JP2023066839A - Therapeutic drug for myasthenia gravis - Google Patents

Abstract

To provide a new therapeutic or prophylactic drug for myasthenia gravis that replaces immunosuppressive therapy or can be used in combination with immunosuppressive therapy to inhibit side effects.SOLUTION: The therapeutic or prophylactic drug for myasthenia gravis contains one or more compounds selected from the group consisting of compounds represented by the formula (I) in the figure and the like, or salts thereof.SELECTED DRAWING: None

Description

The present invention relates to a therapeutic or prophylactic agent for myasthenia gravis, containing a specific compound or a salt thereof.

Myasthenia gravis (MG) is a type of autoimmune disease in which anti-AChR antibodies bind to the muscle-side nicotinic acetylcholine receptors (AChR) of acetylcholine, resulting in acetylcholine-mediated neuromuscular junctions. It is known to be caused by inhibition of stimulus transmission. According to the 2006 nationwide clinical epidemiological survey, the prevalence in Japan is 11.8 per 100,000 population, the number of female patients is 1.7 times that of males, and the thymoma complication rate is 32.0%.

Immunosuppressive therapy centered on steroids is the basic treatment for MG, and calcineurin inhibitor immunosuppressants such as cyclosporine and tacrolimus are used as adjuvant therapy. Symptomatic therapy with cholinesterase inhibitors is also performed (for example, Non-Patent Document 1, etc.). However, the remission rate of MG is less than 20%, and long-term administration of immunosuppressive drugs such as steroids poses problems of side effects such as deterioration of patients' QOL (Quality of Life) and susceptibility to infection.

By the way, a new research concept called drug repositioning (DR) is being discussed as a way to break through the deadlock in new drug development research seen in recent years. The aim is to discover new medicinal effects from existing drugs whose safety and pharmacokinetics in humans have already been confirmed, and lead to their practical application. Since a lot of existing data can be used, development costs can be kept low, and there are further advantages such as the existence of accumulated know-how and materials (peripheral compounds, etc.).

Cochrane Database System Rev. 2014(10):CD006986 (2014)

Therefore, an object of the present invention is to provide a novel therapeutic or prophylactic drug for myasthenia gravis (MG) that can suppress side effects in place of conventional therapies such as immunosuppressive therapy, or in combination with conventional therapies. be.

The present inventors came up with the idea that a compound that inhibits the binding between a nicotinic acetylcholine receptor (AChR) and an anti-AChR antibody would be a candidate therapeutic drug for MG. To identify such compounds, the main immunogenic region (MIR) of AChR α1, the binding site for autoantibodies, was examined in more than 50% of patients with MG (J Neurosci. 29(44):13898-908). (2009)). The present inventors first predicted the compound pocket existing near the MIR by computer simulation, and after primary screening compounds that can bind to such a compound pocket, the compounds with the highest scores were subjected to two Next screening (docking simulation) was performed. The Namiki Virtual Chemical library and a library of FDA-approved compounds were used for computer simulation. Then, by selecting multiple representative compounds from the compounds (hit compounds) listed by the above screening and performing radioimmunoassay (RIA), the compounds inhibit the binding of the patient's autoantibodies to the recombinant acetylcholine receptors. Confirmed that it can be done. Furthermore, it was confirmed that the binding of patient autoantibodies to human iPS cell-derived neuromuscular junctions could be inhibited, and that internalization of AChR due to binding with the autoantibodies could be suppressed. The present inventors have completed the present invention as a result of further studies based on these findings.

That is, the present invention is as follows.
[1]
Formula (I) below:

[In formula (I),
R ₁ to R ₄ are each independently an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group, an amino group in which each hydrogen atom may be substituted, or an aliphatic group having 1 to 3 carbon atoms. shows
Ring A is the following formula (II-1) or formula (II-2):

[In formula (II-1) or formula (II-2),
R ₅ to R ₁₂ are each independently an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group, an amino group in which each hydrogen atom may be substituted, or an aliphatic group having 1 to 3 carbon atoms indicates],
Ring B is the following formula (III-1) or formula (III-2):

[In formula (III-1) or formula (III-2),
R ₁₃ to R ₁₉ each independently represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted;
Y is an oxygen atom or —C(H)(R ₂₀ )—[R ₂₀ represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted; ],
m represents an integer of 0 to 2,
L may or may not be present, and if present, the following formula (IV-1), (IV-2) or (IV-3):

