JP2023066122A - Medicine that targets acc2 - Google Patents

Abstract

To provide a nucleic acid that suppresses ACC2 expression or antibody that inhibits ACC2 enzymatic activity for preventing or treating TGCV, and to provide a novel nucleic acid that suppresses ACC2 expression.SOLUTION: We have found that suppressing or inhibiting the expression or enzymatic activity of ACC2 may be effective in preventing or treating TGCV. A pharmaceutical composition containing a nucleic acid that suppresses ACC2 expression or an antibody that inhibits ACC2 enzymatic activity is useful for preventing or treating TGCV. Furthermore, we have found that a novel nucleic acid directed against a specific target sequence or a novel nucleic acid having a specific sequence has an excellent ACC2 expression-suppressing activity. A pharmaceutical composition containing the novel nucleic acid as an active ingredient is useful for preventing or treating ACC2-related diseases.SELECTED DRAWING: None

Description

The present invention provides a preventive or therapeutic drug for triglyceride deposit cardiovasculopathy (TGCV), comprising a nucleic acid that suppresses the expression of ACC2 (Acetyl-CoA Carboxylase 2) or an antibody that inhibits the enzymatic activity of ACC2. Regarding the composition.
The present invention also relates to novel nucleic acid drugs that target ACC2. More particularly, it relates to a novel nucleic acid against ACC2 useful as a pharmaceutical composition for the prevention or treatment of NASH (Nonalcoholic steatohepatitis), TGCV, diabetes, heart failure, or the like.

TGCV is a result of intracellular metabolic abnormalities of long chain fatty acids (LCFA), which are the energy source of the heart, resulting in insufficient energy supply and neutral fat (Triglyceride, TG) to cardiomyocytes and coronary vascular smooth muscle cells. It is an intractable disease that causes accumulation and presents with severe heart failure, arrhythmia, ischemic heart disease, and the like.
TGCV is classified into primary caused by homozygosity of ATGL (Adipose triglyceride lipase) gene mutation, which is an essential enzyme for intracellular TG degradation, and idiopathic with unknown genetic cause. is extremely low, and TG accumulation has been reported (Non-Patent Document 1). Furthermore, findings in TGCV patients include palpitations, shortness of breath, dyspnea on exertion, etc. caused by decreased cardiac function, and deaths have been reported, resulting in a poor prognosis (Non-Patent Document 2). Similar to the clinical data, fatty acid oxidation in the myocardium is extremely reduced in ATGL homozygous mice, which are nonclinical disease models of TGCV, and severe heart failure and a decrease in survival rate due to accumulation of TG and deterioration of cardiac function. It has been confirmed (Non-Patent Document 3).
On the other hand, no therapeutic drug for TGCV has been marketed so far, and establishment of a therapeutic method for this disease is an important clinical issue.

ACC (Acetyl-CoA Carboxylase) is an enzyme that carboxylates Acetyl-CoA to Malonyl-CoA and is involved in fatty acid metabolism. There are two isoforms of ACC, ACC1 and ACC2.
ACC1 is highly expressed particularly in the liver, adipose tissue, etc., localizes in the cytoplasm, and contributes to fatty acid synthesis. On the other hand, ACC2 is highly expressed mainly in tissues involved in energy production such as skeletal muscle and cardiac muscle. inhibits the β-oxidation of
Since ACC1-deficient mice are lethal in the fetal stage, a selective inhibitor that inhibits ACC2 without inhibiting ACC1 is desired (Non-Patent Document 4).

Patent Document 1 describes specific sequences of antisense oligonucleotides that suppress the expression of ACC1 or ACC2 or ACC1 and ACC2 to improve or reduce the severity of obesity, diabetes, insulin resistance, or the like. ing. Examples provide data showing that treatment of diet-induced obesity model mice with antisense oligonucleotides targeting ACC1 or ACC2 reduced the expression level of the target.
Patent Document 2 describes specific siRNAs for ACC2, but does not describe any data indicating their activity values.
In addition, Patent Documents 3 and 4 describe siRNA target sequences for a large number of genes, and also describe multiple siRNA target sequences for human ACC2. However, no biological data including ACC2 expression suppression are described.

WO2006/110775 WO2005/007859 WO2004/045543 WO2005/116204

European Heart Journal, Volume 36, Issue 9, 1 March 2015, Page 580 Journal of the Japanese Society of Internal Medicine, Vol. 106, No. 11, 2385-2390, 2017 SCIENCE 5 May 2006 Vol 312, Issue 5774 pp. 734-737 PNAS August 23, 2005 102 (34) 12011-12016 PNAS September 2, 2003 100 (18) 10207-10212 Journal of Hepatology Volume 73, Issue 4, October 2020, Pages 896-905

An object of the present invention is to provide a nucleic acid that suppresses the expression of ACC2 or an antibody that inhibits the enzymatic activity of ACC2 as a pharmaceutical composition for the prevention or treatment of TGCV.
Another object of the present invention is to provide a novel nucleic acid having excellent activity of specifically suppressing ACC2 expression.

Excess TG accumulation in cells is considered to be one of the causes of NASH or diabetes. Previously, ACC2 inhibitors have been shown to be effective in the treatment of NASH or diabetes. , suggesting improvement in symptoms (Non-Patent Documents 5 and 6). On the other hand, there is no literature showing that ACC2 inhibition is effective against diseases such as TGCV, in which fatty acid oxidation is reduced and fatty acids cannot be used as energy.

As a result of intensive research, the present inventors have found that suppression of ACC2 expression in the myocardium promotes fatty acid oxidation, and both energy supply to the myocardium and reduction of fat accumulation in the myocardium are effective in preventing or treating TGCV. I found that there is a possibility. In other words, the inventors have found that an ACC2 inhibitor can be used for the prevention or treatment of TGCV. Furthermore, we succeeded in synthesizing a novel nucleic acid (siRNA) having an excellent activity (knockdown activity) to specifically suppress ACC2 expression, and targeted a target region related to nucleic acid knockdown activity in ACC2 mRNA. Found it. The nucleic acids are sufficiently safe for use as pharmaceuticals.

