JP2022534920A - Sequencing by appearance - Google Patents

Abstract

The present invention is a method of sequencing a polymer, wherein the sequence of one or more polymers is determined by the emergence properties of binding interactions of a repertoire of molecular probes to the polymer.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation-in-part of U.S. patent application Ser. No. 62/591,850, filed and entitled "Sequencing by Emergence," is hereby incorporated by reference.

The present disclosure relates generally to systems and methods for sequencing nucleic acids through transient binding of probes to one or more polynucleotides.

DNA sequencing was first achieved with gel electrophoresis-based methods: the dideoxy chain termination method (eg, Sanger et al., Proc. Natl. Acad. Sci. 74:5463-5467, 1977), and chemical digestion. methods (eg, Maxam et al., Proc. Natl. Acad. Sci. 74:560-564, 1977). These nucleotide sequencing methods were both time consuming and expensive. Nevertheless, the former led to the sequencing of the human genome for the first time, albeit over ten years and hundreds of millions of dollars.

As the dream of personalized medicine moves ever closer to becoming a reality, there is a growing need for inexpensive, large-scale methods to sequence individual human genomes (Mir, Sequencing Genomes: From Individuals to Populations, Briefings in Functional Genomics). and Proteomics, 8:367-378, 2009). Some sequencing methods that bypass gel electrophoresis (and are subsequently less costly) were developed as 'next generation sequencing'. One such sequencing method predominates, using reversible terminators (as practiced by Illumina Inc.). The detection methods used in the most advanced forms of Sanger sequencing and the current predominant Illumina technology involve fluorescence. Other possible means of detecting single nucleotide insertions include detection using proton emission (eg, field effect transistors, ionic currents through nanopores, and detection via electron microscopy). Illumina's chemistry involves the cyclic addition of nucleotides (Bentley et al., Nature 456 : 53-59, 2008). Illumina sequencing begins with clonally amplifying single genome molecules and requires substantial prior sample processing to convert the target genome into a library and then clonally amplify as clusters.

However, several methods have since hit the market that circumvent the need for amplification prior to sequencing. Both new methods perform fluorescent sequencing-by-synthesis (SbS) on a single molecule of DNA. The first method, from HelicosBio (now SeqLL), performs stepwise SbS with reversible termination (Harris et al., Science, 320:106-9, 2008). The second method, SMRT sequencing from Pacific Biosciences, uses a label on the terminal phosphate, the natural leaving group of reactions incorporating nucleotides, to continuously sequence without the need for reagent exchange. (eg Levene et al., Science 299:682-686, 2003 and Eid et al., Science, 323:133-8, 2009). A somewhat analogous approach to Pacific Bioscience sequencing is the method being developed by Genia (now part of Roche), by detecting SbS through nanopores rather than optical methods.

Most commonly used sequencing methods are limited in read length, which increases both the cost of sequencing and the difficulty of assembling the resulting reads. . Read lengths obtained by Sanger sequencing are in the 1000 base range (eg Kchouk et al., Biol. Med. 9:395, 2017). Both Roche 454 sequencing and Ion Torrent have read lengths in the hundreds of bases range. Illumina sequencing, which originally started with reads of about 25 bases, now typically has 150-300 base pair reads. However, because fresh reagents must be supplied for each base in the read length, sequencing 250 bases instead of 25 requires 10 times the time and 10 times the expensive reagents. . The longest read lengths possible with commercial systems have been obtained by nanopore chain sequencing at Oxford Nanopores Technology (ONT) and Pacific Bioscience (PacBio) (e.g., Kchouk et al., Biol. Med. 9:395, 2017). The latter usually have reads on average about 10,000 bases long, while the former can very rarely obtain reads several hundred kilobases long (see, for example, Laver et al., Biomol. Det. Quant .3:1-8, 2015).

In addition to ONT and PacBio sequencing, there are several approaches that are not sequencing technologies per se, but sample preparation approaches that complement the Illumina short-read sequencing technology to build longer reads. provide a stepping stone for One of these is a droplet-based technique developed by 10x Genomics, which isolates 100-200 kb fragments (e.g., average fragment length range after extraction) within droplets and were processed into a library of shorter length fragments, each containing a sequence identification tag specific to the 100-200 kb from which they were derived, approximately 50-200 Kb when sequencing the genome from multiple droplets. (Goodwin et al., Nat. Rev. Genetics 17:333-351, 2016). Another approach, developed by Bionano Genomics, elongates the DNA and induces nicking through exposure to nicking endonucleases. This method provides a molecular map or scaffold by fluorescence detection of the nicking points. Although this method has not currently been developed to have a high enough density to assemble genomes, it nonetheless provides direct visualization of genomes, detects large structural variants and long-range haplotypes. can be determined.

Despite the development of different sequencing methods and the general trend towards decreasing sequencing costs, the size of the human genome continues to result in high sequencing costs for patients. The individual human genome is organized into 46 chromosomes, the shortest of which is approximately 50 megabases and the longest of which is 250 megabases. NGS sequencing methods still have a number of issues that affect performance, including reliance on reference genomes that can substantially increase the time required for analysis (e.g., Kulkarni et al., Comput Struct Biotechnol J. 15:471-477, 2017).

Given the above background, what is needed in the art is to be efficient in the use of reagents and time, and to provide long haplotype-resolved reads without compromising accuracy. Devices, systems and methods for providing stand-alone sequencing technology for

The information disclosed in this background section is merely to enhance the understanding of the general background and should not be construed as an acknowledgment or any form of suggestion that this information constitutes prior art known to those skilled in the art. is not.

The present disclosure addresses the need in the art for devices, systems and methods to provide improved nucleic acid sequencing technology. In one broad aspect, the present disclosure includes a method of identifying at least one unit of a multiunit target molecule by binding a molecular probe to one or more units of a double-stranded target molecule. The present disclosure is based on the detection of single-molecule interactions between one or more types of molecular probes and double-stranded target molecules. In some embodiments, the probe transiently binds at least one unit of the target molecule. In some embodiments, the probe repeatedly binds to at least one unit of the target molecule. In some embodiments, molecular entities are positioned to nanometric accuracy on macromolecules, surfaces or matrices.

In one aspect, a method of sequencing a nucleic acid is provided. The method includes (a) immobilizing the nucleic acid in a linearized, elongated/extended form on a test substrate, thereby forming an immobilized elongated/extended nucleic acid. The method proceeds by (b) exposing the fixed elongated/extended nucleic acid to each oligonucleotide probe species of the set of oligonucleotide probe species. Each oligonucleotide probe species in the set of oligonucleotide probe species is a library of probe species of a given length, containing one defined nucleotide and one or more degenerate positions. Each defined nucleotide is selected from the set of A, C, G, T bases. Each degenerate position contains either an A, C, G, T base or a mixture of universal base analogs. Exposure (b) is the transient and reversible binding of individual probes of each oligonucleotide probe species to one or more portions of the immobilized nucleic acid that are complementary to the respective oligonucleotide probe species. , thereby giving rise to each instance of optical activity. The method proceeds by (c) using an imaging device to measure the location on the test substrate of each respective instance of optical activity that occurs during or after exposure (b). The method repeats exposing (b) and measuring (c) for each oligonucleotide probe species in (d) the set of oligonucleotide probe species, thereby generating a plurality of sets of locations on the test substrate. Proceed by acquiring. Each set of locations on the test substrate corresponds to an oligonucleotide probe species in the set of oligonucleotide probe species. The method continues by (e) sequencing at least a portion of the nucleic acid from the plurality of sets of locations on the test substrate by compiling locations on the test substrate represented by the plurality of sets of locations. .

In another aspect of the disclosure, a method of sequencing nucleic acid is provided. This additional method includes (a) immobilizing the nucleic acid in a linearized, elongated/extended form on a test substrate, thereby forming an immobilized elongated/extended nucleic acid. The method continues by (b) exposing the fixed extended/extended nucleic acid to each oligonucleotide probe species of the set of oligonucleotide probe species. Each oligonucleotide probe species in the set of oligonucleotide probe species is a library of probe species of a given length, containing two or more defined nucleotide positions and one or more degenerate positions. Each defined nucleotide position includes A, C, G, T bases. Each degenerate position contains either an A, C, G, T base or a mixture of universal base analogs. Exposure (b) is the transient and reversible binding of individual probes of each oligonucleotide probe species to one or more portions of the immobilized nucleic acid that are complementary to the respective oligonucleotide probe species. , thereby giving rise to each instance of optical activity. The method proceeds by (c) using an imaging device to measure the location on the test substrate of each respective instance of optical activity that occurs during or after exposure (b). The method repeats exposing (b) and measuring (c) for each oligonucleotide probe species in (d) the set of oligonucleotide probe species, thereby generating a plurality of sets of locations on the test substrate. Continue by getting. Each respective set of locations on the test substrate corresponds to an oligonucleotide probe species in the set of oligonucleotide probe species. The method concludes by (e) sequencing at least a portion of the nucleic acid from the set of locations on the test substrate by compiling locations on the test substrate represented by the set of locations. .

In another aspect of the disclosure, a method of sequencing nucleic acid is provided. This additional method includes (a) immobilizing the nucleic acid in a linearized, elongated/extended form on a test substrate, thereby forming an immobilized elongated/extended nucleic acid. The method proceeds by (b) exposing the fixed extended/extended nucleic acid to each oligonucleotide probe species of the set of oligonucleotide probe species. Each oligonucleotide probe species in the set of oligonucleotide probe species is a library of probe species of a given length, containing two or more defined nucleotide positions and one or more degenerate positions. Each defined nucleotide position contains one of the set of A, C, G, T bases. Each degenerate position contains a mixture of A, C, G, T bases or any of the universal base analogues. Exposure (b) allows the individual probes of each oligonucleotide probe species to stably bind to one or more portions of the immobilized nucleic acid that are complementary to the respective oligonucleotide probe species. conditions whereby, upon irradiation, each instance of optical activity is produced at one or more locations on the substrate corresponding to one or more portions of the immobilized nucleic acid. The method proceeds by (c) bleaching the optically active instances such that the gradual loss of the optically active instances is measured/recorded using an imaging device. The method includes (d) exposing the fixed and elongated/extended nucleic acid to conditions that allow the bound oligonucleotide probes to dissociate, and for each oligonucleotide probe species in the set of oligonucleotide probe species: continue by repeating exposing (b) and measuring (c), thereby acquiring a plurality of sets of positions on the test substrate. Each respective set of locations on the test substrate corresponds to an oligonucleotide probe species in the set of oligonucleotide probe species. The method uses (d) a single-molecule localization algorithm to calculate the nanometric/fine-tuned location of each instance of optical activity; By compiling the locations on the substrate, one proceeds by sequencing at least a portion of the nucleic acid from the set of multiple locations on the test substrate.

Another aspect of the disclosure provides a method of sequencing a nucleic acid. The method includes (a) immobilizing/immobilizing a nucleic acid on a test substrate, thereby forming an immobilized/immobilized nucleic acid. The method proceeds by (b) exposing the immobilized/immobilized nucleic acid to each oligonucleotide probe species of the set of oligonucleotide probe species. Exposure (b) is under conditions that allow individual probes of each oligonucleotide probe species to bind to one or more portions of the immobilized/immobilized nucleic acid that are complementary to the respective oligonucleotide probe species. , thereby giving rise to each instance of optical activity. The method proceeds by (c) using an imaging device to measure the location on the test substrate of each respective instance of optical activity that occurs during or after exposure (b). The method repeats exposing (b) and measuring (c) for each oligonucleotide probe species in (d) the set of oligonucleotide probe species, thereby generating a plurality of sets of locations on the test substrate. Continue by getting. Each respective set of locations on the test substrate corresponds to an oligonucleotide probe species in the set of oligonucleotide probe species. The method concludes by (e) sequencing at least a portion of the nucleic acid from the set of locations on the test substrate by compiling locations on the test substrate represented by the set of locations. .

Other embodiments are directed to systems, portable consumer devices, and computer-readable media related to the methods described herein.

As disclosed herein, any embodiment disclosed herein may be applied to any aspect, where applicable.

Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present disclosure are shown and described herein. As will be realized, the disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious aspects, all without departing from the disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature and not as restrictive.

Figure 3 summarizes an exemplary system topology; Polymers with multiple probes involved in binding events and information regarding localization and sequence identification of binding events are collected and stored and then further analyzed to determine polymer sequence according to various embodiments of the present disclosure. and a computer storage medium for. [0013] Figure 1 provides collectively a flow chart of processes and features of a method for determining the sequence and/or structural characteristics of a target polymer, according to various embodiments of the present disclosure. [0014] Figures 10A and 10B provide flowcharts of processes and features of additional methods for determining the sequence and/or structural characteristics of target polymers, according to various embodiments of the present disclosure; [0014] Figures 10A and 10B provide flowcharts of processes and features of additional methods for determining the sequence and/or structural characteristics of target polymers, according to various embodiments of the present disclosure; Examples of transient binding of probes to polynucleotides are summarized according to various embodiments of the present disclosure. FIG. 10A-B summarizes examples of probes of different k-base lengths (k-mers) that bind to target polynucleotides, according to various embodiments of the present disclosure. FIG. 11 summarizes examples of using reference oligos with successive cycles of oligonucleotide sets, according to various embodiments of the present disclosure. FIG. FIG. 10 summarizes examples of applying different probe sets to a single reference molecule, according to various embodiments of the present disclosure. FIG. 10A-10B summarize examples of transient binding when using multiple types of probes, in accordance with various embodiments of the present disclosure. An example of how several collected transient binding events correlate with the degree of probe localization that can be achieved is shown collectively, according to various embodiments of the present disclosure. FIG. 10 summarizes examples of tiling probes according to various embodiments of the present disclosure; FIG. Examples of transient binding of directly labeled probes are summarized according to various embodiments of the present disclosure. FIG. 11 summarizes examples of transient probe binding in the presence of an intercalating dye, according to various embodiments of the present disclosure. FIG. Figures 10A-10B summarize examples of different probe labeling techniques, according to various embodiments of the present disclosure; FIG. 12 shows an example of transient binding of probes on denatured and combed double-stranded DNA, according to various embodiments of the present disclosure. FIG. FIG. 11 summarizes examples of cell lysis and nucleic acid fixation and extension according to various embodiments of the present disclosure. FIG. FIG. 4 illustrates an exemplary microfluidic architecture that captures single cells and optionally provides extraction, extension, and sequencing of nucleic acids from the cells, in accordance with various embodiments of the present disclosure. FIG. FIG. 4 illustrates an exemplary microfluidic architecture that provides individual cells with different ID tags, according to various embodiments of the present disclosure. FIG. FIG. 2 shows an example of sequencing polynucleotides from individual cells, according to various embodiments of the present disclosure. FIG. FIG. 11 collectively illustrates an exemplary device layout for imaging transient probe binding, in accordance with various embodiments of the present disclosure; FIG. FIG. 4 illustrates an exemplary capillary tube containing reagents separated by air gaps, in accordance with various embodiments of the present disclosure; FIG. 4A-4B collectively illustrate fluorescence examples according to various embodiments of the present disclosure. 4A-4B collectively illustrate fluorescence examples according to various embodiments of the present disclosure. 2 shows transient binding on synthetic denatured double-stranded DNA, according to various embodiments of the present disclosure. Two cycles of 'footprint' sequencing are shown. For this 5 base length, 5 cycles are used. Here, each cycle has a different single nucleotide position defined along the "footprint" or length of the oligonucleotide, the remaining nucleotides being degenerate and each position representing all four Includes libraries of either nucleotides or universal nucleotide analogues at each degenerate position (eg, nitroindole, nitropyrrole, or inosine, etc.). Each defined base is represented by a different color linked to one of four different labels that can be distinguished from each other when added in the same mixture. In this figure, position 1 is defined in the first cycle and position 2 is defined in the second cycle. After going through these cycles, the identities of positions 1, 2, 3, 4, 5 of the target (under the oligo footprint) are obtained in successive cycles. In some embodiments, the matched base identities of the target are complementary to the corresponding defined bases of the oligo. In some such embodiments, the localization must be sufficient to identify the location of the footprint to which the oligo binds, the position within the footprint being defined by a code such as color or cycle number. . It schematically shows the case where only one nucleotide is defined and all four different defined nucleotides are shown in different colors. Different colors in some embodiments indicate different fluorophores or different addition cycles. If the colors are different, the entire sequencing process can be performed in a single homogenous or one-pot reaction without the need for reagent exchange. In this approach, strands of DNA are stretched/stretched on the surface and short oligos are added in solution and bind to their complementary sites. Four degenerate positions on each side, oligo binding with three defined bases flanking 5'cy3 NNgGcNN (oligo name: 3004-3mer) are shown. Stretched DNA is lambda phage denatured with 0.5M NaOH for 20 minutes. Binding buffer was 4×SSC and 0.1% Tween 20, binding was performed at 4° C. and imaging was performed at room temperature.

Reference will now be made in detail to the embodiments. Examples are illustrated in the accompanying drawings. In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the present disclosure. However, it will be clear to those skilled in the art that the present disclosure may be practiced without these specific details. In other instances, well-known methods, procedures, components, circuits, and networks have not been described in detail so as not to unnecessarily obscure aspects of the embodiments.

Definitions The terminology used in this disclosure is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the description and the appended claims, the singular forms "a,""an," and "the" refer to the plural forms as well, unless the context clearly indicates otherwise. intended to be included in It should also be understood that the term "and/or" as used herein refers to and includes any and all possible combinations of one or more of the associated listed items. Furthermore, the terms "includes" and/or "comprising", as used herein, do not exclude the presence of a recited feature, integer, step, operation, element, and/or component. , does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, constituents, and/or groups thereof.

As used herein, the term “if,” depending on the context, is “when,” or “upon,” or “in is taken to mean "response to determining" or "in response to detecting". Similarly, the phrases "when it is determined" or "when [the stated condition or event] is detected" are interchangeable, depending on the context, "on determining" or "upon determination" or " It is taken to mean "upon detection of [state or event]" or "in response to detection of [state or event]".

The term "or" is intended to mean an inclusive "or" rather than an exclusive "or." That is, unless specified otherwise, or clear from context, the phrase "X employs A or B" is intended to mean any of the natural inclusive permutations. That is, the phrase "X uses A or B" is satisfied by any of the following examples: X uses A, X uses B, or X uses both A and B. use. Further, as used in this application and the appended claims, the articles "a" and "an" generally refer to "one" unless specified otherwise or clear from context that they are directed to the singular. shall be construed to mean "greater than or equal to".

It should also be understood that although the terms first, second, etc. are used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another. For example, a first filter could be termed a second filter, and, similarly, a second filter could be termed a first filter, without departing from the scope of this disclosure. Both the first filter and the second filter are filters, but not the same filter.

As used herein, the terms "about" or "approximately" can mean within an acceptable margin of error for a particular value as determined by one skilled in the art, which is in part It may depend on how the value is measured or determined (eg, limitations of the measurement system). For example, "about" can mean within 1 or greater than 1 standard deviation, per the practice in the art. "About" can mean a range of ±20%, ±10%, ±5%, or ±1% of a given value. The terms "about" or "approximately" can mean within one order of magnitude, within five times, or within two times the value. Where specific values are recited in this application and claims, the term “about” should be assumed to mean within a tolerance for the specified value unless otherwise stated. is. The term "about" may have a meaning commonly understood by those of ordinary skill in the art. The term "about" can refer to ±10%. The term "about" can refer to ±5%.

As used herein, the terms "nucleic acid," "nucleic acid molecule," and "polynucleotide" are used interchangeably. The term includes deoxyribonucleic acid (DNA, e.g., complementary DNA (cDNA), genomic DNA (gDNA), etc.), ribonucleic acid (RNA, e.g., messenger RNA (mRNA), small interfering RNA (siRNA), ribosomal RNA (rRNA ), transfer RNA (tRNA), microRNA, RNA highly expressed by the fetus or placenta, etc.), and/or DNA or RNA analogs (e.g. synthetic base analogs and/or naturally occurring (epigenetic modifications may refer to nucleic acids in any composition form, including base analogs, sugar analogs, and/or non-natural backbones, etc.), RNA/DNA hybrids and peptide nucleic acids (PNAs), which are All can be in single- or double-stranded form. Unless specifically limited, nucleic acids can contain known analogues of natural nucleotides, some of which can function in a manner similar to naturally occurring nucleotides. Nucleic acids can be in any form useful for carrying out the processes described herein (eg, linear, circular, supercoiled, single stranded, double stranded, etc.). Optionally, the nucleic acid is, in certain embodiments, a plasmid, phage, autonomously replicating sequence (ARS), centromere, artificial chromosome, chromosome, or other nucleic acid (in vitro or in a host cell, cell, cell nucleus, or cellular cytoplasmic, replicable, or replicable) or derived therefrom. In some embodiments, a nucleic acid can be derived from a single chromosome or fragment thereof (eg, a nucleic acid sample from one chromosome of a sample obtained from a diploid organism). Nucleic acid molecules can include full-length naturally occurring polynucleotides (eg, long non-coding (lnc) RNA, mRNA, chromosomal, mitochondrial DNA, or polynucleotide fragments). Polynucleotide fragments can be at least 200 bases long, or at least thousands of nucleotides long, or in the case of genomic DNA, polynucleotide fragments can be hundreds of kilobases to several megabases long. .

In certain embodiments, the nucleic acid comprises a nucleosome, a fragment or portion of a nucleosome, or a nucleosome-like structure. Nucleic acids may include proteins (eg, histones, DNA binding proteins, etc.). Nucleic acids analyzed by the processes described herein are sometimes substantially isolated and substantially unassociated with proteins or other molecules. Nucleic acids include synthetic, replicated, and double-stranded (“sense” or “antisense,” “plus” or “minus” strands, “forward” or “reverse” reading frames) and double-stranded polynucleotides. Also included are derivatives, variants, and analogues of amplified RNA or DNA. Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine and deoxythymidine. For RNA, the base cytosine is replaced with uracil and the 2' position of the sugar contains a hydroxyl moiety. In some embodiments, a nucleic acid is prepared using a nucleic acid obtained from a subject as a template.

As used herein, the term "ending position" or "end position" (or simply "end") refers to the outermost base, e.g., cell-free DNA It can refer to genomic coordinates, or genomic identity, or nucleotide identity, of the bases at the ends of a molecule (eg, a plasmid DNA molecule). A terminal position can correspond to either end of a DNA molecule. Thus, where one refers to the beginning and end of a DNA molecule, both can correspond to terminal positions. In some embodiments, one terminal position is the genomic coordinates or nucleotide identity of the outermost base on one end of the cell-free DNA molecule, which is analyzed by analytical methods such as massively parallel sequencing or next generation. Detected or determined by sequencing, single molecule sequencing, double- or single-stranded DNA sequencing library preparation protocols, polymerase chain reaction (PCR), or microarray. In some embodiments, such in vitro techniques can alter the true in vivo physical ends of cell-free DNA molecules. Thus, each detectable terminus may represent a biologically true terminus, or the terminus may be reduced by one or more nucleotides from the original terminus or extended by one or more nucleotides of the molecule. (For example, it can be 5'blunting and 3'filling of non-blunt-ended double-stranded DNA molecule overhangs with Klenow fragment). Genomic identities or genomic coordinates of terminal positions can be derived from the results of alignment of sequence reads to a human reference genome (eg, hg19). This can be derived from a catalog of indices or codes representing the original coordinates of the human genome. The present invention can refer to locations or nucleotide identities on cell-free DNA molecules read by, but not limited to, target-specific probes, mini-sequencing, DNA amplification. The term "genomic location" can refer to the nucleotide location of a polynucleotide (eg, gene, plasmid, nucleic acid fragment, viral DNA fragment). The term "genomic location" is not limited to the nucleotide location of a genome (eg, a gamete or a haploid set of chromosomes of each cell of a microorganism or multicellular organism).

As used herein, the terms "mutation," "single nucleotide variant," "single nucleotide polymorphism," "variant," "epigenetic modification," and "structural rearrangement" refer to refers to one or more detectable alterations of one or more different types in the genetic material of In certain instances, one or more mutations can be found and identified in cancer cells (eg, driver mutations and passenger mutations). Mutations can be transmitted from parent cells to daughter cells. Those skilled in the art will appreciate that genetic mutations (eg, driver mutations) in parental cells can induce additional, different mutations (eg, passenger mutations) in daughter cells. Mutations or variants generally occur in nucleic acids. In certain instances, a mutation can be a detectable change in one or more deoxyribonucleic acids or fragments thereof. Mutations generally refer to nucleotides that are added, deleted, substituted, inverted, or transposed to new positions within a nucleic acid. Mutations can be naturally occurring mutations or experimentally induced mutations. Variations in sequences in specific tissues are examples of "tissue-specific alleles." For example, a tumor may have mutations that result in an allele at a genetic locus that does not occur in normal cells. Another example of a "tissue-specific allele" is a fetal-specific allele that occurs in fetal tissue but not maternal tissue. The term "allele" can sometimes be used interchangeably with mutation.

The term "transient binding" means that a binding reagent or probe reversibly binds to a binding site on a polynucleotide and the probe does not normally remain bound to its binding site. do. This provides useful information regarding the location of binding sites during the course of analysis. Typically, one reagent or probe binds to the immobilized polymer and then stays for some time before detaching from the polymer. The same or another reagent or probe can then be attached to the polymer at another site. In some embodiments, multiple binding sites along a polymer can be simultaneously bound by multiple reagents or probes. In some cases, different probes bind to overlapping binding sites. This process of reversibly binding reagents or probes to polymers can be repeated many times during the course of an analysis. The location, frequency, residence time and photon emission of such binding events ultimately provide a map of the polymer's chemical structure. Indeed, due to the transient nature of these binding events, an increase in the number of such binding events can be detected. For example, each probe inhibits the binding of the other probe if the probes remain bound for an extended period of time.

The term "repetitive binding" means that the same binding site on a polymer is bound multiple times by the same binding reagent or probe, or the same type of binding reagent or probe, during the course of an analysis. Typically, one reagent binds to a site, then releases, another reagent binds, then releases, etc., until a map of the polymer is developed. Repeated binding increases the sensitivity and accuracy of the information obtained from the probe. As more photons accumulate, multiple independent binding events increase the probability that a real signal will be detected. Sensitivity is increased if the signal is too low to be called over background noise when detected only once. In such cases, the signal becomes callable when seen persistently (eg, if the same signal is seen multiple times, the confidence that the signal is actually increasing increases). Multiple reads of information increase the accuracy of binding site calling because one read is confirmed by another.

As used herein, the term "probe" can comprise an oligonucleotide and has one or more optional labels, which can be fluorescent labels attached. In some embodiments, probes are peptides or polypeptides that are optionally labeled with fluorochromes or fluorescent or light scattering particles. These probes can be used to localize binding sites to nucleic acids or proteins, carbohydrates, fatty acids or other biomolecules or non-biopolymers.

As used herein, the term "oligonucleotide probe species" can include one or more different oligonucleotides used as probes. A portion of the sequence of the oligonucleotide is common to all members of the oligonucleotide probe species and other portions, particularly the bases flanking the common sequence, are degenerate or universal, thus making the oligonucleotide probe species can be provided. In some cases, the term "oligonucleotide probe species" can refer to members of a single species, such as individual oligonucleotide probes. In other cases, the term may refer to all members of multiple species. Oligonucleotide probe species all have a common label, if a label is provided. As used herein, the term "oligonucleotide species set" means a plurality of oligonucleotide species having different consensus sequences.

As used herein, the term "complete set of oligonucleotide species" means all oligonucleotide species used in the sequencing method. Different members of the complete set of oligonucleotides have the same length of k bases or have different lengths of k bases. A complete set of oligonucleotide probe species can include all k base long sequences of a single length of k base lengths, or can include a subset thereof.

As used herein, the terms "tiling set of sequence probes" or "tiling set" refer to a set of oligonucleotide probe species in which all but two of the oligo The nucleotide probe species has bases in common with all but one of the oligonucleotide probe species that are also common to two other oligonucleotide probe species in the set, and the corresponding different bases are in the sequences common to the oligonucleotide probe species. at each end. Two members of the tiling set have oligonucleotide probe species that have bases in common with all but one oligonucleotide probe species and with one other oligonucleotide probe species, and the different bases are , at their respective 3′ and 5′ ends, completing a set of all overlapping oligos.

As used herein, the terms "oligonucleotide" and "oligo" refer to short nucleic acid sequences. In some embodiments, the oligos are of a defined size, eg, each oligo is k nucleotide bases in length (also referred to herein as a "k-mer"). is done). Typical oligo sizes are 3 bases long, 4 bases long, 5 bases long, 6 bases long, and the like. An oligo may also be referred to herein as being N bases long.

As used herein, the term "label" includes a single detectable entity (eg, wavelength emitting entity) or multiple detectable entities. In some embodiments, the label is either transiently attached to the nucleic acid or attached to the probe either covalently or non-covalently. Different types of labels may flash during fluorescence emission, photon emission may fluctuate, or light switches may be turned on or off. Different labels are used for different imaging methods. In particular, some labels are uniquely suited for different types of fluorescence microscopy. In some embodiments, the fluorescent labels fluoresce at different wavelengths and have different lifetimes. In some embodiments, background fluorescence is present in the imaging field. In some such embodiments, such background is removed from analysis by rejecting the time window of fluorescence due to scatter or background fluorescence. If the label is at one end of the probe (e.g., the 3' end of the oligo probe), the localization accuracy corresponds to that end of the probe (e.g., the 3' end of the probe sequence and the 5' end of the target sequence). . Apparent transient, fluctuating or blinking or darkening behavior of the label can distinguish whether the attached probe is bound and dissociated from its binding site.

As used herein, the term "flap" refers to an entity that functions as a receptor for binding of a second entity. Two entities may comprise a molecular binding pair. Such binding pairs may include nucleic acid binding pairs. In some embodiments, the flap comprises a series of oligonucleotide or polynucleotide sequences that bind to labeled oligonucleotides. Such a bond between the flap and the oligonucleotide should be substantially stable during the process of imaging the transient binding of the portion of the probe that binds to the target.

The terms "elongated", "extended", "stretched", "linearized" and "straightened" are , can be used interchangeably. In particular, the term "extended polynucleotide" (or "extended polynucleotide" etc.) refers to a nucleic acid molecule that is linearly extended after being attached to a surface or matrix in some way. In general, these terms mean that binding sites along a polynucleotide are separated by a physical distance that more or less correlates with the number of nucleotides between them (e.g., polynucleotides are linear ). Some uncertainty to the extent that physical distances are consistent with some bases can be tolerated.

The term "imaging" as used herein includes both two-dimensional arrays and two-dimensional scanning detectors. In most cases, the imaging techniques used herein necessarily include a fluorescence excitation source (eg, a laser of appropriate wavelength) and a fluorescence detector.

As used herein, the term "sequence bit" refers to one or several bases (eg, 1-9 bases long) of a sequence. In particular, in some embodiments the sequence corresponds to the length of the oligo (or peptide) used for transient conjugation. Thus, in such embodiments, sequence refers to a region of a target polynucleotide.

As used herein, the term "haplotype" refers to a set of variations that are typically inherited together. This occurs because sets of variations exist in close proximity on a polynucleotide or chromosome. In some cases, a haplotype includes one or more single nucleotide polymorphisms (SNPs). In some cases, a haplotype includes one or more alleles.

As used herein, the term "methyl binding protein" refers to a protein containing a methyl CpG binding domain comprising approximately 70 nucleotide residues. Such domains have a low affinity for unmethylated regions of DNA and can therefore be used to identify the location of methylated nucleic acids. Some common methyl-binding proteins include MeCP2, MBD1, and MBD2. However, there are a variety of different proteins that contain methyl-CpG binding domains (eg, those described in Roloff et al., BMC Genomics 4:1, 2003). Similarly, other types of antibodies are used to bind other types of epigenetic modifications such as methyladenine.

As used herein, the term "nanobody" refers to a set of proteins comprising heavy chain-only antibody fragments. They are highly stable proteins and can be engineered to have similar sequence homology to various human antibodies, and thus can be used in cell types or regions within the body, or in specific types of naturally occurring epitopes. Allows specific targeting to genetically modified nucleobases. A review of nanobody biology is provided by Bannas et al. , Frontiers in Immu. 8:1603, 2017.

As used herein, the term "affimer" refers to a non-antibody binding protein. These are highly customizable proteins, comprising two peptide loops and, in some embodiments, an N-terminal sequence randomized to provide affinity and specificity for the desired protein target. have. Thus, in some embodiments, affimers are used to identify sequences or structural regions of interest in proteins. In some such embodiments, affimers are used to distinguish between many different types of protein expression, localization, and interactions (eg, as described in Tiede et al., ELife 6:e24903, 2017). ing).

As used herein, the term "aptamer" refers to another category of versatile and customizable binding molecules. Aptamers comprise nucleotide and/or peptide regions. It is typical to generate a random set of possible aptamer sequences and then select the desired sequence that binds to the particular target molecule of interest. Aptamers have additional characteristics beyond their stability and flexibility that make them desirable over other categories of binding proteins. (See, eg, Song et al., Sensors 12:612-631, 2012 and Dunn et al., Nat. Rev. Chem. 1:0076, 2017).

Several aspects are described below with reference to exemplary applications for illustration. It should be understood that numerous specific details, relationships and methods have been set forth in order to provide a thorough understanding of the features described herein. It will be understood, however, by one skilled in the relevant art that the features described herein can be practiced without one or more of the specific details or with other methods. Features described herein are not limited by the illustrated order of acts or events, and some acts may occur in different orders and/or concurrently with other acts or events. Moreover, not all illustrated acts or events may be required to implement a methodology in accordance with the features described herein.

An exemplary system embodiment.
In one aspect, disclosed herein is a method of sequencing a target nucleic acid. The method may comprise (a) immobilizing the target nucleic acid in a double-stranded linearized extended form on a test substrate, thereby forming an immobilized extended double-stranded nucleic acid. The method includes (b) denaturing the fixed, extended double-stranded nucleic acid to a single-stranded form on a test substrate, thereby obtaining a fixed first strand and a fixed second strand of the target nucleic acid. Each base of the immobilized second strand may be adjacent or close to the corresponding complementary base of the immobilized first strand. The method may further comprise (c) exposing the immobilized first strand and the immobilized second strand to a respective pool of oligonucleotide probe species of each of the set of oligonucleotide probe species; Each oligonucleotide probe species in the set of oligonucleotide probe species is of a given sequence and length. Exposure (c) is performed by the individual probes of the respective pools of each oligonucleotide probe species each of the immobilized first strand or the immobilized second strand complementary to the respective oligonucleotide probe species. It can be performed under conditions that allow the moieties to bind and form their respective duplexes. Each instance of optical activity can thereby be produced. The method comprises (d) measuring a location on the test substrate using one or more two-dimensional imaging devices, and optionally each respective optical activity occurring during exposure (c). It can be continued by measuring the duration of the case. The method then proceeds by (e) repeating exposing (c) and measuring (d) for each pool of oligonucleotide probe species of the set of oligonucleotide probe species, whereby the test substrate A set of multiple positions on can be obtained. Each set of locations on the test substrate may correspond to one or more oligonucleotide probe species of the set of oligonucleotide probe species. If multiple different oligonucleotide probe species are measured sequentially and/or simultaneously as a result of the use of multiple labels associated therewith, multiple locations on the test substrate from a single step of exposure (c). is obtained. The method comprises (f) compiling a target from a plurality of sets of locations on a test substrate by compiling locations on the test substrate represented by a plurality of sets of locations corresponding to different or different sets of oligonucleotide probe species. It can further comprise sequencing at least a portion of the nucleic acid.

In some embodiments, exposing (c) is the immobilized first strand or carried out under conditions that allow each portion of the immobilized second strand to transiently and reversibly bind to form the respective duplexes, thereby giving rise to instances of optical activity . In some embodiments, exposing (c) is the immobilized first strand or immobilized Each instance of optical activity is performed under conditions that allow it to repeatedly transiently and reversibly bind to each portion of the second strand to form the respective duplexes, thereby rendering each instance of optical activity is repeatedly generated. In some such embodiments, each oligonucleotide probe is attached to a label (eg, dye, fluorescent nanoparticle, or light scattering particle) in a set of oligonucleotide probe species in a pool of oligonucleotide species.

In some embodiments, in a method, exposure is in the presence of a first label in the form of an intercalating dye. In some embodiments, each oligonucleotide probe is bound to a second label in a pool of oligonucleotide species.In a set of oligonucleotide probe species, the first label and the second label are bound to the first label. and the second label are in close proximity to each other, have overlapping donor emission and acceptor excitation spectra that increase one of the first label fluorescence and the second label fluorescence, and are optically active In each case, an intercalating dye intercalating in each duplex between the oligonucleotide probe and the immobilized first strand or immobilized second strand binds to the oligonucleotide probe. derived from the proximity to the second marker that is In other embodiments, both the first label and the second label are attached to the oligonucleotide probe.

In some embodiments, the exposure is in the presence of a first label in the form of an intercalating dye, each oligonucleotide probe species of the set of oligonucleotide probe species bound to a second label, One label can increase the fluorescence of the second label when the first and second labels are in close proximity to each other, and each instance of optical activity is associated with the proximity of the intercalating dye to the oligonucleotide probe. and the immobilized first strand or the immobilized second strand, inserting a second label in each duplex.

In some embodiments, the exposure is in the presence of a first label in the form of an intercalating dye, each oligonucleotide probe species of the set of oligonucleotide probe species bound to a second label, Two labels increase the fluorescence of the first label when the first label and the second label are in close proximity to each other, and each instance of optical activity is due to the proximity of the intercalating dye to the oligonucleotide probe and A second label is inserted in each duplex between the immobilized first strand or the immobilized second strand.

In some embodiments, the exposure is in the presence of an intercalating dye, and each instance of optical activity is between the oligonucleotide probe and the immobilized first strand or the immobilized second strand, respectively. derived from the fluorescence of the intercalating dye intercalating into the double strand of the In such embodiments, each instance of optical activity is greater than the fluorescence of the intercalating dye prior to intercalation into its respective duplex.

In some embodiments, the two or more oligonucleotide probe species of the set of oligonucleotide probe species are immobilized first strand and immobilized second strand during a single instance of exposure (c). each different oligonucleotide probe species of the set of oligonucleotide probe species exposed to the strands and exposed to the immobilized first strand and the immobilized second strand during a single instance of exposure (c) , associated with different labels. In some such embodiments, the first pool of first oligonucleotide probe species of the set of oligonucleotide probe species, the first oligonucleotide probe species associated with the first label are during exposure (c), exposed to the immobilized first strand and the immobilized second strand, a second pool of second oligonucleotide probe species of the set of oligonucleotide probe species, a second label; is exposed to the immobilized first strand and the immobilized second strand during a single instance of exposure (c), the first label and the second oligonucleotide probe species associated with 2 labels are different. Alternatively, the first pool of the first oligonucleotide probe species of the set of oligonucleotide probe species, the first oligonucleotide probe species associated with the first label, are subjected to a single instance of exposure (c) in a second pool of oligonucleotide probe species of the set of oligonucleotide probe species exposed to the immobilized first strand and the immobilized second strand, associated with a second label A second oligonucleotide probe species is exposed to the immobilized first strand and the immobilized second strand during a single instance of exposure (c), and the third oligonucleotide probe species of the set A third pool of oligonucleotide probe species, a third oligonucleotide probe species associated with a third label, was immobilized first strand and immobilized during a single instance of exposure (c) The first label, the second label, and the third label exposed to the second strand are each different.

In other embodiments, any number of different labels distinguished by excitation, emission, fluorescence lifetime, etc. are used with associated pools of oligonucleotide probe species.

In some embodiments, the pool of oligonucleotide probe species comprises a single oligonucleotide probe species. In other embodiments, the pool of oligonucleotide probe species comprises a plurality of oligonucleotide probe species. In a further embodiment, the pool of oligonucleotide probe species has a distinguishing label associated with (bound to) each single oligonucleotide probe species of the pool of oligonucleotide probe species. In further embodiments, some or all of the set of different oligonucleotide probe species have the same type of label that is not directly distinguishable from other oligonucleotide probe species of the pool of oligonucleotide probe species. In yet further embodiments, one or more oligonucleotide probe species of the pool of plurality of oligonucleotide probe species are unlabeled.

In some embodiments, (e) exposing (c) and measuring (d) are repeated for each single oligonucleotide probe species of the set of oligonucleotide probe species.

In some embodiments, exposing (c) and measuring (d) and repeating are performed sequentially. In other embodiments, exposure (c) and measurement (d) are performed simultaneously, and measurement (d) begins as soon as a single frame is obtained during the exposure (c) process. In a further embodiment, multiple exposing (c) processes are performed, eg, with different pools of oligonucleotide probes, before performing the measuring (d) process.

In some embodiments, exposing (c) is to a first pool of oligonucleotide probe species comprising a single species or comprising a plurality of oligonucleotide probe species of a set of oligonucleotide probes. repeating (e), exposing (c), and measuring (d) to a first pool of oligonucleotide probe species, exposing (c) and measuring (d) at a second temperature; Including doing.

In some embodiments, exposing (c) is to a first pool of oligonucleotide probe species of the set of oligonucleotide probe species at a first temperature, repeating (e), exposing (c) , and measuring (d) include exposing (c) and measuring (d) to a first pool of oligonucleotide probe species at each of a plurality of different temperatures, wherein the first temperature and a plurality of constructing a melting curve for the first pool of oligonucleotide probe species using the optical activity measurement locations and durations recorded by measurements (d) at each different temperature of . In other embodiments, different salt concentrations are used instead of different temperatures. In additional embodiments, denaturing reagents such as formamide or changes in pH are used to alter binding affinity. In further embodiments, any combination of different salt concentrations, different temperatures, different pH levels, or different levels of denaturing reagents are utilized for one or more oligonucleotide probe species to achieve melting curve equivalents.

In some embodiments, the set of oligonucleotide probe species comprises a plurality of subsets comprising a pool of a plurality of different types of oligonucleotide probe species, wherein the plurality of different types of oligonucleotides of the plurality of subsets of oligonucleotide probe species Iterations (e), exposures (c), and measurements (d) are performed for each respective subset of the pool containing the probe species. In some such embodiments, each respective subset comprises a pool of multiple different types of oligonucleotide probe species, including two or more different oligonucleotide probe species from the set of oligonucleotide probe species. Alternatively, each respective subset comprising a pool of multiple different oligonucleotide probe species comprises four or more different oligonucleotide probe species from the set of oligonucleotide probe species. In some such embodiments, the set of oligonucleotide probe species consists of four subsets comprising the pool of oligonucleotide probe species. In some embodiments, the method generates a set of oligonucleotide probe species based on a calculated or experimentally derived melting temperature of each oligonucleotide probe species, comprising a pool of oligonucleotide probe species. wherein the oligonucleotide probe species with similar melting temperatures are placed in the same subset of oligonucleotide probes by the splitting, and the temperature or duration in the case of exposure (c) is the oligonucleotide probe Determined by the average melting temperature of the oligonucleotide probe species of the corresponding subset comprising the pool of species. Still further, in some embodiments, the method further comprises dividing the set of oligonucleotide probes into a plurality of subsets comprising pools of oligonucleotide probe species based on the sequence of each oligonucleotide probe species. , oligonucleotide probe species that overlap in sequence are arranged into different subsets comprising pools of oligonucleotide probe species.

In some embodiments, measuring locations on the test substrate identifies the center of each instance of optical activity or a portion of each instance of optical activity within a frame of data obtained by the two-dimensional imaging device. and a fit function for fitting, wherein the center of each instance of optical activity is the location of each instance of optical activity on the test substrate. is considered. In some such embodiments, the fitness function is a Gaussian function, a first moment function, a gradient-based approach, or a Fourier transform.

In some embodiments, each instance of optical activity persists over multiple frames measured by the two-dimensional imaging device, and a single frame out of the multiple frames comprising each instance of optical activity is an optical Measuring the location on the test substrate that is a fraction of each instance of activity is measured using a fit function over multiple frames to identify the center of each instance of optical activity over multiple frames. , the center of each instance of optical activity is taken to be the position of each instance of optical activity on the test substrate over multiple frames. In some such embodiments, the fitness function is a Gaussian function, a first moment function, a gradient-based approach, or a Fourier transform.

In some embodiments, measuring the location on the test substrate includes inputting frames of data measured by a two-dimensional imaging device into a trained convolutional neural network, the frames of data each instance of optical activity in the plurality of instances of optical activity, wherein each instance of optical activity in the plurality of instances of optical activity is a portion of the immobilized first strand or the immobilized second strand In response to inputs corresponding to individual oligonucleotide probes of the oligonucleotide species that bind to Identify locations on the test board. In some embodiments, the multiple instances of optical activity are present at different locations within one or more frames of data, and the multiple different locations of optical activity each represent a plurality of instances of optical activity in the exposing step. and correspond to different binding sites on the first and/or second strand of one or more target polynucleotides. In further embodiments, each instance of optical activity having the same position occurs over a different set of frames, and each other instance of optical activity having a different position occurs over different sets of frames, separately and/or simultaneously. It is processed.

In some embodiments, the measurement resolves the center of each instance of optical activity to a location on the test substrate with a location accuracy of at least 20 nm, at least 2 nm, at least 60 nm, or at least 6 nm.

In some embodiments, the measurement resolves the center of each instance of optical activity to a location on the test substrate, where the location is determined with sub-diffraction limit accuracy and/or precision.

In some embodiments, (d) measuring the locations on the test substrate and the duration of the respective optical activity is greater than 5,000 photons at the locations, greater than 50,000 photons at the locations, or Over 200,000 photons are measured. In some embodiments, the number of photons used for measurement (d) is obtained from a single frame or from a combination of frames deemed to contain a single instance of optical activity.

In some embodiments, each instance of optical activity has a predetermined number of standard deviations (e.g., 3, 4, 5, 6, 7, 8, 9 standard deviations) compared to the background optical activity observed for the test substrate. , or more than 10 standard deviations).

In some embodiments, each respective oligonucleotide probe species of a set or subset of a plurality of oligonucleotide probe species comprises a unique N base long sequence, where N is the set {1, 2, 3, 4, 5, 6, 7, 8, and 9} and all unique N-base long sequences of length N are represented by a set or subset containing a plurality of oligonucleotide probe species. In some such embodiments, the unique N-base long sequence is bounded by one or more degenerate nucleotides and one or more universal bases (eg, 2'-deoxyinosine, CPG500, 5-nitroindole). Contains one or more nucleotide positions that are occupied. In some such embodiments, the unique N-base long sequence is 5′ flanked by a single degenerate nucleotide position or universal nucleotide position and 3′ by a single degenerate nucleotide position or universal flanking nucleotide positions. In some embodiments, the target nucleic acid is at least 140 bases long and determining (f) sequences greater than 70% of the target nucleic acid. In some embodiments, the target nucleic acid is at least 140 bases long and determining (f) sequences greater than 90% of the target nucleic acid. In some embodiments, the target nucleic acid is at least 140 bases long and determining (f) sequences greater than 99% of the target nucleic acid. In some embodiments, determining (f) sequences greater than 99% of the target nucleic acids.

In some embodiments, the target nucleic acid is at least 10,000 bases long, or at least 1,000,000 bases long.

In some embodiments, the test substrate is washed prior to repeating exposing (c) and measuring (d), thereby exposing the test substrate to one or more oligonucleotide probe species in the set of oligonucleotide probe species. One or more oligonucleotide probe species are removed from the test substrate prior to exposure.

In some embodiments, immobilization (a) comprises the nucleic acid by molecular combing (receding meniscus), flow stretching, nanoconfinement, or electro-stretching; Including applying to the test substrate.

In some embodiments, each respective instance of optical activity has an observed metric that meets a predetermined threshold. In some such embodiments, the observation metric includes duration, signal-to-noise ratio, photon count, or intensity. In some embodiments, the predetermined threshold is that (i) each base of a unique N-base long sequence or each non-degenerate base and/or non-universal base is a fixed first strand of the target nucleic acid or a first binding form that binds to complementary bases of the immobilized second strand; and (ii) a unique N-base long sequence of bases or each non-degenerate and/or non-universal base; There is at least one mismatch between the sequence of the immobilized first strand or the immobilized second strand of the target nucleic acid to which the nucleotide probe is bound to form each instance of optical activity , from the second binding form.

In some embodiments, each respective oligonucleotide probe species of the set of oligonucleotide probe species has a unique corresponding predetermined threshold value. In some such embodiments, the predetermined threshold for each respective oligonucleotide probe species of the set of oligonucleotide probe species is derived from the training data set. In some embodiments, the predetermined threshold value for each respective oligonucleotide probe species of the set of oligonucleotide probe species is derived from a training data set, the training set comprising each respective oligonucleotide of the set of oligonucleotide probe species. For the nucleotide probe species, each base of the unique N-base long sequence of each oligonucleotide probe species or each non-degenerate and/or non-universal base was bound to the reference sequence such that it bound to the complementary base of the reference sequence. Includes a measure of the observed metric for each oligonucleotide probe at the time. In some such embodiments, the reference sequences are immobilized on a reference substrate. Alternatively, the reference sequence is included with the target nucleic acid, separated from or ligated to it and immobilized on the test substrate. In some embodiments, the reference sequence is PhiX174, M13, phage lambda, phage T7, Escherichia coli, Saccharomyces cerevisiae, Saccharomyces pombe, or any other naturally occurring genome. or includes all or part of the genome of the transcriptome. In some embodiments, the reference sequence is a synthetic construct of known sequence. In some embodiments, the reference sequence comprises all or part of rabbit globin RNA.

In some embodiments, each oligonucleotide probe species of the set of oligonucleotide probe species produces a first instance of optical activity by binding to the complementary portion of the immobilized first strand and is immobilized. A second instance of optical activity is produced by binding to the complementary portion of the second strand.

In some embodiments, each oligonucleotide probe species of the set of oligonucleotide probe species is positioned at different locations on the test substrate by binding to two or more complementary portions of the immobilized first strand. Two or more instances of optical activity at different locations on the test substrate by producing two or more instances of optical activity and/or binding to two or more complementary portions of the immobilized second strand. Give rise to the second case.

In some embodiments, each oligonucleotide probe species is exposed to a portion of the immobilized first strand or the immobilized second strand that is complementary to the respective oligonucleotide probe species during exposure (c). , bind at the same position more than once, thereby giving rise to more than one instance of optical activity, each instance of optical activity representing a binding event of multiple binding events.

In some embodiments, each oligonucleotide probe is attached at multiple positions to a portion of the immobilized first strand or immobilized second strand that is complementary to the respective oligonucleotide probe species. , binds multiple times at each position, potentially generating multiple instances of optical activity at each location of optical activity during exposure (c), each instance of optical activity resulting in binding events of multiple binding events. show.

In some embodiments, exposure (c) occurs for 5 minutes or more, 5 minutes or less, 2 minutes or less, or 1 minute or less.

In some embodiments, the exposure (c) is one or more frames of a two-dimensional imaging device, two or more frames of a two-dimensional imaging device, 500 or more frames of a two-dimensional imaging device, or Occurs over 5,000 frames of the device.

In some embodiments, multiple two-dimensional imaging devices are utilized, either simultaneously and/or sequentially, each of the multiple two-dimensional imaging devices optimized to detect a particular type of label. , thereby allowing simultaneous collection of data for multiple labels associated with multiple different oligonucleotide probe species.

In some embodiments, exposing (c) is to a first oligonucleotide probe species of a set of oligonucleotide probe species for a first period of time, repeating (e), exposing (c), and measuring (d) includes exposing (c) to the second oligonucleotide probe species for a second period of time, the first period of time being different than the second period of time.

In some embodiments, exposing (c) is to the first oligonucleotide probe species of the set of oligonucleotide probe species for a first number of frames of the two-dimensional imaging device, repeating (e) , exposing (c), and measuring (d) comprises performing a second number of frame-to-frame exposures (c) of the two-dimensional imaging device to the second oligonucleotide probe species, wherein the first number is different from the second number of frames.

In some embodiments, exposing (c) is to the first oligonucleotide probe species of the set of oligonucleotide probe species for a first number of frames of the two-dimensional imaging device, repeating (e) , exposing (c), and measuring (d) comprises performing a second number of frame-to-frame exposures (c) of the two-dimensional imaging device to the second oligonucleotide probe species, wherein the first number The exposure time of each frame of the frames is different than the exposure time of each frame of the second number of frames.

In some embodiments, each oligonucleotide probe species of a set of oligonucleotide probe species is the same length.

In some embodiments, each oligonucleotide probe species of a set of oligonucleotide probe species has the same length M, where M is a positive integer greater than or equal to 2 (eg, M is 2, 3, 4 , 5, 6, 7, 8, 9, 10, or 10 or more), (f) sequencing at least a portion of the target nucleic acid from the set of multiple locations on the test substrate comprises Overlapping sequences of different oligonucleotide probe species represented by are also used. In some such embodiments, each oligonucleotide probe species of the set of oligonucleotide probe species shares M−1 sequence homology with another oligonucleotide probe of the set of oligonucleotide probe species. In some such embodiments, sequencing at least a portion of the target nucleic acid from the set of multiple locations on the test substrate comprises a first tiling pathway corresponding to the immobilized first strand and immobilized determining a second tiling path corresponding to the generated second strand. In some such embodiments, a break in the first tiling path is resolved using a corresponding portion of the second tiling path, the second tiling path Complementary to the ring pathway. In other embodiments, discontinuities in the first tiling path or the second tiling path are resolved using a reference array. In other embodiments, the break in the first or second tiling pathway is the corresponding portion of the third or fourth tiling pathway from another instance of the target nucleic acid. is resolved using In some such embodiments, the confidence of the sequence assignment of the target nucleic acid sequence is increased using corresponding portions of the first tiling pathway and the second tiling pathway. In other embodiments, the confidence of the sequence assignment of the target nucleic acid sequence is increased using the corresponding portion of the third tiling pathway or fourth tiling pathway obtained from another instance of the target nucleic acid. .

In some embodiments, the length of time for instance exposure (c) is determined by the estimated melting temperature of each oligonucleotide probe species in the set of oligonucleotide probe species used in instance exposure (c). be.

In some embodiments, the method comprises (f) combining the immobilized duplex or the immobilized first strand and the immobilized second strand with an antibody, affimer, nanobody, aptamer, or methyl binding protein to thereby determine modifications to the target nucleic acid or correlate with the sequence of portions of the target nucleic acid from a set of multiple locations on the test substrate. In some embodiments, the method may allow determination of various epigenetic modifications that may comprise a portion of the target nucleic acid.

In some embodiments, the test substrate can include a two-dimensional surface. In some such embodiments, the two-dimensional surface is coated with a gel or matrix.

In some embodiments, test substrates can include flow cells, cells, three-dimensional matrices, or gels.

In some embodiments, the test substrate is bound with the sequence-specific oligonucleotide probe species prior to immobilization (a), wherein immobilization (a) uses the sequence-specific oligonucleotide probe species bound to the test substrate. and capturing the target nucleic acid on the test substrate.

In some embodiments, the sequence-specific oligonucleotide probe species are bound to the surface of the test substrate, have higher melting temperatures than natural oligonucleotide bases, and can allow denaturation of target nucleic acids, PNA bases and/or PNA bases. Alternatively, it may contain bases such as LNA bases. In some embodiments, the plurality of different sequence-specific oligonucleotide probe species are complementary, thereby allowing binding of the first and second strands of the target nucleic acid, thereby allowing each From a single target nucleic acid, it may be possible to determine a higher percentage of the bases of the target nucleic acid.