[In formula (IV-1), (IV-2) or (IV-3),
The dotted line indicates that a double bond may be present at any position],
X is an oxygen atom or =C(R ₂₁ )- or -C(H)(R ₂₁ )- [R ₂₁ is selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted; showing selected atoms or groups],
The dotted line indicates that the double bond may be present at either position]
A therapeutic or prophylactic agent for myasthenia gravis, comprising one or more compounds selected from the group consisting of compounds represented by and compounds represented by compound numbers 1 to 19 or salts thereof.
[2-1]
The therapeutic or prophylactic agent according to [1], wherein R ₁ in formula (I) is a hydrogen atom or an aliphatic group having 1 to 3 carbon atoms in which each hydrogen atom may be substituted.
[2-2]
The therapeutic or prophylactic agent according to [1] or [2-1], wherein R ₁ in formula (I) is an aliphatic group having at least one amino group.
[2-3]
The therapeutic or prophylactic agent of [2-1] or [2-2], wherein the aliphatic group is a methyl group.
[3-1]
The therapeutic or prophylactic agent according to any one of [1] to [2-3], wherein R ₄ in formula (I) is an amino group in which each hydrogen atom may be substituted.
[3-2]
The therapeutic or prophylactic agent according to any one of [1] to [3-1], wherein R ₄ in formula (I) is an unsubstituted amino group.
[3-3]
The therapeutic or prophylactic agent according to any one of [1] to [3-2], wherein both R ₂ and R ₃ in formula (I) are hydrogen atoms.
[3-4]
The therapeutic or prophylactic agent according to any one of [1] to [3-2], wherein both R ₂ and R ₃ in formula (I) are hydroxy groups.
[4-1]
According to any one of [1] to [3-4], wherein R ₇ in formula (II-1) is an aliphatic group having 1 or 2 carbon atoms, each hydrogen atom of which may be substituted. therapeutic or prophylactic.
[4-2]
The therapeutic or prophylactic agent according to any one of [1] to [4-1], wherein R ₇ in formula (II-1) is an aliphatic group having at least one hydroxy group.
[4-3]
The therapeutic or prophylactic agent of [4-1] or [4-2], wherein the aliphatic group is a methyl group.
[5-1]
The therapeutic or prophylactic agent according to any one of [1] to [4-3], wherein R ₉ in formula (II-2) is an amino group in which each hydrogen atom may be substituted.
[5-2]
The therapeutic or prophylactic agent according to any one of [1] to [5-1], wherein R ₉ in formula (II-2) is an amino group having at least one methyl group.
[6-1]
According to any one of [1] to [5-2], wherein R ₁₀ in formula (II-2) is an aliphatic group having 1 or 2 carbon atoms, each hydrogen atom of which may be substituted. therapeutic or prophylactic.
[6-2]
The therapeutic or prophylactic agent according to any one of [1] to [6-1], wherein R ₁₀ in formula (II-2) is an unsubstituted aliphatic group.
[6-2]
The therapeutic or prophylactic agent of [6-1] or [6-2], wherein the aliphatic group is a methyl group.
[7-1]
Each of R ₅ , R ₆ , R ₈ , R ₁₁ and R ₁₂ in formula (II-1) or formula (II-2) is independently a hydrogen atom, a hydroxy group, or each hydrogen atom is substituted. The therapeutic or prophylactic agent according to any one of [1] to [6-2], which is a good amino group.
[7-2]
The therapeutic or prophylactic agent according to any one of [1] to [7-1], wherein at least one of R ₅ and R ₆ in formula (II-1) is a hydroxy group.
[7-3]
The therapeutic or prophylactic agent according to any one of [1] to [7-2], wherein at least one of R ₈ and R ₁₁ in formula (II-2) is a hydroxy group.
[7-4]
The therapeutic or prophylactic agent according to any one of [1] to [7-3], wherein R ₁₂ in formula (II-2) is a hydrogen atom.
[8-1]
R ₁₃ to R ₁₉ in formula (III-1) or formula (III-2) are each independently a hydrogen atom, a hydroxy group, or an amino group in which each hydrogen atom may be substituted [1] The therapeutic or prophylactic agent according to any one of ~[7-4].
[8-2]
The therapeutic or prophylactic agent according to any one of [1] to [8-1], wherein R ₁₃ and R ₁₅ in formula (III-1) are unsubstituted amino groups.
[8-3]
The therapeutic or prophylactic agent according to any one of [1] to [8-2], wherein R ₁₄ in formula (III-1) is a hydrogen atom.
[8-4]
The therapeutic or prophylactic agent according to any one of [1] to [8-3], wherein R ₂₀ of Y in formula (III-1) is a hydroxy group.
[8-5]
The therapeutic or prophylactic agent according to any one of [1] to [8-1], wherein R ₁₃ to R ₁₅ in formula (III-1) are all hydroxy groups.
[8-6]
The therapeutic or prophylactic agent according to any one of [1] to [8-1] and [8-5], wherein Y in formula (III-1) is an oxygen atom.
[8-7]
The therapeutic or prophylactic agent according to any one of [1] to [8-1], wherein R ₁₆ in formula (III-2) is a hydroxy group.
[8-8]
The treatment according to any one of [1] to [8-1] and [8-7], wherein R ₁₇ and R ₁₉ in formula (III-2) are unsubstituted amino groups, or preventive medicine.
[8-9]
The therapeutic or prophylactic agent according to any one of [1] to [8-1], [8-7] and [8-8], wherein R ₁₈ in formula (III-2) is a hydrogen atom.
[9]
The therapeutic or prophylactic agent according to any one of [1] to [8-9], wherein the compound represented by formula (I) is sisomicin, rosarin or ribostamycin.
[10]
The therapeutic or prophylactic agent according to any one of [1] to [9], further containing an immunosuppressant or a cholinesterase inhibitor.
[11]
characterized by administering an effective amount of one or more compounds selected from the group consisting of compounds represented by the above formula (I) and compounds represented by compound numbers 1 to 19 or salts thereof to mammals A method for treating or preventing myasthenia gravis in said mammal.
[12]
One or more compounds selected from the group consisting of compounds represented by the above formula (I) and compounds represented by compound numbers 1 to 19, or salts thereof, for use in the treatment or prevention of myasthenia gravis.
[13]
One or more compounds selected from the group consisting of compounds represented by the above formula (I) and compounds represented by compound numbers 1 to 19, or a salt thereof, for the production of a drug for the treatment or prevention of myasthenia gravis Use of.

According to the present invention, it becomes possible to treat MG. In addition, by using it as an adjuvant to existing drugs, it is possible to reduce the dosage of existing drugs and suppress side effects. In particular, by using an existing drug whose safety has been confirmed as an active ingredient of the therapeutic drug of the present invention, it is expected that the development period for clinical application can be shortened.

A compound pocket predicted to reside near the major immunogenic region (MIR) of the nicotinic acetylcholine receptor (AChR) is shown. The predicted docking pose with AChR of the compound with the highest score as a result of computer simulation in the Namiki Virtual Chemical library is shown. A predicted docking pose of sisomicin sulfate with AChR is shown. A schematic diagram of a method of inducing differentiation from human iPS cells to motor neurons is shown. Fig. 2 shows the results of measurement of motor neuron-specific gene expression levels in neurons induced to differentiate in Examples. Error bars are standard errors, * indicates p<0.05. n=3, respectively. The results of immunostaining of neurons induced to differentiate in Examples are shown. Fig. 3 shows the results of immunostaining in the co-culture of motor nerve (like) cells and skeletal muscle cells differentiated in Example. α-Bungarotoxin covalently binds to AchR. We used a fluorescently labeled α-Bungarotoxin to indicate its location on the skeletal muscle. Similar to FIG. 8, fluorescently labeled α-Bungarotoxin was used to indicate its location on the skeletal muscle. Similar to FIG. 9, fluorescently labeled α-Bungarotoxin was used to indicate its location on the skeletal muscle. Schematic diagram of the efficacy evaluation method for hit compounds is shown. The results of efficacy evaluation of the hit compound (left figure) and a schematic diagram of the presumed mechanism (right figure) are shown. Error bars are standard errors, ** indicates p<0.01. n=5, respectively.