That is, the present invention relates to the following.
(1) A pharmaceutical composition for the prevention or treatment of triglyceride-accumulating myocardiovasculopathy, comprising a nucleic acid that suppresses the expression of ACC2 or an antibody that inhibits the enzymatic activity of ACC2.
(2) The pharmaceutical composition according to (1), wherein the nucleic acid is siRNA, antisense oligonucleotide, miRNA or shRNA.
(3) The pharmaceutical composition according to (1), wherein the nucleic acid is siRNA or antisense oligonucleotide.
(4) At least 15 or more bases complementary to the base sequence consisting of positions 831-850, 3201-3220, 3619-3641, 4158-4183 or 4844-4867 of SEQ ID NO: 325 A nucleic acid that specifically suppresses the expression of ACC2, comprising an oligonucleotide consisting of 15 to 30 nucleotides having a nucleotide sequence of
(5) The nucleic acid according to (4), which comprises the base sequence of SEQ ID NO: 319, 320, 321, 322, 323 or 324.
(6) The nucleic acid according to (4) or (5), which has 4 or more base mismatches when hybridized with the base sequence of SEQ ID NO:327.
(7) SEQ. , 224, 226, 228, 230, 232, 240, 244, 258, 264, 268, 270, 272, 284, 300, 308, 310 or 312; or SEQ ID NO: 4, 6, 8, 12, 42 , 46, 48, 50, 52, 54, 78, 82, 94, 96, 124, 128, 154, 156, 172, 192, 204, 216, 222, 224, 226, 228, 230, 232, 240, 244 , 258, 264, 268, 270, 272, 284, 300, 308, 310 or 312, in which 1 to 3 bases are deleted, substituted or inserted;
A nucleic acid that specifically suppresses the expression of ACC2, comprising:
(8) A double-stranded nucleic acid having a combination of any of the following oligonucleotides:
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 6;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 8;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 11 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 12;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 41 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 42;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 45 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 46;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 47 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 48;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 49 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 50;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 51 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 52;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 53 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 54;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 77 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 78;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 81 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 82;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 93 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 94;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 95 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 96;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 123 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 124;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 127 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 128;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 153 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 154;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 155 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 156;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 171 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 172;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 191 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 192;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 203 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 204;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 215 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 216;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 221 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 222;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 223 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 224;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 225 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 226;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 227 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 228;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 229 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 230;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 231 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 232;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 239 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 240;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 243 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 244;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 257 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 258;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 263 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 264;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 267 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 268;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 269 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 270;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 271 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 272;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 283 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 284;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 299 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 300;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 307 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 308;
An oligonucleotide having the nucleotide sequence of SEQ ID NO:309 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:310, or an oligonucleotide having the nucleotide sequence of SEQ ID NO:311 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:312.
(9) The nucleic acid according to claim 8, which specifically suppresses the expression of ACC2.
(10) The nucleic acid according to any one of (4) to (9), which is siRNA, antisense oligonucleotide, miRNA or shRNA.
(11) The nucleic acid according to (10), wherein one or both strands of the siRNA contain 3′-terminal overhangs.
(12) A pharmaceutical composition containing the nucleic acid according to any one of (4) to (11).
(13) The pharmaceutical composition according to (12), which is for the prevention or treatment of ACC2-related diseases.
(14) The pharmaceutical composition according to (13), wherein the disease is non-alcoholic steatohepatitis, triglyceride-accumulating myocardiovascular disease, diabetes or heart failure.

(15) A method for preventing or treating triglyceride-accumulated myocardiovasculopathy, which comprises the step of administering a nucleic acid that suppresses the expression of ACC2 or an antibody that inhibits the enzymatic activity of ACC2.
(16) A nucleic acid that suppresses the expression of ACC2 or an antibody that inhibits the enzymatic activity of ACC2 for the prevention or treatment of triglyceride-accumulated myocardiovasculopathy.
(17) A method for preventing or treating a disease associated with the ACC2 gene, comprising administering the nucleic acid according to any one of (4) to (11).
(18) The nucleic acid according to any one of (4) to (11) for preventing or treating diseases associated with the ACC2 gene.
(19) The method of (17) or the nucleic acid of (18), wherein the disease is nonalcoholic steatohepatitis, triglyceride myocardiovascular disease, diabetes or heart failure.

(20) at least 15 bases complementary to the base sequence consisting of positions 831-850, 3201-3220, 3619-3641, 4158-4183 or 4844-4867 of SEQ ID NO: 325 ACC2 expression in human retinal pigment epithelial cells is specifically suppressed by 55 to 100% at a concentration of 20 nmol / L in vitro, comprising an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of Nucleic acid to do.

The pharmaceutical composition of the present invention contains a nucleic acid that suppresses the expression of ACC2 or an antibody that inhibits the enzymatic activity of ACC2, and is very useful as a drug for preventing or treating TGCV.
In addition, the novel nucleic acid of the present invention exhibits excellent ACC2 expression-suppressing activity, and is very useful as a drug, particularly as a drug for the prevention and/or treatment of ACC2-related diseases such as TGCV, NASH, diabetes, or heart failure. is.

Evaluation of cardiac lipid levels in Atgl knockout mice or Atgl/Acc2 double knockout mice Cardiac function assessment in Atgl knockout mice or Atgl/Acc2 double knockout mice Survival assessment in Atgl knockout mice or Atgl/Acc2 double knockout mice Evaluation of in vivo knockdown activity by Acc2 siRNA administration in Atgl knockout mice Effect on cardiac function by Acc2 siRNA administration in Atgl knockout mice

The terms used herein have the meanings commonly used in the art unless otherwise specified.
In the present invention, genetic engineering techniques known in the art can be used. See, for example, Molecular Cloning, A Laboratory Manual, Forth Edition, Cold Spring Harbor Laboratory Press (2012), Current Protocols Essential Laboratory Techniques, Current Protocols cols (2012) and the like.

Knockout mice can be produced by known methods such as a method using homologous recombination, a method using artificial nuclease TALEN, a method using CRISPR-Cas, and the like.

"Nucleic acid" means all nucleic acids known in the art as pharmaceutically acceptable nucleic acids. Examples include siRNA, antisense oligonucleotides, shRNA, miRNA, ribozymes, aptamers and the like. siRNA also includes single-stranded oligonucleotide siRNA (see WO2015/168661, etc.). In the case of antisense oligonucleotides, they may form double-stranded oligonucleotides together with hybridizable sequences (see WO2013/089283, etc.).

The term “antibody” refers to any antibody that can be used as a pharmaceutical, such as a human-derived antibody, mouse-derived antibody, rat-derived antibody, rabbit-derived antibody, or goat-derived antibody. It often means whole antibodies, antibody fragments (eg, F(ab') ₂ , Fab', Fab or Fv fragments), chimerized antibodies, humanized antibodies, fully human antibodies, and the like.

One aspect of the present invention includes "a pharmaceutical composition for preventing or treating TGCV, comprising a nucleic acid that suppresses ACC2 expression or an antibody that inhibits ACC2 enzymatic activity".