In some embodiments, the nucleic acid is in a solution comprising additional cellular components, fixation (a) or denaturation (b) is performed after the target nucleic acid has been fixed to the test substrate, and exposure (c ), it may further comprise washing the test substrate, thereby purifying additional plurality of cellular components released from the target nucleic acid.

In some embodiments, the test substrate prior to exposure (c) comprises polyethylene glycol, bovine serum albumin-biotin-streptavidin, casein, bovine serum albumin (BSA), one or more different tRNAs, one or more different deoxyribonucleotides, one or more different ribonucleotides, salmon sperm DNA, Pluronic F-127, Tween-20, hydrogen silsesquioxane (HSQ), or any combination thereof .

In some embodiments, the test substrate is coated with a vinylsilane coating comprising 7-octenyltrichlorosilane or methacryloxypropyltrimethoxysilane prior to fixation (a).

Another aspect of the present disclosure provides a method of sequencing a nucleic acid, comprising: (a) immobilizing a target nucleic acid in a linearized and stretched form on a test substrate, thereby forming a immobilized stretched target nucleic acid; and (b) exposing the fixed extension target nucleic acid to a respective pool of each oligonucleotide probe species of the set of oligonucleotide probe species, wherein each oligonucleotide probe species in the set of oligonucleotide probe species is of a given sequence and length, and exposes (b) the immobilized target nucleic acids in which the individual oligonucleotide probes of the respective pools of the respective oligonucleotide probe species are complementary to the respective oligonucleotide probe species. exposing under conditions that allow each portion to be transiently and reversibly thereby giving rise to each instance of optical activity; and (c) using a two-dimensional imaging device, on a test substrate and optionally measuring the duration of each respective instance of optical activity occurring during the exposure (b); and (d) each repeating exposing (b) and measuring (c) for the oligonucleotide probe species, thereby obtaining a set of multiple locations on the test substrate, wherein each respective location on the test substrate on a test substrate by obtaining, where the set may correspond to oligonucleotide probe species in the set of oligonucleotide probe species; Determining the sequence of at least a portion of the target nucleic acid from a set of multiple locations of the set of locations may include locations of optical activity at different locations and/or at the same location on the test substrate. including. In some such embodiments, the target nucleic acid is a double-stranded nucleic acid and the method denatures the target-immobilized double-stranded nucleic acid to a single-stranded form on the test substrate, thereby immobilizing the target nucleic acid. Obtaining an immobilized first strand and an immobilized second strand, wherein the immobilized second strand is complementary to the immobilized first strand. In some embodiments, the target nucleic acid is single-stranded RNA.

Another aspect of the disclosure provides a method of analyzing nucleic acids, comprising: (a) immobilizing a target nucleic acid in double-stranded form on a test substrate, thereby forming an immobilized double-stranded nucleic acid; (b) denaturing the target-immobilized double-stranded nucleic acid to a single-stranded form on a test substrate, thereby obtaining an immobilized first strand and an immobilized second strand of the target nucleic acid; denaturing, wherein the immobilized second strand is complementary to the immobilized first strand; and (c) combining the immobilized first strand and the immobilized second strand into one exposing to more than one oligonucleotide probe species and determining whether the one or more oligonucleotide probe species bind to the immobilized first strand or the immobilized second strand.

Details of an exemplary system will now be described in conjunction with FIG. 1A. FIG. 1A is a block diagram illustrating system 100 according to some implementations. In some implementations, device 100 includes one or more processing units (CPUs) 102 (also referred to as processors or processing cores), one or more network interfaces 104, user interfaces 106, non-persistent memory 111, It may include persistent memory 112 and one or more communication buses 114 for interconnecting these components. One or more communication buses 114 optionally include circuitry (sometimes called a chipset) that interconnects and controls communications between system components. Non-persistent memory 111 typically includes high-speed random access memory such as DRAM, SRAM, DDR RAM, while persistent memory 112 typically includes CD-ROMs, Digital Versatile Disks (DVDs), or other optical storage device, magnetic cassette, magnetic tape, magnetic disk storage device or other magnetic storage device, magnetic disk storage device, optical disk storage device, ROM, EEPROM, flash memory device, or other non-volatile solid state storage device including. Persistent memory 112 optionally includes one or more storage devices located remotely from CPU 102 . Persistent memory 112 includes non-transitory computer-readable storage media. In some implementations, non-persistent memory 111, or alternatively, non-transitory computer-readable storage media, sometimes in conjunction with persistent memory 112, includes the following programs, modules, and data structures, or a subset thereof: can be stored:
- an optional operating system 116, which handles various basic system services and may contain procedures for performing hardware dependent tasks;
an optional network communication module (or instructions) 118 or communication network for connecting the system 100 with other devices;
- an optically active detection module 120 for gathering information about the target molecule 130;
- information about each respective binding site 140 in the plurality of binding sites that can be directly correlated with the set of optically active positions for the target molecule 130;
- information about each respective binding event 142 in the plurality of binding events for each binding site 140, which may include (i) duration 144, and (ii) number of photons emitted 146;
- a sequencing module 150 for determining the sequence of the target molecule 130;
- information about each respective binding site 140 in the plurality of binding sites of each target molecule 130, which may include (i) base calls 152, and (ii) probabilities 154;
• optional information about the reference genome 160 of each target molecule 130 and • optional information about the complementary strand 170 of each target molecule 130 .

In various implementations, one or more of the identified elements are stored in one or more of the aforementioned storage devices and correspond to sets of instructions for performing the functions described above. As used herein, the modules, data, or programs (eg, sets of instructions) identified above need not be implemented as separate software programs, procedures, data sets, or modules; and various subsets of the data are combined or otherwise rearranged in various implementations. In some implementations, non-persistent memory 111 optionally stores a subset of the modules and data structures identified above. Additionally, in some embodiments, non-persistent memory 111 or persistent memory 112 stores additional modules and data structures not described above. In some embodiments, one or more of the elements identified above are stored in a computer system other than an element of visualization system 100 and are addressable by visualization system 100, and visualization system 100 may obtain all or part of such data, as appropriate.

Examples of network communication module 118 include, but are not limited to, World Wide Web (WWW), Intranet, Local Area Network (LAN), Controller Area Network (CAN), Camera Link and/or Cellular Network, Wireless Local Area networks (WLANs) and/or wireless networks (such as metropolitan area networks (MANs) and other devices with wireless communication). Wired or wireless communication optionally uses any of multiple communication standards, communication protocols and/or communication technologies, including, but not limited to, Global System for Mobile Communications (GSM), Extended Data GSM Environment. (EDGE), High Speed Downlink Packet Access (HSDPA), High Speed Uplink Packet Access (HSUPA), Evolution, Data-Only (EV-DO), HSPA, HSPA+, Dual Cell HSPA (DC-HSPDA), Long Term Evolution ( LTE), Near Field Communication (NFC), Wideband Code Division Multiple Access (W-CDMA), Code Division Multiple Access (CDMA), Time Division Multiple Access (TDMA), Bluetooth, Wireless Fidelity (Wi-Fi) (e.g. IEEE802.11a, IEEE802.11ac, IEEE802.11ax, IEEE802.11b, IEEE802.11g and/or IEEE802.11n), Voice over Internet Protocol (VoIP), Wi-MAX, protocols for email (e.g. Internet Access Protocol (IMAP) and/or Post Protocol (POP)), instant messaging (e.g. Extensible Messaging and Presence Protocol (XMPP), Session Initiation Protocol for Enhanced Instant Messaging and Presence Usage (SIMPLE), Instant Messaging and Presence Service (IMPS) )), and/or Short Message Service (SMS), or any other suitable communication protocol, including a communication protocol not yet developed as of the filing date of this disclosure.

Although FIG. 1A shows a "system 100," the figure is intended as a functional illustration of the various features present in a computer system rather than as a structural schematic of the implementations described herein. . In practice, items shown separately could be combined and some items could be separated, as recognized by those skilled in the art. Further, although FIG. 1A shows certain data and modules within non-persistent memory 111 , some or all of these data and modules reside within persistent memory 112 . Additionally, in some embodiments, memory 111 and/or 112 store additional modules and data structures not described above. In other embodiments, one or more different hardware modules (not shown) comprise one or more two-dimensional imaging devices, optical systems including lasers and gratings or filter wheels and associated controllers, and various pumps, Included as part of system 100, such as fluid systems including valves, heaters and other mechanical systems.

A system according to the present disclosure has been disclosed with reference to FIG. 1A, while a method according to the present disclosure will now be described in detail with reference to FIGS. 2A, 2B, 3, and 4. FIG.

block 202; A method is provided for determining the chemical structure of a molecule that is a target nucleic acid. A goal of the present disclosure is to enable single-nucleotide resolution sequencing of target nucleic acids. In some embodiments, methods are provided for characterizing interactions between one or more probes, including oligonucleotide probe species or other molecules, and target nucleic acids or other molecules. The method involves binding one or more probes, which may include an oligonucleotide probe species or another molecule, to a target nucleic acid or other molecule under conditions that allow the one or more probe species to transiently bind to the target nucleic acid or other molecule. Including adding to other molecules. The method may proceed by continuously monitoring individual binding events on the target nucleic acid or other molecule with a detector (which may include one or more two-dimensional imaging devices), over a period of time or over a series of frames. Data from binding events can then be analyzed to determine one or more characteristics of the interaction.

In some embodiments, methods of determining identity (sequence of a polymer that is a target nucleic acid) are provided. In some embodiments, methods of determining cell or tissue identity are provided. In some embodiments, methods of determining the identity of an organism are provided. In some embodiments, methods of determining the identity of an individual are provided. In some embodiments, the method is applied to single-cell nucleic acid and/or protein sequencing.

target polynucleotide.
In some embodiments, the molecule is a target nucleic acid, a naturally occurring target polynucleotide, or a copy of a naturally occurring polynucleotide. In various embodiments, the methods synthesize a single target polynucleotide molecule as an intact target polynucleotide from a single cell, single organelle, single chromosome, single virus, exosome, or bodily fluid. It can further comprise extracting, which can also be described herein as a sample. In further embodiments, the method extracts one or more target polynucleotide molecules as intact target polynucleotides from a single cell, single organelle, single chromosome, single virus, exosome, or bodily fluid. Extracting, which may also be described herein as a sample. In still further embodiments, the method extracts one or more target polynucleotide molecules as intact target polynucleotides from multiple cells, multiple organelles, multiple chromosomes, multiple viruses, multiple exosomes, or bodily fluids. Extracting, which may also be described herein as a sample. In some embodiments, a single target polynucleotide may comprise a single RNA, single ssDNA, or single dsDNA.

In some embodiments, the target nucleic acid is a short polynucleotide (eg, less than 1 kilobase or less than 300 bases). In some embodiments, the short polynucleotide is 100-200 bases long, 150-250 bases long, 200-350 bases long, or 100 bases long, as found in cell-free DNA in body fluids such as urine and blood. ~500 bases long.

In some embodiments, the target nucleic acid is at least 10,000 bases long. In some embodiments, the target nucleic acid is at least 1,000,000 bases long.

In various embodiments, the single target nucleic acid is a chromosome. In various embodiments, the single target polynucleotide is about 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , or 10 ⁹ bases long, or 10 ² -10 ⁹ bases long. Any length.

In some embodiments, the method allows analysis of the amino acid sequence of a target protein, target polypeptide, or target peptide. In some embodiments, methods are provided for analyzing and determining the amino acid sequence of a target protein, target polypeptide, or target peptide. In some embodiments, methods are provided for analyzing peptide modifications as well as the amino acid sequence of target polynucleotides. In some embodiments, the target molecular entity is a polymer containing at least 5 units. In such embodiments, the binding probes are molecular probes, including oligonucleotides, antibodies, affimers, nanobodies, aptamers, binding proteins, or small molecules.

In some embodiments, the standard 20 amino acids, 22 proteinogenic amino acids, non-proteinogenic amino acids found in alloproteins or non-proteinogenic amino acids found as a result of post-translational modifications, naturally occurring D - each or one or more of the amino acids, or naturally occurring L-amino acids, are bound by corresponding specific probes, including N-recognines, nanobodies, antibodies, aptamers, and the like. Binding of each probe is specific for each corresponding amino acid within a target protein, target polypeptide chain, or target peptide. In some embodiments, the order of subunits in a target protein, target polypeptide chain, or target peptide is determined. In some embodiments, binding is binding to the binding site of the surrogate. In some embodiments, the surrogate is a tag attached to a specific amino acid or peptide sequence and the transient binding is binding to the surrogate tag.

In some embodiments, the molecule is a heterogeneous molecule. In some embodiments, a heterogeneous molecule can comprise a portion of a supramolecular structure. In some embodiments, the method allows identifying and ordering units of chemical structure of a heterogeneous polymer or identifying and ordering units of chemical structure of a supramolecular structure, such as A unit can comprise different types of polymeric subunits, such as nucleic acids and amino acids. Such embodiments may involve extending one or more polymers and attaching multiple probes to identify chemical structures at multiple sites along the extended polymer. Stretching the heteropolymer may allow for sub-diffraction level (eg, nanometric) positioning of probe binding sites.

In some embodiments, attachment of oligonucleotide probe species that recognize subunits of the polymer provides a method for sequencing the polymer. Typically, binding of one oligonucleotide probe species is not sufficient to sequence the polymer. For example, FIG. 1B shows an embodiment in which a polymer 130 is sequenced based on measuring transient interactions with a complete set of probe species 182 (e.g., denatured target nucleic acids, Interaction with a complete set of oligonucleotide probe species, or interaction of a denatured target, protein, target polypeptide, or target peptide with a nanobody or affimer, antibody, or other amino acid-specific binder probe species set. and different probe species are labeled to allow observation of optical activity).

Extraction and/or preparation of target polymer.
In some embodiments, it is desirable to separate cells of interest from other cells that are not of interest, or to generate a library of several cells of a single type prior to nucleic acid extraction. In one such example, circulating tumor cells or fetal cells are isolated from blood (eg, by using cell surface markers for affinity capture). In some embodiments, it is desirable to separate microbial cells from human cells and the goal is to detect and analyze target nucleic acids from microbial cells. In some embodiments, opsonins are used to affinity capture a wide range of microorganisms and separate them from mammalian cells. In other embodiments, fractional lysis is performed. Mammalian cells are first lysed under relatively mild conditions. Microbial cells are typically more rigid (less lysable) than mammalian cells, so they can remain intact throughout mammalian cell lysis. Lysed mammalian cell fragments are washed away. Harsh conditions are then used to lyse the microbial cells. The target microbial polynucleotides are then selectively sequenced.

In some embodiments, target nucleic acids are extracted from cells prior to sequencing. In an alternative embodiment, sequencing (eg, sequencing of chromosomal DNA) is performed intracellularly and the chromosomal DNA follows a folding pathway during interphase. In situ stable binding of oligonucleotide probe species is described by Beliveau et al. , Nature Communications 6:7147 (2015). Such in situ binding of oligonucleotide probe species and nanometric localization of oligonucleotide probe species in three-dimensional space can allow determination of the sequence and structural arrangement of chromosomal molecules (target nucleic acids) within cells.

Target polynucleotides often exist in their native folded state. For example, genomic DNA is highly condensed in chromosomes, whereas RNA can form secondary structures. In some embodiments, long length polynucleotides are obtained during extraction from a biological sample (eg, by preserving substantially the native length of the native polynucleotide). In some embodiments, the polynucleotide is linearized such that locations along its length are traced with little or no ambiguity. Ideally, the target polynucleotide is linearized, stretched or elongated either before or after being linearized.

In some embodiments, the methods are useful for sequencing very long polymer lengths, in which the natural length or a significant proportion thereof is conserved (e.g., for entire DNA chromosomes or fragments of about 1 megabase or greater). particularly suitable. However, common molecular biology methods can result in unintended fragmentation of DNA. For example, pipetting and vortexing can cause shear forces and destroy DNA molecules. Nuclease contamination can degrade or fragment nucleic acids. In some embodiments, native-length fragments or fairly high molecular weight (HMW) fragments are stored prior to initiating fixation, extension and sequencing.

In some embodiments, polynucleotides are intentionally fragmented into relatively uniform lengths (eg, about 1 Mb in length) prior to proceeding to sequencing. In some embodiments, the polynucleotide is fragmented into relatively uniform long strands after or during fixation or extension. In some embodiments, fragmentation is accomplished enzymatically. In some embodiments, fragmentation is physically implemented. In some embodiments, physical fragmentation is accomplished via sonication. In some embodiments, physical fragmentation is accomplished via ion bombardment or radiation. In some embodiments, physical fragmentation is effected via electromagnetic radiation. In some embodiments, physical fragmentation is accomplished via UV illumination. In some embodiments, the dose of UV illumination is controlled to fragment to a given chain length. In some embodiments, physical fragmentation is achieved through a combination of UV illumination and dye staining (eg, YOYO-1). In some embodiments, the fragmentation process is stopped by physical action or addition of reagents. In some embodiments, the reagent that can affect cessation of the fragmentation process is a reducing agent such as β-mercaptoethanol (BME).

Fragmentation and Sequencing by Radiation Dose In some embodiments, if the field of view of a two-dimensional imaging device can allow a complete megabase length of DNA to be viewed in one dimension of the two-dimensional imaging device, 1 Mb of It is efficient to generate lengths of genomic DNA. In other embodiments, larger or smaller fragments can be visualized with fragments that fit within one dimension of the two-dimensional imaging device. In a further embodiment, a target nucleic acid of greater length than can be imaged as a single image by a two-dimensional imaging device is used, and images of different portions of the target nucleic acid are imaged at different times to form one image (c ) step, one or more regions of the target nucleic acid are imaged in one or more frames, or more completely before the sequencing process moves the field of view of the two-dimensional imaging device to different portions of the target nucleic acid. , which may involve utilizing the complete set of oligonucleotide probe species or any subset thereof. Also note that reducing the size of the chromosomal-length fragments may minimize strand entanglement and allow for maximum length DNA in an extended and well-segregated form.

A method for sequencing long sub-segments of chromosomes comprises the following steps:
i) staining the double-stranded DNA of the chromosome with a dye, the dye intercalating between the base pairs of the double-stranded DNA;
ii) exposing the dye-stained chromosomal DNA to a predetermined dose of electromagnetic radiation to generate sub-fragments of chromosomal DNA within a desired size range;
iii) extending and fixing the dye-stained chromosomal sub-fragment DNA to the surface;
iv) denaturing the stained chromosomal fragment to disrupt base pairs and thereby release any intercalating dye;
v) exposing the resulting destained, elongated, fixed single-stranded chromosomal fragment to one or more sets of oligonucleotide probe species of desired length and sequence;
vi) determining the location of binding of each oligonucleotide probe species of one or more sets of oligonucleotide probe species along the destained extended single-stranded chromosomal segment;
vii) compiling the binding sites of the oligonucleotide probe species of one or more sets of oligonucleotide probe species to obtain a complete sequencing of the chromosomal sub-fragments.

In some embodiments, staining may occur when the chromosome is intracellular, as described above. In some embodiments, as described above, the labeled oligonucleotide is labeled as a result of adding more intercalating dye to the stain, and then when the duplex is formed, the duplex is inserted into In some embodiments, optionally, in addition to denaturing, a dose of electromagnetic radiation capable of bleaching the stain is applied, as described above. In some embodiments of the above, the predetermined dose is achieved by manipulating the intensity and duration of exposure and cessation of fragmentation by chemical exposure, wherein the chemical exposure is a reducing agent such as β-mercaptoethanol. is an agent. In some embodiments above, the dose is defined such that the Poisson distribution produces fragments about 1 Mb long.

Methods of fixation and immobilization.
block 204; A target nucleic acid is immobilized in a double-stranded linearized extended form on a test substrate, thereby forming an immobilized extended double-stranded nucleic acid. Optionally, the molecule is immobilized on a surface or matrix. In some embodiments, fragmented or natural polymers are immobilized. In some embodiments, the immobilized double-stranded linearized nucleic acid may be linear or along a curved or tortuous path.

In some embodiments, immobilization can include applying the target nucleic acid to the test substrate by molecular combing (retracted meniscus), flow extension, nano-tethering, or electro-extension. In some embodiments, applying or immobilizing the target nucleic acid to the substrate may further comprise a UV cross-linking step, wherein the target nucleic acid is covalently bound to the substrate. In some embodiments, UV cross-linking of the target nucleic acid to the substrate may not be achieved and the target nucleic acid is bound to the substrate via other means (e.g., hydrophobic interactions, hydrogen bonding, etc.). be.

Immobilization (eg, fixation) of a target nucleic acid at only one end can allow the polynucleotide to extend and contract in a non-coordinated manner. Therefore, when any extension method is used, the rate of extension along the length of the target nucleic acid can vary for any particular position of the target nucleic acid. In some embodiments, it is necessary to fix the relative position of multiple locations along the target nucleic acid and not subject to variation. In such embodiments, the extended target nucleic acid is immobilized or anchored to the surface by multiple contact points along its length (e.g., by the molecular combing technique of Michaelet et al, Science 277:1518-1523, 1997). See also Molecular Combining of DNA that can be used for surface extension: Methods and Applications, Journal of Self-Assembly and Molecular Electronics (SAME) 1:125-148 (e.g., ACS Nano. 2015 Jan. 27;9(1):809-16), and in Bensimon et al., US6344319 and Dedecker et al., US2013/0130255).

In some embodiments, an array of target nucleic acids is immobilized on a surface, and in some embodiments, the target nucleic acids of the array are sufficiently separated to be individually resolved by diffraction-limited imaging. ing. In some embodiments, the target nucleic acids are fixed to the surface in an ordered manner so that they are maximally packed within a given surface area and that the target nucleic acids do not overlap. In some embodiments, this is achieved by creating a patterned surface (eg, an ordered arrangement of hydrophobic patches or strips in locations such that the ends of the target nucleic acid can bind). In some embodiments, the target nucleic acids of the array may not be far enough apart to be individually resolved by diffraction-limited imaging, but are individually resolved by super-resolution methods.

In some embodiments, target nucleic acids are organized using DNA curtains (Greene et al., Methods Enzymol. 472:293-315, 2010). This is particularly useful for long target nucleic acids. In such embodiments, transient binding is recorded while a DNA strand attached at one end is stretched by flow or electrophoretic forces, or after both ends of the strand are captured. In some embodiments, many copies of the same target nucleic acid sequence, which can form multiple target nucleic acids, are utilized in the DNA curtain method to assemble sequences from multiple target nucleic acids rather than from one target nucleic acid. is assembled from the binding patterns as In some embodiments, both ends of the target nucleic acid may be attached to pads (e.g., regions of the test substrate that may bind the target nucleic acid more strongly than other sections of the test substrate), each end being attached to a different pad. can be bound to In some embodiments, two pads to which a single linear target nucleic acid can bind can hold the stretched configuration of the single linear target nucleic acid in place and are evenly spaced, non-uniform. Ordered arrays of overlapping or non-interacting single linear target nucleic acids can be formed. In some embodiments, only one target nucleic acid can occupy each pad. In some embodiments, when the pads are populated using a Poisson process, some pads are free of target nucleic acids, some are free of target nucleic acids, and some are occupied by one or more free target nucleic acids. be done.

In some embodiments, target molecules that are target nucleic acids are captured on an ordered supramolecular scaffold (eg, a DNA origami structure). In some embodiments, the scaffold structure may be used initially in free solution, utilizing solution phase kinetics to capture the target molecule, which is the target nucleic acid. Once occupied, the scaffold can settle or self-assemble on the surface and bind to the surface. Ordered arrays can allow efficient sub-diffractive packing of molecules allowing for higher densities of molecules per field (dense arrays). Single-molecule localization methods can allow target molecules, which are target nucleic acids in high-density arrays, to be super-resolved (eg, point-to-point distances of 40 nm or less).

In some embodiments, hairpins are ligated to the ends of a double-stranded target nucleic acid (optionally after polishing the ends of the target nucleic acid). In some embodiments, the hairpin can contain biotin, which can immobilize the target nucleic acid on the surface. In alternative embodiments, hairpins may serve to covalently link two strands of a double-stranded target nucleic acid. In some such embodiments, the other end of the target nucleic acid is tailed for surface capture, eg, by an olio d(T) or by a specific sequence. After denaturation, both strands of the target nucleic acid are available for interaction with oligonucleotides or other probe species.

In some embodiments, ordered arrays take the form of individual scaffolds that link together to form a large DNA lattice (e.g., as described in Woo and Rothemund, Nature Communications, 5:4889). can be done. In some such embodiments, individual small scaffolds may lock onto each other through base pairing. In some embodiments, small scaffolds can be bound together, thus presenting highly ordered nanostructure arrays for the sequencing steps described herein. In some embodiments, the capture sites are arranged with a pitch of 10 nm in a regular two-dimensional lattice. Such grids can trap as many as 1 trillion molecules per square centimeter.

In some embodiments, the trapping sites within the lattice are arranged in a regular two-dimensional lattice with a pitch of 5 nm, a pitch of 10 nm, a pitch of 15 nm, a pitch of 30 nm, or a pitch of 50 nm. In some embodiments, the trapping sites within the lattice are arranged in a regular two-dimensional lattice with a pitch of 5 nm to 50 nm.

In some embodiments, ordered arrays of target nucleic acids or other target molecules are produced using nanofluidics. In one such embodiment, an array of nanotrench or nanogroove (eg, 100 nm wide and 150 nm deep) is formed on the surface and serves to order long target nucleic acids. In such embodiments, the presence of one target nucleic acid in the nanotrenches or nanogrooves can preclude entry of another target nucleic acid. In another embodiment, nanopit arrays are used, with segments of long target nucleic acids within the pits and bound within the pits, with intervening long segments of the target nucleic acid extending between the pits.

In some embodiments, high densities of target nucleic acids may still allow for super-resolution imaging and accurate sequencing. For example, in some embodiments, only a subset of target nucleic acids are of interest (eg, targeted sequencing). In such embodiments, when targeted sequencing is performed, only a subset of target nucleic acids and/or regions of target nucleic acids from a complex sample (e.g., whole genome or transcriptome, multiple genomes) need to be analyzed. Possible, the target nucleic acid is immobilized on the test substrate or matrix at a higher than normal density. In such embodiments, even if there are several polynucleotides in diffraction-limited space or SMLM resolution space, if a signal is detected, it is from only one of the target loci. It is highly probable and unlikely that this locus is within the diffraction limited distance or SMLM resolution space of another locus that simultaneously binds to the same oligonucleotide probe species. The required distance between each target nucleic acid undergoing targeted sequencing correlates with the proportion of polynucleotides targeted. For example, if less than 5% of the polynucleotides are targeted, the density of polynucleotides is 20 times greater than if all target nucleic acid sequences were desired. In some embodiments, for targeted sequencing, the imaging time is shorter than when the whole genome is analyzed (e.g., in the example above, targeted sequencing imaging is faster than whole genome sequencing). 10 times faster).

In some embodiments, the test substrate is bound with the sequence-specific oligonucleotide probe species prior to the immobilizing step, wherein the immobilizing step uses the sequence-specific oligonucleotide probe species bound to the test substrate to Capturing or immobilizing the target nucleic acid on a substrate may be included. In some embodiments, the target nucleic acid is fixed or bound at the 5' end. In some embodiments, the target nucleic acid is fixed or bound at the 3' end. In another embodiment, when there are two separate probes on the test substrate, one probe may be anchored or attached to the first end of the target nucleic acid and the second probe may be attached to the second end of the target nucleic acid. can be fixed or attached to the end of the When using two probes, it may also be desirable to have prior information about the length of the target nucleic acid. In some embodiments, the target nucleic acid is cleaved with a defined endonuclease prior to being immobilized or bound to the test substrate. In additional embodiments, the target nucleic acid is initially fixed or bound at one or both ends and then fixed or bound at additional points along the length of the target nucleic acid.

In various embodiments, the target nucleic acid is extracted or embedded in a gel or matrix prior to fixation (described, for example, in Shag et al., Nature Protocols 7:467-478, 2012). . In one such non-limiting example, target nucleic acids are deposited in a flow channel containing a medium that undergoes a liquid-to-gel transition. The target nucleic acid is first elongated and distributed in a liquid phase, and then assisted by changing the phase to a solid/gel phase (e.g., by heating, which can cause or accelerate cross-linking, or in the case of polyacrylamide). fixed by adding factors or over time). In some embodiments, the target nucleic acid is elongated in solid/gel phase.

In some alternative embodiments, one or more oligonucleotide probe species are immobilized on or in a test substrate or matrix. In such embodiments, one or more target nucleic acids may be suspended in solution and transiently bound to one or more immobilized oligonucleotide probe species. In some embodiments, a spatially addressable array of one or more oligonucleotide probe species is used to capture target nucleic acids. In some embodiments, short target nucleic acids (e.g., less than 300 nucleotides) such as cell-free DNA or microRNAs, or relatively short target nucleic acids such as mRNAs (e.g., less than 10,000 nucleotides) are combined with one or more Random immobilization to a surface by capturing the modified or unmodified ends of the target nucleic acid using a suitable capture molecule which may contain an oligonucleotide probe species or may contain other binding mechanisms such as biotinavidin be done. In some embodiments, short or relatively short target nucleic acids have multiple interactions with a test substrate and sequencing is performed in an orientation parallel to the test substrate. Thus, systematic or structural DNA modifications of splicing isoforms are resolved. For example, in some isoforms, the location of repeated or shuffled exons can be delineated or determined, or marked structural rearrangements can occur in cancerous cells, such structural rearrangements and genetic Alternatively, the relationship to non-coding regions of interest is delineated or determined.

In some embodiments, the immobilized probes can contain common sequences that can anneal to the target nucleic acid. Such embodiments are particularly useful when the target nucleic acids have consensus sequences that can occur at one or both termini. In some embodiments, the target nucleic acids are single stranded and have a common sequence such as a poly A tail. In one such example, a native mRNA with a polyadenylated tail is attached to a test substrate or other Captured on an array or lawn of oligonucleotide poly d(T) probes on a surface or matrix. In some embodiments, particularly when short DNA is analyzed, e.g., by ligating specific short oligos or capturing molecules (specific complementary oligonucleotides on a test substrate or other surface or matrix). The ends of the target nucleic acid are adapted by binding biotin for interaction with the probe species.

In some embodiments, the target nucleic acid may comprise double-stranded DNA with sticky ends generated by restriction enzymes. In some non-limiting examples, rare site (e.g., Pmmel or NOTl) restriction enzymes are used to generate long fragments of the target nucleic acid, each fragment having a common terminal sequence with sticky ends. including. In some embodiments, the adaptation is performed using terminal transferase. In other embodiments, ligation or tagging is used to introduce adapters in a manner similar to that utilized by Illumina sequencing users. This allows users to prepare samples using well-established Illumina protocols, then capture and sequence by the methods described herein. In such embodiments, the target nucleic acid is captured or captured for sequencing prior to any amplification (which introduces errors and biases and removes any epigenetic information that may be part of the native target nucleic acid). Fixed.

Extension Methods In most embodiments, polynucleotides or other target molecules (eg, target nucleic acids, target proteins, target polypeptides, or target peptides) are attached to a test substrate, surface, or matrix such that extension occurs. , bound or fixed. In some embodiments, the stretch of the target nucleic acid is equal to and longer than its crystallographic distance (e.g., for dsDNA, the in situ separation from one base to the next is 0.34 nm). , or shorter. In some embodiments, the target nucleic acid is stretched beyond the in situ crystallographic distance.

In some embodiments, the target nucleic acid is extended via molecular combing (eg, Michaelet et al., Science 277:1518-1523, 1997 and Deen et al., ACS Nano 9:809-816, 2015 It is described in). This can allow millions to billions of target nucleic acids to be extended and unidirectionally aligned in parallel. In some embodiments, molecular combing is performed by washing a solution containing the desired target nucleic acid onto the test substrate and then retracting the meniscus of the solution. Prior to retracting the meniscus, the target nucleic acid may form covalent bonds or other interactions with the test substrate. As the solution recedes, the target nucleic acid is pulled in the same direction as the meniscus (eg, via surface retention). However, if the strength of the binding or anchoring interaction between the target nucleic acid and the test substrate is sufficient to overcome the surface retention forces, the target nucleic acid will extend in a uniform fashion towards the degenerating meniscus. In some embodiments, molecular combing is as described in Kaykov et al. , Sci Reports. 6:19636 (2016), which is incorporated herein by reference in its entirety. In other embodiments, molecular combing is performed as described in Petit et al. Nano Letters 3:1141-1146 (2003), or modifications thereof, in channels (eg, in microfluidic devices).

The shape of the air-liquid interface can determine the orientation of extended target nucleic acids that are extended by molecular combing. In some embodiments, the target nucleic acid is elongated perpendicular to the air-liquid interface. In some embodiments, the target nucleic acid is attached, bound, or immobilized to a test substrate or other surface without modification of one end thereof, or bound without modification to either end thereof. or fixed. In some embodiments, when the ends of a double-stranded target nucleic acid are captured by hydrophobic interactions, when extended by a receding meniscus, portions of the double-stranded target nucleic acid denature and interact with the test substrate or surface. of additional hydrophobic interactions can be formed.

In some embodiments, the target nucleic acid is extended via molecular threading (eg, described in Payne et al., PLoS ONE 8(7):e69058, 2013). In some embodiments, molecular threading is performed after the target nucleic acid is denatured (eg, by chemical denaturants, temperature or enzymes, salt concentration or pH) into single strands. In some embodiments, the target nucleic acid is tethered at one end and then extended using fluid flow (see, for example, Greene et al., Methods in Enzymology, 327:293-315 ).

In various embodiments, the target nucleic acid is present within a microfluidic channel. In some embodiments, target nucleic acids are flowed into microfluidic channels or extracted from one or more chromosomes, exosomes, nuclei, or cells into flow channels. In some embodiments, rather than inserting a target nucleic acid into a nanochannel through a microfluidic or nanofluidic flow cell, one or more channels that are nanochannels or microchannels are formed with walls and/or bottoms of the channels. The target nucleic acid is inserted into the open-top channel by constructing it in such a way that the surface on which the can be formed is electrically biased (see, e.g., Asanov et al., Anal Chem. 1998 Mar. 15; 70 (6 ): 1156-6). In some embodiments, a positive bias is applied to the surface on which the walls and/or bottom of the channel can be formed, attracting negatively charged target nucleic acids to the nanochannel. At the same time, the regions between the channels may be electrically unbiased, thus making it less likely that the target nucleic acid will deposit in the regions between the channels.

In some embodiments, elongation is achieved by hydrodynamic drag. In some embodiments, the target nucleic acid is extended through crossflow within a nanoslit (Marie et al., Proc Natl Acad Sci USA 110:4893-8, 2013). In some embodiments, elongation of the target nucleic acid is achieved by nano-tethering in the flow channel. Flow unfolding and nanoconstraint generally can involve unfolding a target nucleic acid into a linear conformation via a flow gradient performed within a microfluidic or nanofluidic device. A nano-constrained portion of a microfluidic or nanofluidic device that can utilize this method of extension can refer to a narrow region of a microfluidic or nanofluidic device. The use of narrow regions or channels can help overcome problems of molecular individualism, such as the tendency of individual nucleic acids or other polymers to adopt multiple conformations during extension. One problem with the flow extension method is that the flow is not always applied equally along the target nucleic acid. This results in target nucleic acids exhibiting a range of extension lengths. In some embodiments, flow extension may involve elongational flow and/or hydrodynamic drag. In some embodiments, one or more target nucleic acids are nanobound and thereby elongated within the microchannel or nanochannel when the target nucleic acids are drawn into the microchannel or nanochannel. In some embodiments, after nanobinding, the target nucleic acid is deposited, bound, or immobilized on the bias surface or in a coating or matrix on top of the test substrate or other surface.

In some embodiments, any of several methods of applying a positive or negative bias to the surface are utilized. In some embodiments, the test substrate or other surface is made of or coated with a material that has non-fouling characteristics, and the test substrate or other surface is coated with a lipid (e.g., lipid bilayer), bovine serum albumin (BSA), casein, various PEG derivatives, etc. Passivation may serve to prevent accumulation, binding, or immobilization of polynucleotides in any one portion of the channel, thus allowing elongation and/or more uniform elongation. In some embodiments, the test substrate or other surface is also indium tin oxide (ITO) or other transparent conductive surfaces such as broad spectrum transparent conductive oxides, conductive polymers, graphene, very thin metal films. may include

In some embodiments, when creating lipid bilayers (LBLs) on test substrates or other surfaces containing microfluidic or nanofluidic channels, 1% Lissamine™ Rhodamine B 1,2-dihexadecadeca A zwitterionic POPC (1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine) lipid containing noyl-sn-glycero-3-phosphoethanolamine is coated on the surface. Addition of triethylammonium salt (rhodamine-DHPE) lipids can allow observation of LBL formation under a fluorescence microscope. Methods of lipid bilayer passivation used in some embodiments of the present disclosure are described in Persson et al. , Nano Lett. 12:2260-2265, 2012.

In some embodiments, extension of one or more target nucleic acids is via electrophoresis or dielectrophoresis. In some embodiments, the target nucleic acid is tethered at one end and then stretched by an electric field (eg, as described in Giese et al., Nature Biotechnology 26:317-325, 2008). Electrostretching of nucleic acids is based on the fact that nucleic acids are highly negatively charged molecules. For example, Randall et al. 2006, Lab Chip. 6, 516-522, involves drawing nucleic acids through microchannels or nanochannels (to induce orientation of target nucleic acid molecules) by an electric field. In some embodiments, electrostretching is performed within or without a gel or entangled polymer. One advantage of using gels or entangled polymers is that they limit the three-dimensional space available to target nucleic acids, thereby helping to overcome molecular individualism. A general advantage of electrostretching over pressure-driven stretching methods such as nanotethering is the lack of shear forces sufficient to disrupt nucleic acid molecules.

In some embodiments, when multiple polynucleotides are present on a test substrate or other surface, the target nucleic acids may not be aligned in the same orientation or straight (e.g., target nucleic acids may be attached, bound, or fixed to a test substrate or other surface, or may pass through a gel or entangled polymer in a curvilinear path). In such embodiments, it becomes more likely that two or more of the multiple target nucleic acids will overlap, leading to potential confusion regarding the localization of the probes along the length of each target nucleic acid. In some embodiments, the same sequencing information is obtained from a curved target nucleic acid as is obtained from a linear, well-aligned target nucleic acid, but the sequencing information from a curved target nucleic acid is Processing image processing tasks can require more computational power or time than can be obtained from a linear, well-ordered target nucleic acid.

In an embodiment, one or more target nucleic acids are elongated in a direction parallel to the plane that is the surface of the test substrate, and a length of target nucleic acid is an array detector, such as a CMOS or CCD camera, a two-dimensional imaging device. is imaged over a series of adjacent pixels in . In some embodiments, one or more target nucleic acids are elongated in a direction perpendicular to the test substrate or other surface. In some embodiments, the target nucleic acid is detected via light sheet microscopy, spinning disk confocal microscopy, three-dimensional super-resolution microscopy, three-dimensional single molecule localization, or laser scanning disk confocal microscopy or variants thereof. imaged. In some embodiments, the target nucleic acid is elongated at an oblique angle to the test substrate or other surface. In some embodiments, the target nucleic acid is imaged via a two-dimensional imaging device or detector and the resulting images or frames are processed via single molecule localization algorithm software (e.g., Fiji / ImageJ plug-in ThunderSTORM, Ovesny et al., BioInform.30:2389-2390, 2014).

Extraction and isolation of DNA from single cells prior to fixation and extension.
In some embodiments, single-cell traps are designed within the microfluidic structure to hold individual cells in place while their target nucleic acids are released (e.g., using the device designs of WO2012/056192 or WO2012/055415). In some embodiments, instead of extracting and spreading the target nucleic acid in the nanochannel, a coverslip or foil is used to seal the micro/nanofluidic structure, which is further coated with polyvinylsilane to Enables molecular combing (eg, by fluid motion as described in Petit et al., Nano Letters 3:1141-1146.2003). Mild conditions within the fluidic chip can preserve the extracted target nucleic acids to have long chain lengths.

Several different approaches are available for extracting biopolymers from single cells or nuclei (for example, some suitable methods are described in Kim et al., Integr Biol 1(10), 574-86 , 2009). In some non-limiting examples, cells are treated with high concentrations of KCL to rupture or remove cell membranes. Cells are lysed by adding hypotonic solution. In some embodiments, each cell is individually isolated, each cell's DNA is individually extracted, and then each set of target nucleic acids associated with a single cell is placed in a microfluidic container or device. Individually sequenced. In some embodiments, target nucleic acid extraction may be performed by treating one or more cells with detergents and/or proteases. In some embodiments, a chelating agent (eg, EDTA or EDDS) is provided in the lysate to trap divalent cations required by nucleases (thus reducing nuclease activity).

In some embodiments, single cell nuclei and extra nuclear components are separately extracted by the following method. One or more cells are provided to the feed channel of the microfluidic device. One or more cells can then be trapped, each cell being trapped by one trapping structure. A first lysis buffer is flowed into the capture structures of a microfluidic device having one or more captured cells, the first lysis buffer can lyse cell membranes but maintain the integrity of cell nuclei. . Upon flow of the first lysis buffer, one or more extranuclear components of the cells captured within the capture structures of the microfluidic device are liberated within the flow cell within the microfluidic device, where the released RNA and cytoplasm are immobilized. One or more nuclei may then be further lysed by providing a second lysis buffer to the capture structures of the microfluidic device having the one or more captured cells or remnants thereof. Addition of the second lysis buffer causes the release of one or more nuclear and/or mitochondrial components (e.g., genomic DNA or mitochondrial DNA) to the flow cell in the microfluidic device where the DNA is subsequently immobilized. can cause. One or more extranuclear and intracellular components of a cell are immobilized at different locations of the same flow cell, or within different flow cells within the same microfluidic device, or within different microfluidic devices.

The schematic diagrams of Figures 16A and 16B show a microfluidic architecture that can capture and isolate multiple single cells. Cell 1602 is captured by cell trap 1606 within flow cell 2004 . In some embodiments, after cells are trapped, the lysis reagent flows into and through the illustrated cell trap 1606 . After lysis, nucleic acids 1608 may then be distributed in close proximity to capture traps 1606 while remaining segregated from nucleic acids 1608 extracted from other cells 1602 . In some embodiments, electrophoretic induction is performed to manipulate nucleic acids (eg, by using charge 1610), as illustrated in FIG. 16B. Lysis can release nucleic acids 1608 from cells 1602 and nuclei 1604 . Nucleic acid 1608 may remain where it was (eg, relative to cell trap 1606) when cell 1602 was trapped. Traps are of single cell size (eg, 2-10 μm). In some embodiments, the channel that provides the sample containing microdroplets and the flow cell of the microfluidic device are both wider and taller than 2 μm, 10 μm, or greater than 10 μm. In some embodiments, the distance between the branch channel and the trap is 1-1000 microns.

Extraction and extension of high molecular weight DNA on surfaces.
In various embodiments, various methods for extending HMW polynucleotides are used (eg, ACS Nano. 9(1):809-16, 2015). In one such example, surface extension is performed in a flow cell (eg, by using the approach described in Petit and Carbeck in Nano. Lett. 3:1141-1146, 2003). In addition to fluidic or microfluidic approaches, in some embodiments, polynucleotides are prepared according to Giess et al. , Nature Biotechnology 26, 317-325 (2008). Several approaches are available for extending polynucleotides when they are not attached to a surface (e.g., Frietag et al., Biomicrofluidics, 9(4):044114 (2015), Marie et al. ., Proc Natl Acad Sci USA 110:4893-8, 2013).

In some embodiments, as an alternative to using DNA in gel plugs, chromosomes suitable for loading into microfluidic devices that may contain test substrates are described in Cram et al. , Methods Cell Sci. , 2002, 24, 27-35 and pipetted directly into a microfluidic device that may contain a test substrate. In some such embodiments, proteins bound to DNA in chromosomes are digested using a protease to release substantially naked DNA, which is then fixed and elongated as described above. obtain.

Sample processing for lead location preservation.
In embodiments in which very long regions or polymers are sequenced, any degradation of the target nucleic acid has the potential to significantly reduce overall sequencing accuracy. A method for promoting preservation of the entire extended polymer is presented below.

Target nucleic acids have the potential to be damaged during extraction, storage, or preparation. Nicks, gaps, oxidation of bases, delamination of cytosines, and adducts can form within naturally occurring double-stranded genomic DNA molecules. This is especially true when the sample polynucleotides are derived from FFPE material. Therefore, in some embodiments, a DNA repair solution is introduced before or after the DNA is immobilized. In some embodiments, DNA repair is performed after DNA extraction into gel plugs. In some embodiments, repair solutions may include DNA endonucleases, kinases, and other DNA modifying enzymes. In some embodiments, a repair solution may include a polymerase and a ligase. In some embodiments, the repair solution is New England Biolabs' pre-PCR kit. In some embodiments, such methods are based primarily on Karimi-Busheri et al. , Nucleic Acids Res. Oct 1;26(19):4395-400, 1998, and Kunkel et al. , Proc. Natl Acad Sci. USA, 78, 6734-6738, 1981. In other embodiments, it is desirable to detect target nucleic acid damage. For example, it may be desirable to determine the number and location of one or more DNA adducts. In such embodiments, additional labeled adduct-specific binding moieties are utilized as part of the sequencing method.

In some embodiments, gel overlay is applied after the target nucleic acid is elongated. In some such embodiments, after extension and denaturation on a test substrate or other surface, the double-stranded or denatured target nucleic acid is covered with a gel layer. Alternatively, the target nucleic acid is elongated (eg, as described above) while already in the gel environment. In some embodiments, the target nucleic acid is put into a gel after elongation. For example, in some embodiments, the target nucleic acid is attached at one end to a surface and the media of the surrounding area is cast into the gel as it is stretched by a flow of reagents or an electrophoresis field. In some embodiments, loading into the gel can occur by including acrylamide, ammonium persulfate, and TEMED in the reagent stream. Such compounds polymerize to polyacrylamides. In an alternative embodiment, a thermally responsive gel is applied. In some embodiments, the ends of the target nucleic acid are modified with an acrylidite that can polymerize with acrylamide. In some such embodiments, application of an electric field causes the polynucleotide to elongate toward the positive electrode, given the negative charge of the backbone of naturally occurring polynucleotides.

In some embodiments, the target nucleic acid is extracted from cells in a gel plug or gel layer to maintain the integrity of the target nucleic acid and then an AC electric field is applied to dielectrophoretically dielectrophoretically target the nucleic acid within the gel. stretched or elongated. Dielectrophoretic spreading is performed in a gel layer on top of a coverslip, or gel associated with a test substrate or other surface, and then spread using any of the methods described herein. can be applied to different target nucleic acids to detect transient binding of the oligonucleotide probe species.

In some embodiments, the sample or target nucleic acid is crosslinked to the matrix of its environment. In one example, this is the cellular environment. For example, when the nucleic acid sequencing methods described herein are performed in situ in a cell, the target nucleic acid is crosslinked to the cell matrix using a heterobifunctional crosslinker. This is done as part of a method of direct in-cell sequencing using techniques such as FISSEQ (Lee et al., Science 343:1360-1363, 2014).

Much of the damage to target biomolecules occurs in the process of extracting the target biomolecules from cells and tissues and in their subsequent handling (before the target biomolecules are analyzed). In the case of target nucleic acids, aspects of their handling that result in loss of their integrity can include pipetting, vortexing, freeze-thawing, and excessive heating. In some embodiments, mechanical stress is minimized, for example, by methods disclosed in ChemBioChem, 11:340-343 (2010). In addition, high concentrations of noncatalytic divalent cations such as calcium or zinc, EDTA, EGTA, or gallic acid (and analogues and derivatives thereof) can inhibit degradation by nucleases. In some embodiments, a 2:1 mass ratio of sample to non-catalytic divalent cations is sufficient to inhibit nucleases, even in samples such as stool where extreme levels of nucleases are present.

To maintain the integrity of the target nucleic acid (e.g., so as not to induce DNA damage or breakage into smaller fragments), in some embodiments, biopolymers such as DNA or RNA are added to chromosomes, mitochondria, It is desirable to keep it in its natural protected environment, such as cells, nuclei, exosomes. In some embodiments where the target nucleic acid is already outside its protected environment, it is desirable to encase it in a protected environment such as a gel or microdroplet. In some embodiments, the target nucleic acid is released from its protective environment in physical proximity to where it is to be sequenced (e.g., part of a fluidic system or flow cell from which sequencing data can be obtained). . Thus, in some embodiments, a biopolymer (e.g., nucleic acid, protein) is provided with a protected entity that approximates its native state (e.g., native length). and bring the protected entity containing the biopolymer into close proximity to the location where the biopolymer may be sequenced, and then place the biopolymer into the region to be sequenced or to the region to be sequenced. emits to a region close to In some embodiments, the flow cell may comprise an agarose gel capable of effectively encapsulating target genomic DNA of a sample, the agarose gel retaining a substantial portion of genomic DNA greater than 200 Kb in length, An agarose gel containing target genomic DNA is placed near the environment in which the target genomic DNA is to be sequenced (e.g., test substrate, surface, gel, matrix), and the target genomic DNA is transferred from the agarose gel to the sequencing environment (or Close to the sequencing environment) and one or more sequencing methods are performed, such that further transport and handling of the target genomic DNA is minimized. Release to the sequencing environment is by application of an electric field or digestion of the agarose gel by agarase.

Polymer denaturation.
block 206; In some embodiments, the fixed, extended double-stranded target nucleic acid is then denatured to a single-stranded form on a test substrate, thereby separating the fixed first strand and the fixed second strand of the target nucleic acid. You get 2 strands. Each base of the immobilized second strand may be adjacent to the corresponding complementary base of the immobilized first strand. In some embodiments, denaturation is performed by first elongating or stretching a double-stranded target nucleic acid and then adding a denaturing solution to separate the duplexes.

In some embodiments, denaturation is chemical denaturation involving one or more reagents (eg, 0.5 M NaOH, DMSO, formamide, urea, etc.). In some embodiments, denaturation is thermal denaturation (eg, by heating the sample to 85° C. or higher). In some embodiments, denaturation is through enzymatic denaturation, such as through the use of helicase, or other enzymes with helicase activity. In some embodiments, the target nucleic acid is denatured through interaction with a surface or by physical processes such as stretching beyond a critical length. In some embodiments, denaturation is complete or partial.

In some embodiments, binding of the oligonucleotide probe species to modifications on repeat units of a target nucleic acid (e.g., epigenetically modified nucleotides of polynucleotides, or phosphorylation of polypeptides) is followed by an optional denaturation step. before or after

In some embodiments, optional denaturation of double-stranded target nucleic acids may not occur at all. In some such embodiments, oligonucleotide probe species are utilized for binding or annealing to duplex structures of target nucleic acids. For example, in some embodiments, an oligonucleotide probe species is used to detect the sequence of a double-stranded form of the target nucleic acid through the use of modified zinc finger proteins by inducing excessive breathing of the double-stranded form of the target nucleic acid. individual strands of a double-stranded form of a target nucleic acid (e.g., It may bind via strand invasion (using a PNA probe). In some embodiments, the guide RNA may comprise an interrogation probe sequence and a label, thus functioning as an oligonucleotide probe species described herein, and one or more of the oligonucleotide probe species A gRNA comprising each sequence of the set of is provided.

In some embodiments, a double-stranded target nucleic acid may include nicks (eg, natural nicks or those generated by DNase 1 treatment). In such embodiments, under the conditions of the reaction, one strand will transiently unravel or detach from the other strand of the duplex (e.g., transiently denature) or will undergo natural base pairing. Fluctuation occurs. This may allow the oligonucleotide probe species to transiently bind before being displaced by rehybridization of the native strand.

In some embodiments, a single double-stranded target nucleic acid is denatured so that each strand of the duplex is available for binding of an oligonucleotide probe species. In some embodiments, a single target nucleic acid is damaged and repaired (eg, by addition of a suitable DNA polymerase and/or ligase) by a denaturation process or by another step of the sequencing method.

In some embodiments, immobilization and linearization of double-stranded target genomic DNA (in preparation for immobilization or binding to a test substrate or other surface) involves molecular combing, double-stranded target genomic DNA to a surface. UV cross-linking, optional wetting, denaturation of double-stranded target genomic DNA by exposure to chemical denaturants (e.g., alkaline solutions, DMSO, etc.), optional exposure to acidic solutions after washing, and prior Optional exposure to conditioning buffer may be included.

Annealing the probe.
block 208; After an optional denaturation step, the method exposes the immobilized first strand and the immobilized second strand to respective pools of oligonucleotide probe species for each of the set of oligonucleotide probe species. Each oligonucleotide probe species of the set of oligonucleotide probe species is of a given sequence and length. The exposure is such that the individual oligonucleotide probes of each pool of each oligonucleotide probe species are complementary to their respective oligonucleotide probe species, each portion of the immobilized first strand or immobilized second strand. and under conditions that allow them to form their respective duplexes, thereby giving rise to their respective instances of optical activity.

5A, 5B and 5C show examples of transient binding of different probe species to one polymer 502. FIG. Each probe (eg, 504, 506, and 508) can include a specific interrogation sequence (eg, oligonucleotide or peptide sequence). After applying the probe species 504 to the polymer 502, the probe species 504 are washed from the polymer 502 by one or more washing steps. Similar washing steps are then used to remove probe species 506 and 508 .

Probe design and targeting.
In some embodiments, a solution comprising one or more pools of oligonucleotide probe species is provided to target nucleic acids in solution. When a pool containing oligonucleotide probe species contacts target nucleic acids on a test substrate, other surface, or matrix, the oligonucleotide probes can contact the target nucleic acids by diffusion and molecular collisions. In some embodiments, a solution containing one or more pools of oligonucleotide probe species is agitated so as to contact the oligonucleotide probes with one or more target nucleic acids. In some embodiments, the oligonucleotide probe species containing solution is exchanged to provide fresh oligonucleotide probes to one or more target nucleotides on a test substrate, other surface, or matrix. In some embodiments, an electric field can be used to attract oligonucleotide probes to a test substrate, or other surface, such as a positively energized surface or an AC electric field.

In some embodiments, the target nucleic acid can comprise a specific polynucleotide sequence, wherein the specific binding portion of the oligonucleotide probe species is, for example, 3, 4, 5, or 6 bases long. an oligonucleotide interrogation portion, optionally one or more degenerate or universal positions, and optionally a nucleotide spacer (e.g., one or more T nucleotides) or abasic portion or contain non-nucleotide moieties. As shown in FIGS. 6A and 6B, similar binding occurs along target nucleic acid 602 regardless of the length of the oligonucleotide probe species (eg, 604 and 610) used. The main difference inherent in different k base length oligonucleotides is that the k base length sets the length of the binding site bound by the respective oligonucleotide probe species (e.g., 3 base length probe 604 binds predominantly and more stably to 3-nucleotide-long sites such as 606, and 5-base-long probes 610 bind predominantly and more stably to 5-nucleotide-long sites such as 610).