As shown in the Examples below, as a result of computer simulation, multiple compounds with high scores inhibit the binding of nicotinic acetylcholine receptors (AChR) and anti-AChR antibodies, and are one of the etiologies of MG. It was demonstrated by the inventors that the internalization of certain AChRs can be suppressed. Therefore, the compounds used in this example and other high-scoring compounds (hereinafter, these compounds may be collectively referred to as the "compounds of the present invention") are MG It is possible to suppress the internalization of AChR, which is one of the etiologies, thereby treating or preventing MG. Accordingly, the present invention provides a therapeutic or prophylactic drug for MG (hereinafter sometimes referred to as "the drug of the present invention") containing the compound of the present invention.

The medicament of the present invention is the active ingredient of the compound of the present invention alone, or mixed with pharmacologically acceptable carriers, excipients, diluents, etc., and administered orally as a pharmaceutical composition in an appropriate dosage form. It can be administered parenterally or parenterally. In addition, the medicament of the present invention can be administered to mammals (eg humans, rats, mice, guinea pigs, rabbits, sheep, horses, pigs, cows, dogs, cats and monkeys). Accordingly, there is also provided a method for treating or preventing MG in a mammal, comprising administering to the mammal an effective amount of the compound of the present invention.

In the present invention, MG to be treated or prevented is not particularly limited, and may be adult-onset MG or childhood-onset MG including neonatal transient type. In addition, as MGFA (Myasthenia Gravis Foundation of America) classification, adult type I (ocular muscle type), adult type II (systemic type), adult type III (acute acute symptoms), adult type IV (late severe type), and adult type V (muscular atrophic type).

As used herein, the term “therapeutic drug” includes not only drugs intended for the radical treatment of MG, but also drugs intended to suppress the progression of these diseases, relief of symptoms (e.g. Medications intended to improve symptoms (improvement to minimal manifestations MM) or to alleviate sequelae are also included. For example, myasthenia gravis is a disease that progresses over a long period of time (usually years), so early initiation of treatment can prevent the progression of symptoms. In addition, as used herein, the term "prophylactic drug" includes not only drugs intended to reduce the risk of developing MG for subjects who have not developed MG, but also drugs for subjects who have developed MG. Also included are drugs intended to reduce the risk of recurrence of MG. For example, potentially, the development of MG can be prevented by administering the medicament of the present invention to a patient having a genetic background susceptible to MG, before the symptoms of MG are exhibited. .

The compounds of the present invention can also be used as inhibitors of binding between AChR and anti-AChR antibodies or inhibitors of internalization of AChR (hereinafter sometimes referred to as "agents of the present invention"). The agent of the present invention is prepared as a general pharmaceutical composition or pharmaceutical preparation, or as a cosmetic or food, and administered orally or parenterally. Moreover, the agent of the present invention can also be used as a reagent. The agent of the present invention can be administered, for example, to subjects including humans (eg, mammals, mammalian cells, tissues, organs, etc.). Therefore, a method for inhibiting binding between AChR and anti-AChR antibody or a method for inhibiting internalization of AChR in a subject, which comprises administering the compound of the present invention to the subject, is also provided.

Specific examples of the compound of the present invention include the following formula (I):

[In formula (I),
R ₁ to R ₄ are each independently an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group, an amino group in which each hydrogen atom may be substituted, or an aliphatic group having 1 to 3 carbon atoms. shows
Ring A is the following formula (II-1) or formula (II-2):

[In formula (II-1) or formula (II-2),
R ₅ to R ₁₂ are each independently an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group, an amino group in which each hydrogen atom may be substituted, or an aliphatic group having 1 to 3 carbon atoms indicates],
Ring B is the following formula (III-1) or formula (III-2):

[In formula (III-1) or formula (III-2),
R ₁₃ to R ₁₉ each independently represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted;
Y is an oxygen atom or —C(H)(R ₂₀ )—[R ₂₀ represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted; ],
m represents an integer of 0 to 2 (preferably 0 or 1),
L may or may not be present, and if present, the following formula (IV-1), (IV-2) or (IV-3):

[In formula (IV-1), (IV-2) or (IV-3),
The dotted line indicates that a double bond may be present at any position],
X is an oxygen atom or =C(R ₂₁ )- or -C(H)(R ₂₁ )- [R ₂₁ is selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted; showing selected atoms or groups],
The dotted line indicates that the double bond may be present at either position]
The compound represented by can be mentioned.

In one embodiment, R ₁ in the above formula (I) is a hydrogen atom or each hydrogen atom may be substituted (in other words, may have a substituent) C 1-3 aliphatic and compounds that are groups. In the case where R ₁ in the above formula (I) is an aliphatic group, the fatty acid group has at least one (preferably one) substituent (preferably an amino group). 1 or 2 (preferably 1) aliphatic groups (preferably methyl groups). It is also preferred that R ₄ is an optionally substituted (preferably unsubstituted) amino group. It is also preferred that both R ₂ and R ₃ are hydrogen atoms or hydroxy groups.

Ring C in formula (I) is preferably a ring structure represented by the following formula (V-1), (V-2) or (V-3).

[In formulas (V-1), (V-2) and (V-3), the definitions and preferred embodiments of R ₁ to R ₄ and R ₂₁ are the same as those in formula (I). ]

When ring C is a ring structure represented by formula (V-3) above, at least one, preferably all, of R ₁ to R ₄ and R ₂₁ are preferably hydrogen atoms.