"ACC2" is a known protein. Human ACC2 mRNA sequence (GenBank: NM_001093.4) is shown in SEQ ID NO: 325, and amino acid sequence (GenPept: NP_001084.3) is shown in SEQ ID NO: 326. "ACC2" in the present invention is not limited to these sequences, and as long as the function of the protein consisting of the amino acid sequence of SEQ ID NO: 326 is maintained, there are no restrictions on the number of amino acid or mRNA mutations or mutation sites. and

Examples of the “nucleic acid that suppresses ACC2 expression” include nucleic acids that target the gene of human ACC2 and suppress its expression. Nucleic acids include siRNA (including single-stranded oligonucleotide siRNA), antisense oligonucleotides, shRNA, miRNA, expression vectors, and the like.
In general, suppression of gene expression means suppression of 50% or more of the expression level of the original mRNA or protein when compared with a control group. The nucleic acid can be designed and synthesized by a known method, and is expressed in, for example, Patent Documents 1 to 4, Wang (J Biochem Mol Toxicol. 2021 Jul; 35(7): e22797), etc. Nucleic acids capable of suppressing 50% or more of the amount, such as ACC2 siRNA described in Example 5 below.

"Antibodies that inhibit the enzymatic activity of ACC2" include antibodies that inhibit human ACC2 activity. In other words, it means an antibody that, by inhibiting human ACC2 activity, causes a decrease in Malonyl-CoA synthesis, which is downstream of ACC2 in the fatty acid oxidation process. The antibody can be designed and synthesized by known methods, for example, Abu-Elheiga et al. (PNAS February 15, 2000 97 (4) 1444-1449) and John et al. ) and the like.

Another aspect of the present invention includes a novel "nucleic acid that specifically suppresses the expression of ACC2".
The target gene of the nucleic acid is ACC2, and examples thereof include, but are not limited to, human ACC2, mouse Acc2, and the like.
"Specifically inhibit" means not inhibiting off-targets, particularly ACC1.

The novel nucleic acid of the present invention is complementary to the nucleotide sequence consisting of positions 831-850, 3201-3220, 3619-3641, 4158-4183 or 4844-4867 of SEQ ID NO:325. Nucleic acids specifically suppressing the expression of ACC2, including oligonucleotides consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more.

The novel nucleic acid of the present invention may further contain a base sequence complementary to said base sequence. The target regions are regions of the human ACC2 mRNA that are particularly associated with nucleic acid knockdown activity. Oligonucleotides "complementary" to the target region are included in the novel nucleic acids of the present invention as long as they are substantially complementary sequences, regardless of length or nucleotide modifications or mutations. "Substantially complementary sequence" means an oligo having at least 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more homology with the complete complementary sequence of the above base sequence Nucleotides. Here, for homology, for example, Altschul et al. (The Journal of Molecular Biology, 215, 403-410 (1990).) by using the search program BLAST using the algorithm developed, similarity is indicated by a score. .

The "base sequence of at least 15 bases or more complementary to the base sequence" means a base sequence complementary to the base sequence by at least 15 to 30 bases. Preferably, it is a base sequence complementary to at least 15 to 25 bases, more preferably a base sequence complementary to at least 15 to 20 bases.

The "oligonucleotide consisting of 15 to 30 nucleotides" is preferably a nucleotide consisting of 15 to 25 nucleotides, more preferably an oligonucleotide consisting of 15 to 20 nucleotides.

Nucleic acids that suppress the expression of ACC2, including an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 831 to 850 of SEQ ID NO: 325, include, for example: , SNG-2 and SNG-3.
Nucleic acids that suppress the expression of ACC2, comprising an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 3201 to 3220 of SEQ ID NO: 325, include, for example, SNG-47 and SNG-48 are included.
As a nucleic acid that suppresses the expression of ACC2, which comprises an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases complementary to the base sequence consisting of positions 3619 to 3641 of SEQ ID NO: 325, for example, SNG-76 to SNG-79.
As a nucleic acid that suppresses the expression of ACC2, which contains an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases complementary to the base sequence consisting of positions 4158 to 4183 of SEQ ID NO: 325, for example, SNG-86 to SNG-90.
As a nucleic acid that suppresses the expression of ACC2, which comprises an oligonucleotide consisting of 15 to 30 nucleotides having a base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 4844 to 4867 of SEQ ID NO: 325, for example, SNG-100 to SNG-105.

More preferably, the novel nucleic acid of the present invention includes a nucleic acid containing the base sequence of SEQ ID NO: 319, 320, 321, 322, 323 or 324 and suppressing the expression of ACC2. The nucleic acid may further comprise a base sequence complementary to SEQ ID NO:325.

Nucleic acids containing the base sequence of SEQ ID NO: 319 (5'-UCUCUGUGCAGGUCCAGC-3') include, for example, SNG-2 and SNG-3.
Nucleic acids containing the nucleotide sequence of SEQ ID NO: 320 (5'-GUCAACCCUCUU-3') include, for example, SNG-20 to SNG-26.
Examples of nucleic acids containing the base sequence of SEQ ID NO: 321 (5'-UCAUCAUGAGCUUCUGC-3') include SNG-47 and SNG-48.
Nucleic acids containing a continuous base sequence of at least 15 bases in the base sequence of SEQ ID NO: 322 (5'-CAGUCCAGCACCUG-3') include, for example, SNG-76 to SNG-SNG-79.
Nucleic acids containing a continuous base sequence of at least 15 bases in the base sequence (5'-UGUGCCUCAGC-3') of SEQ ID NO: 323 include, for example, SNG-86 to SNG-90.
Nucleic acids containing a continuous base sequence of at least 15 bases in the base sequence of SEQ ID NO: 324 (5′-CACCUCCAGCUCG-3′) include, for example, SNG-100 to SNG-105.

Among the nucleic acids described in (4) and (5) above, nucleic acids having 4 or more base mismatches when hybridized with the base sequence of SEQ ID NO:327 are preferred. Here, a nucleic acid having 4 or more base mismatches means that, when hybridized with the base sequence of SEQ ID NO: 327, the continuous sequence that hybridizes with complete complementarity is 15 bases or less. Nucleic acids having 7 or more base mismatches are more preferred.
Here, SEQ ID NO: 327 shows the mRNA sequence of human ACC1 (GenBank: NM_198839.2).

Another aspect of the novel nucleic acid of the present invention is
(a) SEQ. , 224, 226, 228, 230, 232, 240, 244, 258, 264, 268, 270, 272, 284, 300, 308, 310 or 312, and specifically suppresses the expression of ACC2 or (b) SEQ. , 216, 222, 224, 226, 228, 230, 232, 240, 244, 258, 264, 268, 270, 272, 284, 300, 308, 310 or 312, 1 to 3 bases missing A nucleic acid containing a deleted, substituted or inserted nucleotide sequence and specifically suppressing the expression of ACC2 is included. The nucleic acid may further contain a base sequence complementary to the base sequence.
The novel "nucleic acid" of the present invention is included in the novel nucleic acid of the present invention, regardless of length and nucleotide modification, as long as it contains the base sequence and has activity to specifically suppress ACC2 expression.

