such as NCBI can be used.

The method of the present invention may comprise the step of collecting mammary gland tissue from the subject animal prior to measuring the copy numbers of the HER2 gene and the control gene. Mammary gland tissue can be collected by surgical excision of the subject animal. In addition, in the method of the present invention, mammary gland tissue may be collected from a test animal whose diagnosis of mammary adenocarcinoma has not been confirmed. In this case, copy number measurements of the HER2 gene and a control gene may be performed, and the mammary gland tissue sampled may be used to make a diagnosis of mammary adenocarcinoma based on histopathological evaluation. That is, prognosis prediction and prediction of cancer recurrence according to the present invention can be performed for test animals diagnosed with mammary adenocarcinoma by histopathological evaluation.

As shown in the Examples below, in canines suffering from mammary adenocarcinoma, an increase in the copy number of the HER2 gene in the test animal correlates with the poor prognosis of the test animal, and the increase in the copy number of the HER2 gene in the test animal A decrease correlates with a better prognosis for the subject. Therefore, in the method of the present invention, the prognosis of canines suffering from mammary adenocarcinoma can be predicted by using an increase in the copy number of the HER2 gene in the subject animal as an indicator of poor prognosis of the subject animal. The method of the present invention also predicts the possibility of cancer recurrence in canines suffering from mammary adenocarcinoma by using an increase in the copy number of the HER2 gene in the subject animal as an indicator of the possibility of cancer recurrence in the subject animal. be able to.

In one aspect of the method of the present invention, the ratio of the copy number of the HER2 gene in the subject animal to the copy number of the control gene (hereinafter sometimes simply referred to as the "copy number ratio") is the copy number ratio of the healthy canid animal. (hereinafter, sometimes simply referred to as "cutoff value"), it indicates that the prognosis of the test animal is poor, or that there is a high possibility of cancer recurrence in the test animal. Therefore, the method of the present invention includes the step of calculating the copy number ratio after measuring the copy numbers of the HER2 gene and the control gene in the subject animal, and if the ratio exceeds the cutoff value, the prognosis of the subject animal is poor. Alternatively, the step of determining that there is a high possibility that the cancer will recur in the subject animal may be included. Although this determination process can be performed without using a veterinarian, it goes without saying that the final diagnosis is performed by a veterinarian.

Here, a healthy canine animal means a canine animal that does not have cancer or a disease other than cancer. In addition, the healthy canid animal is preferably of the same species as the subject animal. For example, when domestic dogs are used as the subject animal, domestic canines can be selected as the healthy canid animal.

In carrying out the method of the present invention, the copy number of the HER2 gene and the copy number of the control gene in the mammary gland tissue obtained from a healthy canine animal are measured in advance, and the cut-off value is prepared before the determination step. can be implemented. That is, the method of the present invention further comprises the step of measuring the copy number of the HER2 gene and the copy number of the control gene in mammary tissue obtained from a healthy canine animal, and calculating the copy number ratio of the healthy canine animal. You can stay.

In the method of the present invention, the cutoff value can be the average copy number ratio obtained from healthy canines. Also in the method of the present invention, the cut-off value is:
Cut-off value = (mean copy number ratio of healthy canines) + k x (standard deviation of copy number ratio of healthy canines)
(In the above formula, k is a constant from 0 to 4, preferably k = 1 to 4 or 2 to 4, and in particular k = about 3.)
It can be a value calculated by In any of the above cases, copy number ratios obtained from multiple healthy canids can be used for calculation. Also, the standard deviation can be calculated according to a known method. When the test animal is a domestic dog and the control gene is a region of CFA8 (domestic chromosome 8), the cutoff value calculated by the above formula can be about 1.1.

The method of the present invention can predict the prognosis of canine animals suffering from mammary adenocarcinoma, and can predict cancer recurrence. Therefore, the method of the present invention can be used adjunctively in the treatment of breast adenocarcinoma. For example, when the prognosis of the test animal is evaluated as poor (or the test animal has a high possibility of cancer recurrence) by the method of the present invention, medical treatment including anticancer drug treatment is considered; Appropriate treatment such as confirming the presence or absence of metastasis or recurrence by increasing the number of times and/or examination items (eg, X-ray examination, CT examination) can be selected. When the method of the present invention evaluates that the prognosis of the subject animal is good (or that the subject animal has a low possibility of cancer recurrence), an appropriate treatment such as follow-up can be selected. . That is, canine animals with mammary adenocarcinoma may have a poor prognosis or a good prognosis. If it is possible to predict in advance that the risk of cancer is high, it is advantageous in that early detection of metastasis and recurrence can be performed by increasing opportunities for examination and/or testing, and more appropriate treatment can be implemented.