When ring A of formula (I) is represented by formula (II-1), R ₅ , R ₆ , R ₈ , R ₁₁ and R ₁₂ of formula (II-1) are each independently A hydrogen atom, a hydroxy group, or an optionally substituted (preferably unsubstituted) amino group is preferred. More preferably, at least one, preferably both, of R ₅ and R ₆ are hydroxy groups. Further, R ₇ may have one or more (preferably one) substituents (preferably hydroxy group) and a fatty acid group (preferably methyl group) having 1 or 2 (preferably 1) carbon atoms. is preferably

When ring A of formula (I) is represented by formula (II-2), R ₉ of formula (II-2) may have at least one substituent (preferably a methyl group). A good amino group is preferred. In addition, R ₁₀ is an aliphatic group (preferably methyl group) having 1 or 2 (preferably 1) carbon atoms which may have at least one substituent (preferably has no substituents) is preferred. Furthermore, it is preferable that each of R ₈ , R ₁₁ and R ₁₂ is independently a hydrogen atom, a hydroxy group, or an optionally substituted (preferably unsubstituted) amino group. More preferably, at least one, preferably both, of R ₈ and R ₁₁ are hydroxy groups. It is also preferred that R ₁₂ is a hydrogen atom.

When ring B of formula (I) is represented by formula (III-1), R ₁₃ to R ₁₅ and R ₂₀ (if present) in formula (III-1) are each independently hydrogen It is preferably an atom, a hydroxy group or an optionally substituted (preferably unsubstituted) amino group. In a preferred embodiment, R ₁₃ and R ₁₅ are an optionally substituted (preferably unsubstituted) amino group, R ₁₄ is a hydrogen atom, and R ₂₀ is a hydroxy group. Certain compounds are mentioned. Another preferred embodiment includes compounds in which R ₁₃ to R ₁₅ are hydroxy groups and Y is an oxygen atom.

When ring B in formula (I) is represented by formula (III-2), R ₁₆ to R ₁₉ in formula (III-2) each independently represent a hydrogen atom, a hydroxy group or a substituent It is preferably an amino group which may have (preferably no substituent). Among them, it is preferable that R ₁₆ is a hydroxy group. Also, R ₁₇ and R ₁₉ are preferably amino groups which may have a substituent (preferably have no substituents). It is also preferred that R ₁₈ is a hydrogen atom.

When L in formula (I) exists, L is preferably a compound represented by formula (IV-3) above, and more preferably a compound represented by formula (IV-3-a) below.

Preferred combinations of rings A to C include (1) a structure in which ring A is represented by (II-2), a structure in which ring B is represented by (III-1), and ring C is represented by (V-1) (2) a structure in which ring A is represented by (II-1), a structure in which ring B is represented by (III-2), and a ring C is represented by (V-2) and (3) a structure in which ring A is represented by (II-1), a structure in which ring B is represented by (III-1), and a structure in which ring C is represented by (V-3) a combination of structures that In the case of combinations of (1) or (2) above, compounds in which m is 0 and/or L is absent are preferred. In the case of the above combination (3), compounds in which m is 1 and/or L is represented by the above formula (IV-3) (preferably the above formula (IV-3-a)) are preferred.

Compounds of the present invention also include compounds represented by compound numbers 1 to 19 listed in Tables 1 and 2.

More specific examples of the compound represented by formula (I) above include Sisomicin (Compound No. 2), Rosarin (Compound No. 16) and Ribostamycin (Compound No. 1).

As used herein, "aliphatic group" means a straight or branched hydrocarbon chain that is fully saturated or contains one or more unsaturated bonds. Examples of aliphatic groups include linear or branched alkyl groups (e.g., methyl group, ethyl group, propyl group, isopropyl group, butyl group, 2-butyl group, 2-methylpropyl group, 1,1-dimethylethyl group, , pentyl group, 3-pentyl group, 3-methylbutyl group, hexyl group, 3-hexyl group, etc.), alkenyl group (e.g. vinyl group, allyl group, 2-propynyl group, 2-butenyl group, 3-methyl-2 -butenyl group, 3-hexenyl group, etc.), alkynyl group (e.g. ethynyl group, 1-propynyl group, 2-propynyl group, 1-butynyl group, 2-butynyl group, 3-butynyl group, 1-pentynyl group, 2 -pentynyl group, 3-pentynyl group, 4-pentynyl group, 1-hexynyl group, 2-hexynyl group, 3-hexynyl group, 4-hexynyl group, 5-hexynyl group, 4-methyl-2-pentynyl group, etc.) is mentioned.

As used herein, "each hydrogen atom may be substituted" means that at least one hydrogen atom of a group may be substituted with another atom or group. That is, the group in which each hydrogen atom may be substituted can be rephrased as a group which may have a substituent. In the present specification, substituents include, for example, a halogen atom, a cyano group, a benzyloxy group, a trifluoromethyl group, a hydroxy group, a lower fatty acid group, a lower alkoxy group, a lower alkanoyloxy group, an amino group, an amino group, a mono lower alkylamino group, di-lower alkylamino group, carbamoyl group, lower alkylaminocarbonyl group, di-lower alkylaminocarbonyl group, lower alkoxycarbonylamino group, carboxyl group, lower alkoxycarbonyl group, lower alkylthio group, lower alkylsulfinyl group, A lower alkylsulfonyl group, a lower alkanoylamino group, and a lower alkylsulfonamide group can be mentioned. Each hydrogen atom of these substituents may be substituted. In the present specification, unless otherwise specified, the term "each hydrogen atom may be substituted" means an unsubstituted group. Moreover, in this specification, "lower" means having 5 or less (preferably 3 or less) carbon atoms.

As the compounds of the present invention, commercially available products can be used, or each compound can be produced by a method known per se. For example, the distributor of each compound in the United States can be found from Drugs@FDA.

The compounds of the present invention include not only free forms but also pharmacologically acceptable salts thereof. Although pharmacologically acceptable salts vary depending on the type of compound, examples include alkali metal salts (sodium salts, potassium salts, etc.), alkaline earth metal salts (calcium salts, magnesium salts, etc.), aluminum salts, ammonium salts, etc. base addition salts such as inorganic base salts of and organic base salts such as trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N,N'-dibenzylethylenediamine, or hydrochloride, odorant Inorganic acid salts such as hydrohydride, sulfate, hydroiodide, nitrate, phosphate, citrate, oxalate, acetate, formate, propionate, benzoate, trifluoroacetic acid salts, and acid addition salts such as organic acid salts such as maleates, tartrates, methanesulfonates, benzenesulfonates, and paratoluenesulfonates.