"1 to 3 bases" are preferably 1 or 2 bases. When 2 or 3 bases are mutated, the type of mutation may be the same or different, and is 1 or 2 or more selected from deletion, substitution and insertion. Deletion, substitution, or insertion are also included in the novel nucleic acids of the present invention as long as they have an ACC2 expression-suppressing effect.

Other aspects of the novel nucleic acids of the present invention include the following.
a double-stranded nucleic acid (for example, SNG-2) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:3 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:4;
a double-stranded nucleic acid (for example, SNG-3) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:5 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:6;
a double-stranded nucleic acid (for example, SNG-4) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:7 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:8;
a double-stranded nucleic acid (for example, SNG-6) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 11 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 12;
a double-stranded nucleic acid (for example, SNG-21) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 41 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 42;
a double-stranded nucleic acid (for example, SNG-23) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 45 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 46;
a double-stranded nucleic acid (for example, SNG-24) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 47 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 48;
a double-stranded nucleic acid (for example, SNG-25) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 49 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 50;
a double-stranded nucleic acid (for example, SNG-26) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:51 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:52;
a double-stranded nucleic acid (for example, SNG-27) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:53 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:54;
a double-stranded nucleic acid (for example, SNG-39) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 77 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 78;
a double-stranded nucleic acid (for example, SNG-41) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 81 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 82;
a double-stranded nucleic acid (for example, SNG-47) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 93 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 94;
a double-stranded nucleic acid (for example, SNG-48) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 95 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 96;
a double-stranded nucleic acid (for example, SNG-62) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 123 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 124;
a double-stranded nucleic acid (for example, SNG-64) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 127 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 128;
a double-stranded nucleic acid comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 153 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 154 (for example, SNG-77);
a double-stranded nucleic acid comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 155 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 156 (for example, SNG-78);
a double-stranded nucleic acid (for example, SNG-86) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 171 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 172;
a double-stranded nucleic acid (for example, SNG-96) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 191 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 192;
a double-stranded nucleic acid (for example, SNG-102) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:203 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:204;
a double-stranded nucleic acid (for example, SNG-108) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 215 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 216;
a double-stranded nucleic acid (for example, SNG-111) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:221 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:222;
a double-stranded nucleic acid (for example, SNG-112) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:223 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:224;
a double-stranded nucleic acid (for example, SNG-113) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:225 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:226;
a double-stranded nucleic acid (for example, SNG-114) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:227 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:228;
a double-stranded nucleic acid (for example, SNG-115) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 229 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 230;
a double-stranded nucleic acid (for example, SNG-116) comprising an oligonucleotide having the base sequence of SEQ ID NO: 231 and an oligonucleotide having the base sequence of SEQ ID NO: 232;
a double-stranded nucleic acid (for example, SNG-120) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 239 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 240;
a double-stranded nucleic acid (for example, SNG-122) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:243 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:244;
a double-stranded nucleic acid (for example, SNG-129) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 257 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 258;
a double-stranded nucleic acid (for example, SNG-132) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 263 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 264;
a double-stranded nucleic acid (for example, SNG-134) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 267 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 268;
a double-stranded nucleic acid (for example, SNG-135) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 269 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 270;
a double-stranded nucleic acid (for example, SNG-136) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 271 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 272;
a double-stranded nucleic acid (for example, SNG-142) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:283 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:284;
a double-stranded nucleic acid (for example, SNG-150) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO: 299 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 300;
a double-stranded nucleic acid (for example, SNG-154) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:307 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:308;
a double-stranded nucleic acid (for example, SNG-155) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:309 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:310;
A double-stranded nucleic acid (eg, SNG-156) comprising an oligonucleotide having the nucleotide sequence of SEQ ID NO:311 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:312.

Another aspect of the novel nucleic acid of the present invention is the base sequence consisting of positions 831-850, 3201-3220, 3619-3641, 4158-4183 or 4844-4867 of SEQ ID NO: 325. ACC2 expression in human retinal pigment epithelial cells in vitro at 20 nmol/L, comprising an oligonucleotide consisting of 15 to 30 nucleotides having a nucleotide sequence of at least 15 bases or more complementary to ACC2 specifically 55 to 100 % inhibition.
ACC2 expression suppression activity (knockdown activity) can be measured by a known method. For example, it can be measured by the method described in Examples below.
In the present invention, the expression suppression rate is preferably 70-100%, more preferably 80-100%.

Novel nucleic acids of the present invention include siRNA (including single-stranded oligonucleotide siRNA), antisense oligonucleotides, shRNA, miRNA, expression vectors, and the like. Preferred are siRNAs or antisense oligonucleotides. More preferably, it is an siRNA or an antisense oligonucleotide having an oligonucleotide consisting of the base sequences described in (4) to (8) above.
The length of each strand constituting the nucleic acid that does not contain overhangs or terminal modifications described below is preferably 15 to 30 nucleotides. Examples include lengths of 15-25, 17-25, 17-23, 17-21, 19-21 nucleotides.

When the novel nucleic acid of the present invention is siRNA, the sense strand and/or the antisense strand may have an overhang at the 3' end. An "overhang" is a nucleotide protruding from a duplex structure when the 3' end of one strand of the siRNA extends beyond the 5' end of the other strand (or vice versa). means. Any nucleotide used as an overhang known in the art can be used. For example, 1-6 nucleotides, 1-5 nucleotides, 1-3 nucleotides, 2 or 3 nucleotides (dTdT, U(2'-OMe)U(2'-OMe), U(2'-OMe)A(2' -OMe), A(2′-OMe)U(2′-OMe), A(2′-OMe)A(2′-OMe), U(2′-F)U(2′-F) etc.) is mentioned. It may be complementary or non-complementary to the target sequence mRNA.

The novel nucleic acid of the present invention has not only ACC2 expression-suppressing activity but also usefulness as a medicine, and has any or all of the following excellent characteristics.
a) ameliorates symptoms of one or more diseases associated with ACC2; b) has weak inhibitory action on CYP enzymes (eg, CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP3A4, etc.);
c) exhibit good pharmacokinetics;
d) high metabolic stability;
e) not mutagenic;
f) low cardiovascular risk;
g) exhibit high solubility;

Nucleotides may be modified in the novel nucleic acids of the present invention. Appropriately modified nucleic acids have any or all of the following characteristics compared to unmodified nucleic acids.
a) high affinity with the target gene;
b) high resistance to nucleases;
c) improved pharmacokinetics;
d) Tissue migration becomes high.
e) low immune response and cytotoxicity;
Therefore, modified nucleic acids are less likely to be degraded in vivo than unmodified nucleic acids, and can more stably inhibit target gene expression.