That is, according to another aspect of the present invention, the steps of performing the prognostic prediction method of the present invention and selecting an appropriate treatment method based on the prognosis of the subject animal predicted by the prognostic prediction method. A method for selecting a treatment method for a canine afflicted with mammary adenocarcinoma is provided. The choice of treatment method, possibly in combination with other laboratory findings (eg, radiography, ultrasound, blood tests), can ultimately be made by the veterinarian.

The present invention will be described more specifically based on the following examples, but the present invention is not limited to these examples. The test animals in this example are all domestic dogs. Informed consent was obtained from the owners for the use of clinical data and samples obtained from the test animals.

Example 1: Relationship between HER2 protein overexpression and HER2 gene copy number increase in breast cancer tissue and prognosis of dogs with breast cancer (1) Preparation of mammary gland tissue samples This study was conducted by histopathological examination at the University of Tokyo Veterinary Medical Center. Breast cancer patients diagnosed with breast cancer (n=34), mammary dogs diagnosed with mammary tumors (n=14), and healthy dogs diagnosed as normal (n=11) were examined. Mammary gland tissues surgically collected from dogs with breast cancer were used as breast cancer tissue samples. Similarly, mammary gland tissues surgically collected from dogs with mammary tumors and healthy dogs were used as mammary tissue samples and normal tissue samples, respectively. Each obtained mammary gland tissue was fixed with formalin, embedded in paraffin, and stored at room temperature. Diagnosis was based on histopathological evaluation. Specifically, hematoxylin and eosin stained specimens of mammary tissue were evaluated by two pathologists certified by the Japanese Association of Veterinary Pathologists. Each specimen was classified and graded according to the method proposed by Goldschmidt et al. (see Goldschmidt, M. et al., Vet. Pathol. 2011; 48: 117-131.).

(2) HER2 Immunohistochemistry HER2 immunohistochemical staining was performed according to a known method (Tsuboi, M. et al., Vet. Pathol. 2019; 56: 369-376.). That is, a 4 μm thin slide section of the formalin-fixed paraffin-embedded specimen obtained in (1) above was deparaffinized, rehydrated, treated with 3% hydrogen peroxide-methanol at room temperature for 5 minutes, and then the target The recovery solution (pH 9.0, Dako) was heated in a 98° C. water bath for 40 minutes. After cooling for 1 hour, the sections were washed with Tris-buffered saline (TBS) and incubated in 8% skimmed milk-TBS for 40 minutes at 37°C. Sections were incubated with rabbit polyclonal anti-human c-erbB-2 tumor protein (HER2/neu) antibody (dilution 1:100, Dako) for 40 minutes at 37°C, followed by Envision horseradish peroxidase-conjugated anti-rabbit IgG polymer (Dako). company) and incubated at 37° C. for 1 hour. Reaction products were visualized using 3,3′-diaminobenzidine (Dojindo) and 0.03% H ₂ O ₂ in TBS. Counterstaining was performed with Mayer's hematoxylin. A positive control was prepared using canine urothelial carcinoma tissue known to overexpress HER2 (see Patent Document 1). Negative controls were prepared by omitting the primary antibody.

The criteria (quantification) for the immunohistochemical method are as follows.
Score 0: No reactivity Score 1+: Weak and incomplete membrane immunoreactivity in any percentage of cells Score 2+: Strong and complete membrane immunoreactivity in 30% or less cells, or at least 10 % of cells exhibit weak or minimal heterogeneous and complete membrane immunity.
Score 3+: Represents strong, complete and uniform membrane immunoreactivity (chicken wire pattern) in more than 30% of cells

Samples with scores of 0, 1+ and 2+ were classified as HER2 overexpression negative and samples with a score of 3+ were classified as HER2 overexpression positive. Cytoplasmic immunoreactivity was detected in some tumor cells and normal mammary epithelial cells, but these were not considered.