When the compound of the present invention has isomers such as optical isomers, stereoisomers, positional isomers and rotational isomers, any one isomer and mixture thereof are also included in the compound of the present invention. For example, when at least one of compounds 1 to 19 has an optical isomer, the optical isomer resolved from the racemate is also included in the compounds of the present invention. These isomers can be separated by known synthetic techniques, separation techniques (e.g., concentration, solvent extraction, column chromatography, recrystallization, etc.), optical resolution techniques (e.g., fractional recrystallization method, chiral column method, diastereomer method, etc.). ), etc., can be obtained as single items.

The compound of the present invention may be a crystal, and the compound of the present invention includes both a single crystal form and a mixture of crystal forms. Crystals can be produced by applying a crystallization method known per se to crystallize.

The compounds of the present invention may be solvates (eg, hydrates, etc.) or non-solvates (eg, non-hydrates, etc.), both of which are included in the compounds of the present invention. be.

Compounds labeled with isotopes (eg, ³ H, ¹⁴ C, ³⁵ S, ¹²⁵ I, etc.) are also included in the compounds of the present invention.

Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules), and syrups. agents, emulsions, suspensions and the like. On the other hand, compositions for parenteral administration include, for example, injections and suppositories, and injections include intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, drip injections, and the like. It may also include dosage forms. These formulations contain excipients such as sugar derivatives such as lactose, sucrose, glucose, mannitol, sorbitol; starch derivatives such as maize starch, potato starch, alpha starch, dextrin; cellulose derivatives such as crystalline cellulose; gum arabic; dextran; organic excipients such as pullulan; and silicate derivatives such as light anhydrous silicic acid, synthetic aluminum silicate, calcium silicate and magnesium aluminometasilicate; carbonates such as calcium; inorganic excipients such as sulfates such as calcium sulfate), lubricants (e.g. stearic acid, metal stearates such as calcium stearate, magnesium stearate; talc; colloidal silica; waxes such as beeswax, gay wax; boric acid; adipic acid; sulfates such as sodium sulfate; glycol; fumaric acid; Sulfate; silicic anhydride, silicic acid such as silicic acid hydrate; and the above starch derivatives), binders (e.g., hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, macrogol, and the above excipients) ), disintegrants (e.g., low-substituted hydroxypropyl cellulose, carboxymethyl cellulose, carboxymethyl cellulose calcium, cellulose derivatives such as internally cross-linked sodium carboxymethyl cellulose; carboxymethyl starch, sodium carboxymethyl starch, cross-linked polyvinylpyrrolidone ), emulsifiers (e.g. bentonite, colloidal clays such as Veegum; metal hydroxides such as magnesium hydroxide, aluminum hydroxide; sodium lauryl sulfate, calcium stearate cationic surfactants such as benzalkonium chloride; and nonionic surfactants such as polyoxyethylene alkyl ethers, polyoxyethylene sorbitan fatty acid esters, sucrose fatty acid esters. ), stabilizers (paraoxybenzoic acid esters such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol and phenylethyl alcohol; benzalkonium chloride; phenols such as phenol and cresol; thimerosal; dehydroacetic acid; and sorbic acid), flavoring agents (for example, commonly used sweeteners, acidulants, flavors, etc.), diluents, etc., and are manufactured by known methods .

The dosage of the compound of the present invention, which is the active ingredient of the medicament or agent of the present invention, can vary depending on various conditions such as the type of compound, symptoms, age, body weight, and drug acceptability of the subject to be administered. In the case of parenteral administration, the lower limit is 0.1 mg (preferably 0.5 mg) and the upper limit is 1000 mg (preferably 500 mg), and the lower limit is 0.01 mg (preferably 0.05 mg). , up to 100 mg (preferably 50 mg) can be administered to adults 1 to 6 times per day. The dose may be increased or decreased according to symptoms. In particular, when the compound of the present invention is already on the market as a drug for diseases other than the above diseases, the dose of each compound can be appropriately selected within the range of confirmed safety.

The medicament or agent of the present invention may be used in combination with surgical therapy for MG (e.g., thymectomy, etc.), or other therapeutic or prophylactic agent for MG (hereinafter sometimes referred to as "existing drug") (e.g., : immunosuppressant, cholinesterase inhibitor, immunoglobulin, etc.). Accordingly, in one aspect of the present invention, medicaments for the treatment or prophylaxis of GM are provided comprising a compound of the present invention and one or more existing drugs.

Examples of the immunosuppressant include steroids (eg, prednisone, prednisolone, Rinderone, etc.), calcineurin inhibitors (eg, tacrolimus, cyclosporine, etc.), azathioprine, cyclophosphamide, rituximab and the like. Examples of the cholinesterase inhibitor include ambenonium (trade name: Myterase), pyridostigmine (trade name: mestinone), distigmine (trade name: ubretide), neostigmine (trade name: wagostigmine), edrophonium (trade name: antirex), and the like. mentioned. These compounds or salts thereof can also be used in appropriate combinations.

As mentioned above, remission of MG is difficult to achieve, so treatment for MG is usually long-term and the side effects of administration of existing drugs such as immunosuppressants and cholinesterase inhibitors are increased. Therefore, by using the pharmaceutical of the present invention as an adjuvant for existing drugs, it is possible to reduce the dose of existing drugs and suppress side effects. In addition, as a treatment policy for MG, oral steroids are used in small amounts and calcineurin inhibitors are actively used from an early stage, and the remaining MG symptoms are treated with a strong and fast-acting treatment to improve in a short period of time (early intensive treatment strategy). Proposed. The medicaments of the invention may also be useful in such early intensive treatment strategies.

When used as a combination drug, such combination drug can be formulated together with the compounds of the invention and administered in a single formulation, or can be formulated separately from the compounds of the invention (e.g., kit ), the drug or agent of the present invention can be administered by the same or different route, simultaneously or with a time lag. In addition, the dose of these concomitant drugs may be the amount usually used when the drug is administered alone, or the dose can be reduced from the amount usually used.

EXAMPLES The present invention will be described in more detail with reference to Examples below, but the present invention is not limited to these.