Any nucleotide modification known in the art can be used in the novel nucleic acids of the present invention. Phosphate modification, nucleobase modification, and sugar modification are known as modifications of nucleotides.
Phosphate modifications include, for example, S-oligo(phosphorothioate), D-oligo(phosphodiester), M-oligo(methylphosphonate), boranophosphate and the like.
Nucleobase modifications include, for example, 5-methylcytosine, 5-hydroxymethylcytosine, 5-propynylcytosine, and the like.
Sugar modifications include, for example, 2′-O—CH ₂ —CH ₂ —O—CH ₃ (2′-MOE), LNA (Locked nucleic acid), 2′-OMe, 2′-Fluoro, BNA (Bridged Nucleic acid Acid), AmNA (see WO2011/052436), TrNA (see WO2014/126229), 2'-Deoxy and the like.

Modification of nucleotides and modification methods known in the art are also disclosed, for example, in the following patent documents.
WO98/39352, WO99/014226, WO2000/056748, WO2003/068795, WO2004/016749, WO2005/021570, WO2005/083124, WO2007/143315, WO2009/071680, WO2011/052436, WO2014/112463, WO2014/126229 and the like.

The 3'-end and/or 5'-end of the novel nucleic acid of the present invention may have a modification group. A hydroxyl-protecting group, an abasic (Abasic) nucleotide, a phosphate moiety (formula: -O-P (=O) (OH) group represented by OH or formula: -O-P (=S) (OH) groups represented by OH or modified groups thereof) and the like.
In addition, the novel nucleic acid of the present invention may have an abasic nucleotide inserted therein as long as it has the base sequence described above.

A known ligand may be added to the 3'-end and/or 5'-end of the novel nucleic acid of the present invention (including nucleic acids containing overhangs and terminal modifications). To enable tracking of the novel nucleic acids of the invention, to improve the pharmacokinetics or pharmacodynamics of the novel nucleic acids of the invention, to improve the stability or binding affinity of the novel nucleic acids of the invention, to improve the stability or binding affinity of the novel nucleic acids of the invention, For the purpose of improving intracellular dynamics including intracellular uptake of nucleic acids, or for the purpose of achieving all or any of them, transport carriers consisting of single or multiple types of multimolecules (liposomes, lipid nanoparticles (LNP), (polymers, micelles, virus particles, etc.), ligands known in the art can be used. For example, reporter molecules, lipids (fatty acids, fatty chains, cholesterol, phospholipids, etc.), sugars (N-acetyl-galactosamine, etc.), vitamins, peptides (membrane-penetrating peptides, cell-targeting peptides, receptor-binding peptides, endosomal escape-promoting peptides) , RGD peptides, peptides with high affinity for blood components, tissue-targeting peptides, etc.), PEG (polyethylene glycol), dyes, fluorescent molecules, and the like.

When the ligand is added to the novel nucleic acid of the present invention, it may be via a linker. As the "linker", any linker used in the field can be used. Examples include polar linkers (eg, oligonucleotide linkers), alkylene linkers, ethylene glycol linkers, ethylenediamine linkers, and the like. Linkers can be synthesized with reference to techniques known in the art.

Preferred linkers are oligonucleotide linkers. Oligonucleotide linkers are 2-10 bases, 2-5 bases, 2 bases, 3 bases, 4 bases, 5 bases in length. Examples include dG, dGdG, dGdGdGdG, dGdGdGdGdG, dT, dTdT, dTdTdTdT, dTdTdTdTdT.

Ligands or linkers known in the art and methods for synthesizing them are also disclosed, for example, in the following patent documents.
WO2009/126933, WO2012/037254, WO2009/069313, WO2009/123185, WO2013/089283, WO2015/105083, WO2018/181428 and the like.

The novel nucleic acid (or modified form thereof) of the present invention can be synthesized by a conventional method, and can be easily synthesized, for example, by a commercially available automatic nucleic acid synthesizer (for example, Applied Biosystems, Dainippon Seiki Co., Ltd., etc.). can be done. Synthetic methods include a solid-phase synthesis method using phosphoramidite, a solid-phase synthesis method using hydrogenphosphonate, and the like. For example, it is disclosed in Tetrahedron Letters 22, 1859-1862 (1981), WO2011/052436, and the like.

The novel nucleic acids of the present invention may be any pharmaceutically acceptable nucleic acid that can provide (directly or indirectly) a biologically active metabolite or residue thereof when administered to an animal, including humans. salts, esters, or salts of such esters, or any other equivalents. That is, it includes prodrugs and pharmaceutically acceptable salts of the novel nucleic acids of the invention, pharmaceutically acceptable salts of the prodrugs, and other bioequivalents.

A “prodrug” is an inactive or less active form that is converted by the action and/or conditions of endogenous enzymes or other chemicals into the active form (i.e. drug) within the body or cell. It is a derivative. Prodrugs of the novel nucleic acids of the present invention can be prepared according to the methods described in WO93/24510, WO94/26764, WO2004/063331 and the like.

"Pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of the novel nucleic acids of this invention, i. A salt that does not give any scientific effect.

Pharmaceutically acceptable salts include, for example, alkali metals (e.g., lithium, sodium, potassium, etc.), alkaline earth metals (e.g., calcium, barium, etc.), magnesium, transition metals (e.g., zinc, iron, etc.), Ammonia, salts with organic bases (e.g., trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, meglumine, diethanolamine, ethylenediamine, pyridine, picoline, quinoline, etc.) and amino acids, or inorganic acids (e.g., hydrochloric acid, sulfuric acid, nitric acid, carbonic acid, hydrobromic acid, phosphoric acid, hydroiodic acid, etc.), and organic acids (e.g., formic acid, acetic acid, propionic acid, trifluoroacetic acid, citric acid, lactic acid, tartaric acid, oxalic acid, maleic acid , fumaric acid, mandelic acid, glutaric acid, malic acid, benzoic acid, phthalic acid, ascorbic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, etc.). In particular, salts with hydrochloric acid, sulfuric acid, phosphoric acid, tartaric acid, methanesulfonic acid and the like can be mentioned. In particular, sodium salts, potassium salts and the like are mentioned. These salts can be formed by a commonly used method.

The invention also includes pharmaceutical compositions containing the novel nucleic acids of the invention. The administration method and formulation of the pharmaceutical composition of the present invention (that is, the pharmaceutical composition of the above (1) to (3) and the above (12) to (14)) are other than the above modification method and ligand addition method. In addition, any method of administration and formulation known in the art can be used. Nucleic acid administration methods and formulations are also disclosed, for example, in the following documents.
WO2008/042973, WO2009/127060, WO2011/064130, WO2011/123468, WO2011/153542, WO2013/074974, WO2013/075035, WO2013/163258, WO2013/19 2486 and the like.