In FIG. 6A, the 3-base long oligonucleotide probe species exemplified is unusually short for use as an oligonucleotide probe. Usually such short sequences are not used as oligonucleotide probes because they cannot bind stably unless very low temperatures and long incubation times are used. However, such short oligonucleotide probe species do not form transient binding to target nucleic acids as required for the detection methods described herein. Furthermore, the shorter the sequences of the oligonucleotide probe species, the fewer oligonucleotide probe species present in the set of oligonucleotide probe species. For example, a complete set of 3 base long oligonucleotide probe species requires only 64 oligonucleotide sequences, while a complete set of 4 base long oligonucleotide probe species requires 256 oligos. A nucleotide sequence is required. Furthermore, to increase the melting temperature, in some embodiments the pool of very short oligonucleotide probe species is modified, in some embodiments degenerate nucleotides (e.g., N ) or universal nucleotides. For example, 4 N nucleotides will increase the stability of a 3 base long oligonucleotide, relative to the stability of a 7 base long oligonucleotide.

In the schematic diagram of FIG. 6B, binding of a 5-base long oligonucleotide probe to its perfect match position (612-3), 1-base mismatch position (612-2), and 2-base mismatch position (612-1) is It is shown.

Binding of any one oligonucleotide probe may not be sufficient to allow sequencing of the target nucleic acid. In some embodiments, a complete set of oligonucleotide probes is required to reconstruct the sequence of the target nucleic acid. location of binding sites for oligonucleotide probe species, temporally separated binding of oligonucleotide probe species to overlapping binding sites, mismatched partial binding between oligonucleotide probe species and target nucleic acid, frequency of binding, and Any information regarding the duration of binding can contribute to the inference of the sequence or target nucleic acid. In the case of elongated or stretched target nucleic acids, the location of binding of the oligonucleotide probe species along the length of the target nucleic acid can contribute to the construction of sequences with high confidence. In the case of a double-stranded target nucleic acid, a higher confidence sequence can emerge from simultaneously sequencing both (eg, both complementary strands) of the double-stranded form of the target nucleic acid.

In some embodiments, a common reference oligonucleotide probe species is added with each of one or more pools of oligonucleotide probe species in one or more sets of oligonucleotide probe species. For example, in Figures 7A, 7B, and 7C, the common reference oligonucleotide probe species 704 is independent of any additional probes included in the set of oligonucleotide probe species (eg, 706, 712, and 716) , bind to the same binding site 708 on the target nucleic acid 702 . The presence of a common reference oligonucleotide probe species 704 inhibits binding of other oligonucleotide probe species 706, 712, and 716 to their respective binding sites (e.g., 710, 714, 718, 720, and 722). do not interfere.

As shown in FIG. 7C, binding sites 718, 720, and 722 are where the individual oligonucleotide probes (716-1, 716-2, and 716-3) overlap. show how it binds to all possible sites. In Figures 7A, 7B, and 7C, the probe sequences are shown to be 3 bases long. However, similar methods work equally well with probes that are 4 bases, 5 bases, 6 bases, etc. in length.

In some embodiments, one or more sets of oligonucleotide probe species may include all oligos of a given length. For example, a complete set of 1024 individual 5 bases long is encoded and included in one or more sets of oligonucleotide probe species according to one embodiment of the present disclosure. In some embodiments, one or more sets of oligonucleotide probe species may include all oligonucleotide probe species of multiple lengths. In some embodiments, the set of oligonucleotide probes is a tiling of a series of oligonucleotide probe species. In some embodiments, the set of oligonucleotide probe species is a panel of oligonucleotide probe species. For certain applications in synthetic biology, such as DNA data storage, sequencing may involve finding the order of specific blocks of sequences, where the blocks are designed to encode desired data. .

As shown in FIGS. 8A, 8B, and 8C, in some embodiments, multiple sets of oligonucleotide probe species (eg, 804, 806, and 808) are applied to any target nucleic acid 802. . Each oligonucleotide probe species preferentially binds to its complementary binding site. In some embodiments, washing with buffer between each exposure (c) helps remove the previous set of oligonucleotide probe species.

In some embodiments, the nucleic acid sequencing probe is an oligonucleotide and the epimodification probe is a modified binding protein or peptide (e.g., a methyl binding protein such as MBD1) or an anti-modified antibody (e.g., anti-methyl C antibody). In some embodiments, the oligonucleotide probe species can target specific sites within the genome (eg, sites with known mutations). As shown in FIGS. 9A, 9B, and 9C, in some embodiments both oligonucleotides (eg, 804, 806, and 808) and surrogate probes (eg, 902) are attached to target nucleic acid 802. applied simultaneously (and through multiple exposure steps). Methods for determining target sites of interest are described by Liu et al. , BMC Genomics 9:509 (2008), incorporated herein by reference.

In some embodiments, an oligonucleotide probe species of one or more sets of probes, an oligonucleotide probe species or a subset of one or more sets of probe species, one or more sets of oligonucleotide probe species , each of the probe species is applied in turn (e.g., first binding of one probe species, which is an oligonucleotide probe species or a subset or one or more sets of oligonucleotide probe species, is detected, then , removed before the next oligonucleotide probe species is added, detected, removed, then the next... etc.). In some embodiments, all or a subset of the probes of one or more sets of probes are added simultaneously to a single pool, and each bound probe is fully or partially Linked to an encoding label, the code of each bound probe is decoded by the process of detection and analysis.

As illustrated by FIGS. 11A and 11B, in some embodiments, a tiling series or set of probes may be used to obtain information about the binding sites of multiple probes. In FIG. 11A, a first tiling set 1104 is applied to target nucleic acid 1102 . Each tiling probe of the subset of tiling probes in first tiling set 1104 includes one common base 1108, thereby providing five times the coverage of that one common base 1108 of target nucleic acid 1102. Bring depth. The depth of coverage is proportional to the k-base length of the tiling series of probes (eg, a set of 3-base long oligos provides about 3-fold coverage of all bases in the target nucleic acid).

In some embodiments, when a set of oligonucleotide probe species tiles along a target base, problems can arise if there are discontinuities in the tiling pathway. For example, in a set of oligonucleotide probe species that are 5 bases long, none of the oligonucleotide probe species can bind to one or more sequences of the target molecule greater than 5 bases. In this case, in some embodiments, one or more approaches are utilized. First, if the target nucleic acid comprises a double-stranded nucleic acid, the assignment of one or more bases may be left to or dependent on the sequence obtained from the complementary strand of the duplex. Second, if multiple copies of the target nucleic acid are available, the assignment of one or more bases may depend on other copies of the same sequence on other copies of the target nucleic acid. Third, in some embodiments, when a reference sequence is available, the assignment of one or more bases may be left to or dependent on the reference sequence, and one or more Bases are annotated to indicate that they have been artificially grafted from the reference sequence.

In some embodiments, a particular oligonucleotide probe species is omitted from one or more sets of oligonucleotide probe species for various reasons. For example, some oligonucleotide probe sequences exhibit problematic interactions with themselves, such as self-complementarity or palindrome sequences, with other probes of the complete set of oligonucleotide probe species, or with target nucleic acids. (eg known probabilistic promiscuous combination). In some embodiments, the minimum number of beneficial oligonucleotide probe species is determined for each type of target nucleic acid. Within a complete set of k base long oligonucleotide probe species, one half of the oligonucleotide is perfectly complementary to the other half of the oligonucleotide. In some embodiments, these complementary pairs (and other pairs with problems due to substantial complementarity) may not be added to the polynucleotide at the same time, but rather different subsets or pools of oligonucleotide probe species. may certainly be assigned to . In some embodiments, both sense and antisense single-stranded DNA (from a single double-stranded target nucleic acid) are present and sequencing is performed with only one member of each complementary oligonucleotide probe species pair. done. The sequencing information obtained from both the sense and antisense strands are combined to generate the overall sequence.

In some embodiments, oligonucleotide probe species can include libraries created using custom microarray synthesis. In some embodiments, a microarray library can contain oligonucleotides that systematically bind to specific target portions of the genome. In some embodiments, a microarray library may contain oligonucleotide probe species that are systematically bound at spaced apart locations across a target genome. For example, a library containing one million oligonucleotide probe species can contain oligonucleotide probe species designed to bind approximately every 3000 bases. Similarly, a library containing 10 million oligonucleotide probe species can be designed to bind approximately every 300 bases, and a library containing 30 million oligonucleotide probe species can be designed to bind approximately every 100 bases. can be designed to In some embodiments, the sequences of the oligonucleotide probe species are computationally designed based on a reference genome sequence.

In some embodiments, the region of the genome targeted is a specific locus. In other embodiments, the region of the genome targeted is a panel of loci (e.g., cancer-associated genes or other highly conserved regions), or genome-wide association studies. ) are genes or other highly conserved regions within the chromosomal interval identified by In some embodiments, the target loci may also include the dark matter of the genome, the chromatin regions of the genome that are typically repetitive, and complex loci flanking the repetitive regions. Such regions include telomeres, centromeres, short arms of acrocentric chromosomes, as well as other low-complexity regions of the genome. Conventional sequencing methods cannot address repetitive parts of the genome (there is still no complete human genome as of 2019), but with high nanometric accuracy, the methods described herein can Address the area exhaustively.

In some embodiments, each respective oligonucleotide probe species of the plurality of oligonucleotide probe species comprises a unique N base long sequence, where N is the set {1, 2, 3, 4, 5, 6, 7, 8, and 9}, and all unique N-base long sequences of length N are represented by multiple oligonucleotide probe species.

The longer the oligo length used to make the oligonucleotide probe species, the more likely it is to function as an efficient probe for palindromic or folded sequences affecting the oligonucleotide probe species. In some embodiments, coupling efficiency is substantially improved by shortening the length of such oligos by removing one or more degenerate or universal bases. For this reason, it is advantageous to use shorter reference sequences (eg, 4 bases long) for oligonucleotide probe species. However, shorter oligonucleotide probe sequences exhibit more labile binding (eg, lower binding temperatures). In some embodiments, the binding stability of oligonucleotide probe species is enhanced through the use of specific stabilizing base modifications or oligoconjugates (eg, stilbene caps). In some embodiments, fully modified 3- or 4-base lengths (eg, locked nucleic acids (LNA) and/or peptide nucleic acids (PNA)) are used.

In some embodiments, a unique N-base long sequence may include one or more nucleotide positions occupied by one or more degenerate nucleotides. In some embodiments, degenerate positions include all four nucleotides and members of an oligonucleotide probe species comprising an oligonucleotide probe, wherein degenerate base locations are provided with each of the four nucleotides. In some embodiments, one or more nucleotide positions of the oligonucleotide probe species are occupied by universal bases. In some embodiments, the universal base is 2'-deoxyinosine or other universal bases described herein. In some embodiments, the unique N-base long sequence is flanked at the 5′ end by a single degenerate nucleotide position or universal nucleotide position and at the 3′ end by a single degenerate nucleotide position or universal nucleotide position. adjacent to the target nucleotide position. In some embodiments, the 5' single universal nucleotide and/or the 3' single universal nucleotide is 2'-deoxyinosine or other universal bases described herein, respectively. obtain.

In some embodiments, each oligonucleotide probe species of a set of oligonucleotide probe species is the same length M. In some embodiments, M is a positive integer of 2 or greater. (f) determining the sequence of at least a portion of the target nucleic acid from the set of optically active multiple locations on the test substrate, comprising overlapping sequences of the oligonucleotide probe species represented by the set of optically active multiple locations; may also be used, which may include different locations of a single oligonucleotide probe species and different times at the same location of optical activity, duration, photon intensity, or a combination of sums thereof. In some embodiments, each oligonucleotide probe species of the set of oligonucleotide probe species shares M−1 sequence homology with another oligonucleotide probe of the set of oligonucleotide probes. In other embodiments, a subset of the set of oligonucleotide probes may share M−1 sequence homology with other oligonucleotide species of the set, or none of the set of oligonucleotide probes may share M− They may not share a single sequence homology.

probe label.
In some embodiments, each oligonucleotide probe species of a set of oligonucleotide probes is attached to a label. Figures 14A-14E show different methods of labeling oligonucleotide probes or other probe types. In some embodiments, the label is a dye, fluorescent nanoparticle, or light scattering particle. In some embodiments, probe 1402 is directly attached to label 1406 . In some embodiments, probe 1402 is indirectly labeled via flap sequence 1410, which can include sequence 1408-B that is complementary to the sequence of oligonucleotide probe 1408-A.

Many types of organic dyes with favorable characteristics are available for labeling, some exhibiting high photostability and/or high quantum efficiency, and/or minimal dark state and/or high solubility, and / or have low non-specific binding. Atto 542 is a preferred dye with several favorable qualities. Cy3B is a very bright dye and Cy3 is also effective. Some dyes allow avoidance of wavelengths at which autofluorescence from proteins, cells, or cellular material prevails, such as the red dyes Atto655 and Atto647N. Many types of nanoparticles are available for labeling. The present disclosure uses gold or silver particles, semiconductor nanocrystals (quantum dots), and nanodiamonds as nanoparticle labels, in addition to fluorescently labeled latex particles. Nanodiamonds are particularly preferred as labels in some embodiments. Nanodiamonds emit light with high quantum efficiency (QE), high photostability, high chemical stability, long fluorescence lifetime (e.g., on the order of 20 ns, which is observed from light scattering and/or autofluorescence). have two or more fluorescent emissions, have different emission bandwidths, and are small (eg, around 40 nm in diameter). DNA nanostructures and nanoballs can be very brightly labeled, either by incorporating multiple organic dyes into their structure (which can include branched structures) or by utilizing labels such as intercalating dyes.

In some embodiments, each indirect label may specify the identity of a base encoded in the sequence-referencing portion of the oligonucleotide probe species. In some embodiments, the label may comprise one or more molecules of a nucleic acid intercalating dye. In some embodiments, labels may include one or more types of dye molecules, fluorescent nanoparticles, or light scattering particles. In some embodiments, labels are selected that do not photobleach rapidly to allow for longer imaging times.

12A, 12B, and 12C show transient on-off binding of an oligonucleotide probe 1204 having a fluorescent label 1202 attached to a target nucleic acid 1206. FIG. Label 1202 fluoresces regardless of whether oligonucleotide probe 1204 binds to a binding site on target nucleic acid 1206 . Similarly, FIGS. 13A, 13B, and 13C show transient on-off binding of unlabeled oligonucleotide probe 1306. FIG. A binding event is detected by the intercalation of a dye 1304 (eg, YOYO-1) into a duplex 1304 transiently formed from solution 1302 . The intercalating dye exhibits a significant increase in fluorescence when bound to double-stranded nucleic acids compared to the free state floating in solution.

In some embodiments, an oligonucleotide probe species capable of binding a target nucleic acid may not be directly labeled. In some such embodiments, an oligonucleotide probe species may include a flap. In some embodiments, constructing an oligonucleotide probe species (e.g., encoding them) comprises linking specific sequence units, the units having a label and a complementary (specific units) and of a length sufficient to bind to one end of each k-base length (eg, flap sequence) of a set of one or more oligonucleotide probe species. Each unit of the flap coding sequence can serve as a docking or binding site for a separate fluorescently labeled probe. To encode a probe sequence of 5 bases, a flap on the probe can contain 5 different units or binding sites, for example each site is a different DNA base sequence linked in tandem to the next site. For example, a first unit or binding position on the flap flanks the oligonucleotide probe species sequence (a portion capable of binding to a target nucleic acid) and a second unit or binding position flanks the first unit or binding position. and so on. Prior to using the probe flaps in sequencing, each species of probe flap is conjugated to a set of fluorescently labeled oligos such that the number of units or number of binding sites on the flap sequence is the desired number of fluorescent More than labeled types may include oligos that are unlabeled. Oligos associated with different labels have their respective sequences complementary to different units or binding sites, creating unique identification tags for the oligonucleotide probe species sequences. In some embodiments, this uses four separately labeled oligo sequences that are complementary to each respective unit or binding position on the flap (e.g., as many as 16 different label combinations in total). can be done by

In some embodiments, probes with A, C, T, and G defined are in such a manner that the label reports only one defined nucleotide at a particular position of the oligonucleotide probe species. encoded (and other positions are degenerate or universal). This may require only 1 color per nucleotide, ie 4 colors for coding.

In some embodiments, only one fluorophore color is used throughout the exposure process. In such embodiments, each exposure process is divided into four sub-processes, each of which places a different base at a particular position (e.g., position 1) before the next oligonucleotide probe species in the set is added. One oligonucleotide probe species of a set of four oligonucleotide probe species with is added separately. At each cycle, the oligonucleotide probe species may have the same label. In this embodiment of an oligonucleotide probe species sequence length of 5 bases in length, the complete set of one or more sets of oligonucleotides represents five sets of oligonucleotide probe species corresponding to matches at single base positions. each set may comprise 4 oligonucleotide probe species corresponding to different single bases at a single position of the set of 5 base long oligonucleotide probe species, the total number of exposure subprocesses being 20 (5 sets corresponding to each base position of a complete set of oligonucleotide probe sets of 5 base lengths, each set having 4 oligonucleotide probe species).

In some embodiments, the first base of the oligonucleotide probe seed sequence is encoded by the first unit of the flap sequence and the second base is encoded by the second unit. The order of the flap units may correspond to the order of the base sequences of the oligonucleotide probe species. A separate fluorescent label may then be attached or docked (via complementary base pairing) to each corresponding unit contained in the flap. A first label associated with the first unit, and thus associated with the sequence position of the first oligonucleotide probe species, may in one example emit at a wavelength between 500 nm and 530 nm and is associated with the second unit. A second label, thus associated with the sequence position of the second oligonucleotide probe species, may emit at a wavelength of 550 nm to 580 nm, a third label at 600 nm to 630 nm, a fourth label at At 650 nm-680 nm, the fifth label may emit at 700 nm-730 nm. The identity of the base at each location can then be encoded, for example, by the fluorescence lifetime of the label. In one such example, the label corresponding to A has a longer lifetime than the label corresponding to C, has a longer lifetime than the label corresponding to G, and has a longer lifetime than the label corresponding to T. have In the example above, base A at position 1 may emit at 500 nm-530 nm, which has the longest lifetime, and base G at position 3 may emit at 600 nm-630 nm, which has the third longest lifetime. good.

In some embodiments, as illustrated in FIG. 14E, oligonucleotide probe species 1402 can include sequence 1408-A corresponding to sequence 1408-B. Array 1408-B is attached, bound, or linked to flap region 1410. FIG. As an example of a possible sequence that could give rise to the overall construct of FIG. 14E, each of the four unit positions at 1410 would have the sequences AAAA (e.g., a region complementary to 1412), CCCC (e.g., a region complementary to 1414), respectively. region), GGGG (eg, the region complementary to 1416), and TTTT (eg, the region complementary to 1418). Therefore, the overall flap sequence is (SEQ ID NO: 1) 5'-AAACCCCGGGGTTTT-3'. Each unit position is then encoded using a specific emission wavelength range, and the four different possible bases at that position are encoded by labeled oligos of four different fluorescence lifetimes, the lifetime/brightness ratio being: It can correspond to a particular base position and base code corresponding to the oligonucleotide probe species 1402 sequence itself.

An example of suitable code is as follows:
●Position 1-A base code-TTTT-luminescence peak 510, lifetime/brightness #1
●Position 1-C base code-TTTT-luminescence peak 510, lifetime/brightness #2
●Position 1-G base code-TTTT-luminescence peak 510, lifetime/brightness #3
●Position 1-T base code-TTTT-luminescence peak 510, lifetime/brightness #4
●Position 2-A base code-GGGG-emission peak 560, lifetime/brightness #1
●Position 2-C base code-GGGG-emission peak 560, lifetime/brightness #2
●Position 2-G base code-GGGG-emission peak 560, lifetime/brightness #3
●Position 2-T base code-GGGG-emission peak 560, lifetime/brightness #4
●Position 3-A base code-CCCC-emission peak 610, lifetime/brightness #1
●Position 3-C base code-CCCC-emission peak 610, lifetime/brightness #2
●Position 3-G base code-CCCC-emission peak 610, lifetime/brightness #3
●Position 3-T base code-CCCC-luminescence peak 610, lifetime/brightness #4
●Position 4-A base code-AAAA-emission peak 660, lifetime/brightness #1
●Position 4-C base code-GGGG-emission peak 660, lifetime/brightness #2
●Position 4-G base code-GGGG-emission peak 660, lifetime/brightness #3
●Position 4-T base code-GGGG-luminescence peak 660, lifetime/brightness #4

In other embodiments, different unit positions are encoded by fluorescence lifetimes and bases are encoded by fluorescence emission wavelengths. In some embodiments, other measurable physical attributes may alternatively be used for the code, or where the measurements are compatible with wavelength and lifetime measurements. For example, the polarization or intensity of emitted light can also be measured to increase the size of the number of codes available for inclusion in the flap.

In some embodiments, toe-hold probes (eg, Levesque et al., Nature Methods 10:865-867, 2013) are used. These probes are partially double-stranded and are competitively destabilized when bound to mismatched targets (detailed, for example, in Chen et al., Nature Chemistry 5, 782-789, 2013). ing). In some embodiments, the toehold probe is used alone. In some embodiments, toehold probes are used to ensure correct hybridization. In some embodiments, toehold probes are used to enhance the dissociation kinetics of other probes bound to target nucleic acids.

In some embodiments, the labels excited by the common excitation line are quantum dots. In some such embodiments, according to this example, Qdot525, Qdot565, Qdot605, and Qdot655 are selected to each correspond to four nucleotides. Alternatively, four different laser lines are used to excite four different organic fluorophores and the resulting emission is split and detected by an image splitter. In some other embodiments, the emission wavelength is common to two or more organic dyes, but the fluorescence lifetimes are different. Those skilled in the art could envision several different encoding and detection schemes without undue effort and experimentation.

In some embodiments, different oligonucleotide probe species of one or more sets of oligonucleotide probe species may not be added individually, but are encoded and pooled together. The simplest step-up from one color and one oligo at a time is two colors (or two lifetimes, two of the other detectable differences between labels) and two oligonucleotide probe species at a time. be. For each of the five oligonucleotide probe species, up to about five oligos at a time using five distinct single dye-encoded labels, direct detection of one dye-encoded label It is reasonable to expect to pool the nucleotide probe species.

In other embodiments, a higher level of complexity is required or desired and may add flavor or code. For example, to individually code each base of a complete set of three base long oligonucleotide probe species would require 64 different codes. Also, by way of example, 1024 different codes would be required to individually code each base of a complete set of five base long oligonucleotide probe species. Such multiple codes are achieved by having one code per oligo composed of multiple different detectable label features. In some embodiments, a smaller set of codes is used to encode a smaller set of oligonucleotide probe species or a subset of the complete set (e.g., optionally using 64 codes , encoding 16 subsets of the complete set of sequences of 1024 oligonucleotide probe species of 5 bases length).

In some embodiments, large sets of oligocodes are obtained in several ways. For example, in some embodiments, beads loaded with code-specific dyes, or DNA nanostructure-based codes, may contain luminescent dyes with different optimally spaced fluorescence wavelengths (see, eg, Lin et al. , Nature Chemistry 4:832-839, 2012). In some embodiments, a bead 1412 can include multiple fluorescent labels 1414, as illustrated in FIGS. 14C and 14D. FIG. 14C depicts labels 1414 coated onto beads 1412 . FIG. 14D depicts label 1414 encapsulated in bead 1412 . In some embodiments, each label 1414 is a different type of fluorescent molecule. In some embodiments, all labels 1414 are the same type of fluorescent molecule (eg, Cy3). In further embodiments, one or more of the different labels, including different and/or the same fluorescent molecule, are coated, attached or encapsulated to the beads.

In some embodiments, a coding scheme is used and a modular code is used to describe the base positions of the oligonucleotide probe species and their identities. In some embodiments, this is accomplished by adding coding arms to the oligonucleotide probe species, which may contain a combination of labels capable of distinguishing the oligonucleotide probe species. For example, if it is desired to encode a library of all possible 5-base long oligonucleotide probes, the arm has five sites, units, or attachment positions, each site, unit, or attachment position being , corresponding to each of the five nucleobases of a five-base-long oligonucleotide probe species, each of the five sites being attached to five distinguishable labels and associated with sites, units, or binding sites. Each distinguishable label is further distinguishable from 15 other labels associated with different base determinations. In one such example, a label comprising a fluorophore having a specific peak emission wavelength corresponding to each site, unit, or attachment site (e.g., 500 nm for the first site, unit, or attachment site, 500 nm for the second 550 nm for the site, unit, or binding position of 600 nm for the third site, unit, or binding position, 650 nm for the fourth site, unit, or binding position 4, and the fifth site, unit, or bond 700 nm at the position), and four fluorophores with the same emission wavelength but different fluorescence lifetimes can encode each of the four bases at each position.

In some embodiments, different labels on, attached to, or linked to oligonucleotide probe species or other binding reagents are encoded or partially encoded by the wavelength of emission. . In some embodiments, the different labels are encoded or partially encoded by fluorescence lifetime. In some embodiments, the different labels are encoded or partially encoded by fluorescence polarization. In some embodiments, the different labels are encoded or partially encoded by any combination of wavelength, fluorescence lifetime, fluorescence polarization lifetime, or any other optically observable mechanism.

In some embodiments, the different labels are encoded or partially encoded by repeated on-off hybridization kinetics of associated probe species that are associated oligonucleotide probe species. Different binding probes are used, which are different oligonucleotide probe species with different association-dissociation constants. In some embodiments, probes that are oligonucleotide probe species are encoded or partially encoded by fluorescence intensity. In some embodiments, probes that are oligonucleotide probe species are fluorescent intensities encoded by having different numbers of non-self-quenching fluorophores, optionally bound, attached, or ligated. . Individual fluorophores typically need to be far enough apart to prevent or reduce quenching. In some embodiments, this is achieved by holding the labels in place at a suitable distance from each other, optionally using rigid linkers or DNA nanostructures.

In some embodiments, encoding by fluorescence intensity is achieved by using dye variants that have similar emission spectra but differ in quantum yield or other measurable optical properties. For example, Cy3B with excitation/emission 558/572 (e.g. quantum yield of 0.67) is substantially brighter than Cy3 (with excitation/emission 550/570 and quantum yield of 0.15). have similar absorption/emission spectra. In some such embodiments, a 532 nm laser is used to excite both dyes. Other suitable dyes may include Cy3.5 (with excitation/emission 591/604 nm), which has up-shifted excitation and emission spectra but is nevertheless excited by a 532 nm laser. will be done. However, excitation at that wavelength is not optimal for Cy3.5, and with a bandpass filter optimized for Cy3, the emission of Cy3.5 would appear brighter. Atto532 has excitation/emission 532/553, a quantum yield of 0.9, and is expected to be bright because a 532 nm laser can excite Atto532 at its maximum excitation.

In other embodiments, a single excitation wavelength is used to measure the radiative lifetime of dyes to achieve multiple codes. In one example according to such an embodiment, a set comprising Alexa Fluor546, Cy3B, Alexa Fluor555, and Alexa Fluor555 is used. In some cases other dye sets are more useful. In some embodiments, the code set is also extended by using FRET pairs and/or by measuring the polarization of the emitted light. Another way to increase the number of code indicators is to code with multiple colors.

FIG. 15 shows examples of fluorescence from transient binding of oligonucleotide probe species to target nucleic acids. Selected frames from the time series (e.g. frame numbers 1, 20, 40, 60, 80, 100) show the presence (e.g. dark spots) and absence (e.g. , white areas). Each frame shows fluorescence generated from multiple bound oligonucleotide probe species along the target nucleic acid. The merged image shows the aggregation or sum of the fluorescence of all previous frames, showing all sites where the oligonucleotide probe species bound and were detected during the 100 frames.

Transient binding of probes to target polynucleotides.
The binding of probes, which are oligonucleotide probe species, is a dynamic process, and bound probes always have some probability of becoming unbound (e.g., temperature, salt concentration, competition between probes, and some (determined by a variety of factors, including other factors in Therefore, there is always an opportunity for one probe to replace another. For example, in one embodiment, a pool of oligonucleotide probe species is used, including oligonucleotide probe species that are complementary, to anneal to a stretched target nucleic acid on a test substrate or other surface, and the complementary oligonucleotide probes in solution. It can cause a continuous competition between annealing to seeds. In another embodiment, the probe has three portions, a first portion fully complementary to the target nucleic acid and a second portion partially complementary to the target nucleic acid. is partially complementary to one or more other oligonucleotide probe species of the common pool exposed to the target nucleic acid, and the third portion is one of the common pool exposed to the target nucleic acid It is fully complementary to the other oligonucleotide probe species above. In some embodiments, gathering information about the precise spatial location of units of chemical structure, such as base positions, of a target nucleic acid can help determine the structure and/or sequence of macromolecules. In some embodiments, the locations of oligonucleotide probe species binding sites are determined with nanometric or sub-nanometric precision (eg, by using single-molecule localization algorithms). In some embodiments, multiple observed binding sites of oligonucleotide probe species are resolvable by diffraction-limited optical imaging and are resolved because the binding events are separated in time. The sequence of the target nucleic acid is determined based on the identity of the oligonucleotide probe species that can bind at each location.

In some embodiments, the exposure process is performed by subjecting individual probes of each pool of each oligonucleotide probe species to immobilized first strands or immobilized second strands or individual oligonucleotide probe species. It is performed using conditions that allow each portion of the target nucleic acid that is complementary to transiently and reversibly bind to form the respective duplexes, thereby providing a case of optical activity. give rise to In some embodiments, the dwell time (e.g., duration and/or persistence of binding by a particular oligonucleotide probe species) is such that a binding event is a perfect match. , mismatch, or spurious binding.

In some embodiments, the exposing process comprises immobilizing or anchoring the individual probes of each pool of each oligonucleotide probe species to the immobilized first strand of target nucleic acid that is complementary to the individual oligonucleotide probe species. using conditions that allow it to repeatedly transiently and reversibly bind each portion of the second strand to form the respective duplexes, thereby providing an optically active Iteratively generate each instance of .

In some embodiments, the sequencing process or method comprises subjecting the extended target nucleic acid to transient interactions from each of one or more complete sets of sequentially provided oligonucleotide probe species. (solution with one oligonucleotide probe species is removed and solution with the next oligonucleotide probe species is added). In some embodiments, binding of each oligonucleotide probe species is performed using conditions that allow the oligonucleotide probe species to transiently bind. Thus, for example, binding is performed at 25° C. for one oligonucleotide probe species and 30° C. for the next. In some embodiments, oligonucleotide probe species are utilized in sets that are in a common pool of oligonucleotide probe species. All oligonucleotide probe species that can be transiently bound using similar conditions, such as, for example, similar temperatures, similar salt concentrations, or other factors that can affect hybridization binding, are assembled into a set. can optionally be used together in a common pool of oligonucleotide probe species. In some such embodiments, each oligonucleotide probe species of the set is differentially labeled or differentially encoded.

In some embodiments, transient binding of oligonucleotide probe species is performed in buffers containing small amounts of divalent cations but no monovalent cations. In some embodiments, the buffer may contain 5 mM Tris-HCl, 10 mM magnesium chloride, mm EDTA, 0.05% Tween-20, and pH 8. In some embodiments, the buffer may contain less than 1 nM, less than 5 nM, less than 10 nM, or less than 15 nM magnesium chloride, calcium chloride, manganese chloride, or other suitable divalent cation. In other embodiments, divalent cations are provided at a concentration slightly greater than half the concentration of negatively charged nucleobases in solution, which solution may include oligonucleotide probe species and target nucleic acids.

In some embodiments, multiple conditions are used that promote transient binding. In some embodiments, one condition is used for one oligonucleotide probe species depending on its Tm and another condition is used for another oligonucleotide probe species depending on its Tm. (eg, each 5 base long oligonucleotide probe species from 1024 possible complete sets of 5 base lengths). In some embodiments, only 512 non-complementary 5-base lengths are provided (eg, because the target nucleic acid is in double-stranded form and thus both complementary strands are present in the sample). In some embodiments, addition of each oligonucleotide probe species results in an oligonucleotide probe containing the same 5 specific bases and 2 degenerate or universal bases in the same sequence order (thus 16 heptamers). ), thus all with the same label that can function as a single pentameric oligonucleotide probe in terms of system throughput and number of different reagent sets used to interrogate target nucleic acid sequences. be labeled. Degenerate bases or universal bases can add stability without increasing the complexity of the set of oligonucleotide probe species.

In some embodiments, the same conditions are provided for multiple oligonucleotide probe species that may share the same or similar Tm. In some such embodiments, each oligonucleotide probe species of a set of oligonucleotide probe species may comprise a different code label (which may account for different moieties so that each label species is uniquely identified). ). In such cases, the temperature is held through several oligonucleotide probe species, which are pools of exchange of oligonucleotide probe species, and then for the next set of oligonucleotide probe species that may share the same or similar Tm. changed by

In some embodiments, the binding behavior of the oligonucleotide probe species is measured at two or more temperatures by varying the temperature during binding of the oligonucleotide probe species that is part of the exposure process. In some embodiments, the binding behavior or pattern of the oligonucleotide probe species to the target nucleic acid correlates with stepped temperatures (e.g., 10°C to 65°C or 1°C to 35°C) through a selection range. , an analogue of the melting curve is performed. In other embodiments, changes in salt, addition of denaturants such as formamide, and changes in other parameters known to affect oligonucleotide probe binding are performed in a manner similar to changes in temperature. Alterations are made to other parameters that may affect oligonucleotide probe binding to target nucleic acids. In other embodiments, a single temperature is utilized and observation of binding kinetics is used as another measurable parameter that can be correlated with the Tm of oligonucleotide probe binding.

In some embodiments, the Tm of an oligonucleotide probe species is calculated, eg, by the nearest neighbor parameter. In other embodiments, the Tm of the oligonucleotide probe species is empirically derived. For example, the optimal melting temperature range is derived by performing a melting curve (eg, measuring the degree of melting by absorption over a range of temperatures). In some embodiments, the composition of the set oligonucleotide probe species is designed according to a theoretically matched Tm verified by empirical testing. In some embodiments, binding of the oligonucleotide probe species as part of the exposure process occurs at a temperature substantially below the Tm (eg, up to 33° C. below the calculated Tm). In some embodiments, an empirically defined optimal temperature for each individual oligonucleotide probe species of a set of oligonucleotide probe species is determined as part of the exposure process in a sequencing method for each individual oligonucleotide. Used for binding probe species.

In some embodiments, as an alternative or in addition to changing the temperature of oligonucleotide probe species with different Tms, probe and/or salt concentrations are changed and/or pH is changed. In some embodiments, the electrical bias on the other surface test substrate is positive and positive to actively promote transient binding between the oligonucleotide probe species and one or more target nucleic acids. repeatedly toggled between negative.

In some embodiments, the concentration of the oligonucleotide probe species used is adjusted according to the AT to GC content of the sequence of the oligonucleotide probe species. In some embodiments, higher concentrations of oligonucleotide probe species are provided for oligos with higher GC content. In some embodiments, buffers that can compensate for effects of base composition (e.g., buffers containing chaotropic reagents such as CTAB, betaine, or tetramethylammonium chloride (TMACl)) are used at concentrations between 2.5M and 4M. and thus equalize the effective Tm for different oligonucleotide probe species with different AT versus GC sequence content and different Tms, as measured using the same set of conditions be able to.

In some embodiments, the oligonucleotide probe species are isolated due to stochastic effects or aspects of the sequencing chamber design (e.g., vortices in the flow cell where probes can be trapped in the corners or against the walls of nanochannels). , unevenly distributed throughout the sample (eg, test substrate, flow chamber, slide, length of target nucleic acid, and/or ordered array of target nucleic acid). Local depletion of the probe is addressed by ensuring efficient mixing or agitation of the probe solution. In some cases, this is done by including particles in the solution that can generate turbulence and/or by constructing flow cells that generate turbulence (e.g., herringbone patterns on one or more surfaces). , which is realized using acoustic waves. In addition, due to the laminar flow in the flow cell, there is typically very little mixing, with little solution near the surface mixing with the bulk solution. This can create problems in removing reagents/bound probes near the surface and bringing fresh reagents/probes to the surface. To mitigate this, turbulence generation approaches such as those described above can be implemented and/or large scale fluid flow/exchange at the surface can be performed. In some embodiments, before or after the target nucleic acid is arrayed, non-fluorescent beads or balls are attached to the surface (which is the surface to which the target nucleic acid is bound) to give the surface landscape a rough texture. This can create vortices and flows to more effectively mix and/or exchange fluids near the surface. In other embodiments, an electric field is utilized to concentrate and/or remove bound oligonucleotide probe species, wherein the electric field is applied between the surface to which one or more target nucleic acids are bound and the bulk solution. .

In some embodiments, the complete set or subset of oligonucleotide species are added together. In some such embodiments, buffers that equalize the effects of base composition (eg, TMACl or guanidine thiocyanate as described in US Patent Application No. 2004/0058349) are used. In some embodiments, probe species with the same or similar Tm are added together. In some embodiments, the co-added oligonucleotide probe species may not be differentially labeled. In some embodiments, the oligonucleotide probe species added together are differentially labeled. In some embodiments, differential labels have different brightness, lifetimes, excitation maxima, emission maxima, or other observable optical properties, such as and/or combinations of such physical properties. It is a label with luminescence.

In some embodiments, two or more oligonucleotide probe species are used together and their binding sites determined without the need to distinguish between signals arising from different oligonucleotide species (e.g., oligos are labeled with the same emission wavelength). When both strands of a double-stranded target nucleic acid are available, obtaining binding site data from both strands can allow discrimination between two or more oligonucleotides as part of an assembly algorithm. In some embodiments, one or more reference oligonucleotide probe species are added with each oligonucleotide probe species of a set or subset of assembly algorithms, and then the location of the optical activity of such reference probes and the resulting The binding sites can be used to scaffold or tether the sequence assembly of the target nucleic acid. In other embodiments, two or more oligonucleotide probe species are used together and their binding sites are determined without the need to distinguish signals originating from different oligonucleotide species (e.g., oligos labeled with the same emission wavelength). ), determined by generating multiple sets of oligonucleotide probe species. Each oligonucleotide probe species of the complete set of oligonucleotide probe species is represented in two or more subsets of oligonucleotide probe species, and identification of the oligonucleotide probe species is achieved using combinations of the different subsets, optical The common location of activity and thus the binding location of the oligonucleotide probe species is determined.

In an alternative embodiment, the oligonucleotide probe species can be stably bound using favorable binding conditions, but the binding conditions are changed to unfavorable binding conditions to control and transiently bind the binding. can be used to force a binding. In non-limiting embodiments, the modification of conditions is heat, pH, electric field, or reagent exchange that can dissociate binding of the oligonucleotide probe species. Conditions are then returned to good binding conditions to allow the oligonucleotide probe species to bind again. In some embodiments, if the time interval of the first preferred binding condition does not saturate all target nucleic acid sites, then in the time interval of the second preferred binding condition of the oligonucleotide lobe species, the first preferred binding condition can bind to a different set of target nucleic acid sites than the time interval of the first preferred binding condition. In some embodiments, these cycles are performed multiple times at a controllable rate.

In some embodiments, the transient binding is 1 millisecond or less, 50 milliseconds or less, 500 milliseconds or less, 1 microsecond or less, 10 microseconds or less, 50 microseconds or less, 500 microseconds or less, 1 Lasts no more than seconds, no more than 2 seconds, no more than 5 seconds, or no more than 10 seconds.

In some embodiments, photobleaching of the fluorophore may not pose a significant problem when using transient binding methods and ensuring a continuous supply of fresh oligonucleotide probe species. , a sophisticated field stop or Powell lens may not be necessary to limit the illumination. Therefore, the choice of fluorophore (or anti-fading, provision of a redox system) may not be critical, and in some such embodiments relatively simple optics are constructed, e.g. Illumination of target nucleic acids that are not in the field of view of the two-dimensional imaging device can be prevented.

In some embodiments, another advantage of transient binding is that multiple measurements can be made at all binding sites along the polynucleotide, increasing confidence in the accuracy of optical activity events or detection. to increase. For example, in some cases, the typical stochastic nature of molecular processes can cause oligonucleotide probe species to bind in the wrong place. With such outliers, which are likely to be much shorter than the exact binding of transiently bound probes, isolated binding events can be discarded, allowing multiple detected interactions to Only those binding events that are validated are accepted as valid detection events for purposes of sequencing the target nucleic acid.

Detection of transient binding and localization of binding sites.
Transient coupling is an essential component that enables sub-diffraction level localization. There is always the possibility that each oligonucleotide probe of a set of transiently binding oligonucleotide probe species either binds to a target nucleic acid or is present in solution. Therefore, not all target nucleic acid binding sites are bound by an oligonucleotide probe at any one time. This can allow detection of binding events at sites closer than the diffraction limit of light (eg, two sites only 10 nm apart on the target nucleic acid). For example, if the sequence AAGCTT is repeated after 60 bases, the repeats will be about 20 nm apart (if the target nucleic acid has been extended and linearized to a Watson-Crick base length of about 0.34 nm). Twenty nanometers would normally be indistinguishable by optical imaging. However, if a probe binds to two sites at different times during imaging, they will be detected individually. This allows for super-resolution imaging of binding events. Nanometric precision is particularly important for resolving and determining the number of sequence repeats that are homopolymeric repeats or repeats of 2, 3, or more than 3 bases.

In some embodiments, the multiple binding events associated with multiple instances of optical activity and correlated with target nucleic acid locations are not from the sequence of a single oligonucleotide probe species, but from the complete oligonucleotide probe species. It can be determined by analyzing the data from the set and considering cases of binding events or optical activity that can arise from partially overlapping sequences. As an example, probes ATTAAG and TTAAGC are bound at the same location (sub-nanometrically close, in fact). They are 6 bases long, share a common 5 base sequence, each verify the other, and extend the sequence by 1 base on either side of the common 5 base sequence. In some cases, one base on each side of the five-base sequence is mismatched (mismatches at the ends are typically expected to be more tolerated than internal ones) and are present in both binding events. It is verified that only 5 base sequences do.

In some alternative embodiments, transient single-molecule binding is detected by non-optical methods. In some embodiments, the non-optical method is an electrical method. In some embodiments, transient single-molecule binding is detected by non-fluorescent methods in the absence of direct excitation methods, rather bioluminescence or chemiluminescence mechanisms are used.

In some embodiments, each base in the target nucleic acid is matched by multiple oligonucleotide probe species that may overlap in sequence. This repeated sampling of each base allows detection of rare single nucleotide variants or mutations in the target nucleic acid.

In some embodiments, all instances of optical activity or binding interactions (having a duration greater than the threshold binding duration) that each oligonucleotide probe species under analysis had with the target nucleic acid are utilized in such analysis. be done. In some embodiments, sequencing may involve not only splicing or reconstructing sequences from perfect matches, but in a first software sequencing process, the optical sequence associated with each oligonucleotide probe species. Sequences can be obtained by first analyzing valid instances of activity or binding events. In some embodiments, transient binding is recorded as a means of detection, but may not be used to improve localization of binding of oligonucleotide probe species.

Imaging techniques for detecting optical activity and localizing binding sites.
block 214; In some embodiments, the location on the test substrate and, optionally, the duration of each respective instance of optical activity occurring during the exposure process using a two-dimensional imaging device are measured.

In some embodiments, measuring locations on the test substrate may include inputting frames of data measured by a two-dimensional imaging device into a trained convolutional neural network. A frame of data may include each instance of optical activity at a different location from multiple instances of optical activity at different locations and the same location. Each instance of optical activity of the plurality of instances of optical activity may correspond to an individual nucleotide probe species that binds to a portion of the immobilized first strand or immobilized second strand of the target nucleic acid. In response to the input, the trained convolutional neural network can identify the location on the test substrate of each of one or more instances of optical activity of the plurality of instances of optical activity.

In some embodiments, the detector is a two-dimensional detector and binding events are localized with nanometric accuracy (eg, by using single-molecule localization algorithms). In some embodiments, interaction characteristics can include optical activity or the duration of each instance of binding event, which can correspond to the binding affinity of the oligonucleotide probe species with the target nucleic acid. In some embodiments, a feature is a location, surface, or matrix of a test substrate that can correspond to the location within an array of a particular target nucleic acid (eg, a polynucleotide corresponding to a particular gene sequence).

In some embodiments, each respective instance of optical activity has an observed metric that can meet a predetermined threshold. In some embodiments, the observation metric includes duration, signal-to-noise ratio, photon count, or intensity, or a combination thereof. In some embodiments, a predetermined threshold is met if each instance of optical activity is observed for one frame. In some embodiments, the predetermined threshold is met if the intensity of each instance of optical activity is relatively low and each instance of optical activity is observed for one tenth of the frames.

In some embodiments, the predetermined threshold is such that (i) each residue of a unique N-base long sequence of the oligonucleotide probe species is a fixed first strand or a fixed second strand of the target nucleic acid; and (ii) a unique N-base long sequence of oligonucleotide probe species such that each oligonucleotide probe species forms a respective instance of optical activity or binding event. and a second binding form in which there is at least one mismatch between the sequence of the immobilized first strand or the immobilized second strand of the target nucleic acid bound to the .

In some embodiments, each respective oligonucleotide probe species of the set of oligonucleotide probe species has a unique corresponding predetermined threshold value.

In some embodiments, the predetermined threshold is 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, between the oligonucleotide probe species and the target nucleic acid at a particular location along the target nucleic acid. A determination is made based on observing one or more, or six or more binding events.

In some embodiments, the predetermined threshold value for each respective oligonucleotide probe species of the set of oligonucleotide probe species is derived from a training data set (e.g., lambda phage, or any known synthetic target nucleic acid sequence data set derived from information obtained by applying the temporal combination method to the decision). In some embodiments, different thresholds are determined for different base variants, such as epigenetically modified bases or RNA bases (e.g., uridine) compared to DNA bases, and such different thresholds are expected Corresponding to one of the target nucleic acid types or potentially modified base regions (eg, CpG islands) of the sample is used.

In some embodiments, the predetermined threshold for each respective oligonucleotide probe species of the set of oligonucleotide probe species is derived from the training data set. The training set includes, for each respective oligonucleotide probe species in the set of oligonucleotide probe species, a measure of the observed metric for each respective oligonucleotide probe species when bound to the reference nucleic acid sequence, so that each oligonucleotide Each residue of a unique N-base long sequence of the probe species binds to a complementary base of the reference nucleic acid sequence.

In some embodiments, the reference nucleic acid is immobilized on a reference substrate. In some embodiments, the reference nucleic acid is included with and immobilized on the test substrate. In some embodiments, the reference nucleic acid sequence may comprise all or part of the genome of PhiX174, M13, phage lambda, phage T7, Escherichia coli, Saccharomyces cerevisiae, Saccharomyces pombe. In some embodiments, the reference nucleic acid sequence is a synthetic construct of known sequence. In some embodiments, the reference nucleic acid sequence can comprise all or part of a rabbit globin RNA (e.g., utilized when the target nucleic acid comprises RNA or when only one strand of the target nucleic acid is to be sequenced). ).

In some embodiments, the exposure process may utilize a first label in the form of an intercalating dye. Each oligonucleotide probe species in the set of oligonucleotide probe species is attached to a second label. The first label and the second label have overlapping donor emission spectra and acceptor excitation spectra, and the first label and the second label if the first label and the second label are in close proximity to each other. can increase the fluorescence level. Each instance of optical activity can result from the proximity of the intercalating dye and the respective duplex between the oligonucleotide probe species and the immobilized first strand or immobilized second strand of the target nucleic acid. is inserted into the second label. In some embodiments, the exposure process and associated fluorescence may involve Förster Resonance Energy Transfer (FRET) methods. In such embodiments, the intercalating dye may comprise a FRET donor and the second label may comprise a FRET acceptor.

In some embodiments, instances of optical activity are detected utilizing FRET between intercalating dyes to labels bound, ligated or associated with oligonucleotide probe species or target nucleic acid sequences. In some embodiments, after the target nucleic acids are immobilized, all target nucleic acid ends are labeled, e.g., by terminal transferase, by adding fluorescently labeled nucleotides that can function as FRET partners. In some such embodiments, the oligonucleotide probe species is labeled at one of its termini with a Cy3B or Atto542 label.

In some embodiments, FRET is replaced by photoactivation. In such embodiments, the donor (e.g., label on the target nucleic acid) may comprise a photoactivator and the acceptor (e.g., label on the oligonucleotide probe species) is fluorophore in an inactivated or darkened state. Fore can be included (eg, Cy5 label can be darkened by caging with 1 mg/mL NaBH4 in 20 mM Tris (pH 7.5), 2 mM EDTA, and 50 mM NaCl). In such embodiments, the fluorescence of a dimmed fluorophore that is bound to an oligonucleotide probe species and switched on when in proximity to an activator, which is bound to a target nucleic acid.

In some embodiments, the exposure process may utilize a first label in the form of an intercalating dye (eg, photoactive agent). Each oligonucleotide probe species of the set of oligonucleotide probe species is attached to a second label (eg, a darkened fluorophore). A first label may cause a second label to fluoresce when the first label and the second label are in close proximity to each other. Each instance of optical activity can result from the proximity of the intercalating dye and the respective duplex between the oligonucleotide probe species and the immobilized first strand or immobilized second strand of the target nucleic acid. is inserted into the second label attached to the oligonucleotide probe species.

In some embodiments, the exposure process may utilize a first label in the form of an intercalating dye (eg, a darkened fluorophore). Each oligonucleotide probe species of the set of oligonucleotide probe species is attached to a second label (eg, a photoactivator). The second label may cause the first label to fluoresce when the first label and the second label are in close proximity to each other. Each instance of optical activity can result from the proximity of the intercalating dye and the respective duplex between the oligonucleotide probe species and the immobilized first strand or immobilized second strand of the target nucleic acid. is inserted into the second label attached to the oligonucleotide probe species.

In some embodiments, the exposure process may utilize an intercalating dye. Each instance of optical activity is derived from the fluorescence of an intercalating dye that intercalates into each duplex between the oligonucleotide probe species and either the immobilized first strand or the immobilized second strand of the target nucleic acid. Each instance of optical activity that can occur is greater than the fluorescence of the intercalating dye prior to intercalation into the respective duplex. An increase in fluorescence (over 100-fold) of one or more intercalating dyes intercalating into the duplex between the target nucleic acid and the oligonucleotide probe species is a point source for single-molecule localization algorithms. )-like signal, allowing precise determination of the location of the binding site. Intercalating dyes may be intercalated into the duplex and are strongly detected and exhibit a substantial number of duplex-induced optical activities associated with each binding event of each oligonucleotide probe species binding site that are precisely located. may generate instances of

In some embodiments, each oligonucleotide probe species of the set of oligonucleotide probe species produces the first instance of optical activity by binding to the complementary portion of the immobilized first strand of the target nucleic acid. , produces the second instance of optical activity by binding to the complementary portion of the immobilized second strand of the target nucleic acid. In some embodiments, the immobilized first strand portion of the target nucleic acid can undergo an instance of optical activity upon binding of its complementary oligonucleotide probe species, complementary to the immobilized first strand portion of the target nucleic acid. A portion of the immobilized second strand of the target nucleic acid can give rise to another instance of optical activity due to binding of its complementary oligonucleotide probe species.

In some embodiments, each oligonucleotide probe species of the set of oligonucleotide probe species is optically active by binding to two or more complementary regions of the immobilized first strand of the target nucleic acid. The first instance above can occur, and by binding to two or more complementary regions of the immobilized second strand of the target nucleic acid, two or more second instances of optical activity can occur.

In some embodiments, each oligonucleotide probe species is a portion of the immobilized first strand or the immobilized second strand of the target nucleic acid that is complementary to the respective oligonucleotide probe species during the exposure process. can bind three or more times, thereby resulting in three or more instances of optical activity, each instance of optical activity representing a binding event of multiple binding events.

In some embodiments, each oligonucleotide probe species is attached to a portion of the immobilized first strand or immobilized second strand of the target nucleic acid that is complementary to the respective oligonucleotide probe during the exposure process. , can bind five or more times, thereby giving rise to five or more instances of optical activity, each instance of optical activity representing a binding event of multiple binding events.

In some embodiments, each oligonucleotide probe species is attached to a portion of the immobilized first strand or immobilized second strand complementary to the respective oligonucleotide probe species during the exposure process. It can bind more than once, thereby resulting in 10 or more instances of optical activity, each instance of optical activity representing a binding event of multiple binding events.

In some embodiments, the exposure process may be 5 minutes or less, 4 minutes or less, 3 minutes or less, 2 minutes or less, or 1 minute or less.

In some embodiments, the exposure process can occur in one or more frames of the two-dimensional imaging device. In some embodiments, the exposure process can occur in two or more frames of the two-dimensional imaging device. In some embodiments, the exposure process may occur over 500 frames or more of the two-dimensional imaging device. In some embodiments, the exposure process can occur over 5,000 frames or more of the two-dimensional imaging device. In some embodiments, when optical activity is sparse (e.g., there are instances of spatially low probe binding), one frame of transient binding is associated with the binding site of the oligonucleotide probe species. sufficient to localize the signal.

In some embodiments, the expected length of time for the average instance of optical activity during the exposure process is the estimated melting point of each oligonucleotide probe species of the set of oligonucleotide probe species used in the exposure process. Determined by temperature.

In some embodiments, optical activity can include detection of fluorescence emission from a label. Each label is excited and the corresponding emission wavelengths are detected separately using different filters in the filter wheel. In some embodiments, the label emission lifetime is measured using a fluorescence lifetime imaging (FLIM) system. Alternatively, the emitted wavelengths are split and projected onto different quadrants of a single sensor or onto four separate sensors. In some embodiments, a method of using a prism to split the emission spectrum across the pixels of a CCD is described in Lundquit et al. , Opt Lett. , 33:1026-8, 2008. Spectrographs may also be used in some embodiments. Alternatively, in some embodiments, the emission wavelength is combined with the brightness level to provide information about the residence time of the probe at the binding site if the expected binding time of the oligonucleotide probe species is significantly shorter than the frame exposure time. can provide

Some detection methods, such as scanning probe microscopy (including high-speed atomic force microscopy) and electron microscopy, are capable of resolving nanometric distances when polynucleotide molecules are elongated in the detection plane. can. However, these methods do not provide information on the optical activity of fluorophores. There are multiple optical imaging techniques for detecting fluorescent molecules with super-resolution accuracy. These include stimulated emission depletion (STED), stochastic optical reconstruction microscopy (STORM), super-resolution optical fluctuation imaging (SOFI), single molecule localization microscopy (SMLM), and total internal reflection fluorescence microscopy (TIRF). is included. In some embodiments, an SMLM approach that is most similar to Point Integration for Nanoscale Topography Imaging (PAINT) is used. These systems typically require one or more lasers to excite the fluorophores, a focus detection/holding mechanism, one or more CCD or CMOS cameras, appropriate objective lenses, relay lenses, and mirrors. In some embodiments, the exposing step is performed for a number of image frames (e.g., movie or motion video) to record the binding-on and binding-off of the oligonucleotide probe species. can occur.

The SMLM method relies on high photon counts. High photon counts improve the accuracy with which the centroid of the fluorophore emission of the generated Gaussian pattern is determined, but the need for high photon counts is compromised by long image acquisitions and reliance on bright, photostable fluorophores. is also related. A high concentration probe solution uses quenched probes, molecular beacons, or two or more labels associated with complementary oligonucleotide probe species (e.g., one on each side of the duplex forming the target nucleic acid). is utilized without causing a disturbing background. In such embodiments, the label is quenched in solution via dye-dye interactions. However, when they bind to the target, the labels separate and fluoresce brightly (eg, twice as bright as a single dye), making them more detectable.