Example 1: Computer simulation In this example, the Bioindustry Information Consortium (JBIC: 10th floor, TIME24 Building, 2-4-32 Aomi, Koto-ku, Tokyo 135-8073) provided free of charge for drug development support. A collection of molecular simulation calculation programs created: myPresto was used. First, the three-dimensional structure information (ID: 2BG9) of the AchRα subunit was obtained from the protein data base (PDB). Then, using a program called MolSite included in myPresto, we searched for the molecular pocket that exists near the MIR site of AchR. Next, a compound library docking simulation was performed for these pockets using a program named (sievgene_M).

Top-ranking compounds were selected from the scores shown by this result. In addition to these, the delta G value, which is the free energy change in the simulated binding, and the root-mean-square deviation of atomic positions of the compound, which is an indicator of the accuracy of the binding prediction, RMSD) values were calculated, and secondary screening was performed with reference to these results. Compound groups with high scores in the results were summarized as a list (Table 1 above). In addition, only compound pockets closer to MIR were targeted for screening, and some of the hit compounds were summarized as a list (Table 2 above).

Example 2: Radioimmunoassay The assay was performed using RSR Limited (Avenue Park Pentwyn Cardiff CF23 8HE
The operating instructions for RiaRSR ^™ AChRAb, sold by Co., United Kingdom, were followed. The test results described herein were performed by SRL Co., Ltd. (2-1-1 Nishi-Shinjuku, Shinjuku-ku, Tokyo).

Table 3 shows the results. It was confirmed that all of Rosarin, ribostamycin and sisomicin can inhibit the binding of AChR to autoantibodies (anti-AChR antibodies). Among them, Sisomicin was shown to have the highest inhibitory effect.

Example 3: Evaluation of efficacy of hit compounds Using motor neurons, efficacy of hit compounds was assessed. First, human iPS cells were induced to differentiate into motor neurons. Human iPS cells maintained in culture were detached using TrypLE Express (Thermo Fisher Scientific Inc.) and centrifuged at 120 xg and 25°C for 5 minutes. Then, remove the supernatant with an aspirator and add 2 mL of Dulbecco's phosphate buffer saline (-) (D-PBS (-), Nacalai Tesque, Kyoto) containing 0.15% bovine serum albmin (BSA, Thermo Fisher Scientific Inc.). was added and suspended. DMEM/F12 (Fujifilm Wako Pure Chemical Industries, Ltd., Osaka): Neurobasal medium (Thermo Fisher Scientific Inc.) = 1:1, 10% Knockout Serum Replacement (Thermo Fisher Scientific Inc.), 1% Non-Essential Amino Acid (Sigma-Aldrich Inc., MO, USA), 1% GlutaMAX (Thermo Fisher Scientific Inc.) and 3 as a differentiation inducer to neural crest cells µM CHIR99021 (Cayman Chemical Company Inc., MI, USA), 2.5 µM Dorsomorphin (Cayman Chemical Company Inc.) and 10 µM SB431542 (Tokyo Chemical Industry Co., Ltd.) were added, and the previously prepared human iPS cells were added to 0.5 × 10 ⁶ cells were seeded and cultured for 3 days. At that time, 10 µM Y-27632 was added to prevent cell death of human iPS cells. MN basal medium (DMEM/F12: Neurobasal medium = 1:1, 10% Knockout Serum Replacement, 1% Non-Essential Amino Acid, 1% GlutaMAX, 1% B-27 (Thermo Fisher Scientific Inc. .), 1% N-2 (Thermo Fisher Scientific Inc.), 0.1 mM L-ascorbic acid (Sigma-Aldrich Inc.)), 3 μM CHIR99021, 2.5 μM Dorsomorphin and 10 μM SB431542 were added. 1 μM Purmmorphamine (Cayman Chemical Company Inc.), 1 μM Smoothened agonist (SAG) Dihydrochloride (AdipoGen Life Sciences Inc., Basel, Swiss), 100 ng/ml Sonic hedgehog (SHH) ( Pepro Tech Inc. NJ, USA) was added and cultured for 4 days. After that, 1 μM Purmmorphamine, 1 μM SAG Dihydrochloride, 100 ng/ml SHH, and 1 μM All-trans retinoic acid (Fujifilm Wako Pure Chemical Industries, Ltd.) that provides positional information on the chest side were added to the MN basal medium and cultured. Eleven to 14 days after initiation of differentiation induction, 1 mL of Accutase (Innovative Cell Technologies Inc., CA, USA) was added, and the cells were detached and collected. Then, 1000 cells/well were seeded in a 96-well plate (Sumitomo Bakelite Co., Ltd., Tokyo) and cultured in MN basal medium for 10 to 20 days to form spheres.

Next, we investigated gene expression levels and protein expression patterns in the obtained motor neurons. Remove the medium from the human iPS cell-derived NMJ model, add 2 mL of Dulbecco's phosphate buffer saline (-) containing 0.15% bovine serum albmin, wash, add 500 μL of ISOGEN (Nippon Gene Co., Ltd., Tokyo), and use a cell scraper ( Sumitomo Bakelite Co., Ltd.). In addition, undifferentiated human iPS cells were detached with TrypLE Express and centrifuged at 120 xg and 25°C for 5 minutes. After that, the supernatant was removed with an aspirator, and 500 µL of ISOGEN was added and collected. Add 100 μL of chloroform (Fujifilm Wako Pure Chemical Industries, Ltd.) to each of the human iPS cell-derived NMJ recovery solution and the undifferentiated human iPS cell recovery solution, shake vigorously for 15 seconds, leave at room temperature for 3 minutes, and then mix at 12000×g and 4°C. and centrifuged for 10 minutes. Only the uppermost aqueous phase was recovered, 250 μL of 2-propanol (Fuji Film Wako Pure Chemical Industries, Ltd.) was added, left at room temperature for 10 minutes, and then centrifuged at 12000×g at 4° C. for 10 minutes. The supernatant was removed, 1 mL of 70% ethanol was added, and the mixture was vortexed and then centrifuged at 7500×g and 4° C. for 5 minutes. Thereafter, the supernatant was removed, air-dried for 15 minutes, and 30 μL of diethylpyrocarbonate (DEPC)-treated water (Nacalai Tesque, Inc.) was added to obtain total RNA.