The pharmaceutical compositions of the present invention can be administered by a variety of methods depending on whether local or systemic treatment is desired or the area to be treated. The administration method may be, for example, topical (including ophthalmic, intravaginal, intrarectal, intranasal, and transdermal), oral, or parenteral. Parenteral administration includes intravenous injection or infusion, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration by inhalation or inhalation, intrathecal administration, intracerebroventricular administration, and the like.

For topical administration of the pharmaceutical composition of the present invention, formulations such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders can be used.
Compositions for oral administration include powders, granules, suspensions or solutions in water or non-aqueous media, capsules, powders, tablets and the like.
Compositions for parenteral, intrathecal, or intracerebroventricular administration include sterile aqueous solutions containing buffers, diluents and other suitable additives.

The pharmaceutical composition of the present invention contains an effective amount of the novel nucleic acid of the present invention and various pharmaceutical additives such as excipients, binders, wetting agents, disintegrants, lubricants and diluents suitable for the dosage form. It can be obtained by mixing as needed. In the case of an injection, it may be sterilized with an appropriate carrier to form a preparation.

Excipients include lactose, white sugar, glucose, starch, calcium carbonate, crystalline cellulose and the like. Binders include methylcellulose, carboxymethylcellulose, hydroxypropylcellulose, gelatin, polyvinylpyrrolidone, and the like. Examples of disintegrants include carboxymethylcellulose, sodium carboxymethylcellulose, starch, sodium alginate, agar powder, sodium lauryl sulfate and the like. Lubricants include talc, magnesium stearate, macrogol, and the like. As a base for suppositories, cacao butter, macrogol, methylcellulose or the like can be used. In addition, when preparing a liquid formulation or an emulsion-type or suspension-type injection, commonly used solubilizers, suspending agents, emulsifiers, stabilizers, preservatives, isotonic agents, etc. are added as appropriate. You can In the case of oral administration, sweeteners, fragrances and the like may be added.

Administration will depend on the severity and responsiveness of the condition being treated, and the course of treatment may last from several days to several months, or until cure is achieved or remission of the condition is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in vivo. Persons of ordinary skill in the art can determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages will vary depending on the relative potency of individual nucleic acids, but generally can be calculated based on IC50s or EC50s in in vitro experiments and in vivo animal studies. For example, given the molecular weight of the nucleic acid (derived from the nucleic acid sequence and chemical structure) and an effective dose, such as the IC50 (determined experimentally), doses expressed in mg/kg are customary. calculated according to Examples include 0.001-10 mg/kg per day. Injections can be administered over a period of time, for example, 5 to 180 minutes. It can also be administered once to several times a day, or can be administered at intervals of one to several days (for example, every two weeks).

Since the pharmaceutical composition containing the novel nucleic acid of the present invention has ACC2 expression-suppressing activity, it can be used for the prevention or treatment of ACC2-related diseases.
Diseases associated with ACC2 include NASH, TGCV, diabetes, heart failure, obesity, insulin resistance, hypertriglyceridemia, insulin deficiency, hypercholesterolemia, hyperglycemia, impaired glucose tolerance, and diabetic peripheral neuropathy. , diabetic nephropathy, diabetic retinopathy, diabetic macroangiopathy, dyslipidemia, hyperlipidemia, hypertension, hepatic steatosis, cardiovascular disease, arteriosclerosis, atherosclerosis, myocardial infarction, Infectious diseases, tumors, cardiovascular diseases, and the like.

EXAMPLES The present invention will be described in more detail below with reference to Examples, but the present invention is not limited to these.

Example 1 Generation of Atgl Knockout Mice and Atgl/Acc2 Double Knockout Mice Atgl knockout mice are known as non-clinical models of TGCV. To verify the rationale that suppressing Acc2 expression could be a treatment for TGCV, Atgl knockout (KO) mice lacking the Atgl gene and Atgl double knockout (dKO) mice lacking both the Atgl gene and Acc2 were prepared. prepared by the method.

Example 2 Evaluation of Heart Lipid Content in Atgl/Acc2 Double Knockout Mice The hearts collected from the Atgl knockout mice or Atgl/Acc2 double knockout mice prepared in Example 1 were homogenized and treated according to the report of Folch et al. (J Biol Chem. 1957). May; 226 (1): 497-509.) Tissue lipids are extracted using the Folch method described in, etc., and heart triglycerides (TG ) and cardiac free fatty acid (NEFA) levels were calculated to evaluate the effect of Acc2 deficiency on cardiac lipid levels. Autocera (registered trademark) TG or Autocera (registered trademark) NEFA (Sekisui Medical) was used for each reagent. All treatment groups were performed with N=6. Statistical analysis was performed using Welch's t-test (*p<0.05). The results obtained are shown in FIG.

From FIG. 1, it is clear that the abundance per tissue of TG and NEFA in Atgl/Acc2 double knockout mice is lower than that of TG and NEFA per tissue in Atgl knockout mice.
From Example 2, it is clear that loss of Acc2 in TGCV nonclinical model mice leads to a reduction in cardiac lipids.

Example 3 Evaluation of Cardiac Function in Atgl/Acc2 Double Knockout Mice In order to investigate the effect of Acc2 inhibition on cardiac function, left ventricular ejection fraction (LVEF), which indicates cardiac contractility, was subjected to high-resolution ultrasound imaging. It was evaluated using the system Vevo770 (Primetech). FIG. 2 shows the results of evaluating LVEF (%) in hearts of wild-type (WT) mice, Atgl knockout mice, and Atgl/Acc2 double knockout mice. Statistical analysis was performed using Welch's t-test (*p<0.05).

FIG. 2 shows that Atgl knockout mice have lower LVEF than wild-type mice, and that LVEF is significantly restored in Atgl/Acc2 double knockout mice in which Acc2 is knocked out.
From Example 3, it is clear that loss of Acc2 in TGCV nonclinical model mice improves cardiac function.

Example 4 Evaluation of Survival Period in Atgl/Acc2 Double Knockout Mice Since Acc2 deficiency reduced cardiac lipids and improved cardiac function, the impact of Acc2 deficiency on survival period was evaluated. Statistical analysis was performed using the log-rank test (*p<0.05). The results obtained are shown in FIG.

FIG. 3 shows that Atgl knockout mice have a significantly longer survival period than Atgl/Acc2 double knockout mice.
From Example 4, it is clear that loss of Acc2 in TGCV nonclinical model mice prolongs survival.

From Examples 1 to 4, Acc2-deficient Atgl/Acc2 double-knockout mice in the TGCV nonclinical model showed lower cardiac lipids, improved cardiac function, and prolonged survival compared to Atgl-knockout mice. Admitted.
From the above, it was suggested that inhibition of ACC2 is effective in treating TGCV.