(3) Quantification of HER2 Gene Copy Number DNA was extracted from each mammary gland tissue sample obtained in (1) above using the QIAmp DNA FFPE Tissue Kit (QIAGEN) according to the manufacturer's instructions. A dPCR assay, an already established technique, was used to assess HER2 copy number. HER2 primers and TaqMan MGB probes and reference genes were designed using Primer Express Software (Thermo Fisher Scientific). The reference gene was designed within a region of canine chromosome 8 (CFA8). A previous study of genomic alterations (Beck, J. et al., PLoS One 2013; 8: e75485.) showed that this region was relatively stable in canine mammary carcinoma. Specifically, the following primers and probes were used.

HER2 gene forward primer: GTGGTGAGGCTGGTTTTCAGA (SEQ ID NO: 1)
Reverse primer: CCTGTCCTCCCACCTCTTCAT (SEQ ID NO: 2)
Probe (FAM label): TAACCGCTAAGCAGTATGT (SEQ ID NO: 3)

CFA8 gene forward primer: TGCAGAGTTTGATTTGTTGTTTGAA (SEQ ID NO: 4)
Reverse primer: TGGAAGAAGGTGCATTTTTCTGA (SEQ ID NO: 5)
Probe (VIC label): AATGCCCTTTGACCAGTGGGTAGCC (SEQ ID NO: 6)

HER2 and CFA8 probes were labeled with 6-carboxyfluorescein (FAM) and 4,7,2'-trichloro-7'-phenyl-6-carboxyfluorescein (VIC), respectively. PCR was performed using the QuantStudio ^™ 3D Digital PCR System (Thermo Fisher Scientific). Briefly, each 15 μl reaction mixture contained 2X QuantStudio ^™ 3D Digital PCR Master Mix v2 (Thermo Fisher Scientific), 900 nM of each primer, 200 nM of each probe and 20 ng genome of formalin-fixed, paraffin-embedded canine mammary gland tissue. Prepared to contain DNA. The PCR reaction mixture was then loaded onto a QuantStudio ^™ 3D Digital PCR 20K Chip v2 (Thermo Fisher Scientific) using a QuantStudio ^™ 3D Digital PCR Tip Loader (Thermo Fisher Scientific). The 20K chip contained 20,000 wells in which DNA was randomly and uniformly distributed. Amplification was performed using the ProFlex ^™ 2x Flat PCR System (Thermo Fisher Scientific) under the following conditions.
• Denaturation at 96°C for 10 minutes.
• 39 cycles of 60°C for 2 minutes, 98°C for 30 seconds, 60°C for 2 minutes.
- The temperature is then maintained at 10°C.

The PCR chip was then loaded into a QuantStudio ^™ 3D digital PCR machine (Thermo Fisher Scientific). Positive and negative plots were counted and HER2:CFA8 ratios were calculated using the Poisson distribution with QuantStudio ^™ 3D AnalysisSuite ^™ version 3.1.2 (Thermo Fisher Scientific).

(4) Results a. HER2 copy number in breast tissue The median (range) of HER2:CFA8 ratio in normal tissue samples, breast tumor tissue samples and breast cancer tissue samples was 0.88 (0.69 to 0.98), respectively. 1.00 (0.61-1.18) and 1.10 (0.61-2.35) (Fig. 1). The HER2:CFA8 ratio in breast cancer tissue samples was significantly higher than normal tissue samples (P=0.0068) but slightly higher than breast tumor cases (FIG. 1). There was no significant difference in the ratio of normal tissue samples to mammary tissue samples.