Reverse transcription reactions were performed using the Verso cDNA Synthesis Kit (Thermo Fisher Scientific Inc.). Add 4 μL of 5×cDNA Synthesis buffer, 2 μL of dNTP Mix, 1 μL of RNA Primer (anchored oligo dT), 1 μL of RT Enhancer, 1 μL of Verso Enzyme Mix and 2 μg/tube of total RNA prepared by the above method, and then DEPC. Treated water was added to a 200 μL PCR tube for a total volume of 20 μL. Then, using a thermal cycler (PC320, Astec Co., Ltd., Fukuoka), reaction was carried out (42°C: 31 minutes, 95°C: 2 minutes, 4°C) to prepare cDNA. Power SYBR (registered trademark) Green PCR Master Mix (x2) (applied biosystems Inc., MA, USA) 10 μL, 50 μM Forward Primer 0.5 μL, 50 μM Reverse Primer 0.5 μL to the obtained cDNA 100 ng/1 μL and 8 μL of DEPC-treated water were added to a 100 μL PCR tube. Real-time PCR using Rotor-Gene Q (QIAGEN Sciences Inc, MD, USA) (holding stage: 95°C 10 minutes, cycling stage: 95.0°C 30 seconds, 50°C 30 seconds and 72.0°C 1 minute for 45 cycles, get signal : 72.0°C). The primers used in real-time PCR are as follows.

hChAT-Fw (Fasmac Co., Ltd., Kanagawa) GGAGGCGTGGAGCTCAGCGACACC (SEQ ID NO: 1)
hChAT-Rv (Fasmac Co., Ltd.) CGGGGAGCTCGCTGACGGAGTCTG (SEQ ID NO: 2)
hIslet1(primer 1)-Fw (Fasmac Co., Ltd.) AAGGACAAGAAGCGAAGCAT (SEQ ID NO: 3)
hIslet1(primer 1)-Rv (Fasmac Co., Ltd.) TTCCTGTCATCCCCTGGATA (SEQ ID NO: 4)
hIslet1(primer 2)-Fw (Fasmac Co., Ltd.) GTTACCAGCCACCTTGGAAA (SEQ ID NO: 5)
hIslet1(primer 2)-Rv (Fasmac Co., Ltd.) GGACTGGCTACCATGCTGTT (SEQ ID NO: 6)
Olig2-Fw (Fasmac Co., Ltd.) AGCTCCTCAAATCGCATCC (SEQ ID NO: 7)
Olig2-Rv (Fasmac Co., Ltd.) ATAGTCGTCGCAGATTTCG (SEQ ID NO: 8)
h18S-Fw (Fasmac Co., Ltd.) TCAACTTTCGATGGTAGTCGCC (SEQ ID NO: 9)
h18S-Rv (Fasmac Co., Ltd.) TCCTTGGATGTGGTAGCCGTTTCT (SEQ ID NO: 10)

The results are shown in FIGS. 5 and 6. FIG. 5 and 6 confirmed the presence of motor neurons.

Differentiation of human iPS cell-derived skeletal myoblasts was performed. Human iPS cell colonies were cultured on Matrigel-coated 6-well plates (CORNING Inc.) for 6 days by adding DMEM/F12 (Fuji Film Wako Pure Chemical Industries, Ltd.), 1x concentration of ITS (Thermofisher) and 3.5μM CHIR99021. Then, the cells were further cultured for 10 days under the condition that DMEM/F12 was supplemented with ITS (Thermofisher) at a concentration of 1 and 20 ng/ml bFGF (Fuji Film Wako Pure Chemical Industries, Ltd.). Subsequently, the cells were cultured for 10 days under the condition of DMEM/F12 supplemented with ITS (Thermofisher) at a concentration of 1:1 to obtain human iPS cell-derived skeletal myoblasts.

Next, DMEM (Low Glucose) (Fujifilm Wako Pure Chemical Industries, Ltd.), 5% FCS (Cytiva Inc., ON, Canada), 10 μM SB431542 and 10 μM were added to a Matrigel-coated 6-well plate (CORNING Inc.). N-[(3,5-Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-1,1-dimethylethyl ester (DAPT, Sigma-Aldrich Inc.) was added to a T75 flask (Thermo Fisher Scientific Inc.). 1/16 amount of human iPS cell-derived myoblasts collected from the cells were seeded and induced to differentiate into skeletal muscle cells.

Finally, the motor neurons and skeletal muscle cells were co-cultured and cultured for about a week. After collecting the prepared motor neuron spheres, 8 spheres/well were added to a 6-well plate in human iPS cell-derived skeletal muscle cell culture, and MN basal medium and 10 ng/mL CNTF (Pepro Tech Inc.) were added. , 10 ng/mL BDNF (Bio Legend Inc., CA, USA), 10 ng/mL NT-3 (Bio Legend Inc.) and 10 ng/mL GDNF (Pepro Tech Inc.) were added and co-cultured. It was confirmed that the nerve axons extended from the motor neurons and joined to the surrounding skeletal muscle cells. FIG. 7 shows the presence of a morphological neuromuscular junction.

Figures 8-10 show that individual skeletal muscle cells are contacted by the neuromuscular junction, which is a cluster of acetylcholine receptors. Remove the medium from the human iPS cell-derived NMJ model, wash with 2 mL of D-PBS (-) containing 0.15% BSA, add 1 mL of 4% paraformaldehyde (Fujifilm Wako Pure Chemical Industries, Ltd.), and incubate at room temperature. Let stand for 10 minutes. After that, remove 4% paraformaldehyde, wash with 2 mL of a mixture (TBS-T) of 1× Tris Buffered Saline (Nacalai Tesque, Inc.) and 0.1 w/v% Tween20 (Nacalai Tesque, Inc.), 1 mL of Immunoblock (KAC Co., Ltd., Kyoto) containing Block Ace (KAC Co., Ltd.) was added and allowed to stand at 4°C. After 24 hours, the immunoblock containing Block Ace was removed, and the Anti-HB9 mouse monoclonal antibody (Divelopmental Studies Hybridoma Bank, IA, USA) diluted 100-fold with an equal volume mixed solution of the immunoblock containing Block Ace and TBS-T. , and Anti-Neurofilament rabbit polyclonal antibody (Sigma-Aldrich Inc.) (100 μL each) were added and allowed to stand at 4°C. After 24 hours, wash twice with 1 mL of TBS-T, and Alexa Fluor 546-labeled donkey (anti-rabbit IgG (H+L)) diluted 100-fold with an equal volume mixture of Immunoblock containing Block Ace and TBS-T. 100 μL each of IgG (Thermo Fisher Scientific Inc.) and Alexa Fluor 488-labeled donkey (anti-mouse IgG (H+L)) IgG (Thermo Fisher Scientific Inc.) were added and allowed to stand at 4°C. After 24 hours, wash three times with 2 mL of TBS-T, add 1 mL of 4,6-diamidino-2-phenylindole (DAPI, Molecular Probes Inc., OR, USA) diluted 1000-fold with TBS-T, and store at room temperature. and left for 5 minutes. Then, it was washed three times with 2 mL of TBS-T and observed under a fluorescence microscope (ECLIPSE Ti2-E/B, Nikon Corporation, Tokyo).