In some embodiments, the on-rate of a probe species that is an oligonucleotide probe species is increased by, for example, increasing probe concentration, increasing temperature, or increasing molecular crowding. change (eg, increase) (eg, by including PEG400, PEG800, etc. in the solution). In other embodiments, the off-rate of a probe species that is an oligonucleotide probe species is controlled by manipulating chemical moieties, for example, by decreasing the thermal stability of the probe species that is an oligonucleotide probe species. , adding destabilizing appendages, or in the case of oligonucleotide probe species, in particular reducing their length, using epigenetically or synthetically modified bases instead of natural bases. , is altered by modifying the backbone of the oligonucleotide probe species (eg, by altering the spacing between nucleobases or sugars, eg, by adding charges). In some embodiments, the off-rate is increased by increasing temperature, decreasing (eg, increasing severely) salt concentration, or changing pH.

In some embodiments, the concentration of oligonucleotide probe species used reduces background levels by rendering the probe label, the label of the oligonucleotide probe species, essentially non-fluorescent until they bind. Increased without significant elevation. One way to do this is for binding to trigger a photoactivation event. Another example is to quench the label until binding occurs (eg molecular beacons). Another example is detecting a signal as a result of an energy transfer event (eg, FRET, CRET, BRET). In some embodiments, a target nucleic acid, a biopolymer, is attached to a donor, a test substrate, a surface, and an oligonucleotide probe species, a probe, is attached to an acceptor (or vice versa). In another embodiment, the intercalating dye is provided in solution and upon binding of the labeled probe there is a FRET interaction between the intercalating dye and the labeled probe. An example of an intercalating dye is YOYO-1 and an example of a label on the probe is ATTO655. In another embodiment, the intercalating is a dye used without a FRET mechanism, both the single-stranded target nucleic acid and the oligonucleotide probe species on the test substrate or other surface are unlabeled, and the signal is intercalating Complementary duplexes into which the dye can intercalate can only be detected when binding occurs. The intercalating dye is 100-fold or 1000-fold less bright, depending on its identity, when it is not intercalated into a double-stranded nucleic acid and is instead free in solution. In some embodiments, TIRF or oblique thin-layer illumination (HILO) (e.g., Mertz et al., J. of Biomedical Optics, 15(1):016027, 2010) microscopy is used to intercalate dyes in solution. Eliminate any background signal from

In some embodiments, reduction of high background fluorescence that can obscure the detection of signal on test substrates or other surfaces (obscuring can result from high concentrations of labeled probes). In some embodiments, this is addressed by utilizing DNA stains or intercalating dyes to label duplexes formed on test substrates or other surfaces. The dye may not intercalate into a single-stranded probe or if the target nucleic acid is single-stranded, but if a duplex is formed between the oligonucleotide probe species and the target nucleic acid, the intercalating dye is inserted. In some embodiments, the oligonucleotide probe species are unlabeled and the detected signal can come from the intercalating dye alone. In some embodiments, the oligonucleotide probe species are labeled with a label that can serve as a FRET partner for intercalating dyes or DNA stains. In some embodiments, the intercalating dye is a donor and can be conjugated with acceptors of different wavelengths, thus allowing the oligonucleotide probe species to be encoded with multiple fluorophores.

In some embodiments, the exposure process can detect multiple instances of optical activity or binding events associated with each target nucleic acid site complementary to the oligonucleotide probe species. In some embodiments, the multiple events are from on and off binding of a single oligonucleotide probe molecule, from on and off binding of subspecies of an oligonucleotide probe species, or from on and off binding of a subspecies of an oligonucleotide probe species. from on and off binding, as well as from any combination of the aforementioned binding events (single, subspecies, or species oligonucleotide probes), and can occur multiple times. In some embodiments, on- or off-binding kinetics may not be affected by changes in conditions. For example, both on- and off-binding occur under the same conditions (eg, salt concentration, temperature, etc.) and result from weak probe-target interactions.

In some embodiments, sequencing comprises optically active or on-site at multiple locations on a single target nucleic acid (shorter, of the same length, or within an order of magnitude of the length of the oligonucleotide probe species). This is done by imaging multiple instances of off-coupling events. In such embodiments, longer target nucleic acids are fragmented, or panels of fragments are preselected and arrayed on a test substrate or other surface, so that each target nucleic acid molecule can be resolved individually. It is possible. In these cases, the frequency or duration of instances of optical activity, or binding of the oligonucleotide probe species to a particular location, is used to determine whether the oligonucleotide probe species is perfectly complementary to the target nucleic acid sequence. do. The frequency or duration of binding of the oligonucleotide probe species can determine whether the oligonucleotide probe species is complementary to all or part of the target nucleic acid sequence (the remaining bases being mismatched or overhanging).

In some embodiments, the occurrence of side-by-side overlap between target nucleic acids is detected, in some embodiments, by an increase in fluorescence from the DNA stain. In some embodiments, no staining agent may be used, and overlap is detected by an increase in the frequency of apparent binding sites within regions of nominally single but actually overlapping pairs of target nucleic acids. be done. For example, in some cases where diffraction-limited molecules appear to overlap optically but may not actually overlap physically, as described elsewhere in this disclosure, , super-resolved using single-molecule localization. Where end-on-end overlap occurs, in some embodiments labels at the marked ends of the target nucleic acids are used to divide the aligned target nucleic acids into a true contiguous length of single Distinguish from target nucleic acid. In some embodiments, such optical chimeras are dismissed as artifacts when many copies of the genome or target sequence are expected and only one appearance of the apparent chimera is found. In some embodiments, if the ends of the target nucleic acid (diffraction limited) appear optically overlapping, but not physically overlapping, they are resolved by the methods of the present disclosure. In some embodiments, localization is so precise that signals emitted from very close labels are resolved.

In some embodiments, sequencing is performed by imaging multiple instances of optical activity or on-off binding events at multiple locations on a single target nucleic acid that is longer than the oligonucleotide probe species. In some embodiments, the locations of instances of optical activity or probe binding events across a single target nucleic acid are determined. In some embodiments, the location of an oligonucleotide probe species instance of optical activity or binding event across a single target nucleic acid is determined by elongating the target nucleic acid, so that optical activity along the length of the target nucleic acid is determined. Different locations of instances of activity or binding events are detected and resolved.

In some embodiments, distinguishing the optical activity of the unbound oligonucleotide probe species from the oligonucleotide probe species bound to the target nucleic acid is the rejection of signal from the unbound oligonucleotide probe species or May require removal. In some such embodiments, this can be achieved at specific locations, for example, by utilizing evanescent fields or wave guidance for illumination, or by utilizing FRET pair labeling, or by utilizing photoactivation. This is accomplished by detecting oligonucleotide probe species (described, for example, in Hylkje et al., Biophys J. 2015;108(4):949-956).

In some embodiments, as shown in Figures 13A-13C, the oligonucleotide probe species may be unlabeled, but interaction with the target occurs when binding occurs or occurs (e.g., Detected using a DNA stain such as unbound intercalating dye 1302 that intercalates into the duplex and fluoresces (like intercalating dye 1304), as shown in FIGS. 13A-13C). be done. In some embodiments, one or more intercalating dyes can intercalate into a single duplex between the target nucleic acid and the oligonucleotide probe species at any time. In some embodiments, the fluorescence emitted by the intercalated intercalating dye is orders of magnitude greater than the fluorescence from free, unbound intercalating dye floating in solution. For example, the signal from intercalated YOYO-1 dye is approximately 100-fold greater than the signal from free YOYO-1 dye in solution. In some embodiments, when a lightly stained (or partially photobleached) double-stranded polynucleotide is imaged, the individual signal along the observed polynucleotide is a single intercalating dye. It can correspond to a molecule. To facilitate exchange of the YOYO-1 dye in the duplex and obtain a bright signal, in some embodiments a redox oxidation system (ROX) comprising methylviologen and ascorbic acid is provided in the binding buffer. be.

In some embodiments, sequencing on a single target nucleic acid by detecting incorporation of individual nucleotides labeled with a single dye molecule (e.g., as realized by Helicos and PacBio sequencing). ) can introduce error if the dye is not detected. In some cases, this is because the nucleotide is no longer bound to the dye, single nucleotide binding events are too short to detect, the dye is photobleached, or the cumulative signal detected by blinking of the dye is Either it is weak, the emission of the dye is too weak, or the dye enters a long dark photophysical state. In some embodiments, this is overcome in some alternative way. The first is to label the nucleotides with strong individual dyes (eg Cy3B) with favorable photophysical properties. Another example is to provide buffer conditions and additives that reduce photobleaching and dark photophysics (eg, β-mercaptoethanol, Trolox, vitamin C and its derivatives, redox systems). Another example is minimizing exposure to light (eg, having a more sensitive detector that requires shorter exposures, or providing stroboscopic illumination). Second, labeling nucleotides with nanoparticles such as quantum dots (eg, Qdot655), fluorospheres, nanodiamonds, plasmon resonance particles, light scattering particles, etc., instead of single dyes. Another example is to have many dyes per nucleotide rather than a single dye (eg, as shown in Figures 14C and 14D). In this case, multiple dyes 1414 are spaced to minimize their self-quenching (e.g., by spacing them well apart using rigid nanostructures 1412 such as DNA origami) or linearly spaced via rigid linkers. organized in

In some embodiments, the detection error rate is selected from urea in solution, ascorbic acid or salts thereof, isoascorbic acid or salts thereof, β-mercaptoethanol (BME), DTT, redox systems, or Trolox. Further reduction (and increased signal lifetime) in the presence of one or more compounds.

In some embodiments, transient binding of the probe to the target nucleic acid alone is sufficient to reduce errors due to dye photophysics. The information obtained during the exposure process is an aggregation of many on/off interactions of different labeled oligonucleotide probe species. Thus, other oligonucleotide probes that bind to the target nucleic acid even if they lack label, are too short to adequately detect a single binding event, have photobleached label, or are in the dark The labels on the species are not all devoid of label, have binding events that are too short to detect, are photobleached, or are in a dark state, thus in some embodiments will provide information on the location of their binding sites.

In some embodiments, the instance of optically active signal from the label at each transient binding event provides a light path (typically a magnification factor) covering two or more pixels of a two-dimensional imaging device. ). The point spread function (PSF) for the optically active signal case is determined and the centroid of the PSF is used as the precise location of the optically active signal case. In some embodiments, position determination is determined with sub-diffraction (eg, super-resolution) and even sub-nanometer accuracy. Position determination accuracy is inversely proportional to the number of photons collected. Therefore, the more photons emitted per second by the fluorescent label or the longer the photons are collected, the higher the accuracy.

In one example, as shown in FIGS. 10A and 10B, both the number of instances of optical activity or binding events at the binding site of each oligonucleotide probe species and the number of photons collected are achieved. Correlates with the degree of encroachment. For target nucleic acid 1002, the lowest number of binding events 1004-1 and the lowest number of photons 1008-1 recorded for the binding site correlate with the least accurate localizations 1006-1 and 1010-1, respectively. For binding sites, the degree of localization as either the number of some binding events 1004-2, 1004-3 or the number of recorded photons 1008-2, 1008-3 increases, respectively. 1006-2, 1006-3 and 1010-2, 1010-3 increase. In FIG. 10A, different numbers of detected stochastic instances of optical activity or binding events (e.g., 1004-1, 1004-2, 1004-4) of labeled oligonucleotide probe species with target nucleic acid 1002 are detected by probe (1006-1, 1006-2, 1006-3) result in different degrees of localization, with a greater number of binding events (eg, 1004-2) resulting in a higher degree of localization (eg, 1006-2 ), and a smaller number of binding events (eg, 1004-1) correlate with a lower degree of localization (eg, 1006-1). In FIG. 10B, similarly, different numbers of photons detected (eg, 1008-1, 1008-2, and 1008-3) result in different degrees of localization (1010-1, 1010-2, and 1010-3).

In alternative embodiments, the signal from the label at each transient binding event may not be projected through the optical magnification path. Alternatively, a substrate (typically an optically transparent surface on which target nucleic acid molecules may reside) is directly attached to a two-dimensional detector array. If the pixels of the detector array are small (eg, one square micron or less), a one-to-one projection of the signal on the surface of the detector may allow the bound signal to be localized with at least one micron accuracy. If the target nucleic acid is sufficiently stretched (e.g., a 2 kilobase target nucleic acid is stretched to a length of 1 micron), in some embodiments signals at 2 kilobase intervals are resolved. . For example, for a 6-base long probe, where signal is expected to occur every 4096 bases or every 2 microns, the resolution described above is sufficient to unambiguously localize individual binding sites. A signal may occur partially between two pixels and an intermediate location (e.g., if the signal is between two pixels, the resolution may be 500 nm or better for a 1 square micron pixel). ). In some embodiments, super-resolution methods are utilized for systems that have target nucleic acids in place relative to two-dimensional imaging devices. Such locations may vary depending on the type of sensor used in the two-dimensional imaging device. For example, back-thinned CCDs have an actual sensor area farther from the sensing plane of the sensor than front-illuminated CCDs, both of which can utilize nanolenses associated with each pixel. different. In some embodiments, the substrate is physically translated in the X and/or Y dimensions with respect to the two-dimensional array detector (eg, in 100 nm increments) to provide higher resolution. . In such embodiments, the device or system is smaller (or thinner) because it does not require lenses or spaces between lenses. In some embodiments, conversion of the substrate also provides direct conversion of molecular storage readouts into electronic readouts that are more compatible with existing computers and databases. In some embodiments, time-resolved fluorescence is utilized to capture fluorescence lifetimes or simply to eliminate excitation background.

In some embodiments, capture frame rates are increased and data transfer rates are increased over standard microscopy techniques to capture fast transient instances of optical activity or binding events. In some embodiments, the speed of the exposure process is increased by combining high frame rates with increased concentrations of probe. However, the maximum frame rate is adequate to reduce electronic noise compared to the acquired signal associated with each frame. The electronic noise of a 200 ms exposure is the same as a single 100 ms exposure, but is as high as the square root of 2 when comparing a single 200 ms exposure to two 100 ms exposures.

Higher speed CMOS cameras are becoming available, enabling higher speed imaging. For example, the Andor Zyla Plus allows up to 398 frames per second at 512x1024 pixels square with only a USB 3.0 connection, and when using a limited region of interest (ROI) (low pixel count) or CameraLink connection: It's even faster.

In some embodiments, systems that can achieve high speed imaging may use galvo mirrors or digital micromirrors to transmit temporally incremented images to different sensors. The correct order of the frames of the video is reconstructed by interleaving frames from different sensors according to acquisition time.

In some embodiments, the transient binding process can be sped up by adjusting various biochemical parameters such as salt concentration. There are some high frame rate cameras that can be used to match the speed of binding, often with a limited field of view to get faster readout from a subset of pixels. . In some embodiments, galvanometer mirrors are utilized to temporally distribute sequential signals to different regions of a single sensor or to separate sensors. The latter allows utilization of the full field of view of the sensor, but improves overall temporal resolution when the distributed signals are compiled.

Building a dataset of multiple binding events.
block 218; In some embodiments, the exposure and measurement process is repeated for each oligonucleotide probe species of the set of oligonucleotide probe species, thereby providing a set of multiple locations of optical activity or binding events on the test substrate, the oligo A set of positions for each respective optical activity or binding event on the test substrate corresponding to a single oligonucleotide probe species of the set of nucleotide probe species is obtained.

In some embodiments, the set of oligonucleotide probes may comprise a plurality of subsets of oligonucleotide probes, wherein for each respective subset of the species of oligonucleotide probes of the species of the plurality of subsets of oligonucleotide probes, repeat An exposure and measurement process takes place.

In some embodiments, each respective subset of oligonucleotide probe species may comprise two or more different oligonucleotide probe species from the set of oligonucleotide probe species. In some embodiments, each respective subset of oligonucleotide probe species may comprise four or more different oligonucleotide probe species from the set of oligonucleotide probe species. In some embodiments, a set of oligonucleotide probes may comprise four subsets of oligonucleotide probe species.

In some embodiments, the method divides the set of oligonucleotide probe species into a plurality of subsets of oligonucleotide probe species based on the calculated or experimentally derived melting temperature of each oligonucleotide probe species. It can further include dividing. Oligonucleotide probe species with similar melting temperatures are placed into the same subset of oligonucleotide probes by partitioning. Additionally, the temperature or duration of the exposure process is determined by the average melting temperature of the oligonucleotide probe species of the corresponding subset of oligonucleotide probe species.

In some embodiments, the method may further comprise dividing the set of oligonucleotide probes into a plurality of subsets of oligonucleotide probes based on the sequence of each oligonucleotide probe species, wherein the sequences overlap. The oligonucleotide probe species present are arranged in different subsets.

In some embodiments, repeating the exposure and measurement process is performed for each single oligonucleotide probe species of the set of oligonucleotide probe species.

In some embodiments, the exposing process is performed at a first temperature for a first oligonucleotide probe species of the set of oligonucleotide probe species, and repeating the exposing and measuring process comprises The exposing and measuring process of the oligonucleotide probe species can include performing at a second temperature.

In some embodiments, the exposure process can occur at a first temperature for a first oligonucleotide probe species of a set of oligonucleotide probe species. An instance of repeating the exposure and measurement process may include performing the exposure and measurement process for the first oligonucleotide probe species at each of a plurality of different temperatures. The method uses a first temperature of a plurality of different temperatures and the measured locations, and optionally durations, of the instances of optical activity determined by the exposure and measurement process for each temperature to generate a second It can further comprise constructing a melting curve of one oligonucleotide probe species.

In some embodiments, the test substrate is washed prior to repeating the exposure and measurement process, thereby removing one or more ions from the test substrate prior to exposing the test substrate to one or more different oligonucleotide probe species. , each oligonucleotide probe species is removed. Optionally, one or more wash solutions are substituted for the first oligonucleotide probe species and then one or more different oligonucleotide probe species are added.

In some embodiments, measuring the location of the binding event on the test substrate is adapted to identify and fit the center of each instance of optical activity within a frame of data acquired by the two-dimensional imaging device. It may involve using a function to identify and fit each instance of optical activity. The center of each instance of optical activity is considered to be the location of each instance of optical activity or binding event on the test substrate.

In some embodiments, the fitness function is a Gaussian function, first moment function, gradient-based approach, or Fourier transform. A Gaussian fit is not only an approximation of the PSF of a microscope system, but in some embodiments the addition of a spline (e.g., cubic spline) or Fourier transform approach may improve the accuracy of determining the center of the PSF. (See, eg, Babcock et al., Sci Rep. 7:552, 2017 and Zhang et al., 46:1819-1829, 2007).

In some embodiments, after completion of the measurement process, the set of optically active positions for a single nominal binding site of the oligonucleotide probe species has the determined position and the identified oligonucleotide probe species. (e.g., by the detected emission wavelength), the process can determine which oligonucleotide probe species from the set have overlapping nominal binding sites on the target nucleic acid (e.g., which , e.g., different numbers of detected photons bind to the same nanometric location within different determined tolerances for different oligonucleotide probe species). In one example, the nanometric locations are defined with an accuracy of 1 nm (+/- 0.5 nm) on the center, so the respective accuracy or tolerance for overlap of the respective PSF centroids will be binned together. . Each single defined oligonucleotide probe species is Can couple multiple times (eg, depending on the number of photons emitted and collected).

In some embodiments, the nanometric or sub-nanometric positioning is an oligonucleotide probe seed sequence of, for example, 5′-AGTCG-3′, where the first base is A and the second base is G. , the third base is T, the fourth base is C, and the fifth base is G. Such a pattern suggests a target sequence for 5'-CGACT-3'. Thus, 1024 5 base long oligonucleotide probe species with all single bases defined were applied or tested using 5 cycles using the probe coding system described above, each A cycle may comprise exposing, determining, and repeating the process, and may further comprise both addition and washing steps of the oligonucleotide probe species pool. In some embodiments, the concentration of each specific oligonucleotide probe species in the oligonucleotide [probe species pool is lower than when used alone. In some embodiments, data acquisition takes longer or more frames during the exposure process to reach a threshold number of binding events, potentially as a result of competition between different oligonucleotide probe species. is obtained. In some embodiments, higher concentrations of oligonucleotide probe species that can utilize degenerate bases or universal bases are added to oligonucleotides of the same k-base length species without degenerate or universal bases. Used as probe species. In some embodiments, the coding scheme is achieved by direct labeling of the oligonucleotide probe species, e.g., by synthesizing or conjugating a label at the 3' or 5' position of the oligonucleotide probe species. However, in some alternative embodiments, this is done by indirect labeling (eg, by attaching a flap sequence to each labeled oligo, as described herein).

In some embodiments, the location of each oligonucleotide probe species is precisely defined by determining the PSF of multiple binding events for that location, followed by partial sequence overlap (and , data from the complementary strand of the target nucleic acid in duplex form, if available). Some embodiments described herein highly rely on single-molecule localization of probe binding to one or a few nanometers.

In some embodiments, each instance of optical activity may persist over multiple frames, as measured by a two-dimensional imaging device. Measuring locations on the test substrate identifies and fits each instance of optical activity using a fitting function over multiple frames to identify the center of each instance of optical activity over multiple frames. Including. The center of each instance of optical activity is taken to be the location of each instance of optical activity on the test substrate over multiple frames. In some embodiments, the fit function may independently determine the center on each frame of the plurality of frames. In other embodiments, the fit function may be determined jointly over multiple frames to determine the center of the optically active case.

In some embodiments, the fit may be weighted by how bright the immediately neighboring (e.g., within half-pixel) localizations are if they are present in the next frame, and average them together. A step can be utilized that can assume that this is a single instance of optical activity or binding event. However, if instances of optical activity are separated by more than one frame (e.g., at least a 5-frame gap, at least a 10-frame gap, at least a 25-frame gap, at least a 50-frame gap, or at least 100 frame gaps between binding events). frame gaps), the fitting function may assume that they are different binding events. Tracking different instances of optical activity or binding events can help improve confidence in sequence assignment.

In some embodiments, the measurement process can resolve the center of each instance of optical activity to a location on the test substrate with a localization accuracy of at least 20 nm. In some embodiments, the measurement process can resolve the center of each instance of optical activity to a location on the test substrate with a location accuracy of at least 2 nm, at least 60 nm, at least 6 nm. In some embodiments, the measurement can resolve the center of each instance of optical activity to a location on the test substrate with a positioning accuracy of 2 nm to 100 nm. In some embodiments, the measurement process may resolve the center of each instance of optical activity to a location on the test substrate, where the location is a sub-diffraction limit location, and may be sub-diffraction limit accuracy. have In some embodiments, resolution is more limiting than accuracy.

In some embodiments, the measurement process may determine the location on the test substrate and, optionally, the duration of each instance of optical activity, wherein the measurement process determines the location of one or more instances of optical activity. may be determined to contain more than 5000 photons at locations. In some embodiments, the measurement process may determine the location on the test substrate and, optionally, the duration of each instance of optical activity, wherein the measurement process determines the location of one or more instances of optical activity. contains more than 50,000 photons at a location, or more than 200,000 photons at a location.

Each dye has a maximum rate (eg, 1 KHz to 1 MHz) at which it can generate photons. For example, some dyes can only measure 200,000 photons per second. The typical lifetime of the dye is 10 nanoseconds, thus emitting 100,000,000 photons per second, and when this is combined with the collection efficiency, the filtering loss in the quantum efficiency of the detector results in Orders of magnitude fewer photons per second can be detected. Thus, in some embodiments, measuring the locations on the test substrate and, optionally, the duration of each instance of optical activity is associated with greater than 1,000,000 photons can be measured.

In some cases, certain outlier sequences may bind in a non-Watson-Crick fashion, or short motifs may result in abnormally high on-rates or low off-rates. For example, some purine-polypyrimidine interactions between RNA and DNA are very strong (eg, RNA motifs such as AGG). They not only have lower off-rates, but also higher on-rates because the nucleation sequences are more stable. In some cases, binding arises from outliers that do not necessarily conform to certain known rules. In some embodiments, algorithms are used to identify such outliers or to take into account the expected value of such outliers.

In some embodiments, each instance of optical activity has a predetermined number of standard deviations (e.g., 3, 4, 5, 6, 7, 8, 9, or more than 10 standard deviations).

In some embodiments, the exposure process is performed for a first time period on a first oligonucleotide probe species of the set of oligonucleotide probe species. In some such embodiments, repeating the exposure and measurement process can include conducting the exposure process of the second oligonucleotide probe species for a second period of time. The first period of time exceeds the second period of time.

In some embodiments, the exposure process is performed for a first number of frames for a first oligonucleotide probe species of a set of oligonucleotide probe species using a two-dimensional imaging device. In some such embodiments, repeating the exposure and measurement process includes performing the exposure process for a second number of frames on the second oligonucleotide probe species using the two-dimensional imaging device. can include The first number of frames exceeds the second number of frames.

In some embodiments, one or more tiling sets of complementary oligonucleotide probe species are used to bind to each strand of a denatured double-stranded target nucleic acid. At least a portion of the target nucleic acid can be sequenced using a set of multiple locations on the test substrate, as shown in FIG. and a second tiling path 1116 corresponding to the immobilized second strand of the target nucleic acid 1112 .

In some embodiments, discontinuities in the first tiling path are resolved using corresponding portions of the second tiling path, and discontinuities in the tiling path determine the base sequence with a desired degree of confidence. What cannot be done, and resolving the discontinuity, is to determine the base sequence with the desired degree of confidence. In some embodiments, discontinuities in the first tiling path or the second tiling path are resolved using a reference array. In some embodiments, cleavage of the first or second tiling pathway corresponds to a third or fourth tiling pathway obtained from another instance of the target nucleic acid. Resolved using parts.

In some embodiments, the confidence of the sequence assignment of the target nucleic acid sequence for each binding site is increased using corresponding portions of the first tiling pathway and the second tiling pathway. In some embodiments, the confidence of the sequence assignment of the target nucleic acid sequence is increased using the corresponding portion of the third tiling pathway or fourth tiling pathway obtained from another instance of the target nucleic acid. do.

Sequence alignment or assembly.
block 222; In some embodiments, the sequence of at least a portion of the target nucleic acid is determined using a set of multiple locations on the test substrate by compiling the locations on the test substrate represented by the set of multiple locations. be done.

In some embodiments, contiguous sequences are obtained via de novo assembly. In other embodiments, reference sequences are used to facilitate assembly. If complete genome sequencing requires the synthesis of information from multiple target nucleic acid molecules spanning the same region of the genome (ideally, molecules originating from the same chromosome), the algorithm It may be necessary to process the information obtained. In some embodiments, an algorithm is utilized that can align target nucleic acid sequences based on common sequences between multiple target nucleic acid molecules, and assignments from the co-aligned molecules that cover regions of each target nucleic acid Any gaps in the molecule may be filled (eg, gaps in one target nucleic acid molecule are covered by sequence reads determined for another co-aligned target nucleic acid molecule).

In some embodiments, the shotgun assembly method (described, for example, in Schuler et al., Science 274:540-546, 1996) is applied to sequence assignments obtained as described herein. is adapted to do the assembly. An advantage of current methods over Sanger sequencing or Illumina shotgun sequencing is that large numbers of reads are pre-assembled when they are sequenced from full-length, intact target nucleic acid molecules, or very large fragments thereof. (eg, the location of reads or contigs relative to each other and the length of gaps between reads or contigs may be known). In various embodiments, reference genomes are used to facilitate assembly of long-range genomic structures, or assembly of short-range polynucleotide sequences, or both. In some embodiments, the reads are partially de novo assembled, then aligned to a reference, and then a reference support assembly is de novo assembled. In some embodiments, various reference assemblies are used to provide some guidance for genome assembly. In other embodiments, information obtained from the actual molecule (particularly if supported by more than one molecule) is weighted over any information from the reference sequence.

In some embodiments, the target nucleic acids from which sequence bits are obtained are aligned based on segments of sequence overlap between the target nucleic acids to generate longer silicocontigs and, ultimately, sequences of entire chromosomes. .

In some embodiments, the identity of a target nucleic acid is determined by the pattern of oligonucleotide probe species bound along its length. In some embodiments, the identity is that of RNA species or RNA isoforms. In some embodiments, the identity is the location of the reference sequence to which the target nucleic acid can correspond.

In some embodiments, the accuracy or precision of positioning may not be sufficient to stitch aligned bits together. In some embodiments, a subset of probes are found to bind within specific localities, but strictly speaking, it is difficult to determine sequence order from localization data with the desired degree of confidence. . In some embodiments, the resolution is diffraction limited. In some embodiments, short-range sequences within a local or diffraction-limited spot are assembled by sequence overlap of oligonucleotide probe species located within the local or spot. Thus, for example, by using information about how individual sequences of a subset of oligonucleotide probe species overlap, short-range sequences can be assembled. In some embodiments, short-range sequences constructed in this manner can then be spliced together into long-range sequences based on their order on the target nucleic acid. Long-range sequences can thus be obtained by combining short-range sequences obtained from adjacent or overlapping spots.

In some embodiments, reference sequences and sequence information obtained for complementary strands (eg, for target nucleic acids that are naturally double-stranded) are used to facilitate sequence assignment.

In some embodiments, the target nucleic acid is at least 140 bases long and the determination process can determine sequence coverage of the target nucleic acid sequence of greater than 70%. In some embodiments, the target nucleic acid is at least 140 bases long and the determination process can determine sequence coverage of the target nucleic acid sequence of greater than 90%. In some embodiments, the target nucleic acid is at least 140 bases long and the determination process can determine sequence coverage of the target nucleic acid sequence of greater than 99%. In some embodiments, the determination process may determine sequence coverage of the target nucleic acid sequence of greater than 99%.

Non-specific or inconsistent binding events.
Generally, sequencing assumes that the target nucleic acid contains nucleotides that are complementary to the bound nucleotides. However, this may not always be the case. An example of when this assumption does not hold is a join mismatch error. Nonetheless, discrepancies are useful in determining the sequence of a target nucleic acid if they occur according to known rules or behavior. The use of short oligonucleotide probe species (e.g., 5 bases long) means that the effect of a single mismatch has a large impact on stability, as one base is 20% of a 5 base length. . Thus, using appropriate conditions, short oligonucleotide probe species provide exquisite specificity. Nevertheless, discrepancies can occur, and due to the stochastic nature of molecular interactions, some of those binding durations may not be distinguishable from binding where all five bases are specific. In some embodiments, algorithms are used to make base (or sequence) calling, and assembly often takes into account the occurrence of mismatches. Many kinds of discrepancies are predictable and follow certain rules. Some of these rules are derived by theoretical considerations, others are experimentally derived (eg Maskos and Southern, Nucleic Acids Res 21(20):4663-4669, 2013, Williams et al. al., Nucleic Acids Res 22:1365-1367, 1994).

In some embodiments, the effects of non-specific binding to the surface are mitigated by such non-persistence of probe binding to non-specific sites, such that an imaging agent has non-specific binding sites (e.g., complementary target sequences). ), it can be bleached, but in some cases remains in that position, blocking further binding to that site (eg, interactions via guanine quadruplex formation). Typically, the majority of non-specific binding sites that prevent resolution of imaging agent binding to target polynucleotides are occupied and bleached during the early stages of imaging, resulting in on/off of imaging agent to polynucleotide sites. Off-coupling is then readily observed. Thus, in one embodiment, high laser power is used to first bleach probes occupying non-specific binding sites, optionally no images are taken during this step, and then optionally Briefly, the laser power is reduced and imaging is initiated to capture on and off binding to polynucleotides. Further non-specific binding after the initial non-specific binding is infrequent (because bleached probes often remain anchored to non-specific binding sites) and in some embodiments, e.g. Specific binding to the site is computationally filtered out by applying a threshold for what is considered specific binding to the site, and binding to the same site must be persistent (e.g., at the same site at least 5 times or at least 10 times should occur). Typically, about 20 specific binding events to the docking site are detected.

In other embodiments, binding that is non-specific requires that the signal of the fluorophore be correlated with the linear position of the target molecule stretched to the surface, and other signals are algorithmically removed. be. In some embodiments, the position of the target nucleic acid strand can be determined by either directly staining the target nucleic acid strand in linear duplex form or by interpolating a line through persistent binding sites. It is possible. In some embodiments, signals that do not drop out along the line are generally discarded, regardless of whether they are persistent. Similarly, in some embodiments, when a supramolecular lattice is used, binding events that do not correlate with the known structure of the lattice are discarded.

In some embodiments, multiple binding events can increase specificity. For example, rather than establishing the identity of a portion or sequence detected from a single "call", consensus can be obtained from multiple calls. Also, multiple binding events to the target moiety or target nucleic acid distinguish binding to the actual location from non-specific binding events where binding (of threshold duration) is unlikely to occur multiple times at the same location. can make it possible. It has also been observed that by measuring multiple binding events over time, the accumulation of non-specific binding events on the surface is attenuated such that subsequent non-specific binding is less likely to be detected again. be. This is likely because the non-specific binding sites may remain occupied or blocked, although the signal from non-specific binding is attenuated.

In some embodiments, sequencing is complicated by mismatches and non-specific binding on the target nucleic acid. To avoid the effects of non-specific binding or outlier events, in some embodiments the method may weight signals based on their location and duration. Weighting by location is predicted by whether probes co-localize on a stretched target nucleic acid or a supramolecular lattice (eg, a DNA origami grid), including, for example, locations within a lattice structure. Weighting by binding persistence relates to the duration of binding and frequency of binding, using weights associated with different nominal binding events or binding sites to determine the possibility of exact, partial or non-specific binding. can determine gender. The weighting established for each oligonucleotide probe species in the complete set of oligonucleotide probe species is used to determine signal fidelity.

In some embodiments, the priority is whether the signal duration exceeds a predetermined threshold, whether the signal repetition or frequency exceeds a predetermined threshold, whether the signal correlates with the location of the target molecule, and/or Or used to facilitate signal verification and base calling by determining whether the number of photons collected exceeds a predetermined threshold. In some embodiments, if the answer to any of these determinations is true, the signal is accepted as real (eg, not a mismatch or non-specific binding event). In other embodiments, exceeding one of these determinations may require the signal to be true in order to be accepted as true.

In some embodiments, mismatches are considered a second layer of sequence information, as they are distinguished by their binding patterns over time. In such embodiments, if a binding signal is determined to be mismatched by its binding properties over time, the associated sequence bits are bioinformatically trimmed to remove putative mismatched bases, and the remaining Alignment bits are used for sequencing. Because mismatches are most likely to occur at the ends of the hybridizing oligonucleotide probe species, in some embodiments, temporal binding properties are used to determine mismatches by replacing one or more bases with It can be trimmed from the end of the sequence of the oligonucleotide probe species. Decisions about which bases to trim appropriately are, in some embodiments, informed by information from other oligos that tile over the same target nucleic acid region.

In some embodiments, signals that appear to be reversible are negatively weighted because they have a probability or likelihood corresponding to non-specific signals (eg, due to attachment of fluorescent contaminants to the surface).

Blocks 302-304. In some embodiments, a method of sequencing a target nucleic acid can include a fixation process in which the target nucleic acid is bound in a linearized extended form on a test substrate, thereby forming a fixed extended nucleic acid. A target nucleic acid is attached to a test substrate according to any one of the methods described above.

Isolation of single cells on the surface and extraction of both DNA and RNA.
In some embodiments, either or both RNA and DNA can be isolated and sequenced from a single cell. In some embodiments, if the goal is to sequence DNA, RNase is allowed to react with the sample prior to initiating sequencing. In some embodiments, if the goal is to sequence RNA, DNase is allowed to react with the sample prior to initiating sequencing. In some embodiments, both cytoplasmic and nuclear nucleic acids are analyzed and they are differentially or sequentially extracted. In some embodiments, the cell membrane (not the nuclear membrane) is first disrupted to release and recover cytoplasmic nucleic acids. The associated nuclear membrane is then disrupted to liberate the nuclear nucleic acids. In some embodiments, proteins and polypeptides are recovered as part of the cytoplasmic fraction. In some embodiments, RNA is recovered as part of the cytoplasmic fraction. In some embodiments, DNA is recovered as part of the nuclear fraction. In some embodiments, the cytoplasmic and nuclear fractions are extracted together. In some embodiments, after extraction, mRNA and genomic DNA are differentially captured. For example, mRNA is captured by oligo-dT probes attached to the surface. This can occur in a first portion of the flow cell and the DNA is trapped in a second portion of the flow cell that has a hydrophobic vinylsilane coating where the ends of the DNA can be trapped (eg, presumably through hydrophobic interactions).

In some embodiments, a positively charged surface such as poly(L)lysine (PLL) (e.g., available from Microsurfaces Inc. or proprietary coated) is utilized to bind to cell membranes. known to obtain. In some embodiments, low height and/or wide flow channels (eg, less than 30 microns) are used to increase the likelihood that cells will collide with the surface. In some embodiments, the number of contacts is increased by using a herringbone or serpentine pattern on the ceiling of the flow cell to introduce turbulence. In some embodiments, cell attachment may not need to be efficient in such embodiments, as it is desirable for cells to be dispersed over the surface at low density (e.g., extract from each individual cell to ensure that there is enough space between cells so that the treated RNA and DNA can remain spatially separated). In some embodiments, both the cell membrane and the nuclear membrane are disrupted (e.g., so that the cell contents are released into the medium and trapped on the surface adjacent to the isolated cells) Cells are lysed using proteinase treatment. When immobilized, in some embodiments DNA and RNA are stretched. In some embodiments, the spreading buffer is unidirectionally flowed across the coverslip surface (eg, spreading and aligning DNA and RNA polynucleotides in the direction of fluid flow). In some embodiments, adjusting the conditions (e.g., temperature, extension buffer composition, and physical force of the flow, etc.) denatures most of the secondary/tertiary structure of the RNA, thus reducing the RNA can be made available for binding to antibodies or for sequencing. Once the RNA is extended in denatured form, it is possible to switch from the denaturation buffer to the binding buffer.

Alternatively, RNA is first extracted and immobilized by disrupting the cell membrane and inducing flow in one direction. Proteinases are then used to disrupt the nuclear envelope and induce flow in the opposite direction. In some embodiments, DNA is fragmented before or after release, eg, by using rare-cutting restriction enzymes (eg, NOT1, PMME1). This fragmentation can help dissociate the DNA, allowing individual strands to be isolated and combed. The system is configured so that the RNA and DNA extracted from each cell are not mixed and the fixed cells are well separated. In some embodiments, this is aided by transferring liquid to the gel before, after, or during cell rupture or disruption.

In some embodiments, the target nucleic acid is a double-stranded nucleic acid. In such embodiments, the method may further comprise denaturing the immobilized double-stranded target nucleic acid to a single-stranded form on the test substrate. In some embodiments, the nucleic acid is in single-stranded form or partially denatured form to proceed with sequencing, or is subjected to strand invasion or triplex forming oligonucleotide probe species. must be double-stranded when using Once the immobilized double-stranded nucleic acid is denatured, both the immobilized first strand and the immobilized second strand of nucleic acid become directly accessible. The immobilized second strand is complementary to the immobilized first strand of natural double-stranded target nucleotides.

In some embodiments, the target nucleic acid is single-stranded (eg, mRNA, lncRNA, microRNA). In some embodiments, the target nucleic acid is single-stranded RNA and does not require denaturation before sequencing methods proceed.

In some embodiments, a sample may contain single-stranded DNA polynucleotides that do not have contiguous natural complements. In some embodiments, the binding locations of each oligonucleotide probe species of a complete set of oligonucleotide probe species along the target nucleic acid are compiled, and the sequence aggregates all sequence bits according to those locations and converts them to Assembled by piecing together.

Spreading of RNA In some embodiments, spreading of nucleic acids on a charged surface is affected by the cation concentration of the solution. At low salt concentrations, RNA is single-stranded, negatively charged along its backbone, and can bind to surfaces randomly along its length.

There are multiple possible methods for denaturing and extending RNA into a linear form. In some embodiments, the tRNA is initially encouraged to assume a globular morphology (eg, by using high salt concentrations). In some such embodiments, the ends of each RNA molecule (eg, especially the polyA tail) are made accessible for interaction. In some embodiments, once the RNA is bound in spherical form, a different buffer (eg, denaturing buffer) is run through the flow cell.

In an alternative embodiment, the surface is pre-coated with oligo d(T) to capture the polyA tail of mRNA (as described, for example, in Ozsolak et al., Cell 143:1018-1029, 2010). . The polyA tail is typically a region that should be relatively free of secondary structure (eg, because they are homopolymers). Because the poly-A tail is relatively long in higher eukaryotes (250-3000 nucleotides), in some embodiments, long oligo-d(T) capture probes are designed to significantly reduce intramolecular base-pairing in RNA. Hybridization should be performed at relatively high stringency (eg, high temperature and/or salt conditions) sufficient to melt portions of . After binding, in some embodiments, transitioning the remaining RNA structures from a globular state to a linear state is not sufficient to detach the capture probe, but potentially due to fluid flow or electrophoretic forces. is achieved by using denaturing conditions that can interfere with intramolecular base-pairing of RNA.

block 310; In some embodiments, the fixed, extended target nucleic acid is exposed to a respective pool of each oligonucleotide probe species of the set of oligonucleotide probes. Each oligonucleotide probe species of the set of oligonucleotide probe species is of a given sequence and length, and the exposure is such that the individual probes of each pool of each oligonucleotide probe species are complementary to each oligonucleotide probe species. Each instance of optical activity is performed under conditions that allow transient and reversible binding to each portion of the immobilized nucleic acid that is the target, thereby giving rise to each instance of optical activity.

block 312; In some embodiments, the measurement process determines the location on the test substrate and, optionally, the duration of each respective instance of optical activity occurring during the exposure process that may utilize a two-dimensional imaging device. be.

block 314; In some embodiments, the exposure and measurement process is repeated for each oligonucleotide probe species of the set of oligonucleotide probe species, thereby obtaining a plurality of sets of locations on the test substrate, each Each set of positions corresponds to an oligonucleotide probe species of the set of oligonucleotide probe species.

block 316; In some embodiments, the sequence of at least a portion of the target nucleic acid is determined from the set of multiple locations on the test substrate by compiling the locations on the test substrate represented by the set of multiple locations.

RNA Sequencing Although RNA is typically shorter in length than genomic DNA, it is difficult to sequence RNA from one end to the other using current technology. Nevertheless, due to alternative splicing and gene isoforms, it is very important to determine the complete sequence organization of mRNA. In some embodiments, the mRNA is captured by binding its polyA tail to immobilized oligo d(T) and its secondary structure is extended to the surface by an extensional force (e.g., 400 pN super) and denaturing conditions (eg, containing formamide and/or 7M or 8M urea). This in turn allows the binding oligonucleotide probe species (eg, exon-specific) to transiently bind. Due to the short length of RNA, it is beneficial to resolve, distinguish, and locate exons using the single-molecule localization methods described herein. In some embodiments, the few binding events interspersed with the mRNA are sufficient to determine the order and identity of exons within the mRNA for a particular mRNA isoform.

Double Strand Consensus Methods for obtaining sequence information from sample molecules are as follows:
i) providing a first oligonucleotide probe species having a label with a first emission maximum wavelength, wherein the sequence of the second oligonucleotide probe species is complementary to the sequence of the first oligonucleotide probe species; providing a second oligonucleotide probe species having labels with two emission maxima;
ii) extending, fixing and denaturing the native double-stranded target nucleic acid molecule on the substrate;
iii) exposing both the first and second oligos to the denatured nucleic acid of ii while generating imaging data containing instances of optical activity;
iv) determining the binding sites of the first and second oligonucleotide probe species;
v) if the binding sites co-localize, then the position is considered correct;
vi) binding at multiple locations along the extended target nucleic acid;

In some embodiments, oligonucleotide probe species can bind transiently and reversibly. In some embodiments, the first and second oligonucleotide probe species are part of a complete set of first and second oligonucleotide probe species of a given length, and Steps ii-iii are repeated for each first and second oligo pair of the complete set to sequence the entire nucleic acid.

In some embodiments, it may be necessary to make some modifications to ensure that the two emission maxima are optically co-localized where they should be. This may include correcting for chromatic aberration either optically or using a software process. In some such embodiments, two complementary oligonucleotide probe species are exposed simultaneously, but modified oligonucleotide chemistries are used to prevent them from annealing to each other and thus preventing simultaneous binding to the target nucleic acid. used. In the case of non-self-pairing analogues, on the target nucleic acid, modification G cannot pair with modification C of the complementary oligonucleotide, but can pair with unmodified C, modification A being the complementary oligonucleotide probe species. modified T, but can match unmodified T. Thus, in such embodiments, the first and second oligonucleotide probe species are modified such that the first oligonucleotide probe species is capable of base pairing with the second oligonucleotide probe species. , thus ensuring unhindered access to the target nucleic acid and allowing spectral calibration of chromatic aberrations that may vary across the field of view. In some embodiments, spectral and spatial PSF variations can be similarly calibrated and compensated for using the same process used to calibrate and remove chromatic aberration.

In some embodiments, the first and second oligonucleotide probe species are added one after the other rather than together.

In such embodiments, when oligonucleotide probe species are added one after the other, washing steps are performed in between. In this case, the complementary oligonucleotide probe species are labeled with the same emission maximum wavelength and need not be corrected for chromatic aberration. Also, there is no possibility that two oligos will bind to each other.

In some embodiments, the target nucleic acid is exposed to additional first and second oligonucleotide probe species until the entire set of oligonucleotide probe species has been exposed.

In some embodiments, after the first oligonucleotide probe species, a second oligonucleotide probe species is added followed by another pair of oligonucleotide probe species complementary to the complete set of oligonucleotide probe species. before it is added as the next oligonucleotide probe species. In some embodiments, a second oligonucleotide probe species is not added as the next oligonucleotide probe species before other oligonucleotide probe species of the complete set of oligonucleotide probe species are added.

One example of such an embodiment includes methods for obtaining sequence information from sample target nucleic acid molecules such as:
i) extending, fixing and denaturing the double-stranded target nucleic acid molecule on the substrate;
ii) exposing the first labeled oligo to the denatured target nucleic acid of i) and detecting and recording the location of binding of the oligonucleotide probe species;
iii) removing the first labeled oligonucleotide probe species by washing;
iv) exposing a second labeled oligonucleotide probe species to the denatured target nucleic acid of i) and detecting and recording the location of binding of the oligonucleotide probe species;
v) optionally correcting for drift between the recordings of ii) and iv);
vi) If the recorded positions of binding obtained in ii-iv are co-localized, the sequence information for the sequence of the positions thus obtained is considered correct.

In some embodiments, the first and second oligonucleotide probe species are part of a complete set of oligonucleotide probe species, and the complete set of oligonucleotide probe species is used to sequence the entire target nucleic acid. Repeat steps ii-iii for the first and second oligonucleotide probe species pairs of the set.

Co-localization may indicate looking at the same sequence locus. In addition, an oligonucleotide probe species targeting the sense strand can be aimed at identifying the central base using four differentially labeled oligos and oligonucleotides targeting the antisense strand The probe species can be aimed at identifying the central base using four differentially labeled oligonucleotide probe species with complementary sequences to the oligonucleotide probe species on the sense strand. To obtain a validated base call for the central position, the sense strand data must corroborate the antisense strand data. Thus, if an oligonucleotide probe species with a central A base binds to the sense strand, a complementary oligonucleotide probe species with a central T base must bind to the antisense strand.

In some embodiments, obtaining such confirmation or consensus of the sense and antisense strands can help overcome ambiguities arising from G:T or G:U wobble base pairing. If this occurs on the sense strand, it is unlikely that a signal will be obtained on the antisense strand because C:A is less likely to base pair.

In some embodiments, modified G bases or T/U can be used in oligonucleotide probe species to prevent wobble base pair formation. In some other embodiments, the assembly algorithm is specifically directed to complementary target nucleic acid strands where there is no C:G base pair confirmation on the complementary target nucleic acid strand and where locations form A:T base pairs. The possibility of wobble base pair formation may be considered when correlated with the oligonucleotide probe species that bind. In some embodiments, 7-deazaguanisine, which has the ability to form only two hydrogen bonds instead of three, is used as a G-modification to reduce the stability of the base pairing it can form, and guanine It reduces the formation of quadruplexes and their very strong (thus forming promiscuous bonds).

Simultaneous Duplex Consensus Assembly In some embodiments, both strands of the duplex target nucleic acid are present and exposed to the oligonucleotide probe species described above while in proximity between the target strands. In some embodiments, it is not possible to distinguish from the detected transient light signal which of the two complementary strands of each oligonucleotide probe species of each set of oligonucleotide probe species has bound. Sometimes. For example, if the binding sites along each target nucleic acid strand are compiled for each of the oligonucleotide probe species of each set of oligonucleotide probe species along the target nucleic acid, then two probes of different sequence will appear at the same site. may appear to be bound to These oligonucleotide probe species should have complementary sequences, then determine which strand of each of the two oligonucleotide probe species bound, which is a prerequisite for accurately compiling the sequence of the target nucleic acid. becomes difficult to do.

In some embodiments, determining whether a single oligonucleotide probe species binding event binds to the first target nucleic acid strand or the second target nucleic acid strand is a function of the obtained optical activity data. A complete set must be considered. For example, if two tiling series of oligonucleotide probe species cover the location of interest, which of the two tiling series is selected based on which series of sequences of the oligonucleotide probe species that produce the signal overlap. A signal is assigned whether it is attributed. In some embodiments, sequences can then be assembled by first building each tiling series using the locations of joins and sequence overlaps. The two tiling series are then aligned as reverse complements, and base assignments at each location are accepted only if the sequence data for the two strands are perfect reverse complements at each of these locations ( For example, thus providing a duplex consensus sequence).

In some embodiments, sequencing discrepancies are flagged as ambiguous base calls in which one of the two possibilities must be corroborated by an additional layer of information such as an independent mismatch binding event. attached. In some embodiments, once a duplex consensus is obtained, the conventional (multimolecular) consensus is determined by comparing data from other target nucleic acids covering the same region of the genome (e.g. (if binding site information from multiple cells is available). One problem with such an approach is the possibility of different target nucleic acids containing haplotype sequences.

Alternatively, in some embodiments, an individual strand consensus is obtained followed by a duplex consensus of the individual strand consensus. In such embodiments, the sequence of each strand of a double-stranded target nucleic acid is obtained simultaneously. This is accomplished, in some embodiments, without the need for additional sample preparation steps, and such differential tagging of strands of double-stranded target nucleic acids with molecular barcodes is a feature of current NGS methods. (described, for example, in Salk et al., Proc. Natl. Acad. Sci. 109(36), 2012).

Simultaneous sequence acquisition of both sense and antisense strands is advantageous compared to 2D or 1D ^two -consensus sequencing utilized for nanopore sequencing. These alternative methods require obtaining the sequence of one strand of the duplex before obtaining the sequence of the second strand. In some embodiments, duplex consensus sequencing has an accuracy in the range of ^{10 6 ,} e.g. can provide one error in This makes the method highly compatible with the need to resolve rare variants that are indicative of cancer conditions, such as those present in cell-free DNA, or variants that are present at low frequencies in tumor cell populations.

Single Cell Resolution Sequencing In various embodiments, the method may further comprise sequencing the genome of the single cell. In some embodiments, a single cell does not contain association with other cells. In some embodiments, single cells are attached to other cells in clusters or tissues. In some embodiments, such cells are disaggregated into individual non-adherent cells.

In some embodiments, the cells are disaggregated and then fluidically transferred (e.g., by using a pipette) to the inlet of a structure (e.g., a flow cell or microwell) where the polynucleotides are elongated. . In some embodiments, disaggregation is performed by pipetting the cells, applying proteases, sonication, or physical agitation. In some embodiments, cells are fluidically transferred to a structure in which they are elongated after being disaggregated.

In some embodiments, a single cell is isolated and the target nucleic acid is released from the single cell such that all target nucleic acids from the same cell remain in close proximity to each other and are isolated from other cells. Placed in a different location than where the contents are placed. In some embodiments, Di Carlo et al. , Lab Chip 6:1445-1449, 2006, trap structures are used.

In some embodiments, a microfluidic architecture that captures and isolates multiple single cells (e.g., when the traps are spaced apart as shown in FIGS. 16A and 16B), or multiple non-isolated cells. It is possible to use any of the catching architectures (eg if the traps are continuous). In some embodiments, the trap is the size of a single cell (eg, 2-10 μM). In some embodiments, the flow cell is hundreds of microns to several millimeters long and about 30 microns deep.

In some embodiments, for example, as shown in FIG. 17, single cells are flowed into delivery channel 1702, trapped 1704, releasing polynucleotides, and then elongated. In some embodiments, the cells 1602 are lysed 1706 and then the cell nuclei are lysed through a second lysis step 1708, thus liberating extracellular and intracellular polynucleotides 1608 sequentially. Optionally, both the extranuclear and intranuclear polynucleotides are released using a single lysis step. After release, polynucleotide 1608 is immobilized and elongated along the length of flow cell 2004 . In some embodiments, traps are single cell dimensions (eg, 2 μM to 10 μM wide). In one embodiment, the trap dimensions are 4.3 μM wide at the bottom, 6 μm wide at mid-depth, and 8 μm wide, 33 μm deep at the top, and the device is made of cyclic olefin (COC) using injection molding. made from

In some embodiments, single cells are lysed into individual channels, each individual cell is reacted with a unique tag sequence via transposase-mediated integration, and the polynucleotides are then combined into the same mixture. sequenced in In some embodiments, the transposase complex is in a droplet that is transfected into a cell or fused to a droplet containing the cell.

In some embodiments, aggregates are small clusters of cells, and in some embodiments the entire cluster is tagged with the same sequencing tag. In some embodiments, the cells are not aggregated and are free floating cells such as circulating tumor cells (CTCs) or circulating fetal cells.

In single cell sequencing, there is a problem of cytosine to thymine single nucleotide variants caused by spontaneous cytosine deamination after cell lysis. This is overcome by pretreating samples with uracil N-glycosylase (UNG) prior to sequencing (see, eg, Chen et al., Mol Diagn Ther. 18(5):587-593, 2014). Have been described).

Haplotype identification.
In various embodiments, the methods described above are used to sequence haplotypes. Haplotype sequencing comprises sequencing the first target nucleic acid across the haplotypes of the diploid genome using the methods described herein. A second target nucleic acid spanning a second haplotype region of the diploid genome must also be sequenced. The first and second target nucleic acids will be obtained from different copies of homologous chromosomes. The sequences of the first and second target polynucleotides are compared, thereby determining haplotypes on the first and second target nucleic acids.

Thus, the single molecule reads and assemblies resulting from the embodiments are classified as haplotype-specific. Haplotype-specific information is not always readily available over long ranges only when assembly is intermittent. In such embodiments, lead locations are nevertheless provided. Even in this situation, analysis of multiple polynucleotides covering the same segment of the genome will computationally determine the haplotype.

In some embodiments, homologous molecules are segregated according to haplotype or parental chromosome specificity. Physically or visually in nature, the visual nature of the information obtained by the methods of the present disclosure can indicate a particular haplotype. In some embodiments, haplotype resolution allows improved genetic or ancestry studies to be performed. In other embodiments, haplotype resolution allows for better tissue typing. In some embodiments, haplotype resolution or detection of specific haplotypes allows diagnosis to be made.