Example 5 Design of ACC2 siRNA siRNA targeting human ACC2 mRNA was designed.
The mRNA sequence used for the design is human ACC2 (GenBank: NM_001093.4, SEQ ID NO:325).
The designed siRNA is double-stranded, consisting of a 19-base antisense strand and a 19-base sense strand. The antisense strand is the complementary sequence of the mRNA sequence and the sense strand is the complementary sequence of the antisense strand.
siRNAs were designed to selectively target human ACC2 mRNA but not human ACC1 mRNA. The designed sequences (SNG-1 to SNG-159) are shown in Tables 1-8. In the table, the target site (Target site) indicates the position of the 5′ end and the position of the 3′ end in SEQ ID NO:325. Capital letters in the base sequences mean RNA.

Example 6 In vitro model Human cell culture Human retinal pigment epithelial cell line ARPE-19 was cultured in DMEM/F-12 (DULBECCO'S Modified Eagle Medium: Nutrient Mixture F-12) (SIGMA) + 10% fetal bovine serum (FBS) ( Hyclone) + Penicillin (100 units/mL) (Thermo Fisher Scientific) + Streptomycin (100 ug/mL) (Thermo Fisher Scientific) at 37°C, 95-98% humidity and 5% _CO2. maintained.

Example 7 Evaluation of Knockdown Activity of ACC2 siRNA Using Human Cells The siRNA duplexes in which dTdT was added as an overhang to the 3′ end of the antisense strand and sense strand of the siRNA designed in Example 5 were purchased from SIGMA. . Knockdown experiments in human ARPE-19 cells cultured under the conditions of Example 6 were performed using the purchased siRNA duplexes. The siRNA duplexes were introduced into the cells using Lipofectamine® RNAiMAX (Thermo Fisher Scientific) and added to the cell culture medium to a final concentration of 20 nmol/L of the siRNA duplexes. 48 hours after the introduction, the cells were collected using CellAmp™ Direct RNA Prep Kit for RT-PCR (Takara Bio) and real-time PCR was performed. RPLP0 was used as an endogenous control.

The primer sequence used to measure the expression level of human ACC2 was
Fw primer: (SEQ ID NO: 328); GATAGGCCATGTTTAGCACTGGTTG
Rv primer: (SEQ ID NO: 329); using CTCCAGCTGGGTACTTCCATTCA, the primer sequence used to measure the expression level of human RPLP0 was
Fw primer: (SEQ ID NO: 330); ATCAACGGGTACAAACGAGTC
Rv primer: (SEQ ID NO: 331); CAGATGGATCAGCCAAGAAGG
was used.

Table 9 shows the results of the mRNA residual rate. The mRNA residual rate was calculated by the following method. All treatment groups were N=3. First, the difference between the human ACC2 expression level (Ct value) and the human RPLP0 expression level (Ct value) in the cells of the non-treated (NT) group was calculated (ΔCt). After that, the average value of each ΔCt was calculated as ΔCt _{(NT_ave.)} . Subsequently, the difference between the expression level (Ct value) of human ACC2 and the expression level (Ct value) of human RPLP0 in cells introduced with each siRNA duplex was calculated (ΔCt _(siRNA) ). Thereafter, after calculating the difference (ΔΔCt) between each ΔCt _(siRNA) and ΔCt _{(NT_ave.)} , the mRNA residual rate was calculated for each using the following formula.

mRNA residual rate = 2 ^ΔΔCt × 100 (%)
ΔΔCt = ΔCt _(siRNA) - ΔCt _{(NT_ave.)}

Finally, the average value of residual mRNA in each treatment group was calculated.

As a result, it is clear that knockdown using the siRNA of the present application results in a low residual mRNA rate, and that the siRNA of the present application strongly suppresses the expression of human ACC2.

Example 8 Evaluation of Acc2 siRNA Knockdown Activity Using Atgl Knockout Mice 6-week-old male Atgl knockout mice received physiological saline or Acc2 siRNA (SNG-4) at a dose of 50 mg/kg and 100 mg/kg. A single tail vein administration was performed at , and Acc2 mRNA knockdown activity in the heart was evaluated 14 days after administration.
The Acc2 siRNAs used have 2'-F modified nucleic acids, 2'-OMe modified nucleic acids, DNA and modifications as described in WO2018181428.
RNA was purified from heart tissue collected from Atgl knockout mice under anesthesia using RNeasy Plus Mini Kit (QIAGEN), and cDNA was synthesized using SuperScript™ VILO™ Master Mix (Thermo Fisher Scientific). Real-time PCR was performed using PowerUp™ SYBR™ Green Master Mix (Thermo Fisher Scientific). Rplp0 was used as an endogenous control.

The primer sequence used to measure the expression level of mouse Acc2 was
Fw primer: (SEQ ID NO: 332); GGTAGTGGCTTTGAAGGAACTGTC
Rv primer: (SEQ ID NO: 333); GATATCGTTGTTTCTGGAAGCTCTCG
The primer sequence used to measure the expression level of mouse Rplp0 was
Fw primer: (SEQ ID NO: 334); ATCAATGGGTACAAGCGCGT
Rv primer: (SEQ ID NO: 335); CAGATGGATCAGCCAGGAAGG
was used.

FIG. 4 shows the results of the mRNA residual rate. The mRNA residual rate was calculated by the following method. All treatment groups were N=3. First, the difference between the expression level (Ct value) of mouse Acc2 and the expression level (Ct value) of mouse Rplp0 in the heart of the physiological saline administration (Control: Con) group was calculated (ΔCt). After that, the average value of each ΔCt was calculated as ΔCt _{(Con_ave.)} . Subsequently, the difference between the expression level (Ct value) of Acc2 and the expression level (Ct value) of mouse Rplp0 in mouse heart into which each siRNA duplex was introduced was calculated (ΔCt _(siRNA) ). Thereafter, after calculating the difference (ΔΔCt) between each ΔCt _(siRNA) and ΔCt _{(Con_ave.)} , the mRNA residual rate was calculated for each using the following formula.

mRNA residual rate = 2 ^ΔΔCt × 100 (%)
ΔΔCt = ΔCt _(siRNA) - ΔCt _{(Con_ave.)}

Finally, the average value of residual mRNA in each treatment group was calculated. Statistical analysis was performed using Welch's t-test (*p<0.05).

From FIG. 4, significant suppression of Acc2 mRNA expression was observed in the Acc2 siRNA-administered group compared to the physiological saline-administered group.
As a result, it is clear that the administration of the siRNA of the present application strongly suppresses the expression of mouse Acc2.