Finally, the resulting skeletal muscle-nerve co-culture system with neuromuscular junctions was used to evaluate the efficacy of hit compounds. An overview of the evaluation method is shown in FIG. 20% MG patient serum (AChR Ab "Cosmic II" positive control, Cosmic Corporation, Tokyo) was added to the prepared human iPS cell-derived NMJ model to make the MG model, and the hit compound sisomicin was added at a concentration of 10 μM. The same amount of the solvent was added as the sample, and the culture was continued for 24 hours. The medium was removed with an aspirator, 1 μL of α-BTX CF (registered trademark) 555 conjugate (Biotium Inc., CA, USA) was added to 1 mL of MN basal medium, and left at 37° C. for 60 minutes. Then, it was washed twice with 1 mL of MN basal medium, and α-BTX CF 555 per field of view (1.69 mm ² ) was observed under a fluorescence microscope (ECLIPSE Ti2-E/B) to evaluate the efficacy of the hit compounds. The number of AChRs detected by conjugate was counted in 5 randomly selected fields.

The results are shown in FIG. From FIG. 12, it was confirmed that the addition of the hit compound significantly inhibited the internalization of AChR.

From the above results, it was confirmed that the hit compound can inhibit the binding of patient autoantibodies to human iPS cell-derived neuromuscular junctions, and further suppress the internalization of AChR due to binding with the autoantibodies. Therefore, it is strongly suggested that these compounds exert therapeutic or preventive effects on MG.

The compounds of the invention are useful for treating or preventing myasthenia gravis. Compounds of the invention are also useful as a combination drug for the treatment of myasthenia gravis. In particular, drugs that have already been marketed as drugs for other diseases have accumulated clinical and non-clinical data such as safety, and there is already a library of peripheral compounds, so they can be developed quickly and at low cost. , it may be possible to develop drugs that can treat or prevent myasthenia gravis.

Claims (10)

Formula (I) below:

[In formula (I),
R ₁ to R ₄ are each independently an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group, an amino group in which each hydrogen atom may be substituted, or an aliphatic group having 1 to 3 carbon atoms. shows
Ring A is the following formula (II-1) or formula (II-2):

[In formula (II-1) or formula (II-2),
R ₅ to R ₁₂ are each independently an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group, an amino group in which each hydrogen atom may be substituted, or an aliphatic group having 1 to 3 carbon atoms indicates],
Ring B is the following formula (III-1) or formula (III-2):

[In formula (III-1) or formula (III-2),
R ₁₃ to R ₁₉ each independently represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted;
Y is an oxygen atom or —C(H)(R ₂₀ )—[R ₂₀ represents an atom or group selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted; ],
m represents an integer of 0 to 2,
L may or may not be present, and if present, the following formula (IV-1), (IV-2) or (IV-3):

[In formula (IV-1), (IV-2) or (IV-3),
The dotted line indicates that a double bond may be present at any position],
X is an oxygen atom or =C(R ₂₁ )- or -C(H)(R ₂₁ )- [R ₂₁ is selected from the group consisting of a hydrogen atom, a hydroxy group and an amino group in which each hydrogen atom may be substituted; showing selected atoms or groups],
The dotted line indicates that the double bond may be present at either position]
A therapeutic or prophylactic agent for myasthenia gravis, comprising one or more compounds selected from the group consisting of compounds represented by and compounds represented by compound numbers 1 to 19 or salts thereof. 2. The therapeutic or prophylactic agent according to claim 1, wherein _R1 in formula (I) is a hydrogen atom or an aliphatic group having 1 or 2 carbon atoms in which each hydrogen atom may be substituted. 3. The therapeutic or prophylactic agent according to claim 1 or 2, wherein R ₂ to R ₄ in formula (I) are each independently a hydrogen atom, a hydroxy group, or an amino group in which each hydrogen atom may be substituted. . The therapeutic or prophylactic agent according to any one of claims 1 to 3, wherein R ₇ in formula (II-1) is an aliphatic group having 1 or 2 carbon atoms in which each hydrogen atom may be substituted. . The therapeutic or prophylactic agent according to any one of claims 1 to 4, wherein R ₉ in formula (II-2) is an amino group in which each hydrogen atom may be substituted. The therapeutic or prophylactic agent according to any one of claims 1 to 5, wherein R ₁₀ in formula (II-2) is an aliphatic group having 1 or 2 carbon atoms in which each hydrogen atom may be substituted. . Each of R ₅ , R ₆ , R ₈ , R ₁₁ and R ₁₂ in formula (II-1) or formula (II-2) is independently a hydrogen atom, a hydroxy group, or each hydrogen atom is substituted. The therapeutic or prophylactic agent according to any one of claims 1 to 6, which is a good amino group. Claim 1, wherein R ₁₃ to R ₁₉ in formula (III-1) or formula (III-2) are each independently a hydrogen atom, a hydroxy group, or an amino group in which each hydrogen atom may be substituted. 8. The therapeutic or prophylactic agent according to any one of 1 to 7. The therapeutic or prophylactic agent according to any one of claims 1 to 8, wherein the compound represented by formula (I) is sisomicin, rosarin or ribostamycin. The therapeutic or prophylactic agent according to any one of claims 1 to 9, further comprising an immunosuppressant or a cholinesterase inhibitor.

Images