Simultaneous Sequencing of Polynucleotides from Multiple Cells In various embodiments, the methods described above sequence polynucleotides from multiple cells (or nuclei), each polynucleotide carrying information about its cell of origin. used to determine

In certain embodiments, transposon-mediated sequence insertions are mediated intracellularly and each insertion contains a unique ID sequence tag as a marker of the cell of origin. In other embodiments, transposon-mediated insertion occurs within a vessel in which single cells are isolated (eg, a vessel containing agarose beads, oil-water droplets, etc.). A unique tag indicates that all polynucleotides bearing the tag must come from the same cell. All DNA and/or RNA is then extracted, mixed and elongated. When sequencing (or any other sequencing method) according to the embodiments described herein is then performed on the target nucleic acid, the ID sequence tag read indicates from which cell the target nucleic acid is derived. . In some embodiments, cell identification tags are short. For 10,000 cells (e.g., from a tumor micropsy), about 65,000 unique sequences are provided by 8-nucleotide-long identifier sequences, and about 1 million unique sequences are provided by 10-nucleotide-long identifier sequences. Provided by an array.

In some embodiments, individual cells are tagged with an identity (ID) tag. As shown in FIG. 19, in some embodiments, identity tags are incorporated into polynucleotides by tagging, and reagents are provided directly to single cells, or microencapsulated cells that are fused or encapsulated with cells. provided in droplet 1802 . Each cell receives a different ID tag (eg, from a large set of over one million possible tags). After the microdroplet and cell 1804 fuse, the ID tags are incorporated into polynucleotides within individual cells. The contents of individual cells are mixed within flow cell 2004 . Sequencing (eg, by the methods disclosed herein) then reveals from which cell a particular target nucleic acid is derived. In alternative embodiments, the microdroplet envelops the cell and delivers the tagging reagent to the cell (eg, by diffusing into the cell or bursting the cell contents into the microdroplet).

This same indexing principle applies to non-cellular (e.g., It applies to samples (from different individuals).

Furthermore, when multiple cells are sequenced, it is possible to determine the diversity and frequency of haplotypes in a cell population. In some embodiments, if the molecule is long enough, the different chromosomes, long chromosome segments, or haplotypes present in the cell population are determined without the need to hold the contents of a single cell together. Genomic heterogeneity in the population is analyzed. It does not indicate which two haplotypes exist together in a cell, but reports on the diversity of genomic structural types (or haplotypes) and their frequencies, as well as which aberrant structural variants are present. do.

In some embodiments, when the target nucleic acid is RNA and the cDNA copy is to be sequenced, adding the tag comprises cDNA synthesis using a primer containing the tag sequence. If the RNA is to be sequenced directly, the tag is added by ligating it to the 3' end of the RNA using T4 RNA ligase. An alternative method of generating tags is to extend RNA or DNA with terminal transferase with two or more nucleotides of the four A, C, G, and T bases, each individual polynucleotide , onto which a unique sequence of nucleotides is probabilistically tailed.

In some embodiments, the amount of tag sequence is kept short so that more sequence reads contribute to the sequencing of the polynucleotide sequence itself, so that the tag sequence is distributed over the site of Here, a plurality of short identifier sequences are introduced into each cell or vessel, eg three. The origin of the polynucleotide is then determined from the bits of the tag distributed along the polynucleotide. Thus, in this case, the tag bit read from one location is not sufficient to determine the cell of origin, but is sufficient to make multiple tag bit determinations.

Detection of Structural Variants In some embodiments, differences between the detected sequence and the reference genome comprise substitutions, indels, and structural polymorphisms. In particular, if the reference sequence has not been assembled by the methods of the present disclosure, typically the repeats are compressed and assembly decompresses the repeats.

In some embodiments, the orientation of a series of sequence reads along the polynucleotide reports whether an inversion event has occurred. One or more leads in the opposite direction to the other leads relative to the reference indicates a reversal.

In some embodiments, the presence of one or more reads not expected in the context of other reads in their vicinity is indicative of a rearrangement or translocation compared to the reference. The location of the read in the reference indicates which part of the genome has shifted to another part. In some cases, the read at its new location is a duplication rather than a translocation.

In some embodiments, it is also possible to detect repeat regions or copy number variations. Repeated occurrences of reads with paralogous variations or related reads are observed as multiple reads occurring at multiple locations in the genome or reads that are very similar. These multiple locations are in some cases closely packed together (as in satellite DNA) or in other cases dispersed throughout the genome (as in pseudogenes). ing. The disclosed methods apply to short tandem repeats (STR), variable number tandem repeats (VNTR), trinucleotide repeats, and the like. Absence or repetition of a specific read indicates that deletion or amplification, respectively, has occurred. In some embodiments, the methods described herein are particularly applicable when multiple and/or complex rearrangements are present in the polynucleotide. Since the methods described herein are based on analyzing single polynucleotides, in some embodiments the structural variants described above are isolated from a small number of cells (e.g., as few as 1 from a population). % cells) are resolved.

Similarly, in some embodiments, segmental duplications, ie duplicons, are correctly positioned within the genome. Segmental overlaps are typically long regions of DNA sequences (eg, greater than 1 kilobase long) of nearly identical sequence. These segmental duplications give rise to many structural polymorphisms in individual genomes, including somatic mutations. Segmental duplications can occur in distal portions of the genome. With current next-generation sequencing, it is difficult to determine which segment duplication a read originates from (thus complicating assembly). In some embodiments of the present disclosure, sequence reads are obtained over long molecules (eg, in the range of 0.1-10 megabases in length), and typically the reads are used to identify which segments of the genome become duplicons. It is possible to determine the genomic context of a duplicon by determining its flanking particular segments of the corresponding genome.

Structural variant breakpoints are precisely located in some embodiments of the present disclosure. In some embodiments, it is possible to detect the fusion of two parts of the genome and determine the exact individual read where the breakpoint occurred. Sequence reads collected as described herein contain chimeras of two fused regions, with all sequences on one side of the breakpoint corresponding to one of the fused segments and is the other of the fused segments. This increases the reliability of determining breakpoints even when the structure around the breakpoint is complex. In some embodiments, precise chromosomal breakpoint information is used in understanding disease mechanisms, detecting the occurrence of specific translocations, or diagnosing disease.

Localization of Epigenome Modifications In some embodiments, the method comprises immobilizing an immobilized double-stranded target nucleic acid or an immobilized first strand and an immobilized second strand of a native double-stranded target nucleic acid with an antibody, an affimer , a nanobody, an aptamer, or a methyl-binding protein, thereby determining modifications to the nucleic acid or correlating with the sequence of portions of the nucleic acid from a set of multiple locations on the test substrate. . Some antibodies bind double chains or single chains. Methyl-binding proteins are expected to bind double-stranded polynucleotides, as they do to chromatin.

In some embodiments, native polynucleotides do not require processing prior to presentation for sequencing. This allows the method to integrate epigenomic information with sequence information because chemical modifications of DNA remain in place. In some embodiments, the polynucleotides are well-aligned directionally, thus providing relatively easy imaging, image processing, base calling and assembly, low sequence error rates, and high coverage. Several embodiments are described for carrying out the present disclosure, each embodiment being performed in such a way that the burden of sample preparation is completely or almost completely eliminated.

Because these methods are performed on genomic DNA without amplification, in some embodiments they do not suffer from amplification bias and errors, epigenomic marks are preserved, and (e.g., orthogonal to sequence acquisition ) is detected. In some cases it is useful to determine in a sequence specific manner whether a nucleic acid is methylated. For example, one way to distinguish fetal DNA from maternal DNA is that the former is methylated at the locus of interest. This is useful for non-invasive prenatal testing (NIPT).

of carbon-5 (C5), which produces several cytosine variants in mammals, C5-methylcytosine (5-mC), C5-hydroxymethylcytosine (5-hmC), C5-formylcytosine, and C5-carboxylcytosine Multiple types of methylation are possible, including alkylation. Eukaryotes and prokaryotes also methylate adenine to N6-methyladenine (6-mA). N4-methylcytosine is also frequently found in prokaryotes.

Antibodies are available or produced against each of these modifications, as well as any others, depending on the purpose. Affimers, nanobodies or aptamers that target modifications are of particular relevance due to their potentially smaller footprint. Any reference to antibodies in the present invention should be construed to include affimers, nanobodies, aptamers and any similar reagents. In addition, other naturally occurring DNA binding proteins such as methyl proteins (MBD1, MBD2, etc.) are used in some embodiments.

In some embodiments, methylation analysis is performed orthogonally to sequencing. In some embodiments, this is done prior to sequencing. As an example, an anti-methyl C antibody or a methyl binding protein (the methyl binding domain (MBD) protein family, including MeCP2, MBD1, MBD2, and MBD4), or a peptide (based on MBD1), in some embodiments, is a polynucleotide after their location has been detected via labeling, they are removed (e.g., by adding high salt buffers, chaotrophic reagents, SDS, proteases, urea, and/or heparin). be. In some embodiments, reagents can be transiently bound by facilitating on-off binding or by using reagents that have been engineered to transiently bind. A similar approach is used for other polynucleotide modifications, such as hydroxymethylation or sites of DNA damage, for which antibodies are available or produced. After the sites of modification are detected and the modified binding reagents are removed, sequencing is initiated. In some embodiments, anti-methyl antibodies, anti-hydroxymethyl antibodies, and the like are added after the target polynucleotide is denatured to be single stranded. This method is very sensitive and can detect single modifications on long polynucleotides.

FIG. 19 shows extraction and spreading of DNA and RNA from single cells and differential labeling of DNA and RNA (eg, with antibodies against mC and m6A, respectively). Cells 1602 are immobilized on a surface and then lysed (1902). Nucleic acids 1608 released from nuclei 1604 by lysis are immobilized and elongated 1904 . The nucleic acids are then exposed to and bound by antibodies that have DNA tags 1910 and 1912 attached. In some embodiments, the tag is a fluorescent dye or an oligonucleotide docking sequence for DNA PAINT-based single-molecule localization. In some embodiments, instead of using tags and DNA PAINT, antibodies or other binding proteins are directly fluorescently labeled with either a single fluorescent label or multiple fluorescent labels. When antibodies are encoded, an example of labeling is shown in Figures 14A, 14C and 14D. In some embodiments, epimodification analysis of both DNA and RNA is coupled with their sequences using the sequencing methods described herein.

In some embodiments, in addition to detecting methylation by the binding protein, the presence of methylation at the binding site is differential when the modification is present compared to when the modification is absent at the target nucleic acid site. It is detected by the binding behavior of the oligonucleotide.

In some embodiments, bisulfite treatment is used to detect methylation. Here, after running through the complete set of oligonucleotide probe species, a bisulfite treatment is used to convert unmethylated cytosines to uracil, then the complete set of oligonucleotide probes is reapplied. If a nucleotide position reads C before bisulfite treatment and U after bisulfite treatment, it can be considered unmethylated.

There is no reference epigenome for DNA modifications such as methylation. To be useful, a methylation map of an unknown polynucleotide must be linked to a sequence-based map. Therefore, in some embodiments, the epimapping method is correlated with sequence bits obtained by oligoconjugation to provide context to the epimap. In some embodiments, other types of methylation information are also conjugated in addition to sequence reads. This includes, as non-limiting examples, nicking endonuclease-based maps, oligonucleotide probe species binding-based maps, and denaturation and denaturation-renaturation maps. In some embodiments, transient binding of one or more oligonucleotide probe species is used to map polynucleotides. Functional chromosome or chromatin to genome, in some embodiments, applies to sites of DNA damage and other features that map to the genome such as protein or ligand binding.

In this disclosure, either sequencing or epigenome sequencing is performed first. In some embodiments, both are done at the same time. For example, antibodies to particular epimodifications are in some embodiments differentially encoded from oligos. In such embodiments, conditions (eg, low salt concentration) are used that promote transient binding of both types of probes.

In some embodiments, where the polynucleotide comprises a chromosome or chromatin, antibodies are used on the chromosome or chromatin to detect modifications on DNA, and also modifications on histones (e.g., histone acetylation and methylation). do. The location of these modifications is determined by transient binding of antibodies to locations on the chromosome or chromatin. In some embodiments, antibodies are labeled with oligotags that do not bind transiently, but rather are permanently or semi-permanently anchored to their binding sites. In such embodiments, the antibody comprises an oligotag and the location of these antibody binding sites is detected using transient binding of complementary oligos to the oligos on the antibody tag.

Isolation and Analysis of Cell-Free Nucleic Acids Some of the most diagnostically accessible DNA or RNA is found extracellularly in bodily fluids or stool. Such nucleic acids are often shed by cells in the body. Cell-free DNA circulating in the blood is used for prenatal testing for trisomy 21 and other chromosomal and genomic disorders. It is also a means of detecting tumor-derived DNA and other DNA or RNA that are markers of certain pathological states. However, molecules are typically present in small segments, such as about 200 base pair long ranges in blood and even shorter ranges in urine. The copy number of a genomic region is determined by comparing the number of reads that align to a particular region of the reference relative to other parts of the genome.

In some embodiments, the methods of the present disclosure are applied to enumerate or analyze cell-free DNA sequences by two approaches. The first involves immobilizing short nucleic acids before or after denaturation. Transient binding reagents determine the identity of the nucleic acid, its copy number, whether mutations or specific SNP alleles are present, and whether the detected sequence is methylated or has other modifications (biomarkers) Used to match nucleic acids to determine whether

A second approach involves ligating small nucleic acid fragments (eg, after the cell-free nucleic acid has been isolated from a biological sample). Ligation allows extension of the combined nucleic acids. Ligation is performed by polishing the ends of the DNA and performing blunt-end ligation. Alternatively, blood or cell-free DNA is split into two aliquots, one aliquot tailed with poly-A (using terminal transferase) and the other aliquot tailed with poly-T. .

The resulting concatemers are then subjected to sequencing. The resulting "super" sequence reads are then compared to references to extract individual reads. Individual lead data is computationally extracted and then processed in the same manner as other short lead data.

In some embodiments, the biological sample comprises stool, a medium containing numerous exonucleases that degrade nucleic acids. In such embodiments, high concentrations of divalent cations (required by exonucleases to function) chelators (eg, EDTA) are used to keep the DNA sufficiently intact to permit sequencing. In some embodiments, cell-free nucleic acids are shed from cells via encapsulation in exosomes. Exosomes are isolated by ultracentrifugation or by using spin columns (Qiagen) and the DNA or RNA they contain is recovered and sequenced.

In some embodiments, methylation information is obtained from cell-free nucleic acids according to the methods described above.

Combining Sequencing Technologies In some embodiments, the methods described herein are combined with other sequencing technologies. In some embodiments, after sequencing by transient binding, sequencing by a second method is initiated on the same molecule. For example, longer and more stable oligonucleotides are bound to initiate sequencing-by-synthesis. In some embodiments, the method is used to go beyond full genome sequencing to provide a stepping stone for short read sequencing, such as that from Illumina. In this case, it is advantageous to perform Illumina library preparation by omitting the PCR amplification step in order to obtain more uniform coverage of the genome. One advantage of some of these embodiments is that the required sequencing coverage factor is halved, eg, from about 40-fold to 20-fold. In some embodiments, this is due to the addition of sequencing performed by the method and location information provided by the methods described herein. In some embodiments, the longer, more stable oligos, which are optionally optically labeled, target specific regions of interest in the genome (e.g., the BRCA1 locus) during part or all of the sequencing process. It can bind to the target (differentially labeled) to mark before or at the same time with short sequencing oligos through the .

Machine Learning Methods In some embodiments, artificial intelligence or machine learning is used when testing against a polymer (e.g., polynucleotide) of known sequence and/or determining the sequence of the polynucleotide by another method. The behavior of members of a complete set of oligonucleotide probe species is learned when cross-validated with data from . In some embodiments, the learning algorithm takes into account the complete behavior of a particular oligonucleotide probe species against one or more polynucleotide targets comprising binding sites for the oligonucleotide probe species under one or more conditions or contexts. put in. The knowledge gained from machine learning becomes more powerful as more sequencing is performed on the same or different samples. Learnings from machine learning have been applied to a variety of other assays, particularly transient binding-based emergence sequencing, as well as interactions between oligos and oligo/polynucleotides (e.g., sequencing by hybridization). determination).

In some embodiments, artificial intelligence or machine learning is used to complete short oligos (e.g., 3 bases, 4 bases, 5 bases, or 6 bases in length) to one or more polynucleotides of known sequence. It is trained by providing experimentally obtained binding pattern data for a set of bindings. The training data for each oligo includes binding locations, duration of binding, and number of binding events over a given time period. After this training, machine learning algorithms can be applied to the polynucleotides of the determined sequences and, based on their learning, assemble sequences of the polynucleotides. In some embodiments, a reference sequence is also provided to the machine learning algorithm.

In some embodiments, the sequence assembly algorithm includes both machine learning and non-machine learning elements.

In some embodiments, instead of computer algorithms learning from experimentally derived binding patterns, binding patterns are obtained via simulation. For example, in some embodiments, transient binding of a complete set of oligonucleotide probe species to a polynucleotide of known sequence is simulated. Simulations are based on models of the sequence behavior of each oligonucleotide probe species derived from experimental or published data. For example, prediction of binding stability is available according to the neighborhood method (see, eg, SantaLucia et al., Biochemistry 35, 3555-3562 (1996) and Breslauer et al., Proc. Natl. Acad. Sci. 83:3746). -3750, 1986). In some embodiments, the mismatch behavior is known (eg, G mismatch binding to A can be a stronger or stronger interaction than T to A) or is experimentally derived. Additionally, in some embodiments, unusually high binding strengths of some short subsequences of oligos (eg, GGA or ACC) are known. In some embodiments, a machine learning algorithm is trained on simulated data and then used to determine the sequence of an unknown sequence when it is matched by a complete set of short oligos.

In some embodiments, the data (location, binding duration, signal intensity, etc.) for a complete set of oligos of oligonucleotide probe species or panels is one, or tens, or hundreds, or thousands of known is plugged into a machine learning algorithm trained on an array of A machine learning algorithm is then applied to generate a data set from the problem array, and the machine learning algorithm generates an array of the unknown problem sequences. Algorithm training for the sequencing of organisms with relatively small or less complex genomes (eg, bacteria, bacteriophages, etc.) should be done for that type of organism. For organisms with larger or more complex genomes (especially genomes with repetitive DNA regions) (eg S. pombe or humans), training should be done for that type of organism. For long-range assembly of megabase fragments up to full chromosome length, in some embodiments training is performed on similar organisms so that specific aspects of the genome are represented during training. For example, the human genome is diploid and exhibits large sequence regions with segmental overlaps. Other genomes of interest, especially many agriculturally important plant species, have very complex genomes. For example, wheat and other cereals have highly polyploid genomes.

In some embodiments, the machine learning-based sequence assembly approach comprises (a) information about the binding behavior of each oligonucleotide probe species of a complete set of oligonucleotide probe species collected from one or more training datasets; (b) providing physical attachment of each oligonucleotide probe species of the complete set of oligonucleotide probe species to the target nucleic acid to be sequenced; (c) each oligonucleotide providing information regarding the binding sites for the probe species, and/or the duration of binding and/or the number of times binding occurs at each site (eg, duration of binding repeats).

In some embodiments, a particular experimental sequence is first processed by a non-machine learning algorithm. The output sequences of the first algorithm are then used to train a machine learning algorithm such that the training is performed on the actual experimentally derived sequences of the same molecule. In some embodiments, the sequence assembly algorithm comprises a Bayesian approach. In some embodiments, data derived from the methods of the present disclosure are provided to algorithms of the type described in WO2010/075570, optionally combined with other types of genomic or sequencing data. .

In some embodiments, sequences are extracted from the data in several ways. At one end of the spectrum of array assembly methods, the localization of a monomer or series of monomers is so precise (nanometric or sub-nanometric) that the sequence is obtained by simply ordering the monomer or series of monomers. At the other end of the spectrum, the data are used to rule out various hypotheses about sequence. For example, one hypothesis is that the sequences correspond to known individual genomic sequences. Algorithms determine where the data deviate from individual genomes. Another hypothesis is that the sequence corresponds to the known genomic sequence of a "normal" somatic cell. The algorithm determines where data from putative tumor cells deviate from the sequence of "normal" somatic cells.

In one embodiment of the present disclosure, one or more known target nucleic acids (e.g., lambda phage DNA or synthetic constructs comprising a supersequence comprising the complement for each oligonucleotide probe species of a complete set of oligonucleotide probe species) are A training set containing is used for tested iterative binding of each oligonucleotide probe species from the complete set of oligonucleotide probe species. Machine learning algorithms are used, in some embodiments, to determine binding and mismatch properties of oligonucleotide probe species. Thus, counterintuitively, discordant binding is viewed as a method of providing additional data and is used to assemble sequences and/or add confidence to sequences.

Sequencing Instrumentation and Devices Sequencing methods have common instrumentation requirements. Basically, the instrument must be capable of imaging and exchange of reagents. Imaging requirements include one or more groups: objective lenses, relay lenses, beam splitters, mirrors, filters, cameras or point detectors. Cameras or imaging devices include CCD, array CMOS, or avalanche photodiode array detectors. Point detectors include photomultiplier tubes (PMTs) or avalanche photodiodes (APDs). In some cases, high speed cameras are used. Other optional aspects are tailored to the type of method. For example, illumination sources (eg, lamps, LEDs, or lasers), coupling illumination to substrates (eg, prisms, waveguides, photonic nanostructures, gratings, sol-gels, lenses, movable stages, or movable objectives). , the mechanism for moving the sample in relation to the imaging device, sample mixing/stirring, temperature control, and electrical control are each independently adjusted for the different embodiments disclosed herein.

For single-molecule implementations, the illumination is e.g. prism-based total internal reflection, objective lens-based total internal reflection, plasmonic waveguides, grating-based waveguides, hydrogel-based waveguides, or at suitable angles Evanescent waveguides created by bringing laser light to the edge of the substrate can be used. In some embodiments, a waveguide includes a core layer and a first cladding layer. The lighting alternatively includes HILO lighting or light sheets. Some single-molecule instruments mitigate the effects of light scattering by using synchronization of pulsed illumination and time-gated detection. Here light scattering is gated out. In some embodiments, darkfield illumination is used. Some instruments are set up for fluorescence lifetime measurements.

In some embodiments, the instrument also includes means for extracting polynucleotides from cells, nuclei, organelles, chromosomes, and the like.

A suitable instrument for most embodiments is Illumina's Genome Analyzer IIx. The device includes a prism-based TIR, 20× dry objective, light scrambler, 532 nm and 660 nm lasers, infrared laser-based autofocus system, emission filter wheel, Photometrix CoolSnap CCD camera, temperature control, and a It consists of a syringe pump-based system. In some embodiments, the instrument can be enhanced with a combination of alternative cameras to allow better single molecule sequencing. For example, the sensor has low electronic noise, less than 2e. Also, the sensor has a large number of pixels. In some embodiments, the syringe-pump based reagent exchange system is replaced with a pressure driven flow based system. The system is used with a compatible Illumina flow cell or, in some embodiments, a custom flow cell adapted to match the actual or modified plumbing of the instrument.

Alternatively, a laser bed (laser depends on label choice) or laser system and light scrambler from a genomic analysis device, EM CCD camera (e.g. Hamamatsu ImageEM) or Scientific CMOS (e.g. Hamamatsu Orca FLASH) and A coupled motorized Nikon Ti-E microscope and, optionally, temperature control are used. In some embodiments, consumer sensors are used rather than scientific sensors. This has the potential to dramatically reduce the cost of sequencing. This is coupled with a system of pressure driven or syringe pumps and a specially designed flow cell. In some embodiments, the flow cell is made of glass or plastic, each having advantages and disadvantages. In some embodiments, the flow cell is fabricated using cyclic olefin copolymers (COC), such as TOPAS, other plastics, or PDMS, or in silicon or glass using microfabrication methods. In some embodiments, injection molding of thermoplastics provides a low cost route to industrial scale manufacturing. For some optical configurations, the thermoplastic should have good optical properties with minimal intrinsic fluorescence. Polymers containing aromatic or conjugated systems are expected to have significant intrinsic fluorescence and should ideally be excluded. Zeonor 1060R, Topas 5013, and PMMA-VSUVT (described, for example, in US Pat. No. 8,057,852) have reasonable optical properties in the green and red wavelength ranges (eg, for Cy3 and Cy5). and Zeonar 1060R has the most favorable properties. In some embodiments, thermoplastics can be bonded over large areas of microfluidic devices (eg, as reported in Sun et al., Microfluidics and Nanofluidics, 19(4), 913-922, 2015). ing). In some embodiments, the glass coverslip to which the biopolymer is attached is bonded to a thermoplastic fluidic architecture.

Alternatively, a manually operated flow cell is used on top of the microscope. This is constructed, in some embodiments, by creating a flow cell using double-sided adhesive sheets, laser-cutting channels of appropriate dimensions, and sandwiching them between a coverslip and a glass slide. be done. From one reagent change cycle to another, the flow cell may remain on the instrument/microscope until frame-to-frame alignment. In some embodiments, a motorized stage with a linear encoder is used to ensure movement of the stage when imaging large areas. The same location is revisited correctly. Fiducial markers are used to maintain correct alignment. In some embodiments, fiducial marking, such as etching of the flow cell or surface, provides immobilized beads within the flow cell that are optically detected. If the polynucleotide backbone is stained (eg, by YOYO-1), these fixed, known positions are used to align the images from one frame to the next.

In one embodiment, an illumination arrangement using laser or LED illumination (e.g., U.S. Pat. No. 7,175,811 and Ramachandran et al., Scientific Reports 3:2133) is used to perform the methods described herein. , 2013) with an optional heating mechanism and reagent exchange system. In some embodiments, a smartphone-based imaging setup (ACS Nano7:9147) is combined with an optional temperature control module and reagent exchange system. Such embodiments primarily use the phone's camera, but other aspects such as the lighting and vibration capabilities of an iPhone or other smart phone device can also be used.

20A and 20B illustrate a possible device for imaging transient probe binding as described herein using flow cell 2004 and an integrated optical layout. . Reagents are delivered in packets of reagent/buffer 2008 separated by air gaps 2022 . FIG. 20A shows an exemplary layout in which an evanescent wave 2010 is generated via coupled laser light 2014 transmitted through a prism 2016 (eg, TIRF setting). In some embodiments, the temperature of the reaction is controlled by integrated temperature control 2012 (e.g., in one example, transparent substrate 2024 is electrically coupled, thus changing the overall temperature of substrate 2024). including indium tin oxide). Reagents are delivered as a continuous stream of reagent/buffer 2008 . A grating, waveguide 2020 , or photonic structure is used to couple the laser light 2014 to produce the evanescent field 2010 . In some embodiments, temperature control comes from block 2026 covering the space.

The layout aspect described in FIG. 20A is compatible with the layout aspect described in FIG. 20B. For example, objective-style TIRF, light guide TIRF, condenser TIRF may alternatively be used. Continuous or air-gap reagent delivery is controlled by syringe pumps or pressure-driven flow in some embodiments. The air-gap method is that all reagents 2008 (eg, as illustrated in FIG. 21) are prefilled into capillaries/tubes 2102 or channels and delivered by push or pull from a syringe pump or pressure control system. enable The air-gap method allows all reagents to be prefilled into capillaries/tubes or channels and delivered by push or pull from a syringe pump or pressure control system. Air gap 2022 contains air or a gas (such as nitrogen) or a liquid that is immiscible with aqueous solutions. The air gap 2022 can be used not only for reagent delivery, but also for molecular combing. A fluidic device (e.g., fluidic container, cartridge, or chip) includes a flow cell region where polynucleotide immobilization and optionally elongation occurs, reagent storage, inlets, outlets, and polynucleotide extraction, and for shaping the evanescent field. including any structure of In some embodiments, the device is made of glass, plastic, or a hybrid of glass and plastic. In some embodiments, thermally and electrically conductive elements (eg, metal) are incorporated into glass and/or plastic components. In some embodiments, the fluid reservoir is a well. In some embodiments, the fluid reservoir is a flow cell. In some embodiments, the surface is coated with one or more chemical, biochemical (eg, BSA-biotin, streptavidin), lipid, hydrogel, or gel layers. 22 x 22 mm coverslips coated with vinylsilane (BioTechniques 45:649-658, 2008, or available from Genomic Vision) or spin-coated coverslips with 1.5% Zeonex in chlorobenzene solution were then used. do. Substrates can also be coated with 2% 3-aminopropyltriethoxysilane (APTES) or polylysine and spreading occurs via electrostatic interactions in HEPES buffer at pH 7.5-8. Alternatively, silanized coverslips spin- or dip-coated in 1-8% polyacrylamide solutions containing bis-acrylamide and TEMED. In addition to this, using vinylsilane-coated coverslips, the Cove glass was treated with 10% 3-methacryloxypropyltrimethoxysilane (Bind Silane, Pharmacia Biotech) in acetone (v/v) for 1 hour. can be coated. Polyacrylamide coatings can also be obtained as described below (Liu Q et al. Biomacromolecules, 2012, 13(4), pp 1086-1092). Some hydrogel coatings that can be used are described by Mateescu et al. Described and referenced in Membranes 2012, 2, 40-69.

A target nucleic acid can also be elongated in an agarose gel by applying an alternating current (AC) (dielectrophoresis) electric field. DNA molecules may be electrophoresed into a gel, or the DNA may be mixed with melted agarose and then set with the agarose. An AC electric field with a frequency of about 10 Hz is then applied and a field strength of 200-400 V/cm is used. Stretching can be performed at agarose gel concentrations ranging from 0.5-3%. Optionally, surfaces are coated with BSA-biotin in flow channels or wells prior to addition of streptavidin or neutravidin. The coated coverslips were used to extend the double-stranded genomic DNA by first binding the DNA in a pH 7.5 buffer and then extending the DNA in a pH 8.5 buffer. can do. In some cases, streptavidin-coated coverslips are used to capture and immobilize, but not extend, nucleic acid strands. Nucleic acids are thus bound at one end while the other end is left hanging in solution.

Instead of using various microscope-like components of an optical sequencing system such as GAIIx, in some embodiments a more integrated integrated device is constructed for sequencing. In such embodiments, the polynucleotides are attached directly onto the sensor array, or onto a substrate adjacent to the sensor array, and optionally elongated. Direct detection on sensor arrays has been demonstrated for DNA hybridization to the array (described, for example, in Lamture et al., Nucleic Acid Research 22:2121-2125, 1994). In some embodiments, the sensor is time-gated to reduce background fluorescence because Rayleigh scattering is short-lived compared to the emission from the fluorochrome.

In one embodiment, the sensor is a CMOS detector. In some embodiments, multiple emission maxima are detected (eg, as described in US Patent Application No. 2009/0194799). In some embodiments, the detector is a Foveon detector (eg, described in US Pat. No. 6,727,521). In some embodiments, the sensor array is an array of triple junction diodes (eg, described in US Pat. No. 9,105,537).

In some embodiments, reagents/buffers are delivered to the flow cell in a single dose (eg, via a blister pack). Each blister within the pack contains an oligonucleotide probe species distinct from the oligonucleotide probe species set of oligonucleotides. The first blister is punctured to expose the target nucleic acid to its contents without any mixing or contamination between oligonucleotide probe species. In some embodiments, the washing step is applied sequentially before moving to the next blister. This serves to physically separate the different sets of oligonucleotide probe species and thus reduce background noise (if oligonucleotide probe species from the previous set remain in the imaging field).

In some embodiments, sequencing is performed in the same device or integrated structure in which the cells were placed and/or the polynucleotides were extracted. In some embodiments, all reagents required to perform the method are pre-filled into the fluidic device before the analysis begins. In some embodiments, reagents (eg, probes) are present in the device in a dry state and are wetted and dissolved before the reaction proceeds.

Additional Embodiments In one broad aspect, the invention is a method of obtaining ancillary information by analyzing a repertoire of ancillary events.

In one broad aspect, the scope of the invention includes methods of identifying at least one unit of a multiunit molecule by attaching a molecular probe to one or more units of the molecule. The present invention is based on the detection of single molecule interactions between one or more types of molecular probes and molecules. In some embodiments, the probe transiently binds at least one unit of the molecule. In some embodiments, the probe is repeatedly bound to at least one unit of the molecule. In some embodiments, molecular entities are positioned on a surface or matrix to nanometric accuracy (typically less than 250 nm, preferably less than 50 nm, more preferably less than 2 nm).

In some embodiments, the invention includes methods of characterizing interactions between one or more probes and molecules, including:
adding one or more probe species to the molecule under conditions that allow the probe to transiently bind to the molecule;
continuously monitoring and recording individual binding events on the molecule with a detector over a period of time;
analyzing the data from step b to determine one or more characteristics of the interaction;
optionally, prior to step a, the molecule is immobilized on a surface or matrix. In some embodiments, the detector in c is a 2D or detector and binding events are located on a surface or matrix with nanometer accuracy, for example using single molecule localization algorithms. It is determined. In some embodiments, the feature is the duration of each event corresponding to the affinity between the probe and the molecule. In some embodiments, the feature is a location on a surface or matrix.

In some embodiments, the invention includes methods of identifying or characterizing units of chemical structure of heterogeneous macromolecules, wherein multiple probes are attached to identify chemical structures at multiple sites of the macromolecule. including
a) adding one or more probe species to the macromolecule under conditions that allow the probe to bind to the macromolecule;
b) continuously monitoring and recording binding events on the macromolecule with a detector over a period of time;
c) analyzing the data from step b to identify chemical structures at multiple sites of the macromolecule.

Optionally, the macromolecule is immobilized on a surface or matrix prior to step a. In some embodiments, the macromolecule comprises a supramolecular structure. In some embodiments, each of the one or more probes transiently binds to a macromolecule. In some embodiments, each of the plurality of probes is repeatedly attached to the polymer.

In some embodiments, the molecular entity is a polymer containing at least 5 units. In some embodiments, binding probes are molecular probes, including oligonucleotides, antibodies, binding proteins, small molecules, and the like. Typically, polymers comprise polynucleotides or polypeptides.

In some embodiments, the invention includes a method of identifying or characterizing units of chemical structure of a heterogeneous polymer, wherein multiple probes are attached to identify chemical structures at multiple sites along the polymer. including
a) adding one or more probe species to the polymer under conditions that allow the probe to bind to the polymer;
b) continuously monitoring and recording binding events on the polymer with a detector over a period of time;
c) analyzing the data from step b to identify chemical structures at multiple sites along the polymer.

In some embodiments, the polymer is immobilized on a surface or matrix prior to step a. In some embodiments, the polymer is modified prior to step a. In some embodiments, each of the one or more probes is transiently attached to the polymer. In some embodiments, each of the plurality of probes is repeatedly attached to the polymer. In some embodiments, the location of probe binding that identifies units of chemical structure is determined with nanometric (and optionally sub-nanometric) accuracy/precision (e.g., using single-molecule localization algorithms). ), whereby the "sequence" is determined based on the identity of the probes that bind to each location.

In some embodiments, the positioning accuracy and precision is high (sub-nanometer or few nanometers) and the location and order of each array bit is unambiguously determined. However, sequence reads appear in a discontinuous, intermittent manner. Where most sequencing methods read sequences sequentially from beginning to end, in the present invention the acquisition of sequence information is stochastically distributed. When all sequence data have been collected, the sequence is assembled by ordering the bits of sequence information obtained according to their spatial location, with each sequence bit preceded by the information obtained for, for example, 5 bases in length. and must overlap with the next localized alignment bit, each alignment bit overlapping on one end with 4 bases of the previous alignment bit and on the other end with 4 bases of the next alignment bit There is a need. If this is not preserved exactly (e.g. only 3 overlaps instead of 4) then the alignment bits are likely obtained due to mismatches or may be slightly misaligned. There is A novel aspect of the present invention is that this internal checking mechanism should be able to resolve the correct ordering of alignment bits, and thus resolve alignment with a high degree of confidence.

In some embodiments, the duration of each cycle of probe addition is configured such that a certain number of binding events can be collected for each complementary binding site. The number of binding events is on average 5, 10, 20, etc. In some embodiments, the duration of each cycle of probe addition is configured such that a certain number of photons can be collected for each complementary binding site. The higher the number of photons collected for each bond, the better the degree (accuracy) and precision of localization that can be achieved. In some embodiments, different probes or probe sets have different durations. Thus, some probes can be positioned with high accuracy and other probes can be positioned with lower accuracy. In some embodiments, highly localized positions can be used to anchor sequence assembly, and poorly localized positions are computationally assembled by overlapping sequences. . In some embodiments, the localized positions (including those that are not well localized) can be used in assembly algorithms such as those using de Brownian graphs.

In some embodiments, probes are labeled. The term label encompasses a single detectable entity (eg, wavelength emitting entity) or multiple detectable entities. In some embodiments, the multiple detectable entities may comprise codes, thereby distinguishing between probe species. In some embodiments, probes are labeled with fluorophores or particles. Fluorescent labels can emit fluorescence at different wavelengths and have different lifetimes. In some embodiments, background fluorescence is removed by rejecting early timeframes of fluorescence due to scatter. If the label is at one end of the probe (eg, the 3' end of an oligo probe), 1 nm accuracy corresponds to the 3' end of the probe sequence and the 5' end of the target sequence.

In some embodiments, sequencing of a polymer is based on measuring its transient interaction with a repertoire of probes (eg, interaction with a repertoire of polynucleotides and oligonucleotides). In some embodiments, the repertoire includes all oligonucleotides of a given length or set of given lengths.

In some embodiments, the invention comprises a method of sequencing nucleotide bases and/or modifications on a single target polynucleotide,
a) immobilizing the polynucleotide on a surface or matrix and optionally extending the polynucleotide;
b) optionally, denaturing the polynucleotide to the extent that at least a portion of the polynucleotide is available for binding to the probe;
c) adding one or more probe species under conditions that allow the probe to transiently bind to the polynucleotide;
d) continuously monitoring and recording binding events on the polynucleotide with a detector over a period of time;
e) removing the probe of b;
f) repeating steps b-d, each time with a different one or more probe species, until binding of the complete repertoire of probes has been monitored;
g) compiling data from each iteration of step c to reconstruct the sequence of modifications and/or bases.

In some embodiments, polymer sequencing is the result of emergent properties of transient binding interactions of a repertoire of probe species. The binding of one probe is not sufficient to sequence a polymer and a complete repertoire of oligomers is required (eg, in the case of polynucleotides, a repertoire of oligonucleotides). Information about the location of oligo binding, temporally distant binding to overlapping sites, mismatched partial binding, frequency of binding, and duration of binding all contribute to the construction of robust sequences. In the case of elongated or stretched polynucleotides, the location of probe binding along the length of the polynucleotide contributes to the construction of robust sequences. Also, in the case of double-stranded DNA, the sequence emerges from sequencing both strands of the duplex simultaneously.

In some embodiments of the above, the attachment of probes to modifications on repeating units of the polymer (nucleotides in the polynucleotide) is performed prior to the optional denaturation step of b. In some embodiments, the optional b denaturation step is not performed and the probe addresses double-stranded structure. In some cases, the probe recognizes the sequence of the duplex through strand invasion (e.g., using PNA probes), through induction of excessive duplex fluctuation, or through a modified zinc finger protein. or by using Cas9 or a similar protein that melts the duplex (e.g., by allowing guide RNA sequences to bind) (the guide RNA may contain a reference probe sequence, and the repertoire of A gRNA containing each sequence is provided), which binds to the individual strands of the duplex.

The above caveat is that in some embodiments, a particular probe may, e.g. sequences), interactions with other probes of the repertoire, or interactions with polynucleotides (e.g., known stochastic and promiscuous binding), which may be omitted from the repertoire, but the sequences of the present invention Enough probes remain to make a decision. In fact, the minimum number of useful probes can be determined for each type of sequence under analysis. Another caveat concerns the fact that half of the complete repertoire is fully complementary to other oligos in the repertoire. In some embodiments, these complementary pairs (and other pairs in question due to substantial complementarity) are guaranteed not to be added to the polynucleotide at the same time. In some embodiments, when both sense and antisense strands of double-stranded DNA are present, sequencing is performed with only one member of a complementary pair, and The sequence information obtained from both is combined to generate the sequence.

In some embodiments, the reference sequence and sequence information obtained for the complementary strand (of the naturally double-stranded target) can be used to facilitate assignment of sequences at particular locations.

In some embodiments of the invention, sequencing comprises the following steps (shown for 5 base sequencing):
a) spreading/elongating the double stranded DNA on the surface,
b) denaturing the double stranded DNA leaving the remaining pair of complementary strands in situ on the surface;
c) A complete repertoire of short oligos (e.g., 3, 4, 5, 6 bases long) is attached to a pair of DNA strands and the attachment site of each oligo is aligned along the linear length of the pair of strands. and
d) constructing two tiling paths of oligos representing the complement to each of the two strands using the attachment sites and sequence overlap between the oligos;
e) Comparing the reverse complement sequences of the two strands and making base assignments from a "duplex consensus" (both strands confirm assignments, indicating base call ambiguity if no confirmation is found). ), including

Problems can arise when there are discontinuities in the tiling pathway, eg, in the case of 5 base sequencing, when there are no oligo bonds in stretches greater than 5 bases in length. In this case, one or more approaches can be taken: the base assignments follow the sequence obtained from the complementary strand of the duplex, if available; or follow a reference sequence (in which case the bases may be annotated to indicate that they are artificially transplanted from the reference).

In some embodiments, artificial intelligence or machine learning is used when testing against polymers (e.g., polynucleotides) of known sequence and/or comparing the sequences of polynucleotides with data from another method. When cross-validating, the behavior of the members of the repertoire is learned. A learning algorithm takes into account the complete behavior of a particular probe against one or more polynucleotide targets, including the binding site of the probe, under one or more conditions or contexts. The knowledge gained from machine learning becomes more powerful as more sequencing is performed on the same or different samples. Learnings from machine learning can be applied to a variety of other assays, particularly transient binding-based emergence sequencing and interaction between oligos and oligo/polynucleotides, in addition to other embodiments of the invention. It can be applied in assays involving action, such as sequencing by hybridization.

In some embodiments, artificial intelligence or machine learning is used to complete short oligos (e.g., 3 bases, 4 bases, 5 bases, or 6 bases in length) to one or more polynucleotides of known sequence. It is trained by providing experimentally obtained binding pattern data for the binding of a diverse repertoire. The training data for each oligo includes binding locations, duration of binding, and number of binding events over a given time period. After this training, machine learning algorithms can be applied to the polynucleotides of the determined sequences and, based on their learning, assemble sequences of the polynucleotides. A reference sequence can also be provided to a machine learning algorithm.

In some embodiments, the sequence assembly algorithm includes both machine learning and non-machine learning elements.

In some embodiments, the sequence assembly algorithm comprises a Bayesian approach. In some embodiments, data derived from the methods of the invention can be provided to algorithms of the type described in (WO2010075570), optionally other types of genomic or sequencing data. can be combined with

In some embodiments, instead of computer algorithms learning from experimentally derived binding patterns, binding patterns are obtained via simulation. For example, transient binding of oligos in the repertoire to polynucleotides of known sequence can be simulated, the simulation being based on models of the behavior of each oligo derived from experimental or published data. be able to. For example, prediction of binding stability can be performed using the nearest neighbor method [SantaLucia et al. Biochemistry 35, 3555-3562 (1996), Breslauer et al. Proc. Natl. Acad. Sci. USA, 83:3746-3750 (1986)], and although the mismatch behavior is known or can be derived experimentally, short subsequences of some of the oligos (e.g. GGA to ACC ) are known to have unusually high bond strengths. A machine learning algorithm can be trained on simulated data and then used to determine the sequence of an unknown sequence when it is matched against the complete repertoire of short oligos.

In some embodiments, the data (location, binding duration, signal intensity, etc.) for a repertoire or panel of oligos are trained on one or more, preferably (tens, hundreds, or thousands) of known sequences. It is plugged into the machine learning algorithms that have been developed.

A machine learning algorithm is then applied to generate a data set from the problem array, and the machine learning algorithm generates an array of the unknown problem sequences. Algorithms for sequencing lower organisms such as bacteria, bacteriophages, etc. need to be trained for that type of organism. S. For higher organisms, starting from yeast such as pombe to humans or wheat with repetitive DNA, they need to be trained to higher organisms. For long-range assembly of megabase fragments up to full chromosome length, training may need to be performed on similar organisms so that specific aspects of the genome are represented during training. For example, the human genome is diploid and has many segmental duplications. Wheat is polyploid.

In some embodiments, the machine learning-based sequence reconstruction approach comprises:
a) providing information about the binding behavior of each oligo of the repertoire collected from one or more training datasets, and an assembly algorithm capable of using such information;
b) Each oligo of the repertoire is physically attached to the polynucleotide to be sequenced, and for each oligo the location of attachment and/or the duration of attachment and/or the number of times attachment occurs at each location (number of iterations of attachment). providing information about the lifetime);
c) reconstructing the sequence of the polynucleotide using an assembly algorithm using the training data set.

For the human genome, a good ground rule genome would be NA12878. NA12878 has been extensively characterized by various sequencing, haplotyping and structural mapping methods, and its assembly is the most reliable of any human genome. Nonetheless, the ground truth datasets available for such genomes may not be perfect, as so far there is no perfect technology that can give a true representation of complex genomes. , and machine learning algorithms may need to take into account alternative 'true values' or 'means' or 'consensus'. True values are pre-constructed from assemblies using different technologies (eg, 10×Genomics, Bionanogenomics, PacBio, ONT) in combination with Illumina sequencing.

In some embodiments, a particular experimental sequence is first processed by a non-machine learning algorithm. The output sequences of the first algorithm are then used to train a machine learning algorithm such that the training is performed on the actual experimentally derived sequences of the same molecule. An advantage of machine learning algorithms is that they can be implemented faster than other algorithms.

In some embodiments, the invention includes a method of identifying or ordering units of chemical structure of a heterogeneous polymer, wherein multiple probes are attached to identify chemical structures at multiple sites along the polymer. Including. Multiple sites of interest are closer than can be resolved by diffraction-limited optical imaging, but are resolved because their detection is separated in time. The binding of chemical structure identifying probes is optionally determined with nanometric/sub-nanometric localization accuracy/precision, thereby determining the spatial order of the chemical structure, the "sequence."

In further embodiments, the plurality of polymers characterized or sequenced are closer than is resolvable by diffraction-limited optical imaging, but the location of probe binding along their length is nanometric. are resolved because they are locally localized.

In some embodiments, the invention includes a method of identifying or ordering units of chemical structure of a heterogeneous polymer, stretching the polymer to identify chemical structures at multiple sites along the polymer; and binding a plurality of probes. The multiple sites are closer than can be resolved by diffraction-limited optical imaging, but are resolved because the polymers are stretched and/or their labels are separated in time. The location of binding of the probes that identify each chemical structure is determined with nanometric precision, thereby determining the spatial order of the chemical structure, the "sequence."

In some embodiments, the invention includes methods of analyzing base sequences on target polynucleotides. In some embodiments, the invention includes methods for analyzing nucleotide modifications or DNA damage as well as base sequences on target polynucleotides. In some embodiments, the invention includes methods of analyzing the organization of sequences on a target polynucleotide.

The term "transient binding" means that the binding reagent or probe does not normally remain bound to its binding site during the course of the analysis, typically binding one reagent on and off and then , binding of the same or different reagents on and off, etc. Repeated binding means that the same binding site is bound multiple times by the same binding reagent or probe, or the same type of binding reagent or probe, during the course of an assay, typically with one reagent binding on and off. , then the binding of another reagent is turned on and off, and so on. In some embodiments, binding interactions are observed continuously over a period of time.

In some embodiments, repeated binding increases the sensitivity and accuracy of the information obtained. Because the signal, once detected, may be too low to be called out above background, and is called out when seen persistently, increased sensitivity increases confidence that the signal is genuine. Increase. The information of multiple reads increases the accuracy because one read is confirmed by another read (similarly, reading on both strands allows one read to be confirmed by another read).

In some embodiments, the mechanism of the method involves binding of the probe molecule to the target molecule. Such binding events are short-lived or transient, and many such binding events occur repeatedly at the same and/or partially overlapping locations. The location, frequency, dwell time and photon emission of such binding events are recorded and processed computationally.

In some embodiments, transient binding is performed in buffers containing small amounts of divalent cations but no monovalent cations (eg, 5 mM Tris-HCl, 10 mM MgCl2, 1 mM EDTA, 0.05% Tween-20, pH 8).

Polynucleotide sequencing therefore involves the following steps:
a) immobilizing the polynucleotide;
b) binding the repertoire or sub-repertoire of oligos to the polynucleotide in a reaction buffer containing less than 1 nM, less than 5 nM, 10 nM, or 15 nM magnesium chloride;
c) detecting transient binding;
d) optionally repeating b through c.

Assembly of Polynucleotide Sequences In some embodiments, the solid substrate to which molecules are immobilized is glass, silicon, silicon dioxide, silicon nitride, metals (e.g., gold), polydimethoxysilane (PDMS), polymers (e.g., cyclic olefins, Zeonex, polymethyl methacrylate, polystyrene). In some embodiments, the solid surface is coated with, for example, polyvinylsilane. In some embodiments, the polymer is extended onto the polyvinyl coating surface by molecular combing and then crosslinked to the surface by exposure to ultraviolet light or elevated temperature.

In some embodiments, the invention involves determining the binding location of each member of the repertoire to an elongated polymer that forms multiple interactions with the surface or matrix. In some embodiments, the binding sites are determined by detecting repetitive, transient on-off probe binding events. The binding sites may overlap but do not significantly interfere with each other's binding, as their binding tends to be separated in time. If the probe binds for a longer period of time, binding of one blocks binding of the other.

In some embodiments, the repertoire is the complete repertoire (eg, of all oligos of a given length). In some embodiments it is a tiling series of oligoprobes. In some embodiments it is a panel of oligoprobes. For certain applications in synthetic biology, such as DNA data storage, sequencing may involve finding the order of particular blocks of sequences, designed to encode data.

In some embodiments, the mechanism of the method involves binding of the probe molecule to the target molecule, such binding being detectable by a label, the label turning off and/or on its emission or photoswitching. , and many such binding events may occur repeatedly at the same location and/or at one or more partially overlapping locations. The location and duration of such binding events are recorded and processed. In some embodiments, the apparent transient, variable, or blinking behavior of the label is due to the label being attached to the probe and the probe binding and dissociating from the target.

In some embodiments, the target-binding probe is not directly labeled. In some such embodiments, the probe comprises a "flap", an entity that functions as a receptor for binding of a second entity. Two entities may comprise a molecular binding pair. Such binding pairs may include nucleic acid binding pairs. In some embodiments, the flap comprises a series of oligo or polynucleotide sequences that bind to labeled oligonucleotides (oligos), such binding being the process of imaging transient binding of the portion of the probe that binds to the target. is substantially stable during the process of In some embodiments, the target comprises a polynucleotide sequence and the binding portion of the probe is e.g. contains one or more degenerate or universal positions, and optionally a nucleotide spacer (eg, one or more T nucleotides), or an abasic or non-nucleotide portion, and a flap portion. Such flap portions are unmodified in sequence, are designed to be, for example, 20 bases long or longer, are stable in sequence, and are preferably linked to the target polynucleotide in order to retain stability during the imaging process. It is not found often.

In some embodiments, a repertoire of probes is applied to the target. In some embodiments, each of the probes of the repertoire, or a subset of the probes of the repertoire, are applied one after the other. That is, one or a subset of bindings is first detected and then removed, followed by the next added, detected and removed, and then the next. The data are then processed to give the nanometric or sub-nanometric position of each probe binding event for each specific probe. In some embodiments, the sequence is assembled using the binding order and/or location of each probe specificity.

In some embodiments, all or a subset of the conjugated probes of the repertoire are added simultaneously, each conjugated probe is tethered to a label that fully or partially encodes its identity, and the code of each conjugated probe is Decoded by detection.

In some embodiments, the flaps on the probe are modular and may contain binding sites for different oligos, such oligos having different labels to encode the identity of the probe portion of the oligo. used.

In some embodiments, nucleic acid targets are attached to a surface or matrix. In some such embodiments, one end of the target is attached to the surface or matrix, while the remainder of the target is non-interacting. In some embodiments, targets are captured on an ordered supramolecular scaffold (eg, a DNA origami structure). In some embodiments, the scaffold structure starts free in solution to take advantage of solution phase kinetics to capture target molecules. Once occupied, the scaffolds anchor or self-assemble to the surface, locking down to form large DNA lattices, with individual smaller scaffolds locking into each other. They then present highly ordered nanostructure arrays for the sequencing step of the invention.

In some embodiments, the method prioritizes signals based on their location and duration to avoid the effects of non-specific binding or outlier events. For example, probes are prioritized by location based on whether they co-localize on an extended polymer or supramolecular lattice (eg, DNA origami grid) that includes locations within the lattice structure. Prioritization by binding persistence relates to the duration of binding and frequency of binding, and a priority list is used to determine the likelihood of exact, partial, or non-specific binding. This priority is established for each bound probe in a panel or repertoire and used to determine the fidelity of the signal. Priorities are used by the algorithm of the present invention to facilitate signal verification and base calling. In some embodiments, the algorithm is
1. Is signal duration>threshold? If yes, accept as real.
2. Is signal repetition/frequency>threshold? If yes, accept as real.
3. Whether the signal correlates with a pattern (grid or line). If yes, accept as real.

Otherwise, discard the data for this signal. As an alternative to 1 and 2, the algorithm can ask if the number of photons collected>threshold.

Also, signals that do not appear to be reversible may correspond to non-specific signals (eg, attachment of fluorescent contaminants to surfaces) and thus may be discarded or weighted in the assembly algorithm.

In some embodiments, the invention includes methods of sequencing nucleotide modifications and/or bases on a single target polynucleotide:
Immobilizing and linearizing a polynucleotide to a surface;
adding one or more labeled probe species under conditions that allow the probe to transiently bind and probe binding to target sites to be distinguished from probe binding to non-target sites;
continuously imaging the polynucleotide with a 2D detector and recording the pixel coordinates of probe binding until a threshold number of binding events at each location has been accumulated (depending on the precision of localization desired);
removing the probe of b;
repeating steps b through d, each time using a different one or more probe species;
Each of step c. compiling data from replicates and correlating nanometric localization sites with probe species identities (e.g., specific oligonucleotide sequences or specific antibodies);
Determining the order (sequence) of the binding species, determining the sequence identity (and modification state) associated with each sub-nanometric or nanometric location, and determining nucleotide modifications and/or base sequences over the length of the polynucleotide. compiling and detecting any gaps across the length of the polynucleotide.

In some embodiments, prior to step g, an additional step is performed, in which, in determining whether the binding event is a perfect match, mismatch, or pseudo-binding, , the duration and/or lifetime for its respective binding site, and, if the target is a denatured duplex, which probes have bound to adjacent sites and complementary strands.

In some embodiments, step h can be added to determine the correlation between one type of binding target (eg, antigen) and another type of binding target (eg, sequence).

In some embodiments, the probe of step b is removed by reagent exchange. Optionally, the probes are first replaced with one or more wash solutions and then the next set of probes is added.

In some embodiments, in step c, imaging (of on-off binding events) is performed for a period long enough to likely accumulate a threshold number of binding events.