To determine the universal threshold for HER2 copy number gain in mammary tissue, the mean+3×standard deviation of the HER2:CFA8 ratio in normal tissue samples was calculated and found to be 1.12. Therefore, a HER2:CFA8 ratio >1.12 was defined as the universal threshold. Based on this threshold, HER2 copy number gains were detected in 14/34 (41%) breast cancer tissue samples and 2/14 (14%) breast adenoma tissue samples (Table 1). No HER2 copy number gain was detected in normal tissue samples.

b Expression of HER2 protein in mammary gland tissue The HER2 immunoreactivity of each sample was as follows.
Normal tissue samples: 7/8 (88%) scored 0, 1/8 (13%) scored 1+.
Breast tumor tissue samples: 2/14 (14%) scored 0, 10/14 (71%) scored 1+, 2/14 (14%) scored 2+.
Breast cancer tissue samples: 13/34 (38%) scored 0, 12/34 (35%) scored 1+, 6/34 (18%) scored 2+, 3/34 (9%) scored 3+.

All normal and breast tumor tissue samples were classified as HER2 overexpression negative, whereas HER2 overexpression positive was observed in 3/34 (9%) of breast cancer tissue samples (Table 1).

HER2 copy number gain was also detected in 2/3 (67%) breast cancer tissue samples with HER2 protein overexpression, whereas HER2 overexpression was found in 2/14 (14%) with HER2 copy number gain. observed in breast cancer tissue samples (Table 2). No significant correlation was observed between HER2 copy number gain and protein overexpression of HER2.

C. Effect of HER2 Copy Number Increase and Protein Overexpression on Survival All cases of breast cancer tissue samples were used for survival analysis. The effects of HER2 copy number increase and protein overexpression on viability are shown in FIG. 2 as Kaplan-Meier curves.

Cases from breast cancer tissue samples included 14 cases with HER2 copy number gain and 20 cases without HER2 copy number gain. No significant differences in age and neutering status were found between the two groups. During the study, 21/34 breast cancer cases died. Dogs that died included 10 with HER2 copy number gain and 11 without HER2 copy number gain. Median survival with and without HER2 copy number gain was 243 days (range: 79-711 days) and 515 days (range: 11-2008 days), respectively. Survival of cases with HER2 copy number gain was significantly shorter than those without HER2 copy number gain (P=0.0276; FIG. 2A).

The breast cancer tissue sample cases also included 3 cases with HER2 protein overexpression and 31 cases without HER2 protein overexpression. No significant differences in age and neutering status were found between the two groups. Two cases with HER2 protein overexpression and 19 cases without HER2 protein overexpression died during the study. Median survival with and without HER2 protein overexpression was 711 days (range: 99-2008 days) and 313 days (range: 11-1615 days), respectively. No significant difference in survival was found between the two groups (P=0.3466; FIG. 2B).

D. Discussion In dogs with mammary cancer, the survival period was significantly shorter and the prognosis was poorer in the group with HER2 copy number increase than in the group without HER2 copy number increase. On the other hand, in dogs with breast cancer, there was no significant difference in survival between groups with HER2 protein overexpression and groups without HER2 protein overexpression. Here, no significant correlation was observed between HER2 copy number gain and protein overexpression of HER2 in mammary tissue samples in dogs with breast cancer. Therefore, it was shown that the copy number of the HER2 gene in the mammary gland tissue obtained from a canine animal suffering from breast cancer is an indicator of the prognosis of the test animal, but HER2 protein overexpression is not an indicator of the prognosis of the test animal. was done.

Claims (7)

A method for predicting the prognosis of a canine animal suffering from mammary adenocarcinoma, said method comprising the step of measuring the copy number of the HER2 gene in mammary gland tissue obtained from the subject animal. 2. The method according to claim 1, wherein the HER2 gene copy number is measured by a PCR method. 3. The method according to claim 1 or 2, wherein an increase in the copy number of the HER2 gene in the subject animal is used as an indicator of poor prognosis of the subject animal. 4. The method of any one of claims 1-3, further comprising the step of measuring the copy number of the control gene in the subject animal. The prognosis of the subject animal is poor when the ratio of the HER2 gene copy number to the control gene copy number (copy number ratio) in the subject animal exceeds the copy number ratio (cutoff value) of healthy canids. 5. The method of claim 4, wherein is indicated. The method according to any one of claims 1 to 5, which is a method for predicting cancer recurrence. A method for selecting a treatment method for a canine animal suffering from mammary adenocarcinoma, comprising the steps of: performing the prognostic prediction method according to any one of claims 1 to 6; The above method, comprising the step of selecting an appropriate therapeutic method based on the prognosis of the subject animal.

Images