Example 9 Evaluation of Malonyl-CoA Abundance in Atgl Knockout Mice Administered with Acc2 siRNA The following method can be used to assess Malonyl-CoA abundance in Atgl knockout mice administered with Acc2 siRNA.
Six-week-old male Atgl knockout mice are given a single dose of saline or Acc2 siRNA via the tail vein, and 14 days after administration, cardiac malonyl-CoA concentrations are assessed.
On the day of dissection, the Atgl knockout mice were fasted for 3 hours, then the heart was excised under anesthesia and homogenized with a 9% homogenate buffer (distilled water: 60% perchloric acid: 85% phosphoric acid = 43:5:2). Prepare. Malonyl-CoA concentrations in tissues are quantified by LC/MS/MS.

LC/MS/MS analysis can use the following conditions.
Column: XBridgeC18 Guard Cartridge (5 μm, id 2.1×10 mm) (Waters)
Flow rate: maintain 0.75 mL/min for 1 minute, 0.4 mL/min for next 1 minute, 0.75 mL/min for next 1 minute.
Mobile phase: [A] is 5 mmol/L dibutylamine acetate buffer/5 mmol/L ammonium acetate [B] is 100% methanol Gradient: hold 5% solvent [B] for 1 min, then 5% for 1 min Perform a linear gradient of -50% solvent [B], perform a linear gradient of 50%-5% solvent [B] in 0.5 minutes, hold 5% solvent [B] in 0.5 minutes.

Example 10 Effects on Cardiac Function by Acc2 siRNA Administration in Atgl Knockout Mice Six-week-old male Atgl knockout mice were given Hprt1 siRNA (hereinafter referred to as Control siRNA) at 100 mg/kg and ACC2 siRNA at 50 mg/kg or 100 mg/kg. kg was administered once every two weeks, and cardiac function was evaluated by the method described in Example 3 at 10 weeks of age. All treatment groups were N=4. Statistical analysis was performed using Welch's t-test (*p<0.05). The results obtained are shown in FIG.
Control siRNA has the sequence shown below and further has the modifications described in WO2018181428.
Sense strand (SEQ ID NO:336):
G(F)^A(M)^U(F)^G(M)^A(F)^U(M)C(F)U(F)C(F)U(M)C(F)A (M)A(M)C(M)^U(F)^U(M)^U(F)^A(M)^A(F);
Antisense strand (SEQ ID NO:337):
U(M)^U(F)^A(M)A(F)A(M)G(F)U(F)U(F)G(M)A(F)G(M)A(M) G(M)A(F)U(M)C(F)A(M)U(F)C(M)^T(D)^T(D)
In the notation, (F) is a 2'-F modified nucleic acid, (M) is a 2'-OMe modified nucleic acid, (D) is DNA, and ^ represents a phosphorothioate bond.

The Acc2 siRNA 100 mg/kg administration group showed a significant improvement in the left ventricular ejection fraction compared to the control siRNA 100 mg/kg administration group.
As a result, it is clear that administration of the siRNA of the present application improves cardiac function.

The pharmaceutical composition of the present invention contains a nucleic acid or antibody that suppresses the expression of ACC2, and is very useful as a medicament for preventing or treating TGCV.
The novel nucleic acid of the present invention exhibits excellent activity of specifically suppressing the expression of ACC2. The pharmaceutical composition of the present invention containing the nucleic acid is very useful as a medicament for the prevention and/or treatment of ACC2-related diseases, particularly NASH, TGCV, diabetes, or heart failure.

Claims (14)

A pharmaceutical composition for the prevention or treatment of triglyceride-accumulated myocardiovasculopathy, comprising a nucleic acid that suppresses the expression of ACC2 or an antibody that inhibits the enzymatic activity of ACC2. 2. The pharmaceutical composition of claim 1, wherein said nucleic acid is siRNA, antisense oligonucleotide, miRNA or shRNA. 2. The pharmaceutical composition of Claim 1, wherein said nucleic acid is an siRNA or an antisense oligonucleotide. A base sequence of at least 15 bases or more complementary to the base sequence consisting of positions 831 to 850, positions 3201 to 3220, positions 3619 to 3641, positions 4158 to 4183, or positions 4844 to 4867 of SEQ ID NO: 325 A nucleic acid that specifically suppresses the expression of ACC2, comprising an oligonucleotide consisting of 15 to 30 nucleotides. 5. The nucleic acid of claim 4, comprising the base sequence of SEQ ID NO:319, 320, 321, 322, 323 or 324. 6. The nucleic acid according to claim 4 or 5, which has 4 or more base mismatches when hybridized with the base sequence of SEQ ID NO:327. SEQ. 226, 228, 230, 232, 240, 244, 258, 264, 268, 270, 272, 284, 300, 308, 310 or 312; or SEQ ID NO: 4, 6, 8, 12, 42, 46, 48, 50, 52, 54, 78, 82, 94, 96, 124, 128, 154, 156, 172, 192, 204, 216, 222, 224, 226, 228, 230, 232, 240, 244, 258, A base sequence in which 1 to 3 bases are deleted, substituted or inserted in the base sequence of 264, 268, 270, 272, 284, 300, 308, 310 or 312;
A nucleic acid that specifically suppresses the expression of ACC2, comprising: A double-stranded nucleic acid having any of the following oligonucleotide combinations:
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 3 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 4;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 5 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 6;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 7 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 8;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 11 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 12;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 41 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 42;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 45 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 46;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 47 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 48;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 49 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 50;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 51 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 52;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 53 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 54;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 77 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 78;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 81 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 82;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 93 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 94;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 95 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 96;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 123 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 124;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 127 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 128;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 153 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 154;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 155 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 156;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 171 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 172;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 191 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 192;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 203 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 204;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 215 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 216;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 221 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 222;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 223 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 224;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 225 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 226;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 227 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 228;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 229 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 230;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 231 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 232;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 239 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 240;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 243 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 244;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 257 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 258;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 263 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 264;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 267 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 268;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 269 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 270;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 271 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 272;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 283 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 284;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 299 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 300;
an oligonucleotide having the nucleotide sequence of SEQ ID NO: 307 and an oligonucleotide having the nucleotide sequence of SEQ ID NO: 308;
An oligonucleotide having the nucleotide sequence of SEQ ID NO:309 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:310, or an oligonucleotide having the nucleotide sequence of SEQ ID NO:311 and an oligonucleotide having the nucleotide sequence of SEQ ID NO:312. 9. The nucleic acid according to claim 8, which specifically suppresses ACC2 expression. The nucleic acid according to any one of claims 4 to 9, wherein said nucleic acid is siRNA, antisense oligonucleotide, miRNA or shRNA. 11. The nucleic acid of claim 10, comprising 3' overhangs on one or both strands of the siRNA. A pharmaceutical composition containing the nucleic acid according to any one of claims 4-11. 13. The pharmaceutical composition according to claim 12, for the prevention or treatment of diseases associated with ACC2. 14. The pharmaceutical composition according to claim 13, wherein said disease is non-alcoholic steatohepatitis, triglyceride myocardiovascular disease, diabetes or heart failure.

Images