In some embodiments, the method continuously images the polynucleotide on a 2D detector until it is likely that a threshold number of binding events at each location has accumulated, and probe binding pixel coordinates including recording

In some embodiments, the duration of the imaging duration depends on the required positioning accuracy (eg, nanometric or sub-nanometric accuracy). Imaging may need to be performed for a long time to obtain sub-10 nM or sub-nanometric localization. In some embodiments, the imaging duration depends on the degree of confidence required as to which short stretch of sequence (array bit) is bound to which probe. Longer runs increase confidence in correct matches and computationally filter out pseudo-joins or non-matching joins.

In some embodiments, target polynucleotides of the invention are immobilized. In some embodiments, immobilization is on a structural support (eg, flat surface, cell matrix). In some embodiments, target polynucleotides are placed in fluidic containers such as wells or flow cells.

In some embodiments, immobilization and linearization of double-stranded genomic DNA and preparation of transient binding on surfaces include:
a) molecular combing,
b) UV crosslinking,
c) optional wetting;
d) denaturation, including exposure to chemical denaturants, alkaline solutions, DMSO, etc.;
e) exposure to an acidic solution after optional washing;
f) optional preconditioning buffer.

In some embodiments, the polymer is a short polynucleotide, less than 1 Kbp or less than 300 bp. In some embodiments, short polynucleotides are in the 100-200 base range, as found in cell-free DNA in body fluids such as urine and blood. In some embodiments, polynucleotides are bound or captured to a surface, preferably by one of the two termini. In some embodiments, polynucleotides are sequentially captured in a nanostructured lattice. The lattice consists of supramolecular structures such as can be formed with DNA origami. The trapping sites can be arranged with a pitch of 10 nm in a regular 2D grid. Such a lattice can trap 1 trillion molecules per cm2 at full occupancy.

In some embodiments, the polymer is linear. In some embodiments, linearization provides the polymer along a wavy or tortuous path on the surface. In other embodiments, the polymer is elongated and linear. In some embodiments, linear polymers are aligned in a single direction. In some embodiments, the polymer is unstretched and may form a tortuous path through 2D or 3D space. The latter is the case when applying the method to intracellular biopolymers.

In some embodiments, the polynucleotides are randomly arranged on the surface or matrix. In some embodiments, the polynucleotides are arranged in an ordered manner. In some embodiments, the polynucleotide is displayed as a DNA curtain [Greene and coworkers, US2008/0274905A1]. In such embodiments, transient binding is recorded while a DNA strand attached at one end is stretched by flow or electrophoretic forces, or after both ends of the strand are captured. In some embodiments, capture at one or both ends results from binding or ligation to spatially addressable oligos on the surface or interface from which the curtain extends. In some embodiments, the lipid surface coating used in the DNA curtain minimizes surface binding and background. In some embodiments, many copies of the same sequence form multiple polynucleotides of the DNA curtain, and the sequence is not from one polynucleotide, but from an aggregate binding pattern from multiple polynucleotides. Assembled.

For long polynucleotides, as demonstrated for DNA curtains (Greene and co-workers), the ordered method is to individually attach one end of each long polynucleotide to a pad in an ordered array of pads. with different polynucleotide ends occupying each pad. In some embodiments, both ends of the polynucleotide are attached to pads and each end is attached to a different pad. Two pads to which a single linear polynucleotide binds hold the stretched configuration of the polynucleotide in place, and an ordered array of equally spaced, non-overlapping or non-interacting polynucleotides. It can play a role in making it possible to form an array. In some embodiments, only one polynucleotide can occupy each pad. In some embodiments, the Poisson process occupies the pad. Some pads are not occupied by polynucleotides, some are occupied by one, some by more than one.

In some embodiments of the invention, for sequencing DNA extracted from a plurality of cells, a substantial number of which are of the same cell type (and expected to contain substantially the same sequences), the sequences are: Assembled from aggregate binding patterns from multiple polynucleotides rather than from a single polynucleotide.

In some embodiments, polynucleotides are removed from their natural environment (eg, cells, tissues, biological fluids) and immobilized on a surface. In some embodiments, the polynucleotides remain in their cellular or tissue environment. In some embodiments, cells or tissues are fixed. In some embodiments, the polynucleotides are cross-linked intracellularly.

In some embodiments, the polynucleotide is single-stranded (eg, mRNA, lncRNA, microRNA). In some embodiments, the polynucleotide is double-stranded. In some embodiments, the polynucleotide is denatured. In some embodiments, denaturation includes one or more reagents from 0.5 M or 1 M NaOH, DMSO (eg, 60%), formamide (10-90%), urea (7-8 M), and the like. Chemical denaturation. In some embodiments, denaturation is heat denaturation at 85° C. or higher. In some embodiments, the denaturation is through enzymatic denaturation, such as through the use of helicase or other enzymes with helicase activity. In some embodiments, polynucleotides are denatured through interaction with surfaces or by physical processes such as stretching beyond a critical length. In some embodiments, denaturation is complete or partial.

In some embodiments, an array of polynucleotides is immobilized on a surface, and in some embodiments, the polynucleotides of the array are sufficiently separated to be individually resolved. In some embodiments, the polynucleotides of the array are not far enough apart to be individually resolved. In some embodiments, the polynucleotides of the array are individually resolved by super-resolution. In some embodiments, the polynucleotide is elongated parallel to the surface. In some embodiments, the polynucleotide is elongated at an oblique angle to the surface. In some embodiments, detection via a 2D detector is processed via single-molecule localization algorithm software (eg, Thunderstorm, a plugin for Fiji/ImageJ, or https://github. Picasso available for download at com/jungmannlab/picasso). In some embodiments, the polynucleotide is elongated perpendicular to the surface. Detection of the coordinates of the labels is done via spinning disk confocal microscopy, light sheet microscopy, 3D super-resolution microscopy, or 3D single molecule localization microscopy, or other 3D imaging approaches.

In the methods of the invention, probes (from multiple copies of a particular species) transiently bind to polynucleotide target sites in a specific manner (eg, Watson-Crick base pairing, antibody-antigen binding). and the Cartesian coordinates and the duration of the transient binding are recorded. In some embodiments, homogeneous probes transiently and repeatedly bind to target sites. In some embodiments, one probe species is removed and another probe species is added. In some embodiments, this is repeated until a repertoire of probes (eg, a complete repertoire), tiling series, or panel has been tested. In some embodiments, the location of binding for each probe species is recorded. In some embodiments, the recording is within a few tens of nanometers, within a few nanometers, or even sub-nanometers ( Angstroms) are processed to give nanometric localization accuracy (ie, xy and, in some embodiments, z coordinates) of the bond. In some embodiments, one oligoprobe species or repertoire or panel of oligoprobe sequences is provided, and one or a repertoire of binding agents (e.g., proteins) capable of binding to sites of nucleic acid modification or damage is also provided. can be

In some embodiments, one or more physical properties of the label on the probe are also recorded. Different probe species are labeled with labels that contain different physical properties, including brightness (absorption, quantum yield), wavelength, lifetime, and polarization. In some embodiments, the physical property is any other physical property that can be measured at the single molecule or single particle level. In some embodiments, the plurality of labeling entities comprises labels.

In some embodiments, transient binding is for a few seconds or several seconds. In some embodiments, transient binding can range from 10 microseconds to tens of seconds. In some embodiments, the transient binding is 1 millisecond to 1 second in duration. In some embodiments, the transient binding is 10 microseconds to 1 millisecond.

The present invention is performed on single (individual) molecules (e.g., polymers) such that the method has the potential for exquisite sensitivity and can resolve diversity in heterogeneous molecular populations. . Also, the processing of sample molecules suffers from its concomitant loss (e.g., ligation is so inefficient that unmatched molecules are effectively lost by ligation) and the introduction of artifacts (e.g., replication during PCR). Sensitivity is also positively affected by the fact that the present invention does not require processing of sample molecules (with errors).

Multiple binding events increase sensitivity, more photons are accumulated, and multiple independent binding events increase the probability that the actual signal is detected. Multiple binding events also increase specificity, as consensus can be drawn from multiple calls rather than establishing the identity of a portion or sequence detected in a single "call". . Also, multiple binding events to a target moiety or sequence may be useful to distinguish binding to a real location from non-specific binding events where binding (of threshold duration) is unlikely to occur multiple times at the same location. to enable. Also, by measuring multiple binding events over time, it is observed that the accumulation of non-specific binding events on the surface diminishes, after which non-specific binding is rarely detected again. This is likely because the non-specific binding sites remain occupied or blocked, although the signal from non-specific binding is bleached. Therefore, since the early frames of the movie can be clipped, no great effort is required to passivate the surface to minimize non-specific binding.

In some embodiments, the signal from the label at each transient binding event is projected through an optical path (typically providing magnification) that covers more than one pixel of the 2D detector. Plot the point spread function (PSF) of the signal and take the centroid of the PSF as the exact location of the signal. This position determination can be performed with sub-nanometer accuracy. Since the accuracy of localization is inversely proportional to the number of photons collected, the more photons emitted per second or the longer photons are collected, the higher the accuracy. To achieve high accuracy and precision, it is necessary to minimize sample drift relative to the 2D detector or implement effective means for drift correction. In some embodiments, the drift correction approach includes fiducial markers on the surface that can be used to reference correct drift. DNA origami with multiple specific binding sites is a very effective fiducial marker when accuracy needs to be increased to a few nanometers or sub-nanometers.

In an alternative embodiment of the invention, the signal from the label at each transient binding event is not projected through the optical magnification path, but rather the substrate, typically an optically transparent substrate on which the target molecule resides. A surface is directly bonded to the 2D detector array. Then, if the detector array pixels are small (e.g., 1 micron or less), a 1:1 projection of the signal on the surface will allow the binding signal to be located with an accuracy of at least 1 micron. . For stretched DNA, for example, a length of 2 kbp corresponds to 1 micron and signals 2 kilobases apart can be resolved. This resolution is sufficient if a 6 base long probe is expected to produce a signal every 4096 bases, ie every 2 microns. Also, a signal that fits partially between two pixels provides an intermediate location, so the resolution of a 1 micron pixel is 500 nm. Of course, in an actual natural polynucleotide sequence, the signal would be expected to occur closer to and farther than every 4096 bases. However, in some novel applications such as DNA storage, polynucleotide constructs can be designed to accommodate signals, for example, every 2 Kb. The advantage of this approach is that the device is simpler and more stable. Also, the substrate can be translated relative to the 2D array detector by, for example, 100 nm to give higher resolution. One advantage of this embodiment is that no lenses are required, so the device can be smaller (or thinner) and spaces can be created between the lenses. Direct conversion of molecular storage readouts to electronic readouts that are more compatible with existing computers and databases can also be provided.

In some embodiments, multiple conditions are used that promote transient binding. In some embodiments, one condition is used for one probe species according to its Tm, another condition is used for another probe species according to its Tm, etc. It is used for the entire repertoire, eg for each 5 base long species from a possible 1024 repertoire of 5 base lengths. In some embodiments, only 512 non-complementary 5-base lengths are provided because both target polynucleotide strands are present in the sample. In some embodiments, each probe addition comprises a mixture of probes containing 5 specific bases and 2 degenerate bases (thus 16 heptamers), resulting in a single probe for the ability to match sequences. All labeled with the same label that functions as a pentamer, degenerate bases add stability without increasing the complexity of the probe set.

In some embodiments, identical conditions are provided for multiple probes sharing the same or similar Tm. Each probe in the repertoire may contain a different coded label (or the label by which it is identified). In such cases, after holding the temperature through several probe exchanges, the temperature is increased for the next series of probes sharing the same or similar Tm.

In some embodiments, Tm is calculated by, for example, nearest neighbor parameters. In other embodiments, Tm is empirically derived. For example, the optimal TM or TM range is derived by constructing a melting curve (eg, measuring the degree of melting due to absorption over a range of temperatures). In some embodiments, probe set compositions are designed according to their theoretically matched Tm's verified by empirical testing. In some embodiments, the binding is performed at a temperature substantially below Tm, eg, 33 degrees below Tm. In some embodiments, the optimal temperature for distinguishing mismatches from perfect matches is determined empirically by generating melting curves using short synthetic targets containing perfect matches and mismatches at various locations. be judged. In some embodiments, the empirically determined optimum temperature for each oligo is used for binding each oligo in sequencing.

In some embodiments, the concentration of oligos used is adjusted according to the AT to GC content of the oligo sequences. Higher concentrations of oligos are provided for oligos with higher GC content. In some embodiments, buffers containing chaotropic reagents such as CTAB, betaine, or tetramethylammonium chloride (TMACl) at concentrations of 2.5-4 M are used that equalize the effects of base composition.

The longer the oligo length used, the more likely it is to act as an efficient probe for palindromic or folded sequences affecting the oligo. Efficiency can be substantially improved by shortening the length of such oligos by removing one or more degenerate bases. In this case, the binding stability of the oligos can be enhanced by using specific stabilizing base modifications or oligo-conjugates. For this reason, the use of shorter reference sequences (eg, 4 bases long) has advantages. In some embodiments, fully modified 3-base or 4-base lengths (eg, LNA) can be used.

In some embodiments, the entire repertoire is added together. In some such embodiments, buffers that equalize the effects of base composition (eg, TMACl or guanidinium thiocyanate) are used. In some embodiments, probe species with the same or similar Tms are added together. In some embodiments, probe species that are added together are differentially labeled. In some embodiments, the co-added probe species are not differentially labeled. In some embodiments, differential labels are labels with emissions having, for example, different luminosities, lifetimes, or wavelengths, and combinations of such physical properties.

In some embodiments, the differential labels are encoded, eg, they are DNA origami or DNA nanostructure-based codes. In some embodiments, coding arms are added to probes that contain a combination of labels that identify the probe. For example, to encode a library of all possible 5 base long oligonucleotide probes, the arm has 5 sites, each site corresponding to each of the 5 nucleobases of 5 base lengths, and the 5 Each of the moieties can bind to five distinct species. For example, a fluorophore with a particular peak emission wavelength can correspond to each of the positions (e.g., 500 nm for position 1, 550 nm for position 2, 600 nm for position 3, 650 nm for position 4, and 700 nm for position 5), Four fluorophores of the same wavelength but with different fluorescence lifetimes can encode each of the four bases at each position.

In some embodiments, probes are encoded in a manner in which the label reports only one nucleotide at a particular position of the oligonucleotide. Subsets of the repertoire (sub-repertoires) can be added simultaneously. A four-color coding scheme can be used in which at each cycle one of the base positions of the oligo is defined and the others are degenerate.

All oligos where A, C, T, and G are defined are each labeled with a specific fluorophore specific for that defined base. After binding, detecting and removing a sub-repertoire of oligos in which the first base is defined and the rest are degenerate, of similar composition but encoded by a label in the second position ( A sub-repertoire of probes is added, followed by the third, fourth, and fifth respectively.

The first cycle, set 1: 4 colors represent the 4 bases at position 1.

The second cycle, set 2: 4 colors represents the 4 bases at position 2.

The third cycle, set 3: 4 colors represents the 4 bases at position 3.

The fourth cycle, set 4: 4 colors represents the 4 bases at position 4.

The 5th cycle, set 5: 4 colors represents the 4 bases at position 5.

The entire repertoire can be exhausted in 5 cycles.

In some embodiments, less than 4, eg, only 1 color is used throughout the process. In this case, each cycle is divided into four subcycles, in each of which one of the four bases at a position (e.g. position 1) is added separately before the next base is added, Each time the probe has the same label. In this embodiment, the entire repertoire can be exhausted in 20 cycles.

After data processing, single-molecule localization was performed for probes from sets 1-5 that have the same footprint on the polynucleotide (i.e., bind to the same nanometric location) (by detected color ) can be identified. For example, nanometric locations are defined with an accuracy of 1 nm centers (+/-0.5 nm). Therefore, all probes whose PSF centroids are within the same 1 nm are binned together. Each single-base-defined oligo-species is bound multiple times (depending on the number of photons emitted and collected) to enable precise localization down to nanometric (or sub-nanometric) centroids. can do. Thus, nano-sub-nanometric or sub-nanometric positioning is, for example, for an oligo sequence of 5′AGTCG3′, the first base is A, the second base is G, the third base is T, the fourth base is is a C, and the fifth base is a T, which would suggest a target sequence of 5'CGACT3'. Thus, 1024 oligo probes with every single base defined can be run through or tested in as little as 5 cycles (including oligo addition and washing), which covers the entire sequence space of 5 bases long. . In some embodiments, the concentration of each oligo in the set is used at a lower concentration than when it is used alone, in which case data acquisition takes longer to reach the threshold number of binding events. It is also possible to use higher concentrations of degenerate oligos than specific oligos. This coding scheme can be done by directly labeling the probe, for example by synthesizing or conjugating a label at the 3' or 5' of the oligo. However, it can also be done by indirect labeling. For example, by binding the probe sequence to the "flap" sequence (sequence not intended for binding interaction) to which the labeled oligo is bound, the identity of the bases encoded in the sequencing portion of the probe Gender can be specified. In this scheme, only four different types of labels are needed, since only four bases need to be distinguished. Since if only 1 base is encoded, the synthesis of the oligo library only needs to synthesize 20 different oligos, each containing 1 defined base and 4 other degenerate bases, Inexpensive. It is preferred to use manual mixing during automated synthesis of degenerate positions so that concentrations can be adjusted for reactivity during synthesis.

Each oligo location is precisely defined by determining the PSF of multiple events for that location and then supported by partial sequence overlap from offset events. This embodiment is highly dependent on single-molecule localization of probe binding to nanometric or sub-nanometric precision.

In some embodiments, contributions from all four bases are equalized. This can be done by using reagents that either suppress the stability of the GC pair or increase the stability of AT. Such reagents include betaine, TMA, and various other reagents. Alternatively, nucleotide analogues, modifications, and N-positions can be used to equalize the Tm of the probe. Therefore, to obtain a Tm equal to G, a T analogue with increased stability is used.

In some embodiments, the concentrations of the four partially degenerate oligo pools are each adjusted to compensate for differences in stability of single encoded bases according to their Tm. This can only be a partial compensation, since the adjustment of density by Tm does not apply to degenerate positions.

In some embodiments, the probes of the probes of the repertoire are encoded. In some embodiments, for example, the entire set of 1024 5 bases is encoded. In some embodiments, encoding comprises attaching a particular sequence unit (eg, a flap sequence) to one end of the 5-base length used for sequence matching. Each unit of coding sequence serves as a docking site for a separate fluorescently labeled probe, with fluorescently labeled oligos hybridized on the flap. To encode a 5 base probe sequence, the flap on the probe contains 5 different binding sites, eg, each site is a different DNA base sequence tandemly linked to the next site. For example, the first position on the flap is adjacent to the probe sequence (the portion that binds to the polynucleotide target), the second position is adjacent to the first position, and so on. Prior to using the probe flaps in sequencing, each probe flap is attached to a set of fluorescently labeled oligos to generate a unique ID tag for the probe sequence. This can be done by using 4 different label oligo sequences complementary to each position on the flap, requiring a total of 16 different labels.

In some embodiments, units corresponding to the order of the base sequence, such as the first base of the sequence is encoded by the first unit of the flap and the second base is encoded by the second unit. are coded in the order A separate fluorescent label is then docked (through complementary base pairing) to each unit. For example, the first position is for wavelengths 500-530 nm, the second position is for wavelengths 550-580 nm, the third position is 600-630 nm, the fourth position is 650-680 nm, the fifth position is for wavelengths 550-580 nm. The position may emit at 700-730 nm. The identity of the base at each location can then be encoded, for example, by the fluorescence lifetime of the label. For example, the label corresponding to A has a longer lifetime than C, which has a longer lifetime than G, and G has a longer lifetime than T.

A at position 1 emits at 500-530 nm and has the longest lifetime, G at position 3 emits at 600-630 nm and has the third longest lifetime, and so on.

In some such embodiments, the method of sequencing a polynucleotide comprises
a) providing a coded set of oligos, said coding comprising modular multi-unit sequences, with pre-bound different labeled probes for each unit;
b) transiently and repeatedly binding the repertoire to polynucleotides to localize each type of different signal;
c) using the recorded binding sites to reconstruct the sequence of the polynucleotide and decoding the identity of each probe.

In some embodiments, only four different oligonucleotide sub-repertoires are used, eg, only the central bases of 5 bases in length are defined and the rest are degenerate. A mismatch at the central position of the oligonucleotide is expected to be the most labile, and conditions can be set up such that there is an absolute need for the central base to bind and not form a mismatch. Temporary binding ensures that more or less all sites are covered by oligonucleotide binding, after which when positioning is performed to high levels (e.g., sub-nanometer), sequences of polynucleotides are centered. can be assembled by simply splicing together the base-by-base information provided by the oligos encoded in the . Each of the central bases A, C, G, T can be encoded by four different distinguishable fluorophores, eg, Atto488, Cy3B, Atto655, Alexa700.

In practice, it is preferable to determine the optimal concentration (and reaction conditions and temperature) by iteratively adjusting the concentration, reaction conditions, and temperature of each pool in sequencing polynucleotides of known sequence, and varying Concentrations/conditions that give the most accurate sequence for any representative polynucleotide can be considered optimal.

In some embodiments, the invention is a method for sequencing a polynucleotide comprising:
a) immobilizing the polynucleotide;
b) a library/repertoire of oligonucleotides where one position (bases A, C, G, T) of the oligos is designated (X) and encoded by a label, the rest being degenerate bases (N) adding;
c) imaging the repeated binding of each labeled oligo to the polynucleotide and nanometrically localizing the binding sites and identities of specific bases;
d) adding a library/repertoire of labeled oligonucleotides for the second position, nanometrically localizing the binding sites and identities of specific bases, the third, fourth and fifth positions, etc. Do the same for
e) assembling the sequence at each location according to which base label is persistently and transiently bound at each location of the oligonucleotide repertoire;
f) assembling the sequence of the polynucleotides by taking into account sequence overlap between the binding sites and adjacent sites.

This embodiment of the invention benefits from a nanometric localization accuracy of less than 2.5 nm, or less than 1 nm, or less than 0.34 nm, allowing the location of a particular base in a probe oligonucleotide to be compared to another base in the same neighborhood. of the probe-oligonucleotide binding from the specific base location.

In some embodiments, some of the probes of the repertoire are encoded. In some embodiments, for example, the entire set of 1024 5 bases is encoded. In some embodiments, encoding comprises attaching a particular sequence unit (eg, a flap sequence) to one end of the 5-base length used for sequence matching. Each unit of coding sequence serves as a docking site for a separate fluorescently labeled probe species with fluorescently labeled oligos hybridized on the flap. To encode a 5 base probe sequence, the flap on the probe contains 5 different binding sites, eg, each site is a different DNA base sequence tandemly linked to the next site. For example, the first position on the flap is adjacent to the probe sequence (the portion that binds to the polynucleotide target), the second position is adjacent to the first position, and so on. Prior to using the probe flaps in sequencing, each probe flap is attached to a set of fluorescently labeled oligos to generate a unique ID tag for the probe sequence. This can be done by using 4 different label oligo sequences complementary to each position on the flap, requiring a total of 16 different labels.

In some embodiments, units corresponding to the order of the base sequence, such as the first base of the sequence is encoded by the first unit of the flap and the second base is encoded by the second unit. are coded in the order A separate fluorescent label is then docked (through complementary base pairing) to each unit. For example, the first position is at wavelengths 500-530 nm, the second position is at wavelengths 550-580 nm, the third position is at 600-630 nm, the fourth position is at 650-680 nm, the fifth position is at wavelengths 550-580 nm. The position may emit at 700-730 nm. The identity of the base at each location can then be encoded, for example, by the fluorescence lifetime of the label. For example, the label corresponding to A has a longer lifetime than C, which has a longer lifetime than G, and G has a longer lifetime than T.

A at position 1 emits at 500-530 nm and has the longest lifetime, G at position 3 emits at 600-630 nm and has the third longest lifetime, and so on.

In some such embodiments, the method of sequencing a polynucleotide comprises
a) providing a coded set of oligos, said coding comprising modular multi-unit sequences, with pre-bound different labeled probes for each unit;
b) transiently and repeatedly binding the repertoire to polynucleotides to localize each type of different signal;
c) using the recorded binding sites to reconstruct the sequence of the polynucleotide and decoding the identity of each probe.

The advantage of this approach is that every individual oligo does not have to be synthesized individually, but simply made by adding a mixture of nucleotides during the synthesis cycle.

The degree of discrimination that a particular nucleotide in an oligo can provide depends on its position in the oligo. Mismatches are expected to be worst tolerated in the middle of the 5-base length, and better tolerated away from the middle. Therefore, assigning the correct sequence identity from data from a single binding event can sometimes be difficult, but multiple events for the site and flanking sites (overlaps, offsets) can support the sequence.

In some cases, the duration of binding may not be exact, reproducible, or correspond to what is expected. However, in some embodiments, the sequence selects the probe with the longest average binding duration to that location by examining the binding duration of all probes from the complete repertoire that bind to that location. can be assigned by doing so. Applied to the data set, except in the case of knowledge of mismatched binding or unusually high binding of non-Watson-Crick base-pairing probes, in some embodiments the oligo with the longest binding duration is , are considered to correspond to sequences in the polynucleotide.

In some embodiments, more than 5 cycles are performed as the oligos are divided into sets according to their melting temperature. Approximately 20 sets are sufficient to represent a 5 base long Tm repertoire (excluding outliers). In some embodiments, Tm contributions of A or T=2 and G or C=4 are used to calculate Tm. In other cases, the nearest neighbor parameters (eg by Breslauer) are used to calculate Tm. In other cases, the Tm of each oligo is determined empirically. At each given temperature, when one of the complements is bound to the surface and the other is labeled and in solution is determined empirically via obtaining a melting curve or analyzing the binding of the oligo-complements. determined by

In some embodiments, the same temperature is used for all oligo attachments and the Tm is adjusted by adjusting the concentration of oligos. Higher concentrations are used for less stable oligos and lower concentrations for more stable oligos. The concentration of each oligo is determined empirically or theoretically. In some embodiments, a single temperature is used, but the length or chemical composition of the oligonucleotide is varied.

In some embodiments, conditions are first found for short oligo probes to efficiently discriminate between matches and mismatches. Short probes have very fast kinetics and can accumulate many transient binding events in a short period of time (eg, less than a second, seconds, or a minute or two). Rate limiting steps can be reagent exchange and temperature adjustment. Binding is imaged without drying, thereby allowing the use of optimal equilibrium reaction conditions for each probe.

In general, sequencing assumes that the target polynucleotide contains nucleotides that are complementary to the nucleotides bound, and binding mismatch errors are an example of when this assumption does not hold. Nonetheless, discrepancies can be useful in determining the sequence of a target if they occur according to known rules or behavior. The use of short oligonucleotides (eg, 5 bases long) means that the effect of a single mismatch has a large impact on stability, since one base is 20% of a 5 base length. Thus, under appropriate conditions, exquisite specificity can be obtained with short oligoprobes. Nevertheless, discrepancies can occur, and due to the stochastic nature of molecular interactions, the duration of their binding may in some cases be indistinguishable from binding in which all five bases are specific. be. However, the algorithms used to perform base (or sequence) calling and assembly can take into account the occurrence of discrepancies. Many kinds of discrepancies are predictable and follow certain rules. Some of these rules can be derived by theoretical considerations, others are experimentally derived (see, for example, Maskos and Southern Nucleic Acids Res, Williams et al Nucleic Acids Res 22:13651367 (1994 )).

In one embodiment of the invention, a training set comprising one or more known target polynucleotides (e.g., lambda phage DNA or a synthetic construct comprising a supersequence comprising the complement to each oligo of the repertoire) is generated from each oligo from the repertoire. Used to test repeat binding of oligonucleotides. Machine learning algorithms can be used to determine binding and mismatch properties of oligo probes. Thus, counter-intuitively, discordant binding can be viewed as a method of providing additional data and can be used to assemble sequences and/or add confidence to sequences.

Certain outlier sequences may bind in a non-Watson-Crick fashion, or short motifs may result in abnormally high on-rates or low off-rates. For example, purine-polypyrimidine interactions between RNA and DNA can be very strong (eg RNA motifs such as agg). They not only have lower off-rates, but also higher on-rates by providing a more stable nucleation sequence. Sometimes binding arises from outliers that do not necessarily conform to certain known rules. Algorithms can be designed to identify such outliers or to take into account the expected value of such outliers.

When double-stranded DNA (e.g., native human genomic DNA) is immobilized, one oligo (antisense) from the set of 1024 binds to one strand (sense) and the other oligo (sense). binds to the other strand (antisense). Even after denaturation, it may not be possible to readily distinguish which strand a particular oligo is attached to, sense or antisense.

It may not be immediately distinguishable to which denatured strand one of the probes binds. However, the full sequencing data set allows this to be revealed, as overlapping sequences of oligo-bonds are found to be nanometrically located on one side or the other (see Figure 7).

A surprising advantage of the two strands remaining co-located is that the independent matching of base sequence assignments based on complementary target sites allows for very high accuracy. The authenticity of the binding of one specific oligo to one strand is established by the binding of its complement to the co-located other strand within a few or several nanometers of the surface. can do.

In some embodiments, oligonucleotide probes with 6 defined bases are used and the complete repertoire contains 4096 sequences. In some embodiments, oligonucleotide probes with 5 defined bases are used and the complete repertoire contains 1024 sequences. In some embodiments, 5 or 6 bases are defined and additional universal bases or degenerate positions are included in the length of the oligonucleotide.

Non-specific binding typically binds for a shorter period of time than specific probes and thus can be computationally distinguished during data processing. For example, under certain conditions binding events shorter than 10 ms are considered non-specific.

The probe on-rate can be manipulated (increased) by increasing probe concentration, increasing temperature, increasing molecular crowding (including PEG400, PEG800, etc.). Decreasing the thermal stability of the probes by manipulating the chemical moieties, adding destabilizing appendages or, in the case of oligonucleotides, increasing the off-rates by shortening their length can be done. The off-rate can also be accelerated by increasing temperature, decreasing salt concentration (increasing severity), and moving pH closer to the extremes of the scale.

Increasing the on-rate by increasing the concentration of the probe can be problematic as background fluorescence from the probe in solution can become significant. Single-molecule detection at a surface relies on lowering the background signal such that the signal bound to the surface is detected above background.

In some embodiments, the concentration of probe used can be increased by rendering the probe essentially non-fluorescent until it binds. One way to do this is for binding to trigger a photoactivation event. Another example is that the probe is fluorogenic. Another example is to quench the label until binding occurs (eg molecular beacons). Another example is detecting a signal as a result of an energy transfer event (eg, FRET, CRET, BRET). In one embodiment, the surface biopolymer carries the donor and the probe carries the acceptor, or vice versa. In another embodiment, the intercalating dye is provided in solution and there is a FRET interaction between the intercalating dye and the probe when the labeled probe binds. The intercalating dye may be the acceptor with the label on the donor and the probe, or vice versa. For example, the intercalating dye can be 1000-10,000-fold dilution of YOYO-1 or 100-10,000-fold dilution of Evagreen from stock, and the label on the probe can be ATTO655. In another embodiment, the intercalating dye is used without the FRET mechanism, both the single-stranded target and probe sequences on the surface are unlabeled, and the signal is that the intercalating dye is intercalated upon binding. detected only when a double-strand is produced. Intercalating dyes, when not intercalated into DNA and free in solution, can be 100-fold or 1000-fold less bright, depending on their identity. Combining this with TIRF or HILO microscopy eliminates any background signal from intercalating dyes in solution.

In some embodiments, the invention comprises a method of sequencing nucleotide modifications and/or bases on a single target polynucleotide,
i) immobilizing the polynucleotide on a surface or matrix;
ii) one or more probe species can be transiently bound by the probe to the polynucleotide, resulting in a change in one or more fluorescent (or other detectable) signals detected from the polynucleotide; under the conditions of adding
iii) continuously monitoring one or more signals from the polynucleotide with a detector and recording binding events over a period of time;
iv) removing the probe of b;
v) repeating steps ii-iv using one or more different probe species each time;
vi) compiling the data from each iteration of step iii to reconstruct the sequence of modifications and/or bases.

In certain embodiments, the methods of the invention can operate on arrays of polynucleotides. In some embodiments, the array of target polynucleotides is immobilized so that multiple polynucleotides can be viewed in a single field of view.

In some embodiments, the target polynucleotide is elongated or stretched so that chemical features (sequences, lesions, modifications) can be seen along its length. In some embodiments, a single very long target polynucleotide is immobilized so that substantially all of its length can be viewed in a single field of view (Frietag et al).

In some embodiments, the fluid reservoir is a well. In some embodiments, the fluid reservoir is a flow cell. In some embodiments, the surface is coated with one or more chemical, biochemical (eg, BSA-biotin, streptavidin), lipid, hydrogel, or gel layers.

In some embodiments, native polynucleotides do not require processing prior to presentation for sequencing. This allows the method to integrate epigenomic information with sequence information because chemical modifications of DNA remain in place. Preferably, the polynucleotides are well-aligned directionally so that imaging, image processing, base calling and assembly are relatively easy, sequence error rates are low, and coverage is high. Several means have been described for carrying out the invention, each of which is done in such a way that the burden of sample preparation is completely or almost completely eliminated.

The present invention is intuitive because it allows one million or more substantially contiguous bases of genomic DNA to be sequenced by performing reagent addition cycles orders of magnitude fewer than the number of bases in the genomic DNA. On the contrary, it is surprising. The methods of the invention are based, in part, on the discovery that single target polynucleotide molecules can be sequenced by detecting transient binding of probes to them. Thus, in various aspects and embodiments, the present invention provides for obtaining long strand lengths of polynucleotides and arranging the polynucleotides in a linear fashion so that locations along the length of the polynucleotide can be traced. including doing and

In some embodiments, the full length or nearly full length of the polynucleotide comprises contiguous reads with a negligible number of gaps. This provides long-range genomic structure, even through repetitive regions of the genome, and also allows individual haplotypes to be resolved. This method can provide highly complete sequences from one or a few cells.

In some embodiments, contiguous sequences are obtained through de novo assembly using an algorithm. In some cases, locations with a high percentage of overlapping alignment bits are obtained experimentally, so the task of the algorithm is relatively simple. However, reference sequences can also be used to facilitate assembly if difficulties exist in increasing confidence. Some of the algorithms that process information from multiple polynucleotides have been used to resolve individual haplotypes covering very large distances.

Sequences can be extracted from the data in several ways. At one end of the spectrum of sequence reconstruction methods, the localization of a monomer or series of monomers is so precise (nanometric or sub-nanometric) that one only needs to order a monomer or series of monomers to obtain the sequence. At the other end of the spectrum, the data are used to rule out various hypotheses about sequence. For example, one hypothesis is that the sequences correspond to known individual genomic sequences. Algorithms determine where the data deviate from individual genomes. Another hypothesis is that the sequence corresponds to the known genomic sequence of a "normal" somatic cell. The algorithm determines where data from putative tumor cells deviate from the sequence of "normal" somatic cells. Variations across the spectrum of these approaches can be implemented.

Thus, in some embodiments, the assembly of unknown sequences is
a) providing a reference genome;
b) determining in silico the theoretical binding pattern to the repertoire of oligos of the reference genome;
c) comparing actual data in silico with theoretical references;
d) determining in silico the difference between the actual data and the theoretical reference;
e) altering/reconstructing the reference sequence according to the differences found in d to generate an assembly of hitherto unknown sequences.

In some embodiments, differences include substitutions, indels, and structural polymorphisms. In particular, if the reference sequence has not been assembled by the method of the invention, repeats are compressed and reconstruction uncompresses.

In some embodiments, genomic DNA is obtained from multiple cells and the data can be integrated between multiple molecules. Each of the plurality of molecules partially overlaps with at least another of the plurality of molecules, which are aligned by matching common probe binding patterns. Each partially overlapping molecule shares a set of sequences with the other molecule. Once the alignment is computationally performed, sequences unique to each molecule are used to fill gaps, resulting in a fully or substantially contiguous assembled sequence.

The method can be performed in parallel on multiple individual (non-clonal) polynucleotides, which are individually resolved over the entire (or substantial portion) of their length. possible and arranged in such a way that there is minimal or no overlap between individual polynucleotides. If side-by-side duplication occurs, this can be detected by an increase in fluorescence from the DNA stain, or if no stain is used, by an increase in the frequency of binding events, and the molecules are optically overlapped. appear to overlap but are physically non-overlapping (diffraction limit), they can be resolved by the super-resolution provided by the single-molecule localization provided by the present invention. . Where end-to-end overlap occurs, in some embodiments labels marking the ends of polynucleotides can be used to distinguish juxtaposed polynucleotides from true contiguous lengths. Such optical chimeras can also be dismissed as artefacts if many copies of the genome are expected and only one appearance of the apparent chimera is found. Again, if the ends of the molecules (diffraction-limited) appear to overlap optically, but not physically, they can be resolved by the method of the invention. In some embodiments, localization is so precise that signals emitted from very close labels can be resolved.

High concentrations of probe solutions cause disturbing background by using quenched probe molecular beacons or having two or more labels of the same type (e.g., one label on each side of the oligo) can be achieved without In solution they are quenched via dye-dye interactions. However, once bound to the target, they are separated and can fluoresce twice as brightly as a single dye, facilitating detection. Such dye-dye interactions are known for Cy3.

In one aspect, the invention includes a device for sequencing a polymer by transient binding of a repertoire of probes, such device comprising a light source, fluidic conduits, optics, detectors, electronic circuitry, and optionally includes a computer processor and computer memory. The DNA is placed in a fluid container and in fluid contact with the binding probe, and the light source emits light where the label associated with the binding probe is detected by the detector. In some embodiments the detector is a 2D detector. In some embodiments, the polynucleotide is retained in one portion of the fluid conduit and the binding probe is in another portion. Optionally, one portion of the fluid conduit is separated from the other portion via a valve. In some embodiments, an oligo or set of oligos is delivered as droplets or packets. In some embodiments, the droplets are pre-filled into the flow cell where sequencing takes place.

In some embodiments, the subset of polynucleotides to be sequenced is first selected from the first set of polynucleotides. In some such embodiments, capture oligonucleotides are used in solution to hybridize to a subset of polynucleotides and remove them from solution. For example, Agilent's SureSelect or similar approach can be used. In some embodiments, selection involves a CRISPR-type approach and nucleic acid binding is facilitated by protein binding. Similarly, proteins or polypeptides to be sequenced can be selected from solution by capture antibodies, nanobodies, affibodies, aptamers, and the like. Similarly, antibodies, affibodies, or nanobodies to be sequenced can be selected from solution by the capture antigen. Isolated biopolymers are arrayed on the surface and subjected to the sequencing methods of the invention.

In some embodiments, the binding probe comprises a CRISPR system comprising a protein (eg, cas9) and guide RNA. In some embodiments, the purpose of sequencing is to determine the binding sites of guide RNAs for detecting target and off-target effects.

In some embodiments, the target polynucleotide is present in body fluids, eg, circulating DNA or RNA in blood. Such polynucleotides are short in length, approximately 200 bases in blood and shorter in urine. These polynucleotides can be surface immobilized and subjected to the sequencing methods of the invention. Some such polynucleotides have single-stranded ends and are thereby immobilized. For example, they can be immobilized on a vinylsilane surface (Genomic Vision, France). In some embodiments, the circulating DNA or RNA is circularized and circles are used in a rolling circle reaction. In some embodiments, circularization is performed by an enzyme such as CircLigase. In some embodiments, long strand lengths of tandem copies that are products of rolling circle amplification reactions are extended on a surface or in a matrix and then subjected to the sequencing methods of the invention. Such an approach can yield consensus sequences for circulating polynucleotides. In some embodiments, the detected circulating DNA is rare, e.g., for early detection of cancer, the consensus obtained by sequencing tandem copies provides a level of accuracy that exceeds the error rate of sequencing methods. allow you to get For example, if the raw accuracy of the method is 99.9%, consensus reads may allow for 99.999% accuracy, allowing detection of very rare variants. An advantage of rolling circle amplification in this context is that each amplicon is copied directly from the circularized polynucleotide and thus does not perpetuate errors from the first or earlier replication rounds (resulting in PCR).

In some embodiments, the method is applied in situ along the stretched molecule. In some embodiments, the method is applied to chromatin in situ. In some embodiments, the method can be applied in situ to mitotic/metaphase chromosomes. In some embodiments, the method can be applied in situ to interphase chromosomes. In some embodiments, the method can be applied in situ to chromosomal DNA within cells. In some embodiments, the method can be applied in situ along with tandem copies.

In some embodiments, if the goal is to sequence DNA, RNAse is applied to the sample prior to initiating sequencing. In some embodiments, if the goal is to sequence RNA, DNAse is applied to the sample prior to initiating sequencing. In some embodiments, both cytoplasmic and nuclear nucleic acids are analyzed and they are differentially or sequentially extracted. First, the cell membrane (not the nuclear membrane) is disrupted to release and recover cytoplasmic nucleic acids. The nuclear membrane is then disrupted to liberate the nucleic acids. In some embodiments, proteins and polypeptides are recovered as part of the cytoplasmic fraction. In some embodiments, RNA is recovered as part of the cytoplasmic fraction. In some embodiments, DNA is recovered as part of the nuclear fraction. In some embodiments, the cytoplasmic and nuclear fractions are extracted together. In some embodiments, after extraction, mRNA and genomic DNA are differentially captured. For example, mRNA is captured by oligo-dT probes attached to the surface. This can occur in the first part of the flow cell and the DNA is trapped in the second part of the flow cell which has a hydrophobic vinylsilane coating where the ends of the DNA can be trapped (presumably by hydrophobic interactions).

The transient binding mechanism described so far is passive because the probe binding is labile. The following describes alternative embodiments of the invention in which transient binding is the activation mechanism. Here the probe binding must be stable and removed by physical or molecular means.

Therefore, the active transient binding loop is
1) stably binding an oligo or oligo set to a target;
2) actively removing the oligo or oligoset from the target;
3) repeating 1 and 2;

In some embodiments, the loop is performed at least twice. In some embodiments, on-off coupling is continuously monitored. In some embodiments, only on-coupling is monitored. Attaching oligos to targets in step 1 involves attaching many oligos of the same sequence. In some embodiments, multiple oligo sequences are attached to the target in step 1 and bind to different sites on the target.

In some embodiments, the sequencing method comprises
1) add oligo 1 or oligo 1 set,
2) oligos are stably bound to a subset of target sites while being imaged;
3) actively removing the oligo from the target;
4) Repeat 2 and 3 until enough images are collected from enough locations.
5) wash off the oligos,
6) add oligo 2 or oligo set 2,
7) repeat steps 2-5;
8) add oligo 3 or oligo set 3;
9) repeat steps 2-5;
10) Continuing the above process until the repertoire is exhausted.

In some embodiments, steps 2 and 3 are performed multiple times for each oligo or set of oligos. This is done for several reasons. Since binding is a stochastic process, if binding is allowed to occur for an appropriate period of time, the reaction will be terminated before equilibrium or in the early stages, and a small fraction of the binding sites will be occupied. Thus, if the binding sites of the oligos or sets of oligos used are too close together overall to be resolved individually, the subsets will be statistically further apart, and the concentration of oligos and the time of reaction will vary. If properly configured, it will be possible to detect them individually. Appropriate times and concentrations can be determined empirically. This allows subsets of different positions to be combined and matched at each iteration. Another reason for performing multiple ligations is to allow most sites to be matched, and substantially all or most sites to be matched multiple times each. , thus improving sensitivity and accuracy.

In some embodiments, active binding and removal is effected by temperature change. In some embodiments, active binding and removal is effected by reagent change. In some embodiments, active binding and removal are effected by electrical changes.

In some embodiments of the invention, the temperature can be varied over the course of the probe binding period, allowing the binding behavior of the probe to be determined at more than one temperature. In some embodiments, melting curve analogues are performed and the binding behavior or pattern to the target polymer correlates with the gradient of temperature over a selected range (eg, 10 degrees to 65 degrees).

In some embodiments, alternatively, or in addition to changing the temperature of oligonucleotide probes with different Tms, their concentration, and/or salt conditions, and/or pH can be changed. In some embodiments, the electrical bias on the surface is repeatedly switched between positive and negative to actively promote transient binding.

In some alternative embodiments, transient single-molecule binding is detected by non-optical methods. In some embodiments, the non-optical method is an electrical method. In some embodiments, transient single-molecule binding is detected by non-fluorescent methods in the absence of direct excitation methods, rather bioluminescence or chemiluminescence mechanisms are used.

In some embodiments, the invention includes a method for sequencing a target polynucleotide comprising:
1) immobilizing the target polynucleotide along its length by one or more interactions (e.g., multiple interactions) with the surface/matrix;
2) under conditions (oligo concentration, salt concentration, temperature ), flooding the immobilized target polynucleotide with an oligonucleotide or chemical composition of given sequence and length;
3) detecting transient binding events and recording their 2D coordinates;
4) removing the oligonucleotide;
5) adding and removing the next set of oligonucleotides, repeating 3 and 4 until the entire repertoire of sequences of a given length has been tested;
6) using an algorithm to compile a sequence of the immobilized target polynucleotide based on the location of the transient binding oligonucleotides.

The methods of the present invention are particularly suitable for sequences of very long polymer length, where the natural length or a significant fraction thereof is conserved (eg, for the entire DNA chromosome or about a 1 Mbp fraction). However, common molecular biology methods result in DNA fragmentation. Pipetting, vortexing cause shear forces that can destroy DNA molecules. Nuclease contamination can degrade nucleic acids. In some embodiments of the invention, native-length or native-length high molecular weight (HMW) fragments are preserved prior to initiating immobilization, extension, and sequencing.

Thus, in some embodiments, the invention includes a method for sequencing a target polynucleotide comprising
1) placing the cells in a microfluidic container or device;
2) extracting the polynucleotides from the cells into a microfluidic environment;
3) immobilizing and extending the target polynucleotide along its length by one or more (e.g., multiple interactions) with the surface/matrix;
4) under conditions (oligo concentration, salt concentration, temperature ), filling the immobilized target polynucleotide with oligos or chemical compositions of given sequence and length;
5) detecting transient binding events and recording their 2D coordinates;
6) removing oligos;
7) repeating 4-6 times, each time with a different oligo, until the entire repertoire of sequences of a given length has been tested;
8) nanometrically localizing each binding site using a single-molecule localization algorithm;
9) using an algorithm to compile a sequence of the immobilized target polynucleotide based on the location of the transient binding oligonucleotides.

In some embodiments, a single linearized, linear polymer is analyzed or studied at a time. In this case there is no need to record the 2D coordinates, only the 1D coordinates.

In some embodiments, the polynucleotide is fragmented into relatively uniform long chain lengths (eg, about 1 Mb) after, during, or before step 1. In some embodiments, the polynucleotide is fragmented into relatively uniform long chain lengths after or during step two. In some embodiments, fragmentation is performed enzymatically. In some embodiments, fragmentation is done physically. In some embodiments, physical fragmentation is through sonication. In some embodiments, physical fragmentation is through ion bombardment or radiation. In some embodiments, physical fragmentation is through electromagnetic radiation. In some embodiments, physical fragmentation is through UV illumination. In some embodiments, the dose of UV illumination is controlled to cause fragmentation to a given length. In some embodiments, physical fragmentation is through a combination of UV illumination and staining with a dye (eg, YOYO-1). In some embodiments, the fragmentation process is stopped by physical action or addition of reagents. In some embodiments, the reagent that affects terminating the fragmentation process is a reducing agent such as β-mercaptoethanol (BME).

In some embodiments, the invention provides
1) placing the cells in a microfluidic container or device;
2) staining the cells with an intercalating dye;
3) providing a dose of UV light to effect intercalating dye-mediated fragmentation;
4) optionally discontinuing fragmentation;
5) extracting the polynucleotides from the cells into a microfluidic environment;
6) immobilizing and extending the polynucleotide;
7) sequencing in situ on the immobilized and elongated polynucleotides.

These steps can be added to various embodiments of the invention, including steps acting on isolated single cells.

In some embodiments, each cell is individually isolated within a microfluidic container or device and its DNA is individually extracted and individually sequenced. In some embodiments, extraction is performed by treatment with detergents and/or proteases. In some embodiments, a chelating agent (eg, EDTA) is provided in solution to remove divalent cations required by nucleases. In some embodiments, with a particular sample source, the concentration of divalent cations is higher than commonly used in molecular biology.

In some preferred embodiments, the present invention is faster than popular sequencing techniques. In some preferred embodiments, the present invention is less costly than popular sequencing technologies. In some preferred embodiments, the present invention provides longer reads than prevailing sequencing technologies. In some preferred embodiments, the present invention provides greater accuracy than current sequencing techniques. In some preferred embodiments, the present invention provides greater sensitivity than prevailing sequencing technologies. In its most preferred embodiments, the present invention provides all of the aforementioned advantages. Moreover, in some preferred embodiments, whole genomes can be obtained using small quantities of biochemical reagents for only a few dollars or less, even though the cost of flow cells, instrumentation, and computer power add to the cost. It can be sequenced within about an hour. For example, a 5-base length with a 20-base labeling site can be purchased for about $1, making a complete repertoire $1000. Fluorescently labeled oligos that can be stably attached to the labeling site cost about $50. Approximately one millionth of such oligos synthesized on the micromolar scale are used, costing less than $1 per run.

The method of the present invention is notable in that it does not require enzymes and only consumes dilute solutions of probes (oligos). Therefore, the method is low cost. Sequencing chemistry consumes only simple probes and buffers, so the cost is primarily equipment and plasticware.

A surprising feature of the present invention is that the single molecule extended target remains stable over hundreds of reagent exchange and washing cycles.

A notable aspect of the present invention enabled by single-molecule localization is that a 10 nm-pitch ordered array, if fully occupied, provides 1 trillion target molecules per cm ² .

Another notable aspect of the invention is that a single base substitution in the target alters (for example) 10 5 base long probes relative to the reference sequence. Five previously unbound probes now bind, and five previously bound probes no longer bind. This change will also be seen in other strands.

In its preferred embodiments, the present invention distinguishes from the prior art by including two or more of the following elements: no prior library preparation before polynucleotides are immobilized; unidirectional alignment of polynucleotides in embodiments; transient linkage; repetitive linkage; constructing a contiguous sequence of polynucleotides by piecing together bits of sequence information.

In some embodiments of the invention, all reagents required to perform the method are pre-filled into the fluidic device before the analysis is started. In some embodiments, reagents (eg, probes) are present in the device in a dry state and are wetted and dissolved before the reaction proceeds.

In some embodiments, the method includes means for sequencing a target biopolymer that includes multiple binding events to a single polymer during the course of imaging without reagent exchange. In some embodiments, multiple binding events to each of multiple locations on a single biopolymer occur one or more times.

In some embodiments, the sequencing method comprises transiently binding a sequence probe to a single polynucleotide, wherein the probe substantially overlaps each of a plurality of overlapping sites on the single polynucleotide. complementary to each other. In some embodiments, each of the overlapping sites is resolved by the local accuracy and precision of the method.

In some embodiments, the sequencing method comprises transiently binding sequence probes to a single polynucleotide, wherein the plurality of probes of the repertoire each binds sequence bits on the single polynucleotide. Substantially complementary, the binding of two or more probes to overlapping sites are separated in time.

In some embodiments, the sequencing method comprises transiently binding a tiling set of sequence probes to a single polynucleotide, wherein the plurality of probes of the set are each on a single polynucleotide. and the binding of two or more probes to overlapping sites/bits are separated in time.

In some embodiments, the sequencing method comprises binding a panel of sequence probes to a single polynucleotide, wherein the plurality of probes of the panel each substantially binds sequence bits on the single polynucleotide. Complementary to In some such embodiments, sequence bits are matched multiple times with the same or different probes.

In some embodiments, the invention includes methods for analyzing amino acid sequences on target proteins. In some embodiments, the invention includes methods for analyzing amino acid sequences on target polypeptides. In some embodiments, the invention includes methods of analyzing peptide modifications as well as amino acid sequences on target polynucleotides.

In some embodiments, the methods of the invention are applied to the sequencing of polypeptides. Each of the 20 amino acids is bound by a corresponding specific probe including N-recognins, nanobodies, antibodies, aptamers and the like. Binding of each probe is specific for each corresponding amino acid within the polypeptide chain.

In some embodiments, the order of subunits in the polypeptide is determined. In some embodiments, the binding binds to a binding site surrogate. In some embodiments, alternatives are tags attached at specific amino acid or peptide sequences. Transient binding binds to the surrogate tag.

In some embodiments, the invention includes determining the identity of the polymer. In some embodiments, the invention involves determining the identity of cells or tissues. In some embodiments, the invention includes determining the identity of an organism. In some embodiments, the invention involves determining the identity of an individual. In some embodiments, the methods of the invention are applied to single cell sequencing.

In some embodiments, sequencing is performed in situ within a cell. The cell contents, which may be referred to as the matrix, are fixed and denatured before transient binding begins. In some embodiments the cells may form a monolayer, or in other embodiments they are part of a 3D architecture such as a tissue or organoid. Imaging methods capable of detecting 3D structural events can be used, such as multiphoton microscopy and light sheet microscopy. By immobilizing and matching molecules in a matrix or gel, all molecules, including rare ones, can be captured. In some embodiments, cells (eg, circulating tumor cell CTCs) are dispersed on a surface and sequenced. In some embodiments, the cells are dispersed over the surface such that each cell is sufficiently separated from the other cells. Cells can then be lysed and their molecular inventory captured on the surface and subjected to the sequencing methods of the invention.

In some such embodiments, the method comprises:
I) fixing the location of the polynucleotide within the cell;
II) adding oligos of given specificity and using single molecule localization to determine the location of all binding events;
III) adding oligos of different specificities and using single molecule localization to determine the location of all binding events;
IV) repeating steps II-III;
V) reconstructing the sequences of linear pathways or regions of polynucleotide locations within the cell by compiling the sites of binding of the oligonucleotides.

In some of the above embodiments, mechanisms (FRET, fluorescent labels, quench labels, etc.) are used to minimize background fluorescence/light scattering that makes detection of individual point sources difficult. In some embodiments above, RNAse is used to remove RNA before the invention is applied to the remaining DNA. In some embodiments of the above, the double-stranded DNA is denatured in situ prior to addition of oligos.

In some embodiments, the location of modifications is also determined by using single molecule localization to determine the location of modifications such as 5 methyl C (5MC).

Some embodiments of the present invention are designed to solve problems in digital molecular counting. One problem in counting molecules is obtaining highly accurate and reproducible data. Due to the stochastic nature of molecular interactions, endpoint digital counting assays can miss specific events that are not present at the time endpoint measurements are taken, or they can be spurious events (e.g., non-specific binding or partial matches) can be counted. For this reason, digital counting assays are more suitable, in which the molecules to be counted are detected by transient binding probes that bind multiple (or repetitively). Multiple binding events provide confidence that something authentic is being detected and determine what is being detected or what of some feature is being detected (e.g. partial match). can be done.

Thus, in some embodiments, the invention includes a method of counting the number (or determining the copy number) of a molecular class (e.g., a DNA fragment comprising a particular sequence) in a sample,
a) adding one or more probe species under conditions that allow the probe to transiently bind to the molecule;
b) continuously monitoring and recording individual binding events on the molecule with a detector over a period of time;
c) analyzing the data from step b to filter out non-authenticating interactions and determine the number of authenticating interactions, thereby determining the copy number of the molecule;
d) optionally, the molecule is immobilized on a surface or matrix prior to step a.

In some embodiments, enumeration of certain types of molecules is a result of the emergence properties of transient binding interactions. A single probe binding event or endpoint determination of binding is not sufficient to determine the true value of the number of molecular species, and a true determination separates wheat from the husk (a true event becomes a non-genuine event resulting from the analysis of multiple binding events (occurrence characteristics).

In some embodiments, the invention provides a method of counting interactions between one or more probes and a molecule comprising:
a) adding one or more probes of a given specificity under conditions that allow the probes to transiently bind to the molecule;
b) continuously monitoring and recording individual binding events on the molecule with a detector over a period of time;
c) analyzing the data from step b to determine the number of interactions that occurred over a period of time;
d) optionally adding one or more probes of different specificities and repeating steps b-c;
e) optionally, prior to step a, the molecule is immobilized on a surface or matrix. In some such embodiments, in step c, the interactions are classified by the duration of each interaction and the number of events falling into each classification is recorded. This embodiment can be useful, for example, when the degree of identity between a sequence and different probes is being measured. This embodiment can be adapted to the previous embodiment to distinguish genuine events from non-genuine events.

Several criteria can be established to determine what constitutes a genuine event and what constitutes a non-genuine event. For example, an association duration cutoff is one criterion for separating authentic events from non-authentic events.

For certain single-molecule localization methods, such as PAINT, which deal with crowded fields containing dense molecules that need to be measured, the accuracy of localization depends on: (1) the photons collected; (the degree of localization is inversely proportional to the number of photons, so a large number of photons are needed to obtain localization to the subnanometer or low nanometer level), (2) a low duty cycle (i.e., each binding events are short-lived), this is due to the fact that binding events are statistically stochastic, so that at any given time only a small fraction, and thus at any given time, only individually resolvable signals are liberated. means to be

In some alternative embodiments, a low duty cycle is not required if the field of view of the molecules is not crowded or dense or the sites along the elongated or stretched polymer are sparse. . The signal or detectable photon emission can be long-lived, and the duration of detection determines the extent to which localization can be made using single-molecule localization algorithms. Long exposure times can be used to collect more photons. In such embodiments, it is useful to use pulsed or strobed illumination to minimize photobleaching of the probe. Signals from dyes can also often be recovered by excitation with lower wavelength light. Therefore, the detection is
1) illumination of wavelength 1;
2) detection of the signal;
3) illumination of wavelength 2; and 4) repeating 1-3 until enough photons required for position determination are collected.

When this is applied to sequencing to determine, for example, the location of a 5-base long probe along the length of a polynucleotide, sequence bits can be located down to a few nanometers, and each of the repertoire of probes Locations can be used to summarize sequences of polynucleotides that are characteristic of occurrences of locations in a repertoire of binding events. This embodiment, which does not require transient binding, remains novel as the signal is localized down to nanometer or sub-nanometer dimensions.

In some embodiments, the polynucleotides are placed in a flow channel containing a medium capable of undergoing a liquid-to-gel transition, and after the polynucleotides are sufficiently dispersed and individually isolated, the polynucleotides are transferred to their Make it possible to induce a sol-gel transition that locks in place. The probes of the invention can then be applied to the polynucleotides captured in the gel phase. Because the polynucleotides are distributed in 3D (albeit unidirectionally aligned), imaging methods such as light sheet microscopy can be used to image 2D slices.

In some embodiments, the solution has two phases, a liquid phase and a solid phase (or gel phase). Polynucleotides are first elongated and distributed in a liquid phase, and then by changing the phase to a solid/gel phase (e.g., by heating or by adding a cofactor in the case of polyacrylamide, or fixed over time). In some cases, the polynucleotide can be elongated in the solid/gel phase. The sequencing chemistry of the invention is then applied to static polynucleotides isolated in three dimensions on solid phase. Detection of the sequencing reaction is then performed by confocal microscopy, multiphoton microscopy, light sheet microscopy, spinning disk confocal microscopy, and the like. This embodiment is particularly relevant when substantially all molecules in the sample need to be sequenced (not just those that can be captured on the surface). Polynucleotides are treated in a medium containing poly(N-isopropylacrylamide) and heating produces a hydrogel that immobilizes the polynucleotide in 3D space but allows the exchange of reagents through the hydrogel during a phase transition. (Eriksen et al Biomicrofluidics 5:31101-311014, 2011).

In some embodiments, the polymer is trapped at one end and then straightened or stretched due to forces on the polymer due to the flow of the liquid medium in which the polymer is placed. The transition from the liquid/sol phase to the gel phase renders the molecule static.

In some methods, the relative fixation of features (e.g., sequence blocks or amino acids) along the length of the polymer when the polymer is placed or will be placed in the gel. Alternatively, static positioning allows the location of the label along the length of the polymer to be determined by single-molecule localization methods.

Accordingly, these embodiments are
I) unidirectionally aligning the polynucleotides in a gel or matrix;
II) flowing fluorescent oligos of given specificity through a gel or matrix so that the oligos can undergo transient interactions with the polynucleotide;
III) flowing fluorescent oligos of different specificities through a gel or matrix so that the oligos can undergo transient interactions with polynucleotides;
IV) repeating step III;
V) using the information about the binding location of each specific oligo to determine the sequence of the target polynucleotide.

In some embodiments, sequence information is obtained by transient binding of sequence-specific nucleic acid binding proteins such as restriction enzymes, nicking endonucleases, and methyltransferases. A large repertoire of such proteins is commercially available, covering much of the sequence space. A number of sequence enzymes are available that recognize palindrome sequences. One characteristic of the three proteins mentioned above is that they recognize sequences of double-stranded DNA. These probes consist of several oligonucleotides from the complete repertoire, e.g., several oligos that under normal reaction conditions undergo self-interactions or hairpin interactions, making them relatively inefficient probes. nucleotides).

Transient binding of antibody or binding protein can be effected by manipulation of reaction conditions such as salt concentration. In some embodiments, the salt concentration is increased above 100 mM to provide transient binding. In some embodiments, the salt concentration is raised above 200 mM. In some embodiments, the salt concentration is raised above 300 mM. In some embodiments, transient binding is performed actively by buffer exchange from low salt to high salt. In some embodiments, the sequence- or modified (e.g., methylated) specific binding proteins allow stable or transient binding, and their location is associated with a single Determined by molecular localization or by direct or tag-mediated conjugation to the protein.

In some embodiments, the reverse reaction is performed, probes are immobilized, and transient interactions with molecules in solution (targets to be analyzed) are determined.

In some embodiments of the invention, molecules are not immobilized on a surface or matrix and are freely diffusing in solution. Detection is performed by fluorescence correlation spectroscopy (FCS). In some such embodiments, molecules (eg, larger and) move through solution more slowly than probes. Therefore, in each confocal spot, many putative binding events between probe and molecule can be recorded before the molecule diffuses out of the confocal spot, and these binding events are cross-correlated. Bound cross-correlation can be distinguished from unbound cross-correlation by the dwell time of the probe in the confocal spot. In some embodiments, an encoded repertoire of oligos is provided and the identity of bound oligos (which statistically occurs one at a time) is determined by decoding the fluorescent binding signal. .

In some such embodiments, the method comprises:
I) adding the polynucleotide into the solution;
II) illuminating a confocal volume that isolates a single polynucleotide;
III) flowing or uncaging fluorescent oligos of given specificity so that the oligos can undergo transient interactions with the polynucleotide;
IV) flowing or uncaging fluorescent oligos of different specificities so that the oligos undergo transient interactions with polynucleotides and their binding properties can be determined;
V) repeating step IV;
VI) using information about the duration and duration of binding events detected for each specific oligo to determine the sequence of the target polynucleotide.

In some embodiments, the binding characteristic includes whether a binding duration exceeding a predetermined threshold occurs.

In some embodiments, the polynucleotide remains in solution, its bulk allows it to remain relatively in the same place or within a confocal region, and the oligos of the repertoire divide its volume one by one (or set by set) or, preferably, added all at once as a coded repertoire. In some embodiments, the bulk of the polynucleotide is made trapped to a fixed location by physical trapping (eg, laser trapping, electrostatic trapping). In some embodiments, multiple polynucleotides can be individually captured by multiple optical traps.

In some embodiments, the polynucleotide is confined within a container (eg, within an immiscible lipid vesicle). The container may allow exchange of probes but does not dissipate the polynucleotides.

In some embodiments, the confocal volume is a multi-photon volume.

In some embodiments, the polymer in solution is not stationary and the polymer moves in a direction perpendicular to the direction of a well-separated flow stream (e.g., a laminar stream) that has a different repertoire of probes. . Migration is electrophoretic (ie, toward a positively biased electrode) and acts on polynucleotides of higher molecular weight than oligos in a flow stream whose trajectory is not significantly affected by the direction of polynucleotide migration.

In some embodiments, polynucleotides are immobilized at only one end, but in a flow stream parallel to the surface (or, for example, a 2D detection surface when immobilized to optically captured beads). It extends inside and does not interact with the long-lived surface from anywhere along its length other than at one end. In some embodiments, the polynucleotide immobilized at one end is single stranded. The oligos in the repertoire are then exchanged in fluid amounts. In some embodiments, the direction of oligo flow is the same as the direction of polynucleotide elongation. In some embodiments, the detectable repeated transient binding of individual oligomolecules leads to the complementary binding of the elongated polymer even when the majority of the oligos are moving along the direction of flow. occurs in a particular place.

In some embodiments, the polynucleotide is extended perpendicular to the direction of flow from its point of immobilization. This can be achieved by providing an electric field perpendicular to the direction of flow. Flow is effected by pressure-driven flow by applying a pressure of 1 millibar up to 1 bar, the electric field can be 1-100 volts per centimeter, and the ends of the immobilized polynucleotides are shunted. One surface of the flow cell is made negative and the other surface of the flow cell is made positive to which the polynucleotides are attracted.

In some such embodiments, the method comprises:
I. attaching a polynucleotide at one end to a surface and extending it in one direction by a physical mechanism;
II. flowing fluorescent oligos of given specificity so that the oligos can undergo transient interactions with the polynucleotide;
III. flowing fluorescent oligos of different specificities so that the oligos can undergo transient interactions with the polynucleotide;
IV. repeating step III;
V. using information about the duration and duration of binding events detected for each specific oligo to determine the sequence of the target polynucleotide.

In some embodiments, the physical mechanism is flow extension, electrophoretic extension, or extension by action on a bulky entity (eg, a bead) attached to one end of the polynucleotide. The bulky entity can then be subjected to laser trapping, electrostatic trapping (if charged), magnetic trapping (if paramagnetic).

When the polynucleotides of the above methods are genomic DNA, the methods can further include redundantly assembled polynucleotide sequences to assemble the chromosome.

In some embodiments, the present invention relates to a method for delivering biopolymers for analysis, comprising:
1. providing a protected entity comprising a biopolymer, the protected entity preserving the biopolymer near its native state;
2. placing a protective entity comprising a biopolymer proximate to the analysis zone;
3. releasing the biopolymer from the protective entity into the analysis zone;
4. and analyzing the biopolymer according to the method of the invention.

In some embodiments, probes are labeled according to a single defined nucleotide (eg, NNNXNNN, where X is a defined or coding nucleotide). In some embodiments, the repertoire of NNNXNNN oligos position X comprises A, C, G, or T and position N is one of A, C, G, and T. The central base of the oligo is differentially labeled according to its identity, A, C, G, or T. In some embodiments, four libraries of NNNXNNN oligos (e.g., each library comprising a set of oligonucleotides: NNNANNN, NNNTNNN, NNNGNNN, and NNCNNN) are each differentially labeled and used in homogeneous reactions that do not require reagent exchange.

It is very easy to detect nucleic acid sequences using complementary nucleic acid sequences (eg oligoprobes). A sequence (eg, 5 bases) bound by an oligonucleotide is referred to herein as a sequence bit. In some assays, such as Fodor's gene chip assay (described, for example, in Chee et al Science 274:610-4.1996), probes are immobilized and targets are labeled and provided in solution. be. In many other assays, targets are immobilized and probes are labeled and provided in solution (e.g., via Southern blotting, see Southern EM, Journal of Molecular Biology, 98:503-517 (1975)). Have been described). In such assays, probes hybridize to target nucleic acid sequences by Watson-Crick interactions, excess labeled probe is washed away, and residual bound probe is detected. Hybridization requires correct binding that is stable enough to survive washing and remain in place during detection. Methods for sequencing immobilized polynucleotides have only been proposed by hybridization of repertoires of oligonucleotides (described, for example, in Drmanac et al Science, 260, 1649-1652, 1993), and this " A "sequencing by hybridization" (SbH) approach has been demonstrated for resequencing of small genomes (described, for example, in Pihlak et al Nature, Biotechnology 26:676-684 2008). Mir (WO2002/074988, 2001) further provides SbH of surface-extended polynucleotides. All of the probing and sequencing methods described above are endpoint assays and require probes to form long-lived interactions with complementary polynucleotide targets. Any nucleic acid interaction has an off-rate, but for nucleic acid assays, the off-rate is slow enough not to significantly affect the assay. If the probe is stably bound, certain steps involving a rigorous detachment protocol (including high temperature) must be performed to remove the probe before hybridizing the next probe in the series. Harsh conditions can damage the DNA or remove the target DNA from the surface, and in our experience, a significant amount of the probe effectively remains permanently anchored.

The present invention is a novel counter-intuitive sequencing approach that involves short-lived Watson-Crick interactions between probes and target sequences. The chemical structure (eg, sequence, 3D structure) of the probe is designed so that it does not form long-lived stable interactions under the conditions used. Rather, the majority of probe molecules are designed to bind to the target and then dissociate during the detection process. This is in contrast to hybridization where most of the probe is expected to remain bound during detection.

A step of the present invention involves the fact that when hybridization-based approaches in sequencing involve stable long-lived bonds, the present approach particularly requires short-lived labile bonds. Conditions were found for labile, transient and repetitive binding of oligonucleotides as short as 5 reference bases, which readily generated and performed the entire repertoire (1024 oligos). short enough for

Although the present invention has some similarities with SbH, it does not suffer from the inherent problems of SbH: once one probe binds, its footprint, e.g., 5 bases long, covers a sequence of 5 bases. and inhibits or interferes with other probes that partially overlap the footprint of 5 bases from binding. Even if only one probe is used at a time, the first binding oligo prevents information from adjacent positions if the probe subsequences are repeated in tandem. However, since the present invention involves transient binding, the first probe is dislodged, making the sequence accessible for binding by a second probe, and the second probe is dislodged, allowing a third binding. and so on. Another advantage of this approach is that the truth of each array bit is verified by iterative joins. However, in the case of SbH, once something binds, it sticks, making it difficult to determine whether it is the result of specific or non-specific binding. In addition, stable binding of mismatches poses problems for SbH, but in the present case, mismatches can be distinguished from perfect matches by the duration of binding, the frequency of long-duration binding, etc. In some cases, a mismatch (eg, 4 bases) can form a Watson-Crick base pair, and the fifth base does not base pair. In other cases, for example, 4 may form a Watson-Crick base pair and the 5 may form a non-Watson-Crick base pair. In some cases (e.g., when non-Watson-Crick bonds are formed), a non-perfect match with several Watson-Crick base pairs and one or more non-Watson-Crick base pairs is actually a perfect match. may form interactions that are more stable than each other, and the average duration of binding may be longer. Collecting empirical data on all such possibilities will improve the performance of the sequencing techniques of the invention. Using machine learning, such behavior can be learned from a subset of experiments in order to predict the behavior of the full set.

The use of short oligonucleotides of the invention has the advantage that searching for a target sequence typically involves finding 3, 4, 5, or 6 matches, which is very rapid. and the occurrence of the target sequence is fairly frequent. In some embodiments, substantially all of the matched and mismatched sites are transiently bound during the course of detection, while in some embodiments only some of the sites are bound.

Polynucleotide sequencing of the present invention is an emerging property of binding properties of a repertoire of oligos. Generally, SbH and hybridization assays derive information from perfect match binding of a synthetic oligonucleotide to its target natural polynucleotide by the Watson-Crick rule and seek to eliminate binding containing mismatches. Some embodiments of the invention examine the repertoire of binding interactions (over a threshold binding duration) that each oligonucleotide has with the polynucleotide under analysis. In some embodiments, sequencing involves splicing or reconstructing sequences from perfect matches as well as obtaining sequences by analyzing the binding propensity of each oligo. The method was uniquely set up to measure the binding propensity of each oligo species: rate and duration of on-off binding, which is a function of the type and number of base pairs with which the probe forms a bond with the site. be. In summary, repetitive binding interactions between oligos and sites where the oligos form perfect base pairs or perfect matches are distinct from where some bases of the probe form mismatches that do not match the target. In most cases, binding to mismatch sites tends to be shorter-lived than to perfect match sites. Empirical data are used to modify expectations for certain outliers (Watson-Crick discordant bonds outlast Watson-Crick concordant bonds). The algorithm of the invention can take this into account.

In some embodiments of the invention, the detection step involves taking a number of image frames (eg, movie or video) in which the on- and off-bindings of the probe are recorded.

In some embodiments, the detecting step involves detecting multiple on- and off-binding events to each complementary site. Multiple events are due to on- or off-binding of the same probe molecule, or displaced by another molecule with the same specificity (i.e., specific for the same sequence or molecular structure). can occur multiple times. On- or off-binding is unaffected by changes in conditions, both on- and off-binding occur under the same conditions (salt concentration, temperature, etc.) and binding is transient due to weak probe-target interactions due to being

In some embodiments of the invention, sequencing includes multiple on-off binding events at multiple locations on a single target polynucleotide of shorter, the same length, or within an order of magnitude of probe length. is performed by imaging the In such embodiments, longer target polynucleotides are fragmented or panels of fragments are pre-selected and arrayed on a surface so that each polynucleotide molecule is individually resolvable. In these cases, the frequency or duration of probe binding to a particular location is used to determine whether the probe corresponds to the target sequence. The frequency or duration of probe binding can also determine whether the probe corresponds to all or part of the target sequence (with the remaining bases mismatched).

In some embodiments of the invention, sequencing is performed by imaging multiple on-off binding events at multiple locations on a single target polynucleotide that is longer than the probe. In some embodiments, the location of probe binding events on a single polynucleotide is determined. In some embodiments, the location of probe binding events on a single polynucleotide can be determined by extending the target polynucleotide and different locations along its length can be detected and resolved. In some embodiments, elongation occurs on a surface. In some embodiments, elongation occurs in a nanochannel. In some embodiments, elongation occurs by hydrodynamic drag when one or both ends of the target are under tension. In some embodiments, elongation occurs via electrophoretic forces, e.g., when one end of the target polynucleotide is tethered, tethered, or captured, the other end is hanging freely inside.

In some embodiments, on-off binding of labeled probes requires rejection or removal of signal from unbound probes. This can be done, for example, by using evanescent fields or waves for illumination, or by taking advantage of resonance energy transfer (RET, e.g., fluorescence or Forster RET), or by taking advantage of photoactivation. (eg, described in Biophys J. 2015 Feb 17;108(4):949-956).

In some embodiments, the probe is unlabeled, but interaction with the target is detected by a DNA stain such as an intercalating dye that intercalates into the duplex when binding occurs or occurs. One or more intercalating dyes can intercalate into the duplex. When intercalated, the fluorescence emitted by the intercalating dye can be orders of magnitude greater than the fluorescence from the intercalating dye free in solution. For example, the signal from intercalated YOYO-1 dye is approximately 100-fold greater than the signal from free YOYO-1 dye in solution.

This aspect of the invention provides that when a lightly stained (or after some degree of photobleaching) double-stranded polynucleotide is imaged, the It was initially motivated by the observational practice that individual signals can be observed. A redox system (ROX) comprising s and ascorbic acid can be provided in the binding buffer to facilitate exchange of the YOYO-1 dye in the duplex and to obtain a bright signal.

In some embodiments, sequencing comprises subjecting extended polynucleotides to transient interactions from each of a complete sequence repertoire of probes provided in turn (a solution with one probe sequence is removed and the solution with the next probe is added). In some embodiments, binding of each probe is performed under conditions that allow the probe to bind transiently. Thus, for example, binding is performed at 25° C. for one probe and 30° C. for the next. Also, probes can be bound in sets, eg, all probes that are transiently bound in much the same way can be assembled into sets and used together. In some such embodiments, each probe sequence of the set is differentially labeled or differentially encoded.

In some embodiments, or in some cases, multiple binding events to a target locus are analyzed by analyzing data from a repertoire rather than from a single probe sequence to identify events arising from partially overlapping sequences. determined by consideration. For example, probes ATTAAG and TTAAGC are bound at the same location (sub-nanometrically close, in fact). They are 6 bases long and share a common 5 base sequence, each verifying the other and extending the sequence by 1 base on either side of the 5 bases. In some cases, one base on each side of the five-base sequence is mismatched (mismatches at the ends are typically expected to be more tolerated than internal ones) and are present in both binding events. It is verified that only 5 base sequences do.

In some embodiments, the signal is detected by FRET from the intercalating dye to the label on the probe or target sequence. In some such embodiments, the probe is labeled with a Cy3B label on one of its termini. In some embodiments, after target immobilization, all target molecules are end-labeled and incorporated, eg, by terminal transferase, with fluorescently labeled nucleotides that act as FRET partners.

In some embodiments, the complete sequence repertoire is not used, but rather a tiling array of solution probes covering specific segments of the sequences of interest. In some embodiments, the complete sequence repertoire is not used, but rather a panel of probes, so that multiple locations are interrogated by probes that transiently bind sequence-specifically.

In some embodiments, the target polynucleotide must be single-stranded (eg, mRNA) or rendered single-stranded in order to practice the present invention. In some embodiments, the target polynucleotide is double-stranded and transient binding results from transient strand invasion of the probe. In some embodiments, the double-stranded target contains nicks (e.g., naturally occurring or generated by DNase1 treatment), and under reaction conditions, one strand transiently unwinds from the other. or exfoliate, or cause a natural base-pair wobble, allowing the probe to transiently bind before being displaced by the natural strand.

In some embodiments, sequences are constructed by analyzing transient data collected for each of the probes. In some embodiments, such data include coordinates of binding events on a 2D surface, typically correlated with the pathways of extended polynucleotides.

The location of probe binding provides the order of binding for each probe, which can be compiled into a contiguous sequence.

As used herein and in the claims, the term target polynucleotide refers both to the presence of only a single strand and to the presence of two double helices. Where double-stranded or single-stranded polynucleotide alone is intended, it is indicated in the text. When RNA is referred to it is assumed to be single-stranded.

In the present specification and claims, when binding or location is recorded on a substrate, it can be assumed that a significant proportion of binding occurs on nucleic acids on the substrate.

Polynucleotide Extraction In various embodiments, the methods extract a single target polynucleotide molecule from a cell, organelle, chromosome, virus, exosome, or biological material or fluid as a substantially intact target polynucleotide. further including In various embodiments, the target polynucleotide molecule is elongated/stretched. In various embodiments, the target polynucleotide molecule is immobilized on a surface. In various embodiments, the target polynucleotide molecules are placed in a gel (compare, eg, Shag et al Nature Protocols 7:467-478 (2012)). In various embodiments, target polynucleotide molecules are disposed in microfluidic and/or nanofluidic channels. In various embodiments, the target polynucleotide molecule is intact.

In various embodiments, the method further comprises sequencing the genome of the single cell. In various embodiments, the method further comprises releasing polynucleotides from the single cell into the flow channel. In various embodiments, the walls of the flow channel comprise passivation to prevent accumulation of polynucleotides. In various embodiments, passivation includes coatings of lipids, polyethylene glycol (PEG), casein and/or bovine serum albumin (BSA).

In some embodiments, it is necessary to separate the cells of interest from other cells that are not of interest before extraction is performed. Several methods are available, for example, circulating tumor cells or circulating fetal cells are isolated from blood by using their surface market for affinity capture. In some embodiments, it is necessary to separate microbial cells from human cells for the purpose of detecting and analyzing polynucleotides derived from microbial cells. Opsonins can be used to capture a wide range of microorganisms and separate them from mammalian cells so that the microbial polynucleotides can be selectively sequenced. Also, differential lysis can be performed. Here, first, conditions for lysing mammalian cells are used. Microbial cells (particularly mycobacteria) are resistant to the conditions used to lyse mammalian cells and thus remain intact and isolated by washing away the contents of mammalian cells. can do. The polynucleotides are then extracted from the microbial cells using harsher conditions and they are selectively sequenced.

Sequencing In general, the method of the invention comprises
a) providing a target nucleic acid;
b) performing a transient binding reaction to obtain a first set of sequence bit locations on the target;
c) performing a transient binding reaction to obtain a second set of sequence bit locations on the target;
d) performing a transient binding reaction to obtain a third set of sequence bit locations on the target.

In some embodiments, multiple oligos are grouped or separated by a determinable distance.

In some embodiments, the targets from which the sequence bits are derived are aligned based on segments of sequence overlap between the targets to generate longer "in silico" contigs and ultimately sequences for the entire chromosome.

In some embodiments of the invention, target polynucleotides are contacted with a gel. In some embodiments, contact with the gel occurs after elongation of the target polynucleotide. In some embodiments, contacting with the gel occurs prior to elongating the target polynucleotide.

In some embodiments, commonly found sequences are used for target polynucleotides. This can be one or more of several sequences that occur very frequently in the genome. In this case, fingerprints of the genome can be readily obtained, rather than the full sequence of the genome.

In some embodiments, the present invention increases the density of sequence information that can be obtained by super-resolving tightly packed polynucleotides as well as sequence bits along the polynucleotide.

In one embodiment, the method comprises:
1) extracting long strands of genomic DNA without modification or treatment of the DNA;
2) spreading or elongating a genomic DNA molecule onto a surface;
3) providing a flow cell so that the solution can flow over the DNA stretched on the surface (either the stretching was done in the flow cell or the flow cell was constructed on the surface);
4) denaturing the DNA;
5) adding a transiently binding probe;
6) Detecting which probes are bound at each location using, for example, laser total internal reflection (TIR) illumination, focus detection/holding mechanisms, CCD cameras, appropriate objective lenses, relay lenses and mirrors. When,
7) The stage on which the flow cell is mounted is moved relative to the CCD camera so that genomic molecules or portions of molecules provided at different locations (outside the field of view of the CCD in its first position) can be sequenced. and
8) repeating 5-7 as necessary;
9) processing the data,
a) processing the image;
b) making a sequence call;
c) binding array calls to spatial locations;
d) determining which array call locations fit the line;
e) using the information obtained to assemble sequencing reads to provide super-contiguous reads;
f) assembling the genome using the assembled reads; and g) providing the sequence reads and/or the assembled genome to the user, preferably via a graphical interface on a computer or smart phone type device. and processing the data, including

When genomic DNA can be extracted from multiple cells, many copies of the molecule are surface displayed, results from the same homolog are collected, consensus reads are obtained, and homologous molecules are identified according to haplotype or parental chromosomal specificity. separated.

In some embodiments, transient binding is recorded as a means of detection, but not used to improve position determination. In some cases, the molecules are sparsely aligned and do not require increased localization. However, the robustness to photobleaching and the ability to filter out non-specific background (permanently stuck signals can be processed) make this approach compelling.

In some embodiments, the probe remains bound to the target but has a tail or flap to which the transient binding label binds on and off. In some embodiments, the tail consists of non-Watson-Crick base-pairing nucleic acid analogues.

Single Base Interrogation In some embodiments, probes are labeled according to only one defined nucleotide.

In some embodiments, the oligonucleotides are divided into species, different nucleotides, ACGTs, are defined, and each oligo corresponding to each different nucleotide is differentially labeled and optionally added to the sequencing reaction. be done.

In some embodiments, the oligos are not differentially labeled, but each base type is added separately after washing removes the previous nucleotide.

In some embodiments, in order to detect binding events over relatively short time scales (e.g., 1 minute or longer), one or a few bases are correspondingly used to accommodate the higher complexity of the oligo library. A higher concentration of oligos is required, defined only by If 10 nM oligos with 5 bases defined are sufficient, a 256-fold higher concentration of oligos with only 1 base defined is needed. This corresponds to 2.56 uM of oligonucleotide (in some embodiments, due to mismatch etc., lower concentrations are sufficient), when an exponentially decaying evanescent field of illumination from the surface is used. However, it will result in levels of background fluorescence that make it difficult to detect binding events on polynucleotide targets on the surface. Since background fluorescence is substantially due to light scattering, in some embodiments it can be time gated out. In some embodiments, high concentrations of oligos in solution are not fluorescent, but are fluorogenic and are quenched or not excited directly, but from entities attached to the surface or the target polynucleotide itself. A mechanism is used that emits light only when subjected to resonance energy transfer. In some embodiments, a dye that intercalates into the formed duplex is excited and upon binding transfers energy to a fluorescent label on the oligo. In some embodiments, each of the defined oligo libraries is added one at a time, no labels are attached to the oligos, and only nucleic acid stains or intercalating dyes from solution are used for binding. Events are labeled.

In some embodiments, for the four possible defined bases A, C, G, or T, where only one base is defined and the remaining positions are degenerate in the oligonucleotide , only 4 or fewer reagent change cycles are required. In some embodiments, each of the bases is encoded by a separate label, and reagent exchange is not required if there is means to detect all four labels simultaneously. When such homogenous or one-pot sequencing reactions are performed, the instrumentation is very simple, essentially microscopic, and does not require reagent exchange. For example, just one drop of an oligo mixture (a mixture of oligonucleotide probe species) in a suitable buffer is added onto a coverslip on which the target polynucleotide is located, and then the binding event is observed for a long enough time to allow one The above binding events cover the entire sequence. This homogeneous reaction is run for several hours and sealed against evaporation. If large enough volumes are used, reagent depletion that can occur near the surface can be overcome by facilitating reagent exchange by diffusion from the bulk of the solution (e.g., this may result in turbulent or chaotic flow). can be enhanced by mixing). Alternatively, if the goal is simply to replace depleted reagents rather than adding a different oligomix, a reagent replacement is performed.

In some such embodiments, the target polynucleotide is elongated or stretched so that the location of the binding event, and thus the location of the nucleotides along the length of the polynucleotide, can be determined. In some such embodiments, the polynucleotide is single-stranded, so there is no ambiguity as to which strand the oligo binds. This is because this single-nucleotide interrogation approach avoids the luxury of constructing tiling pathways to reverse fold on which strand of the denatured double-helical polynucleotide each binding event occurs. ), so it is useful. There are several examples where the single base matching approach can be applied to single strands. First, for the most part, RNA is naturally single-stranded. In other cases, a double stranded nucleic acid can be made single stranded, and in further cases one strand of a duplex can be replicated to make a single strand, e.g., the nucleic acid can be circularized, rolled It can replicate iteratively via circle amplification.

In some such embodiments, there is a strong need to avoid drift, and since each binding event only provides information for a single base, the tiling path formed by the overlapping bits of the sequence is the nucleotide cannot be extracted from the complete dataset to facilitate placement. In order to obtain the required accuracy, we use a system that is extremely stable in terms of vibration and thermal drift. One such stable system is the IX2 Nosepiece stage that can be used with Olympus' IX81 inverted laser TIRF microscope. In some embodiments, a drift correction mechanism is additionally or alternatively used, and a very effective means for drift correction uses fiducial markers such as DNA origami to iteratively drift correct the data. It is to perform multiple rounds of processing to generate accurate and highly accurate super-resolution images. DNA origami has been designed by those skilled in the art to have multiple binding sites for fluorescent labels at very regular and precisely placed positions within the structure. For example, DNA origami of the type described in Dai et al. (Nature Nanotechnology 2016, 11:798-807, incorporated herein by reference) can be used, including, for example, a 12 or 16 point grid. . The origami is labeled with a DNA PAINT mechanism, with single-stranded docking sites protruding from the top surface of the grid and transiently bound by a fluorescently labeled imaging agent. Binding sites are provided on the grid for imaging agents labeled with four different labels, and the labels are used to specifically label four single base defined oligo libraries. In some embodiments, the imaging agent that binds to the origami grid is designed to have a binding system that is more orthogonal than the Watson-Crick binding system of sequencing reactions. Such an orthogonal system is, for example, the Extended Alphabet Nucleobase Pairing System using Artificially Augmented Genetic Information System (AEGIS) phosphoramidite reagents available from Firebird Biomolecular Sciences LLC (www.firebirdbio.com). be. The system provides Z:P and S:B base pairs that are orthogonal to the Watson-Crick A:T and G:C base pairs used in the sequencing system of the invention.

In some embodiments, oligos (e.g., oligos of defined 3-base length) can be attached at low temperature or high salt, resulting in a large number of sites, some of which are not resolvable. ) can be combined. In some embodiments, to identify the location of binding, the fluorescent label is bleached so that the precise location of each can be determined by single molecule localization. For example, Neely et al Nucleic Acids Res. 2014 Apr;42(7):e50 and US Patent Application No. 13/701,628 (filed December 3, 2012, incorporated herein by reference). In this non-transient binding approach, it is possible that binding of one oligo can interfere with binding of overlapping oligos. Multiple cycles are used to address this. The bound oligos of the first set are melted by temperature and/or chemical denaturation, then binding is initiated again, allowing locations blocked in the first cycle to bind in the second cycle, etc. enable the possibility of This is optionally repeated for more cycles to allow more previously blocked sites to bind. Similarly, in some embodiments, coupling is performed using stochastic optical reconstruction microscopy (STORM), e.g., US Pat. 073,035), turning on only some of the fluorophore signals at any given time. In some embodiments, this is repeated multiple times to maximize coverage of the sequence.

The rate of conjugation can be increased by increasing the oligo concentration, increasing the conjugation temperature, and/or varying the identity and concentration of salt and volume excluding agent. In some embodiments, the volume excluding agent is selected from the group consisting of hydroxypropylmethylcellulose (HPMC), hydroxyethylmethylcellulose (HEMC), hydroxybutylmethylcellulose, hydroxypropylcellulose, methylcellulose, and hydroxylmethylcellulose, and PEG-800 is , at concentrations ranging from about 0.002% to about 15% by weight. In addition, divalent cations such as MgCl2 at concentrations of 100-600 mM have an accelerating effect on binding kinetics.

In some embodiments, an additional means of increasing the rate of binding is by taking measurements in the presence of flow. Therefore, with a flow cell volume of up to 50 ul, a flow rate of 1 μl per minute can increase the binding rate. In some embodiments, the flow is turbulent. In some embodiments, turbulence is induced by the presence of rods or ridges protruding from the surface, a herringbone pattern on the top surface of the flow cell, or the presence of beads or microstructures in the solution that make the flow turbulent. In addition to increasing the binding rate, optimizing the flow process also increases the efficiency of reagent exchange and ensures that residual oligos from previous cycles are minimized. In some embodiments, one or more washes with clean buffer are required during the exchange process from one oligospecies to the next, during which oligoprobes diffuse from the surface, Time is required to reach equilibrium concentrations. In some embodiments the time is 1 minute and in other embodiments the time is 10 minutes. In some embodiments, 10-100 volumes of buffer are passed through the flow cell to ensure removal of residual oligos. In some embodiments, movement of the probe outside the TIRF range is facilitated, for example, by applying an electric field that causes ver-charged oligos to move to the positively biased electrode, thus reducing the time. One or more of the various processes: time, turbulence, amount of buffer exchanged, and electric field can be combined. In some embodiments, some residual oligos are acceptable. This is because the identities of the previous oligos are known and the assembly algorithm can take their minor presence into account.

In some embodiments, degenerate positions are not used and the desired stability of the oligonucleotide is obtained by properly manipulating conditions (e.g., low temperature, high salt), or is itself sufficient Stable (eg, gamma PNA, etc.) may be obtained by using oligo chemistry, or conjugates such as spermine or stilbenes may be added to the ends to increase the stability of short oligonucleotides.

In some embodiments, hybridization is degenerate and uses universal bases such as nitroindole or deoxyinosine rather than using a library of oligonucleotides containing all possible sequences at undefined positions. can be improved by These universal bases can be specified at positions along the sequence of oligos purchased from various vendors. In some embodiments, some positions are occupied by a library of nucleotides and other positions are occupied by universal bases. Universal bases can use lower concentrations of oligoprobes to reduce the complexity of the mixture.

Due to the high one base encoding complexity of the oligos used, the concentration of the oligo library used had to be increased, so instead of the concentration of 10 nM, concentrations of 1 uM and above had to be used; As this creates a large background, in some embodiments a FRET mechanism such as from an intercalating dye is used and an intercalating labeling scheme (no FRET) or oligos are fluorogenic labels that fluoresce upon hybridization. be labeled.

In some embodiments, all 64 possible oligos are added simultaneously and differentially labeled at two defined bases. In some embodiments, 16 differential labels are available, so the 64 libraries are divided into four 16 libraries. Therefore, sequencing is completed in only 4 cycles. In other embodiments, 4 labels are used, allowing 4 oligos to be added together, requiring 16 cycles to be performed. These 3-base-long hybridizations can be performed in a buffer containing 4×SSC, or 2.4 M TMACl or 3.5 M TMACl, LiTCA, GUCN. These may serve to better discriminate discrepancies and/or equalize the effects of base composition.

Improved temporal resolution.
In some embodiments, the transient binding process can be sped up by adjusting various biochemical parameters such as salt concentration. There are some high frame rate cameras that can be used to match the speed of binding, often with a limited field of view to get faster readout from a subset of pixels. . One alternative approach is to use galvonometer mirrors to temporally disperse sequential signals to different regions of a single sensor or to separate the sensors, the latter being the The full field of view can be utilized, but the overall temporal resolution increases when scattered signals are compiled. The ability to reject multiple signals within a diffraction-limited spot during imaging cases allows the process to run faster and accommodate high binding rates of probes.

Avoidance of DNA Photodamage In some embodiments, it is advantageous to have fluorescent moieties attached to oligonucleotides via protein to reduce the effects of photodamage on nucleic acids to be sequenced. In some embodiments, the effect of the protein moiety is to provide protection to the oligo and target sequences from various adverse effects of fluorescent labeling. Some of these adverse effects, such as oxidative damage, can be overcome by including additives in the reaction solution, such as reducing agents or redox systems. However, other detrimental mechanisms such as electron transport or tunneling effects may not be prevented by the additive. In some embodiments, the reducing agent or redox system is physically linked to the oligo. In some embodiments, the protein is streptavidin. Fluorescently labeled versions of streptavidin are available, eg, streptavidin-phycoerythrin, which includes streptavidin-phycoerythrin conjugated to another dye that produces a wavelength shift by FRET. Streptavidin then also binds to one or more biotinylated oligonucleotides through the well-known biotin-streptavidin interaction. Various closely related proteins, avidin, neutravidin can also be used. Streptavidin has multiple dyes attached. Other suitable proteins include ubiquitin and SNAP-tag proteins. Molecules other than proteins can also be used if they are empirically found to be able to provide a shield around the fluorochrome to prevent damage.

Thus, in some embodiments, the sequencing reagents comprise a transiently binding nucleotide/oligonucleotide attached to a first position on the protein and at least one fluorescent nucleotide/oligonucleotide attached to a second position on the protein. and a dye component comprising a dye moiety.

Single Cell Resolution Sequencing In various embodiments, the method further comprises sequencing the genome of the single cell. In some embodiments, a single cell does not contain association with other cells. In some embodiments, single cells are attached to other cells in clusters or tissues. In some embodiments, such cells are disaggregated into individual non-adherent cells.

In some embodiments, the invention includes a method for sequencing a polynucleotide, the method comprising the steps of:
i) introducing one or more cells into the flow cell;
ii) treating the cell to release the polynucleotide;
iii) extending the released polynucleotides in a flow cell;
iv) performing a sequencing reaction using the extended polynucleotide as a template/sequencing target.

In some embodiments, the invention includes a method for sequencing a polynucleotide, the method comprising the steps of:
i) introducing one or more cells into a micro-container;
ii) treating the cells to release the polynucleotides;
iii) releasing the contents of the container into the flow cell;
iv) extending the polynucleotide;
v) performing a sequencing reaction using the elongated polynucleotide as a template.

In some embodiments, a method is provided for sequencing a polynucleotide, the method comprising the steps of:
i) exposing the cells to a flow cell, the flow cell comprising an inlet and an outlet;
ii) extracting polynucleotides from the cells;
iii) attaching the polynucleotides to the surface of the flow cell such that at least a portion of the polynucleotides are individually resolvable;
iv) exposing an oligo to said polynucleotide;
v) identifying the binding site of the oligo on the polynucleotide.

In some embodiments, the cells are disaggregated and then fluidically transferred (e.g., by using a pipette) to the inlet of a structure (e.g., a flow cell or microwell) where the polynucleotides are elongated. . Disaggregation can be done by pipetting the cells, applying proteases, sonication, or physical agitation. In some embodiments, the cells are disaggregated and then fluidically transferred to a structure where the polynucleotides are elongated.

In some embodiments, single cells are isolated and polynucleotides are released from the single cells such that all polynucleotides from the same cell remain in close proximity to each other and are isolated from other cells. Placed in a different location than where the contents are placed. In some embodiments, the trapping structures described in Lab Chip, 2006, 6, 1445-1449 are used.

In some embodiments, single cells are captured, the contents released, and then elongated. In some embodiments, single cells are ruptured into individual channels, each individual cell is reacted with a unique tag sequence via transposase-mediated integration, and the polynucleotides are then combined into the same mixture. sequenced in The transposase complex is in droplets that are transfected into cells or fused to droplets containing cells.

In some embodiments, aggregates are small clusters of cells, and in some embodiments the entire cluster is tagged with the same sequencing tag. In some embodiments, the cells are not aggregated and are free floating cells such as circulating tumor cells (CTCs) or circulating fetal cells.

In single cell sequencing, there is a problem of cytosine to thymine single nucleotide variants caused by spontaneous cytosine deamination after cell lysis. This is overcome by pretreating the samples with uracil N-glycosylase (UNG) prior to sequencing. (for example, as described in Mol Diagn Ther. 2014 Oct;18(5):587-593)

Cell-Specific Indexing of Polynucleotides In various embodiments, the method is further applied to sequencing polynucleotides from a plurality of cells (or nuclei), each polynucleotide containing information about its cell of origin. hold.

In certain embodiments, transposon-mediated insertion occurs intracellularly and each insertion contains a unique ID sequence tag as a marker of the cell of origin. In other embodiments, transposon-mediated insertion occurs within a vessel in which single cells are isolated (eg, a vessel containing agarose beads, oil-water droplets, etc.). A unique tag indicates that all polynucleotides bearing the tag must come from the same cell. All genomic DNA and/or RNA can then be extracted, mixed and extended. Then, if the SbS (or any other sequencing method) is from PBS or a promoter, the first sequence it gets is from the cell identification sequence, followed by the sequence of the polynucleotide. It is preferred to keep cell identification tags short. For 10,000 cells (e.g., from a tumor micropsy), about 65,000 unique sequences can be provided by 8 nucleotide long identifier sequences, and about 1 million unique sequences can be provided by 10 nucleotide long identifier sequences. It can be provided by an identifier sequence.

This same indexing principle applies to non-cellular (e.g., samples (from different individuals).

Thus, in some embodiments, the method comprises:
1) isolating the contents of the cells;
2) performing transposon-mediated insertion to insert the cell's unique sequence tag into the cell's polynucleotide;
3) immobilizing the polynucleotides in the cells;
4) performing the sequencing method of the invention, including reading the sequence of the tag and the sequence of the polynucleotide.

In some embodiments, the polynucleotide is RNA and the cDNA copy is sequenced. In such embodiments, tagging may involve cDNA synthesis using a primer containing the tag sequence.

In some embodiments, several tag sequences are used to keep the amount of sequence short so that more sequence reads can contribute to the sequencing of the polynucleotide sequence itself. distributed over the site of Here, a plurality of short identifier sequences are introduced into each cell or vessel, eg three. The origin of the polynucleotide is then determined from the bits of the tag distributed along the polynucleotide. Thus, in this case, the tag bit read from one location may not be sufficient to determine the cell of origin, but is sufficient to make multiple tag bit determinations.

Sequencing by Multiple Methods In some embodiments, after sequencing by transient binding, sequencing by a second method can be initiated on the same molecule. For example, longer, more stable oligonucleotides can bind to initiate sequencing-by-synthesis.

Target Polynucleotide The term polynucleotide refers to DNA, RNA, and variants or mimetics thereof, and may be used interchangeably with nucleic acid. A single target polynucleotide is one nucleic acid strand. A nucleic acid strand may be double-stranded or single-stranded. A polymer can comprise a full-length naturally occurring polynucleotide such as long non-coding (lnc) RNA, mRNA, chromosomal, mitochondrial DNA, or it is a polynucleotide fragment of at least 200 bases in length, but preferably at least It is several thousand nucleotides long, and in the case of genomic DNA, it is more preferably several hundred kilobases to several megabases long.

In various aspects and embodiments, the present invention provides for obtaining long chain length polynucleotides, e.g., by preserving substantially the natural length of the polynucleotide during extraction from a biological environment; Polynucleotides are arranged in a linear fashion so that their location along the length of the polynucleotide can be traced with little or no ambiguity, and ideally they are linearized, stretched or elongated. before or after placing the target polynucleotide in a linear state.

In various embodiments, the single target polynucleotide is a chromosome. In various embodiments, a single target polynucleotide is about 102, 103, 104, 105, 106, 107, 108, or 109 bases long. Wheat chromosome 3b is 995 million bases long, while the largest human chromosome 1 is 249 million bases. In various embodiments, a single target polynucleotide is single stranded. In various embodiments, a single target polynucleotide is double-stranded.

A single target nucleotide is preferably a naturally occurring polynucleotide. A single target nucleotide can be double-stranded, such as genomic DNA. A single target polynucleotide can be single-stranded, such as mRNA. A single double-stranded target polynucleotide can be denatured such that each strand of the duplex is available for binding by an oligo. A single polynucleotide is damaged and repaired. In various embodiments, a single target polynucleotide is the entire length of chromosomal DNA. Full-length chromosomal DNA can remain in cells without extraction. Sequencing can be performed in cells where chromosomal DNA undergoes a folding pathway during interphase. Stable binding of oligos in situ has been demonstrated:B. Beliveau, A et al Nature Communications 6 7147 (2015). Such in situ binding oligos and their nanometric positioning in 3D space can allow one to determine the sequence and regional arrangement of chromosomal molecules within a cell. The present invention differs in that the binding of oligos is not stable and transient, allowing ultra-fine resolution of chromosomal regions. Similarly, the location and quantity of RNAs (eg, microRNAs, mRNAs, lncRNAs) can be determined by their binding patterns to binding oligos.

Reaching the Limits of Sensitivity Once a molecule is released from the cell, virtually all of it becomes available for sequencing. First, where relevant, the regions are passivated to prevent the molecules from sticking. Substantially all molecules are then captured in one of two ways. For the first time, molecules continue to flow in the channel and are stochastically trapped over the length of the channel, long enough that virtually all molecules are eventually trapped. Thus, the channel can be a serpentine channel, allowing very long lengths to be packed into a small space. Second, it allows all molecules released from one or more cells to flow and separate sufficiently to be individually resolvable in 3D space. The solution is then jellified. ie, a solid-gel transition, whereby molecules become immobilized in 3D space. Molecules can then be subjected to the sequencing methods of the invention and the 3D space can be interrogated by 3D sectioning methods such as light sheet or spinning disk microscopy and 3D single molecule localization.

Capturing Polynucleotides on Surfaces In some embodiments, target polynucleotides are attached to surfaces via hydrophobic interactions with their termini. In some embodiments, the contacting of the polynucleotide with the surface is performed under stringent conditions such that the ends are cleaved and hydrophobic single strands are exposed.

In some embodiments, rather than using a flow cell to create an extension or flow extension through a receding meniscus, the coverslip is immersed in a trough with polynucleotides and the coverslip is removed from the solution. Polynucleotides are combed when pulling out.

In some embodiments, an electric field can be used to attract negatively charged polynucleotides (so that a greater proportion of the sample can be sampled), and in some cases oligoprobes, to the surface.

Immobilization of Polynucleotides on Surfaces Immobilizing one end and allowing it to flow allows rocking, extension and contraction, and the like. Due to variations in the degree of stretching (contraction and expansion) along the length of the polymer, the xy coordinates cannot guarantee a specific position of the target from one cycle to the next.

In some embodiments, it is desirable that the relative positions of multiple locations along the polymer are not subject to variation in order to obtain reproducible, high precision and accurate position determination. In such cases, the elongated molecule must be immobilized or anchored to the surface by multiple contact points along its length.

Thus, in some embodiments, the polymer contacts the surface through multiple interactions (performed by molecular combing techniques (Michalet et al, Science 1999)). Then, under conditions of use, the relative location is known to be fixed. I haven't seen a case like this, but consider outliers where some detach from the surface and reattach.

Thus, in some embodiments, long polymers are analyzed and the long polymers form multiple interactions with the surface or matrix.

In some aspects, the invention includes methods of detecting rare variants that involve multiple matching of each base on a single molecule. Each transient binding event matches one or more bases, and each base is matched by multiple binding events. Further, in some embodiments, each base is matched by multiple oligonucleotides that overlap in sequence (eg, as a tiling series).

Polynucleotide Extension In various embodiments, the method further comprises extracting a single target polynucleotide molecule from a cell, organelle, chromosome, virus, exosome, or bodily fluid as an intact target polynucleotide. Target polynucleotides often occupy their native folded state. For example, genomic DNA is highly concentrated in chromosomes, whereas RNA forms secondary structures. In various embodiments of the invention, steps are taken to expand the polynucleotide. In various embodiments, the target polynucleotide molecule is provided in a linear state so that its backbone can be traced. In various embodiments, the target polynucleotide molecule is elongated. Such extensions can be equal to, longer than, or shorter than the crystallographic distance (0.34 nm separation from one base to the next). In some embodiments, the polynucleotide is extended beyond the crystallographic distance.

In various embodiments, the target polynucleotide is placed in a gel or matrix. In various embodiments, target polynucleotides are extracted into a gel or matrix. In various embodiments, target polynucleotides are extracted in microfluidic flow cells or channels.

In various embodiments, the target polynucleotide molecule is immobilized on a surface. Polynucleotides can be oriented parallel to a plane or perpendicular to a surface. If they are parallel to the plane, their length can be imaged over a series of adjacent pixels in a 2D array detector such as a CMOS or CCD camera. If they are perpendicular to the surface, their length can be imaged via light sheet microscopy or scanning disk confocal microscopy or variants thereof.

In some embodiments, the polynucleotide is extended via molecular combing (see, eg, Michaelet et al, Science 277:1518 (1997) and Deen et al, ACS Nano 9:809-816 (2015)). is being used). This can allow parallel stretching and unidirectional alignment of millions and billions of molecules. In some embodiments, molecular combing is performed by moving a fluid/liquid front on the surface. In some embodiments, molecular combing is as described in Petit et al. Nano Letters 3:1141-1146 (2003), or a modified version of the method, in the channel.

The shape of the air-liquid interface determines the orientation of the elongated polynucleotide. In some embodiments, the polynucleotide is elongated perpendicular to the air-liquid interface. In some embodiments, the target polynucleotide is attached to the surface without modification of one or both of its termini. In some embodiments, the terminus is trapped by hydrophobic interactions, and extension by a receding meniscus denatures portions of the duplex, resulting in additional hydrophobic interactions with the surface.

In some embodiments, the polynucleotide is extended via molecular threading (eg, described in Payne et al, PLoS ONE 8(7):e69058 (2013)). In some embodiments, molecular threading is performed after the target is single-stranded (eg, by chemical denaturants, temperature, or enzymes). In some embodiments, the polynucleotide is tethered at one end and then extended in fluid flow (eg, as described in Greene et al, Methods in Enzymology, 327:293-315). In some embodiments, the polynucleotide is tethered at one end and then stretched by an electric field (eg, as described in Giese et al Nature Biotechnology 26:317-325 (2008)).

In various embodiments, the target polynucleotide molecules are placed in a gel. In various embodiments, target polynucleotide molecules are disposed in microfluidic channels. In various embodiments, the target polynucleotide is attached to the surface at one end and elongated in flow.

In some embodiments, spreading is by electrophoresis. In some embodiments, unfolding is through nano-binding. In some embodiments, extension is due to hydrodynamic drag. In some embodiments, the polynucleotide is stretched within a cross-flow nanoslit (eg, described by Marie et al. Proc Natl Acad Sci USA. 110:4893-8 (2013)).

In some embodiments, rather than inserting a polynucleotide into a nanochannel through a microfluidic or nanofluidic flow cell, the channel is constructed in such a way as to electrically apply the surface on which the channel walls are formed. Polynucleotides are inserted into the open top channel by (see, eg, Asanov A N, Wilson W W, Oldham P B. Anal Chem. 1998 Mar. 15;70(6):1156-6). A positive bias is applied to the surface such that negatively charged polynucleotides are attracted into the nanochannel. Since the ridges of the channel walls do not contain biases, polynucleotides are less likely to deposit there, and materials that have contamination-resistant characteristics and are passivated with lipids, BSA, caesin, PEG, etc. can be made or coated with In some embodiments, polynucleotides that are attracted to a nanochannel are nanobound and thereby elongated within the channel. In some embodiments, after nanobinding, the polynucleotides are deposited onto the bias surface or onto a coating or matrix on the surface. The surface may comprise indium tin oxide (ITO).

In some embodiments, the polynucleotides are not all well aligned in the same direction, or they are not linear, but rather take curvilinear paths through 2D or 3D space and are well linearly aligned. The same kind of information can be obtained with aligned molecules, but the image processing task is more difficult and for molecules that take different orientations, they are more likely to overlap, leading to errors. However, this is a necessary evil when sequencing is performed intracellularly, in situ, on polynucleotides.

In various embodiments, the method further comprises releasing polynucleotides from single or multiple chromosomes, exosomes, nuclei, or cells into the flow channel.

In various embodiments, the walls of the flow channel comprise passivation to prevent accumulation of polynucleotides. In various embodiments, passivation comprises a coating of casein, PEG, lipids, or bovine serum albumin (BSA).

The terms elongated, extended, stretched, linearized and linearized can be used interchangeably and generally multiple binding sites are separated by nucleotides separated by a physical distance that more or less correlates with the number of Some uncertainty to the extent that physical distances are consistent with some bases can be tolerated. Physical distance does not correlate with the number of bases having the same ratio over the length of the polynucleotide if the extension or extension is not uniform along the length of the polynucleotide. This can occur to a negligible degree and can be effectively ignored or handled by the algorithm. If this occurs to any significant extent, other measures are necessary. For example, in some segments of the polynucleotide the stretch can be 90% of the crystallographic distance, while in other regions it diverges by about 50%. One way to handle it is to put the contiguous sequences together via an assembly algorithm. At one extreme, the algorithm does not need the distance data, only the order of the reads. Another way of dealing with this is to use an intercalating dye such as JOJO-1 or YOYO-1 to stain the length of the polynucleotide, and then the polynucleotide is too stretched in a particular segment. If not, more dye signal will be seen on the segment of the polynucleotide compared to the more extended segment. The integrated dye signal can be used as part of the equation to calculate the distance between origins.

In various embodiments, the target polynucleotide molecule is intact. If the target is native genomic DNA, it can be rendered single-stranded prior to oligonucleotide binding. This can be done by first elongating or extending the added polynucleotide and then adding a denaturing solution (eg, 0.5 M or 1 M NaOH) to separate the two strands. . Oligos can be modified so that they can form more stable duplexes. Oligos have free 3' ends from which extensions can occur to increase stability. In some embodiments, oligos may target specific hyper-frequent target sites in the genome (eg, as described in Liu et al BMC Genomics 9:509 2008).

Oligos can include libraries and are created using custom microarray synthesis. A microarray-generated library can contain oligos targeted to specific sites of the genome (eg, all exons or panels of a specific disease, such as a cancer panel). A microarray-generated library can contain oligos that are systematically linked to locations at regular distance intervals across the polynucleotide. For example, a library containing 1 million oligos will bind every 3000 bases. A library containing 10 million oligos can be designed to bind every 300 bases and a library containing 30 million oligos can be designed to bind every 100 bases. The sequences of oligos can be computationally designed based on the reference genome sequence. For example, if an oligo is designed to bind every 1000 bases, but after one or several rounds of nucleotide incorporation, the distance becomes apparent to diverge, then a structural polymorphism occurs compared to the reference. indicate that A set of oligos can be validated by first using them to originate polynucleotide sequencing from the reference itself, and oligos that fail to bind in place will be excluded from future libraries. can be omitted.

Detection of Tightly Spaced Signals Along Polynucleotides Several detection methods, such as scanning probe microscopy (including high-speed AFM) and electron microscopy, detect when a polynucleotide molecule is elongated across the detection surface. , can resolve nanometric distances. Moreover, super-resolution optical methods such as STED, stochastic optical reconstruction microscopy (STORM), super-resolution optical fluctuation imaging (SOFI) and single-molecule localization microscopy (SMLM) can measure such distances. can be resolved. Although encompassing these methods, the present invention specifically utilizes the SMLM approach, which is most similar to point integration for nanoscale topography (PAINT).

The present invention goes beyond simply localizing a single binding site to a short DNA target. A novel aspect of the present invention is the positioning of multiple binding sites of a single oligospecies along the length of a polynucleotide. Another novel aspect of the invention is to locate the binding of multiple oligonucleotide species on a polynucleotide. Another novel aspect of the present invention is to determine the distance between binding positions of a single oligonucleotide species or multiple oligonucleotide species. Another novel aspect of the invention is determining the nanometric location of multiple binding sites along a polynucleotide. Another novel aspect of the present invention is the assignment of probe binding events to specific polynucleotides present in an array of polynucleotides. Another novel aspect of the invention is the determination of the nanometric location of multiple binding sites of multiple types of chemical entities (e.g., sequence binding probes, epigenomic mark binding probes) along a polynucleotide. Another novel aspect of the present invention involves nanometric positioning of epigenomic binding probes to polynucleotides. Another aspect of the invention is to increase accuracy in detecting sequences by repetitive matching of sequences on a single polynucleotide. Another novel aspect of the present invention is the determination of the sequence of polynucleotides by locating a complete repertoire of oligonucleotides. Another novel aspect of the present invention is to determine the sequence of a target segment of a polynucleotide by determining the location of a tiling array of oligonucleotides.

Ordered Array Polynucleotides can be provided on a surface in a regular fashion such that the molecules are maximally packed within a given surface area and that they do not overlap. This creates an ordered arrangement of hydrophobic patches on a patterned surface, e.g., where the end of a polynucleotide (e.g., 1 Mbp long) binds, where the next patch is just beyond the end of the polynucleotide. It can be done by Alternatively, a spatially addressable array of oligonucleotides can be used to capture polynucleotides. Polynucleotides are single-stranded and have common sequences such as poly-A tails (eg, mRNA). Polynucleotides are double-stranded and have cohesive ends generated by restriction enzymes. For example, rare-cutting restriction enzymes (eg, Pmmel or NOTl) can be used to generate long fragments each containing common terminal sequences.

Ordered arrays can be made using nanofluidics. In some cases, arrays of textured nanotrenches or nanogrooves (e.g., 100 nm wide, 150 nm deep) serve to order long polynucleotides, allowing one polynucleotide to penetrate another. Eliminate. In another case, the nanopit array has long polynucleotide segments in the pits and long segments between the pits. Regular arrays can also be made.

Sequencing by Transient Probe Binding and Assembly In some embodiments of the invention, the sequencing reads themselves are not obtained. In the case of sequencing by transient probe binding, a read is the complement of an oligo hybridized to a specific location on the polynucleotide. At the first level, assembly is done from the sequence information gathered by the ligation of oligos. Accordingly, some embodiments of the invention include:
(i) extending the polynucleotide;
(ii) denaturing the polynucleotide (e.g. removing secondary structure if the target is RNA or separating the duplex if the target is double stranded DNA such as genomic DNA) thing),
(iii) adding a short oligoprobe that binds to the target with labile interactions;
(iv) determining the binding location of each short oligo probe.

In some embodiments, each oligo sequence is added one at a time. In some embodiments, an oligo has a tag whose identity can be decoded (eg, a sequence tag to which a set of orthogonal oligos can be bound or to determine its identity). In some embodiments, more than one oligo is added at a time. In some embodiments, as many oligos as decodable are added. For example, if 16 different codes are available, 16 oligo sequences each having one of the codes are added simultaneously. In some embodiments, substantially more oligos are added and differentiated by using optical barcodes such as DNA origami (described, for example, in Nat Chem. 10:832-9, 2012). . In some embodiments, a complete set of oligos is used, eg every 5 or 6 bases in length (optionally supplemented with degenerate or universal positions).

At the second level, the assembly of the entire chromosome is performed by duplication of the polynucleotides assembled at the first level. If sufficient long overlaps exist, haplotype phased assembly can be performed.

Transient Probe Binding Driven Through Competition Oligoprobe binding is a dynamic process in which the bound probe is constantly fluctuating (at a rate determined by various factors including temperature and salt concentration). Breathing must be understood and therefore there is an opportunity for one strand to be substituted for another. For example, in one embodiment, the complement of the probe is used to create a continuous competition between the stretched target DNA on the surface and the annealing to the complement in solution. In another embodiment, the probe has three parts. The first portion is complementary to the target, the second portion is partially complementary to the target and partially complementary to the oligo in solution, and the third portion is complementary to the solution. is complementary to the oligo in the

In some embodiments, toehold probes (e.g., as described in Nature Methods 10:865 (2013)) comprising partial duplexes that are competitively destabilized when bound to mismatched targets ( Toehold probe) is used (described, for example, in Nature Chemistry 5, 782-789 (2013)).

This method can ensure the accuracy of sequencing by transient probe binding. The method is
(i) extending the polynucleotide;
(ii) if the polynucleotide is not single stranded, rendering it substantially single stranded (e.g., by denaturation);
(iii) applying the repertoire of toehold probe sets to a target polynucleotide;
(iv) determining the binding location of one oligo from each toehold probe set of the repertoire;
(v) reconstructing the sequence based on the localization data of all toehold probes in the repertoire.

In some embodiments, toehold probes are used to ensure correct hybridization. In some embodiments, toehold probes are used to facilitate off-reactions.

Assembly of Short-Range Arrays and Joining to Create Long-Range Arrays In some embodiments, the localization accuracy or precision is not sufficient to stitch together alignment bits. A subset of probes are found to bind at specific localities, but precisely their order is difficult to reliably determine from localization data. In some cases, the resolution is diffraction limited. In some embodiments, short-range arrays within a local or diffraction-limited spot can be assembled by sequence overlap of probes located within the local or spot. Thus, for example, short-range sequences are assembled by using information about how the individual sequences of a subset of oligos overlap. Short-range sequences constructed in this manner can then be spliced together into long-range sequences based on their order on the polynucleotide. Thus, long-range sequences are obtained by combining short-range sequences obtained from adjacent or overlapping spots.

Homopolymers and short tandem repeats There is the problem of homopolymers, where it is difficult to enumerate the number of bases in a homopolymer, eg, 10 bases, when the length is greater than the length of the oligo. Also, short tandem repeats can be difficult to enumerate. This can be dealt with in several ways, e.g. one of the following:

1. To increase the accuracy of position determination so that the exact extent to which iterations extend can be determined.

2. The kinetics of binding to the region differ when multiple tandem copies (of any repeat sequence) are present, or even when partial copies are present. Copy number can be estimated by the increase in binding rate and off-rate is affected as an oligo bound at one site can migrate to another adjacent site without passing through 3D space.

3. Also, the number of bases between the two strands of the duplex must match. A mismatch indicates inaccuracy.

4. For homopolymers as well as 5-base long repertoires, longer homopolymer oligos (eg, 6 A's, 7 A's, 8 A's, etc.) can be added at the appropriate Tm.

5. Take into account the reference genome.

6. To provide the possibility that homopolymers or repeats are of constant length.

Polynucleotide Identification The identity of a polynucleotide can be determined by the pattern of probe binding along its length. Identity can be of RNA species, of RNA isoforms. It may also be the reference location to which the polynucleotide corresponds.

Localization of Epigenome Modifications Methylation analysis can be performed orthogonally to sequencing. In some embodiments, this is done prior to sequencing. Anti-methyl-C antibodies or methyl-binding proteins (the methyl-binding domain (MBD) protein family, including MeCP2, MBD1, MBD2, and MBD4), or peptides (based on MBD1), can bind to polynucleotides and via labels After their locations have been detected by , they are removed (eg, by adding high salt buffers, chaotrophic reagents, SDS, proteases, urea, and/or heparin). Preferably, reagents are transiently bound by facilitating on-off binding or by using reagents that have been engineered to transiently bind.

A similar approach is taken for other polynucleotide modifications, such as hydroxymethylation or sites of DNA damage, for which antibodies are available or can be produced. After the sites of modification are detected and the modified binding reagents are removed, sequencing can begin. In some embodiments, anti-methyl antibodies, anti-hydroxymethyl antibodies, and the like are added after the target polynucleotide is denatured to be single stranded. This method is very sensitive and can detect single modifications on long polynucleotides.

There is no reference epigenome for DNA modifications such as methylation. To be useful, a methylation map of an unknown polynucleotide must be linked to a nucleic acid sequence or sequence-based map. Thus, the epimapping method of the invention can be correlated with the sequence bits obtained by oligoconjugation to provide context to the epigenome map. In addition to sequence reads, other means of obtaining sequence information can be coupled with epigenome maps. This includes nicking endonuclease-based maps, oligo-ligation-based maps, and denaturation and denaturation-renaturation maps. In some embodiments, transient binding of one or more oligos can be used to map polynucleotides. In addition to functional modifications to the genome, the same approach can be applied to other features that map to the genome, such as DNA damage and protein (eg, transcription factor) sites or ligand binding.

In the present invention either sequencing or epigenome sequencing can be performed first. In some embodiments, both can be done simultaneously. For example, antibodies to specific epimodifications can be differentially encoded from oligos, and using conditions such as low salt results in transient binding of both types of probes.

In some embodiments, antibodies can be used on chromosomes or chromatin to detect not only modifications on DNA, but also modifications on histones such as histone acetylation and methylation. The location of these modifications can be determined by transient binding of the antibody to a chromosomal or chromatin location. In some embodiments, antibodies are labeled with oligotags that do not bind transiently, but can be permanently or semi-permanently anchored to their binding sites. In this case, the location can be detected by using transient binding of complementary oligos to the antibody-tagging oligos.

Processing Samples for Read Placement In some embodiments, a gel overlay is applied after the polynucleotides are extended. After extension and denaturation on the surface, the polynucleotides (double-stranded or denatured) can be covered with a gel layer. Alternatively, the polynucleotides are elongated while already in the gel environment. In some embodiments, the polynucleotides are elongated and then loaded into a gel. For example, when a polynucleotide is attached at one end to a surface and stretched in a stream or by an electrophoretic current, the surrounding medium can be cast into a gel. This can be done by including acrylamide, ammonium persulfate, and TEMED in the stream, which, when set, becomes polyacrylamide. Alternatively, a heat sensitive gel can be applied. In some embodiments, the ends of the polynucleotide can be modified with an acrylidite that polymerizes with acrylamide. An electric field can then be applied that elongates the polynucleotide towards the positive electrode, given that the backbone of native polynucleotides is negative.

In some embodiments, the sample is crosslinked to the matrix of its environment, which is the cellular environment. For example, when sequencing is performed in situ in cells, polynucleotides are cross-linked to the cell matrix using heterobifunctional cross-linkers. This has been done when sequencing is directly applied intracellularly using techniques such as FISSEQ (described, for example, in Lee et al. Science 343:1360-3 (2014)).

In some embodiments, panels of probes are used to enable targeted sequencing. When targeted sequencing is performed, only a subset of polynucleotides (e.g., the whole genome or transcriptome) from a complex sample needs to be analyzed, so that polynucleotides are spread over the surface or matrix at a higher than usual density. can be placed on. Therefore, even if there are some polynucleotides stretched into the diffraction limited space, if a signal is detected it is likely to be from only one of the target loci. It then allows the imaging necessary for targeted sequencing to occur simultaneously with the targeted sample fractionation. For example, if less than 5% of the exon-containing genome is targeted, the density of polynucleotides can be 20-fold greater, and thus imaging time can be 10-fold shorter than if the whole genome is analyzed.

In some embodiments, the portion of the genome targeted is a specific locus. In other embodiments, the portion of the genome targeted is a panel of loci, eg, genes associated with cancer, or genes within chromosomal intervals identified by genome-wide association studies. Target loci may also be the dark matter of the genome, typically heterochromatin regions of the genome that are repetitive, as well as complex loci near repetitive regions. Such regions include the telomeres, centromeres, and short arms of acrocentric chromosomes, as well as other low-complexity regions of the genome. Conventional sequencing methods cannot address repetitive parts of the genome, but with high nanometric precision, the method of the present invention can address these regions exhaustively.

An advantage of the present invention is that by splicing together contiguous or overlapping sequence information obtained by conjugation of short oligos instead of actually performing each long read, which is expensive and time consuming, a long read can be obtained. Being able to get leads. Multiple short 3-, 4-, 5-, or 6-base bits of sequence information are obtained simultaneously along the length of a single polynucleotide molecule, so that they are all ligated, binding the polynucleotide on and off When saturated with oligos, their nanometric position, resolution, and order reveal the sequence of the entire molecule. Sequencing of polynucleotides is currently used because multiple bits of sequence information are obtained simultaneously, rather than a single long read (e.g., PacBio sequencing) obtained by SbS reactions from one place to another on the molecule. takes less time than the method of

Another major advantage of the present invention is that all kinds of structural variation (including microarray-based techniques, balanced copy number variations and inversions that are difficult for current mainstream approaches), both large and small. without being able to detect at resolutions and scales not approachable by microarrays, cytogenetics, or other current sequencing methods.

Furthermore, the method allows sequencing across repetitive regions of the genome. For conventional sequencing, the problem of reads across such parts of the genome is that such regions are not well represented in the reference genome, and Illumina, Ion Torrent, Helicos/SeqLL, and Complete Genomics Techniques such as typically address large genomes by aligning to a reference rather than by de novo assembly. Second, if the reads do not span the entire repetitive region, it is difficult to assemble the region via shorter reads across the region. This is because it can be difficult to determine which of multiple possible alignments between the repeat region on one molecule and the repeat region on another molecule is correct. Misalignment can lead to shortening or lengthening of repeat regions within the assembly. In the sequencing methods of the invention, if there is complete or near-complete coverage of a single molecule by multiple reads performed either simultaneously or one after the other (if the polynucleotide itself spans the repeat region ) can build assemblies spanning the repeat regions. The methods of the invention can be applied to sufficiently long polynucleotides that span the repeat region. A 1-10 Mb polynucleotide is sufficient to span most repetitive regions of the genome. The method of the present invention is shown in Freitag et al. and attempted (for example, in Rasmussen, et al Lab on a Chip, 11:1431-3 (2011)). , can be applied to full-length chromosomes of polynucleotides from eukaryotic genomes, and thus can span all or most of the genome's possible repeat lengths.

Preservation of Polynucleotide In Situ Region Information In some embodiments, the sequencing methods of the invention are applied in situ, within a cell. For RNA and genomic DNA, sequencing can be initiated after denaturation. In the case of mRNA, sequencing can optionally be initiated after denaturing secondary structures. In some embodiments, sequencing is performed on slices of cells obtained, for example, by microtome.

By performing the sequencing method of the invention in a cell, not only is it possible to sequence the genomic DNA, but it is also possible to establish the location of the genomic DNA within the cell. Furthermore, when applied to tissues, it allows the distribution of somatic variants in the cells of the tissue analyzed, as well as differences in chromosomal composition. This is very important. This is because different parts of the genome interact within the cell. For example, enhancers contact gene regions through loops, allowing in situ genomic analysis to detect such interactions. Also, the organization of the genome or individual chromosomes within the cell can be visualized or determined. Additionally, the process can be performed on cell populations (eg, fibroblasts or neurons) grown in culture dishes or on tissue sections. For cells or tissues that are substantially three-dimensional, sequencing can be performed on slices of the cells or tissues. In some embodiments, chromatin DNA within the cell undergoes denaturation (eg, using 0.5 M NaOH) followed by transient binding interactions of the invention. RNA can be removed by adding RNAse. In some embodiments, transient binding interactions are detected from binding of intercalating dyes to duplexes formed by unlabeled probe binding. In some embodiments, the probe is labeled and binding is detected via FRET between the dye intercalating into the duplex and the label on the probe.

Identity and Spatial Location of Bound Probes One aspect of the present invention is to preserve the identity and spatial location of probes transiently attached to each of a plurality of sequence fragments. The location of probe attachment along the polynucleotide is determined by the location-sensitive aspect of the detector. When using a 2D detector such as a CCD, the location is determined by the xy coordinates of the pixels onto which the image is projected. Several computational filters are used to remove spurious binding of labels from true detection events. The label must correlate with a line through some origin to indicate the path followed by the polynucleotide. If the path is straight, the position through the filter is on a straight line.

The identity of probes bound to biopolymers can be determined in one of two ways. When multiple probes are differentially labeled and used together in a reaction volume, the identity of the oligos can be used to detect code labels (detected at specific locations along the polynucleotide). determined by This can be done by irradiating four different lasers, one for each label, using four different emission filters, one for each label, or using different combinations of lasers and emission filters. can. In this case, an image is taken at one wavelength, mapped to the polynucleotide, and so on. Instead of detecting four labels sequentially, four labels can be detected simultaneously. This can be done by using a prism to split the emission onto different locations on the 2D detector. This can also be done by using dichroic mirrors and emission filters, one for each of the four labels, to split the emission wavelengths into four channels. Finally, the emission wavelength can be split between any number of channels and the intensity of each signal detected in each channel to give a label-specific signature. In some embodiments, first a signature across the channel for each fluorophore is obtained and then the signature is used to identify the label and thus the sequence from the recorded data.

Sequencing of tags In some embodiments, segments of DNA are tagged in situ (i.e., along the length of genomic DNA or within a cell), and the location and identity of tags are determined according to the present invention. Determined using transient binding methods. The tags can be sequence tags and can be designed so that only a small pool of transiently binding oligos can be used to determine their identity. In some embodiments, once the location and identity of the tags are determined, the polynucleotides can be extracted from the cell or released from the surface while the sequence tags remain attached to the polynucleotide fragments. is. Polynucleotides+sequence tags can optionally be amplified and sequenced using any sequencing method (eg, high-throughput Illumina sequencing). From the sequencing output, the sequence of the tags can be used to localize specific segments of the sequence to specific locations within the genome.

Dye Photophysics Detection of single fluorescent dyes is sensitive to the peculiarities of each particular dye type. Certain dyes have photophysical characteristics such as dark state, fast photobleaching, and low quantum yield, which exclude them from candidate dyes. The chemical characteristics of the dyes, their structure, and whether they carry a charge also affect how well they can be incorporated and how nonspecifically they bind. The choice of dyes is based on the avoidance of poor photophysical and chemical problems, and how well they can be excited and detected in the instrument set-up of choice, and how well they differ from the other three dyes. can be identified, depends on. Other features such as FRET efficiency or quench efficiency are also important in some embodiments of the invention. Fortunately, there are several dye manufacturers and a large list of dyes to choose from. Four dyes that can work well are Atto488, Cy3b, Atto655, and Cy7 or Alexa594. Another four good single-molecule dyes that can be used in the present invention are described by Sobhy et al. [Rev. Sci. Instrum. 82, 113702 (2011), 405 nm, 488 nm, 532 nm, and 640 nm lasers can be used to excite Atto425, Atto488, Cy3, and Atto647N, respectively. Each label indicates the identity of a different base. Certain dyes require a pulse of light of a wavelength different from the peak excitation wavelength to release them from the trapped photophysical state. Several redox systems are known that minimize photophysics. Trolox, beta-mercaptanol; glucose, glucose oxidase and catalase; protocatechuate and protocatechuate-3,4-dioxygenase; methylviologen and ascorbic acid. (See Ha and Tinnefeld, Annu Rev Phys Chem. 2012; 63:595-617). As an alternative to continuous illumination, in some embodiments the sample is subjected to pulsed or stroboscopic illumination, which reduces photobleaching.

Imaging An image of the polynucleotide is projected onto an array of 2D detectors (eg, charge-coupled device (CCD) cameras), from which it is digitized and stored in memory. The images stored in memory are then subjected to image analysis algorithms. These algorithms can distinguish signal from background, monitor changes in signal properties, and perform other signal processing functions. Memory and signal processing are performed off-line on the computer or in dedicated digital signal processing (DSP) circuits controlled by a microprocessor or field programmable gate array (FPGA).

Imaging When a fluorescent label is transiently bound to an elongated polynucleotide, it can be detected by taking an image with a 2D array detector. The next task is to extract the sequencing data from the captured images. One seeks to align the stretched molecules along one axis of the 2D array detector, along either the columns or rows of pixels of the 2D array detector (eg, CCD or CMOS sensor).

When time-delayed integration (TDI) imaging or line scanners are used and continuous image strips are obtained (for example, as described in Hesse et al. Anal Chem. 2004 Oct 1;76(19):5960-4), One embodiment of the invention involves matching the direction of image movement (or stage movement) with the linear direction of polynucleotide elongation. This makes it possible to obtain continuous images of very long polynucleotides (hundreds of microns, millimeters, or tens of millimeters long) and requires extra effort in image stitching, which can also lead to errors in the image interface. This is to avoid having to expend computational resources.

In some embodiments, the systems of the present invention include methods for obtaining rapid and accurate long-range images of polymers,
i) stretching the polymer in one direction;
ii) using a 2D detector with time delay integration (TDI);
iii) moving the sample in the direction of the DNA extension relative to the detector;
iv) reading lines in the direction of travel, where long polymer molecules are analyzed from a single long image swath/strip (without the need to stitch separate frames).

In some such embodiments, the travel speed is a fraction of the readout speed. This causes multiple signal events to be captured by the sensor element from each location before the next location on the surface is imaged by the sensor. Therefore, multiple binding events can be detected. A certain number of consecutive pixels capture a temporal event around a location before the location shifts enough to capture the event from an adjacent location.

In other cases, ultra-long polynucleotides are folded into a serpentine pattern due to constraining within serpentine nanochannels (see Frietag et al.) and then placed within the frame of a single CCD or CMOS. is imaged with

If the stretch direction does not correspond to the axis of the 2D array detector, a first image processing step is performed to transform the image so that the lines are aligned along the axis in the image. In some embodiments of the invention, the polynucleotides are linearly aligned in a single direction, and the location of the polynucleotides can be tracked by examining pixels that are activated along the linear axis. Not all pixels need to be activated, just the number that allows tracking of polynucleotides beyond background/non-specific binding to the surface is sufficient. Signals not along the axis are ignored. In some embodiments, the backbone of the polynucleotide is labeled. For example, conjugation of fluorescent dyes such as Sybr Gold can be used to track polynucleotides. Conjugated cationic polymers can be used in place of conventional DNA stains.

Fluorescence Lifetime and Background Scatter Rejection Different bound probes (including transiently bound ones) can be encoded with luminescent entities (eg, dyes) with different fluorescence lifetimes. The fluorescence lifetime of a molecule is the average time a molecule spends in an excited state before returning to the ground state by emission of a fluorescence photon.

Pulsed laser excitation can then be used to excite the dyes, and a time-correlated single-photon detector (or other detector capable of high-resolution time-correlated detection) can be used to detect the fluorescence of each dye. Discover lifespan profiles. The detector is an am-enhanced CCD (IMCCD). Also possible is an array of point detectors that can bin the arrival times of photons. Also, the detection time of luminescence can be gated out such that early (picosecond range) fluorescence due to light scattering is gated out, and fluorescence emitted by the dye above background is detected. be done.

Although the method of the present invention can be performed with or without an evanescent field and with relatively high concentrations of oligos, background fluorescence due to scattering is eliminated by rejecting early timeframes of fluorescence. be. Therefore, using pulsed excitation and time-gated or time-correlated detection kills two birds with one stone: one encodes sequencing reference reagents (nucleotides, oligos) with labels distinguished by different fluorescence lifetimes. and another can reject background fluorescence due to scattering.

Background fluorescence due to dyes in solution (not scattering) still remains, but this can be reduced by using evanescent waves, zero-mode waveguides and/or RET mechanisms for excitation. Alternatively, reagents can be quenched (eg, molecular beacons, etc.).

An exemplary setup includes a wide-field fluorescence lifetime imaging microscope (FLIM) system, using a 405 nm pulsed laser diode to illuminate the sample and collect the shifted fluorescence signal with an ICCD camera. A 4 Picos enhanced CCD camera (Stanford computer optics) with a minimum gate time of 200 ps can be used. A beam splitter is used within the microscope to separate the laser pulse from the fluorescent signal. This beamsplitter reflects the 405 nm excitation wavelength and transmits the fluorescence signal of the sample shifted to longer wavelengths. The wide-field FLIM setup additionally requires trigger synchronization of the pulsed laser diode and the enhanced CCD camera. The excitation source for time-resolved measurements is pulsed or modulated, allowing fluorescence emission and kinetic measurements. Time-domain fluorometry methods are generally more easily understood because they produce a true representation of the fluorescence decay curve. Typically, time domain systems consist of a pulsed light source providing excitation coupled with a fast response detector. Lifetime results can be improved by increasing the number of time gates and developing a fitting algorithm to account for multi-exponential decay fitting. Time-correlated detection can be combined with single-molecule localization.

Fluidics The present invention can be implemented in fluidic devices (flow cells or wells). The means of delivering and exchanging reagents can take a variety of forms. Syringe pumps or pressure-driven systems, acoustic-driven systems can be used to move reagents from where they are stored to where sequencing is performed and then removed as waste. . If multiple probes need to be delivered (e.g. each of 1024 oligos), store a large number of oligos and deliver them to a sequencing system that can be used to carry out the methods of the invention. One means for is described by Pihalk et al. Anal. Chem. 2005, 77, 64-71. Another approach that can be used is Linder et al Anal. Chem. 2005, 77, 64-71. One simple way to deliver a large number of different probes or probe sets is to load them into capillaries, each separated by an air gap. A washing liquid can also be interspersed. The loop is then run at an appropriate speed (eg, by pulling from a syringe pump) so that each probe and wash contact the surface for a time sufficient to perform the imaging required by the present invention.

Sequence Quality: Minimizing Sequencing Errors and Coverage Bias All sequencing techniques are subject to some level of error, and different sequencing platforms are susceptible to different types of error. According to Schirmer et al. (Nucl. Acids Res. 2015; nar. gku1341) l, Illumina MiSeq, the raw error rate is 2%. This includes errors introduced by library preparation, cluster amplification, prephasing (errors in early integration), and phasing (errors in late integration). This can be reduced by trimming and duplicating reads to build consensus.

Since PCR is not performed in embodiments of the present invention, there is no coverage bias introduced due to PCR and no errors due to polymerase misincorporation during PCR. In Illumina, ABI SOLID, Ion Torrent, Intelligent Biosystems and Complete Genomics sequencing, amplification errors can be introduced during library preparation and clone amplification (eg, DNA nanoball, polony or cluster generation).

A common means of overcoming errors in next-generation sequencing is to generate reads for the same segment of the genome from multiple distinct (non-amplicon) copies of the genome, for multiple copies of the unamplified genome. Sequencing. Sequences are then assigned from the consensus of a large number of molecules. If two sequences predominate, it may indicate heterozygosity. This is not the case when sequencing is performed in single cells. It is also a problem when the tissue or cells from which multiple copies are obtained are not homogenous. For example, within tumors, multiple clonal populations may coexist and somatic mutations may be present. Genomes are also changing in immune cells, requiring direct single-cell sequencing. The method of the present invention applies in such cases on the basis of single polynucleotides.

For some applications, it is important to detect somatic mutations that occur in populations of cells. In this case, it may be difficult to distinguish errors from true rare mutations, so it is better not to rely on errors being able to be eliminated by obtaining consensus reads from many molecules. Another problem with this is that the different copies are paralogous and can be from different duplications of segments of the genome (segmental duplications) but contain small differences.

When sequencing according to the methods of the invention, raw errors can be reduced by reinforcing sequence calls with multiple probe binding events.

This is due to the fact that no dye is detected when sequencing on a single molecule via detecting incorporation of nucleotides labeled with a single dye molecule, as is done in Helicos and PacBio sequencing. errors can occur. This is because the dye is photobleached, the cumulative signal detected by blinking of the dye is weak, the dye emits too little light, or the dye enters a long photophysical dark state. This can be overcome in several ways in the present invention. The first is to label the dyes with strong individual dyes (eg Cy3B) with favorable photophysical properties. Another example is to provide buffer conditions and additives that reduce photobleaching and dark photophysics (eg, β-mercaptoethanol, Trolox, vitamin C and its derivatives, redox systems). Another example is minimizing exposure to light (eg, having a more sensitive detector that requires shorter exposures, or providing stroboscopic illumination). Second, labeling with nanoparticles such as quantum dots (eg, Qdot655), fluorospheres, plasmon resonance particles, light scattering particles, etc., instead of single dyes. Another example is to have many dyes per nucleotide rather than a single dye. In this case, multiple dyes are organized to minimize their self-quenching (e.g., by spacing them well apart and using rigid nanostructures such as DNA origami) or at linear spacing via rigid linkers. become. Genovox can incorporate nucleotides containing many fluorophores and Mir (WO2005/040425) has been able to incorporate nucleotides with attached nanoparticles.

However, the most important means for reducing dye photophysical errors that are most relevant to the present invention is through the use of transient binding as described in the present invention. Here, the readout during the imaging step is obtained as an aggregation of many on/off interactions of the different label-bearing probes, so that even if one label is photobleached or in the dark state, Labels on other bound probes that do not may not be photobleached or in a dark state.

Detection error rate in the presence of one or more compounds selected from urea, ascorbic acid or its salts, isoascorbic acid or its salts, β-mercaptoethanol (BME), DTT, redox systems, or Trolox in solution is further reduced (and signal lifetime is extended).

Aggregation of Reads by Array Capture In another embodiment, target polynucleotides are captured using capture reagents that target specific polynucleotides or specific segments of polynucleotides located on a surface or in a matrix. In some embodiments, capture probes are designed to target a particular common sequence present on all polynucleotides in a sample. For example, oligo(dT) capture reagents target all RNA. In some embodiments, common oligosequences can be grafted onto target polynucleotides to capture them. Different capture reagents can be used to capture different polynucleotides, and the different capture reagents can be arranged in a spatially addressable ordered array, such as a microarray. Once the polynucleotides are captured, they can be elongated by fluid flow or electrophoretic flow.

Generating Sense-Antisense Single-Strands for Sequencing In some embodiments, hairpins are ligated to the ends of a double-stranded target, one of the other ends being anchored to the surface via only one of the strands. become. The polynucleotide is then denatured and extended/extended from the point of attachment. The polynucleotide is then fixed in the extended state.

This provides a way to ensure that the target is single stranded. Furthermore, the reads obtained from the sense and antisense strands between the ends provide complementary reads, which are an internal verification of the authenticity of the resulting sequencing. Such sense-antisense strands can also be generated by performing cDNA synthesis on RNA using AMV reverse transcriptase, which naturally creates hairpins to synthesize the second strand. In some embodiments, primers for reverse transcription are modified with moieties that allow attachment to surfaces.

Single-Strand Assembly In some embodiments of the invention, the sample comprises single-stranded polynucleotides that have no contiguous natural complement. Now, once the binding locations of each oligo of the repertoire along the polynucleotide have been compiled, the sequence is reconstructed according to their location by aggregating all the sequence bits and splicing them together. can be done. In fact, the complete repertoire would provide a tiling series of array bits. In the real world, patterns can be complicated by mismatched and non-specific binding on the polynucleotide. However, the discrepancies can be distinguished by their binding patterns over time and can thus be viewed as a second layer of sequence information. In this case, if its binding properties over time determined that the binding signal was mismatched, the sequence bits were bioinformatically trimmed to remove the putative mismatched bases and the remaining sequence bits were subjected to sequence reconstruction. can be added to Since mismatches are most likely to occur at the ends of hybridizing oligos, one or more bases can be trimmed from the ends, depending on binding properties over time. Information from other oligos tiling on the same sequence space can be used to know which bases are trimmed.

Simultaneous Duplex Consensus Assembly In some embodiments of the invention, both strands of the duplex are present in close proximity to distinguish which strand the oligo is attached to from the transient signal detected. It is not possible. However, when the binding sites of each oligo in the repertoire along the polynucleotide are compiled, it is possible that two oligo sequences appear to bind at the same site. These oligos must be complementary in sequence. The data are considered globally to determine whether a single binding event is to one strand or the other. Two tiling series of oligos cover the position in question, each tile being an incremental shift of position along the length of the polynucleotide in one direction or the other. Based on which series the signal-generating oligo sequence overlaps, one of the two tiling series to which the signal belongs is assigned. This is illustrated in FIG. Then, in some embodiments, the sequence is reconstructed by first constructing each of the two tiling series using the locations of joins and sequence overlaps. The two tiling series are then aligned as reverse complements, and base assignments at each location are accepted only if the two strands are perfect reverse complements at each of these locations (this is providing the duplex consensus sequence). Any discrepancy is flagged as an ambiguous base call in which one of the two possibilities must be corroborated by an additional layer of information such as an independent discrepancy binding event. In some embodiments, once a duplex consensus is obtained (when DNA from multiple cells is available), individual haplotypes covering the same region of the genome are selected, taking care not to mix individual haplotypes. A conventional (multimolecular) consensus is determined by comparing data from multiple polynucleotides. Alternatively, in some embodiments, an individual strand consensus is obtained followed by a duplex consensus of the individual strand consensus. In such embodiments of the invention, the sequence of each strand of the duplex is differentiated by molecular barcodes of the two strands of the duplex, as currently available in Next Generation Sequencing (NGS). (J. Salk, et al. “Detection of ultra-rare mutations by next-generation sequencing”. Proc. Natl. Acad. Sci., vol. 109 no.36, 2012). This simultaneous acquisition of both strands (sense and antisense) sequence is also utilized for nanopores where sequence must be obtained for one strand of a duplex before sequence for the second strand is obtained. It is advantageous compared to possible 2D or 1D2 consensus sequencing. Double-strand consensus sequencing can provide accuracies in the range of 106, or 1 error in a million bases (compared to raw accuracies of 102-103 for other NGS approaches). For the present invention, duplex consensus is an essential part of sequence acquisition without additional sample preparation steps. This method addresses the need to address rare variants that arise when trying to detect circulating DNA for early cancer detection, or when trying to detect DNA from low-frequency subclones of tumor cell populations. very compatible with

Incorporating Reads from Multiple Polynucleotides Preferably, contiguous sequences are obtained via de novo assembly. However, reference sequences can also be used to facilitate assembly. This makes it possible to build de novo assemblies, but it is more difficult to resolve individual haplotypes over very long distances, requiring encountering enough locations along the molecule to provide information about the haplotype. There is Where complete genome sequencing requires the synthesis of information from multiple molecules spanning the same segment of the genome (ideally, molecules originating from the same chromosome), the algorithm will combine the information obtained from multiple molecules. need to be processed. One algorithm is a type of algorithm that aligns molecules based on sequences that are common among multiple molecules and fills gaps within each molecule with assignments from co-aligned molecules that have regions covered. . Thus, gaps in one molecule are covered by reads in another (co-aligned molecule) molecule. In addition, shotgun assembly methods, such as those developed by Eugene Myers, use the additional advantage of having a large number of pre-assembled reads (e.g., location of reads relative to each other, length of gaps between reads known). ), which can be adapted to perform the assembly. Other algorithmic approaches such as SUTTA described by Mishra et al. (Bioinformatics, Oxford Journals, (2011) 27(2):153-160) can also be adapted for data assembly. In various embodiments, a reference genome can be used to facilitate assembly of either long-range genomic structures or short-range polynucleotide sequences, or both. Reads can be partially de novo assembled, then aligned to a reference, and then de novo assembled with reference assisted assembly. Various reference assemblies (eg, from different ethnicities) can be used to provide some guidance for genome assembly. However, information obtained from actual molecules (especially when supported by more than one molecule) is weighted over any information from references. The prior art has not shown that contiguous sequences can be reconstructed by aligning local sequences obtained from multiple individually examined single polynucleotide molecules.

Reference-Free Sequencing In various embodiments, the sequence is determined without the use of another copy of the target polynucleotide molecule or a reference sequence of the target polynucleotide molecule. In this case, most of the reads (eg, 90%) are coalesced and the gaps between the reads for those that are not coalesced are known. that the linear length of the polynucleotide is traceable and that the gap distance can be determined by counting the number of pixels between reads and using knowledge of the length of the DNA across each pixel will give the gap distance.

Haplotype-Resolving Sequencing Genomic sequencing would have far greater utility if haplotype information (allelic association along a single DNA molecule derived from a single parental chromosome) could be obtained over long distances. deaf.

In various aspects and embodiments, the methods can be used to sequence haplotypes. Haplotype sequencing includes sequencing a first target polynucleotide across haplotypes of the diploid genome using a method according to the invention, and sequencing a second target polynucleotide across the haplotype divergence, wherein the first and second target polynucleotides are from different copies of homologous chromosomes; comparing the sequences of the polynucleotides thereby determining haplotypes on the first and second target polynucleotides.

Determination of Haplotype Diversity and Frequency in Cell Populations Many existing methods aimed at examining genomic heterogeneity in populations of cells employ technically demanding single-cell analysis. However, a notable feature of the present invention is that if the molecule is long enough, different chromosomes, long chromosomal segments, or haplotypes present in a cell population can be determined, thus requiring the contents of a single cell to be held together. Without gender, genomic heterogeneity in populations can be analyzed. It does not indicate which two haplotypes exist together in a cell, but reports on the diversity of genomic structural types (or haplotypes) and their frequencies, as well as which aberrant structural variants are present. do. This embodiment includes the following steps:
1. extracting genomic DNA from two or more cells;
2. elongating the DNA and performing the sequencing method of the invention;
3. analyzing the data to determine which DNA strands are homologs;
4. determining different haplotypes between homologs;
5. and determining frequencies of different haplotypes.

Synergy with Other Sequencing Technologies In some embodiments, the methods of the present invention go beyond full genome sequencing and provide a stepping stone for short read sequencing, such as those from Illumina. used to In this case, it is advantageous to perform Illumina library preparation by omitting the PCR amplification step in order to obtain more uniform coverage of the genome. One advantage of some of these embodiments is that the required sequencing coverage factor can be halved, eg, from about 40-fold to 20-fold. In some embodiments, this is due to the sequencing performed by the method of the invention and the addition of location information provided by the method.

Sequencing Panels In some embodiments, it is desirable to sequence a subset of the genome corresponding to a particular gene or locus. In this case, genomic DNA is made single-stranded and sequence-specific oligos are transiently annealed over the region of interest. One advantage of targeting sequencing in this way is that even if the entire genome is stretched to the surface, only the targeted region is lit up. Imaging time can thus be reduced by going directly to the photodetectable target area. Furthermore, genomes can be arrayed on surfaces at much higher densities than usual, since only a small fraction of the molecules need to be detected. As an example, the BRCA1 region of the human genome can be sequenced by annealing multiple oligonucleotides complementary to the BRCA1 sequence. Other parts of the genome remain undetected.

Cell-Free Nucleic Acids Some of the most diagnostically accessible DNA or RNA is found extracellularly in bodily fluids or stool. DNA circulating in the blood is used for prenatal testing for trisomy 21 and other chromosomal and genomic disorders. It is also a means of detecting tumor-derived DNA and other DNA or RNA that are markers of certain pathological states. However, these molecules typically range in length from about 200 bp in blood and are shorter in urine. The copy number of a genomic region is determined by comparing the number of reads that align to the reference compared to other parts of the genome.

In some cases it is useful to determine in a sequence specific manner whether a nucleic acid is methylated. For example, one way to distinguish fetal from maternal DNA is that the former is methylated at the locus of interest, which can be useful for non-invasive prenatal testing (NIPT).

The present invention can be applied to enumeration or analysis of cell-free nucleic acid sequences by two approaches. The first involves immobilizing short nucleic acids before or after denaturation. Transient binding reagents determine the identity of the nucleic acid, its copy number, whether mutations or specific SNP alleles are present, and whether the detected sequence is methylated or has other modifications (biomarkers) can be used to interrogate nucleic acids to determine whether

This includes
1) isolating cell-free nucleic acids from a body fluid (e.g., blood);
2) immobilizing the isolated cell-free nucleic acid on a substrate;
3) performing sequencing by binding of the probe to the immobilized cell-free nucleic acid.

The second is to ligate small pieces first so that the concatemer can be extended. This includes
4) isolating cell-free DNA from the blood;
5) ligating the DNA;
6) performing sequencing by binding probes on the ligated DNA.

In some embodiments, ligation is performed by polishing the ends of the DNA and performing blunt-end ligation. Alternatively, the blood or cell-free DNA can be split into two aliquots, one aliquot tailed with poly-A (using terminal transferase) and the other aliquot tailed with poly-T. be.

The resulting concatemers are then subjected to sequencing. The resulting "super" sequence reads are then compared to references to extract individual reads. Individual lead data is computationally extracted and then processed in the same manner as other short lead data.

Nucleic acids are also found in the stool, a medium containing numerous exonucleases capable of degrading nucleic acids and containing large amounts of divalent cation chelators (e.g., EDTA) required for the exonucleases to function. can be used to keep the DNA sufficiently intact to be sequenced according to the methods of the invention. Another method by which DNA is shed from cells is through encapsulation within exosomes. Exosomes can be isolated by ultracentrifugation or by using spin columns (Qiagen) and the DNA or RNA contained therein can be recovered and sequenced according to the methods of the invention.

In some embodiments, the binding of one, but usually at least two, preferably several oligonucleotides to the nucleic acid is derived or originated from its identity or from which part of the genome of the nucleic acid. is sufficient to determine Thus, incomplete sequencing may provide the necessary information before the full repertoire is tested. In some embodiments, the proportion of different chromosomal or genomic regions is determined by counting the number of nucleic acid molecules that are distinguished according to their genomic origin. In some embodiments, this allows information about the fetal fraction of the sample to be determined. In some embodiments, the occurrence of single nucleotide variants or indels is determined by analyzing binding of one or more oligos along with determining the identity or origin of the nucleic acid molecule.

The longer the oligonucleotide binds, the less oligonucleotide is required to determine the identity or origin of the nucleic acid molecule. In this regard, specific genes or loci can be detected by providing a panel of oligonucleotide probe sequences, such probes being oligos greater than 10 nucleotides in length, or multiple oligos less than 10 nt in length. Certain short oligonucleotides. Thus, a panel of cancer-associated probes is applied to nucleic acid molecules extracted from blood to identify cancer-associated genes, and then binding of additional oligonucleotides is used to identify single nucleotide variants or indels. be able to. Advantages of the approach described in the present invention for this include multiple binding events and, in some embodiments, probing of both strands to increase confidence in calling variants.

RNA Sequencing Although RNA is typically shorter in length than genomic DNA, it is difficult to sequence RNA from one end to the other using current technology. Nevertheless, due to alternative splicing, it is very important to obtain and determine the complete sequence composition of mRNA. In some embodiments of the present invention, mRNA can be captured by binding its polyA tail to immobilized oligo d(T), and its secondary structure is determined by stretching forces and denaturing conditions. removed so that it can be extended to the surface. A binding reagent (which is exon specific) is then allowed to bind transiently. Due to the short length of RNA, it is beneficial to resolve and distinguish exons using the single-molecule localization methods described in this invention. In some embodiments, the few binding events interspersed in the RNA are sufficient to determine the order and identity of exons within the mRNA for a particular mRNA isoform.

Preserving the Integrity of Biomacromolecules Prior to Analysis In biology, it is often difficult to observe biomolecules in their native state. Most often, the process of retrieving information on biomolecules in their native state results in the disruption of some aspect of their native state.

In the case of genomes, the challenge is to analyze the information content of the genome in its native chromosomal state. DNA in human chromosomes can range from 50 million to 250 million bases long, but today's shotgun sequencing technology can read only a few hundred bases long. This is despite the increasing recognition that the location and copy number of DNA sequences have important implications for phenotype.

Much of the damage occurs in the process of extracting biomolecules from cells and tissues and in their subsequent handling (before they are analyzed). In the case of DNA, aspects of its handling that result in loss of its integrity can include pipetting, vortexing, freeze-thawing, and excessive heating. Mechanical stress can be minimized (for example, as described in ChemBioChem, 11:340-343 (2010). In addition, EDTA, EGTA, or gallic acid (and its analogs and derivatives) can be High concentrations of divalent cations can inhibit degradation by nucleases, hi some embodiments, a 2:1 mass ratio of sample to divalent cations is useful in samples such as stool where extreme levels of nucleases are present. is also sufficient to inhibit the nuclease.

The problem that alternative embodiments of the present invention seek to address is how to preserve the natural integrity of a biopolymer, in particular its natural length, or its natural length, prior to analysis. How to preserve genomic DNA with a length somewhat close to . This concerns both sequencing using the method of the invention or sequencing using other methods. It is particularly relevant for nanopore sequencing.

In some embodiments, the present invention relates to a method for delivering biopolymers for analysis, comprising:
1) providing a protected entity comprising a biopolymer, the protected entity preserving the biopolymer near its native state;
2) placing a protective entity comprising a biomacromolecule in proximity to the analysis zone;
3) liberating the biopolymer from the protective entity into the analysis zone.

In some embodiments, the present invention relates to methods for preparing biopolymers for analysis, comprising:
1) providing a protected entity comprising a biopolymer, the protected entity preserving the biopolymer near its native state;
2) placing a protective entity comprising a biomacromolecule in proximity to the analysis zone;
3) liberating the biopolymer from the protective entity;
4) passing the biopolymer through an analysis zone;

In some embodiments, the present invention relates to methods for preparing biopolymers for analysis, comprising:
1) providing a protected entity comprising a biopolymer, the protected entity preserving the biopolymer near its native state;
2) placing a protective entity comprising a biomacromolecule in proximity to the analysis zone;
3) liberating the biopolymer from the protective entity into the analysis zone.

In a further embodiment, the invention relates to a method for analyzing biomacromolecules,
1) providing a protected entity comprising a biopolymer, the protected entity preserving the biopolymer near its native state;
2) placing a protective entity comprising a biomacromolecule in proximity to the analysis zone;
3) liberating the biopolymer from the protective entity;
4) passing the biopolymer through the analysis zone;
5) detecting at least one characteristic of the biopolymer in the analysis zone.

In some embodiments, the invention relates to a method for delivering genomic DNA for analysis, comprising:
1) providing a protected entity comprising genomic DNA, said protected entity preserving the genomic DNA near its natural length;
2) placing protective entities containing genomic DNA in close proximity to the analysis zone;
3) liberating the genomic DNA from the protective entity;
4) passing the genomic DNA through an analysis zone;

In a further embodiment, the invention provides
1) providing an agarose gel containing genomic DNA, said agarose gel preserving a substantial portion of genomic DNA greater than 200 Kb in length;
2) placing the agarose containing genomic DNA in close proximity to the surface on which the DNA is to be analyzed;
3) liberating the genomic DNA from the agarose to the surface;
4) stretching the DNA in one direction.

In some embodiments, the present invention relates to methods for preparing biopolymers for analysis in which rare target molecules are detected,
1) to minimize mechanical stress and/or in vessels containing environments with high concentrations of divalent cations/gallic acid and to minimize accumulation of macromolecules (e.g. via lipid layers); extracting the biopolymer within the region of the passivated container;
2) fixing the extracted biopolymer to a surface within the container;
3) analyzing/sequencing the extracted and immobilized biopolymers according to the methods of the invention.

In some embodiments, the length of genomic DNA is greater than 50Kb, 100Kb, 200Kb, 400Kb, 800Kb. In some embodiments, the specified portion of DNA is greater than about 1 Mb in length. In some embodiments, the DNA of some molecules is greater than 5 Mb in length. In some embodiments, the DNA target molecule approximates the substantial length of a chromosome. In some embodiments, the entire length of the chromosome from telomere to telomere is stored and analyzed.

In some embodiments, the agarose gel is in the form of agarose beads. In some embodiments, DNA is encapsulated in droplets. In some embodiments, the DNA remains substantially as chromatin. In some embodiments, the DNA remains chromosomal. In some embodiments, the chromosome is a cell cycle metaphase chromosome. In some embodiments, the chromosome is a late cell cycle chromosome.

In some embodiments, the sample comprises substantially the total DNA content of a single cell. In some embodiments, the sample comprises substantially the total RNA content of a single cell. In some embodiments, the sample comprises substantially the entire protein/polypeptide/peptide content of a single cell. In some embodiments, the sample comprises substantially the total DNA and RNA content of a single cell. In some embodiments, the sample comprises substantially the total DNA, RNA, protein content of a single cell.

In some embodiments, the sample comprises substantially the entire cytoplasmic contents of a single cell. In some embodiments, the sample comprises substantially the entire nuclear contents of a single cell. In some embodiments, the sample comprises total cytoplasmic content of RNA and total nuclear content of DNA. In some embodiments, the sample comprises substantially the entire membrane content of proteins.

In some aspects, the method includes the following.

1. Methods for delivering biopolymers to the analysis zone:
a. providing a protected entity comprising a biopolymer, the protected entity preserving the biopolymer near its native state;
b. placing a protective entity comprising a biopolymer proximate to the analysis zone;
c. liberating the biopolymer from the protective entity;
d. passing the biopolymer through an analysis zone;
e. detecting at least one characteristic of the biopolymer in the analysis zone.

2. 2. The method of 1, wherein the protective entity is juxtaposed with the analysis zone.

3. 2. The method of 1, wherein the protective entity comprises the natural environment of the biopolymer.

4. 4. The method of 3, wherein the protective entity comprises a chromosome, chromatid, or chromatin.

5. 4. The method of 3, wherein the protective entity comprises cells, nuclei, organelles, vesicles, exosomes, capsids.

6. 2. The method according to 1, wherein the protective entity comprises condensation, folding or other rendering of biomacromolecules in a compact structure.

7. 2. The method of 1, wherein the protective entity is a droplet, bead, or gel.

8. 6. The method of 5, wherein the protective entity is a gel bead, gel plug, gel slab, gel capillary, or other gel former.

9. 9. The method according to 8, wherein the gel is agarose.

10. 10. The method of preceding aspects 1-9, wherein the biopolymer is encapsulated or encased in a protective entity prior to step 1 of aspect 1.

11. 9. A method according to 8, wherein the biopolymer is released from the protective entity via application of an electric field.

11a. A method in which a biopolymer is released into a microfluidic structure.

11b. The method of 11a, wherein the microfluidic structure is passivated.

11c. The method of 11b, wherein passivation is via a lipid coating.

12. 2. The method of 1, wherein the analysis zone is a nanopore, nanogap, or other nanoscale detection station/reading head.

12b. 13. The method according to 12, wherein nanopore sequencing is performed on individual polynucleotides after they have been released near the analysis zone.

13. 2. The method of 1, wherein the analysis zone is a surface.

14. 13. The method according to 12, wherein the surface comprises an agent capable of binding to one or more sites on the biopolymer.

15. 2. The method of 1, wherein the analysis zone is a nanochannel, nanogroove, nanopit, or nanoslit.

16. 2. The method of claim 1, wherein the biopolymer is present in the fluid and released into a structure in contact with the analysis zone.

17. 16. The method according to 15, wherein the biopolymer passes through a microfluidic channel before reaching the analysis zone.

18. 2. The method of 1, wherein the biopolymer is released by electrophoresis or electroosmosis.

19. 2. The method of claim 1, wherein the speed of passage into the analysis zone is controlled by molecular ratchets, molecular motors, hydrodynamic drag, electric fields, optical tweezers, magnetic tweezers.

20. 2. A method according to 1, wherein the biopolymer is liberated by an agent that destroys the protective entity.

21. 21. The method according to 20, wherein the disrupting agent is an enzyme, detergent, acid solution, or alkaline solution.

22. 22. The method according to 21, wherein the enzyme is a protease.

23. 21. The method according to 20, wherein the destructive agent includes sonication, charge switch, temperature change, heat shock, cold shock, thawing, and the like.

24. 2. The method according to 1, wherein the protection is protection from shear forces.

25. 2. The method according to 1, wherein the protection is protection from nucleases, proteases.

26. 2. The method of claim 1, wherein step e comprises detecting two or more features at two or more locations on the biopolymer.

27. 2. The method according to 1, wherein the biopolymer is a polymer.

28. 28. The method of claim 27, wherein near-native preservation comprises preserving the polymer with substantially longer chain lengths.

29. 29. The method of 28, wherein the polymer is a DNA polymer and chain length is conserved over 40 Kb, 100 Kb, 200 Kb, 500 Kb, 1 Mb, 5 Mb, 50 Mb, 250 Mb.

30. 2. The method of claim 1, wherein the biopolymer is liberated by a flow of reagent perpendicular to the direction of movement of the biopolymer (cross-flow).

31. 31. The method according to 30, wherein cross-flow comprises RNAse, protease, alkali, detergent.

32. A method according to 1, wherein the biopolymer traverses a series of pillars or posts after its release and before entering its analysis zone.

33. 2. The method of 1, wherein the protective entity comprises paraffin.

34. 34. The method according to 33, wherein the protective entity comprises a formalin-fixed, paraffin-embedded biopolymer.

35. 2. The method of 1, wherein the biopolymer is exposed to a solution that preserves its integrity and repairs damage.

36. 36. The method of 35, wherein the biopolymer is DNA and the solution contains repair enzymes (eg, PCR repair mix with NEB).

35. 37. A method according to aspects 1-36, wherein liberating the biopolymer is a process of extracting the biopolymer from its natural encasing (eg, extraction of DNA from cells).

36. 2. A method according to 1, wherein the steps are performed without the use of micropipetting, vortexing and/or centrifugation after the biopolymer has been released from the protective entity.

ALTERNATIVE EMBODIMENT In an alternative embodiment, the probe binds stably, but its transience is controlled by an external trigger that switches the environment to off mode. Such triggers are heat, pH, electric field, or reagent exchange to dissociate probe binding. The environment then switches to on mode, allowing the probe to bind again. In some embodiments, if the first round of binding does not saturate all sites, the second round can occupy other sites than the first. These cycles can be executed multiple times at a controllable rate.

Alternative Super-Resolution and Single Molecule Localization Methods In alternative embodiments, probes are bound relatively stably, but several approaches for resolving optical signals closer than the diffraction limit exists. First, if the optical properties of a luminescent label, such as a quantum dot or dye, are known, it is possible to resolve two closely spaced signals along the polynucleotide using the point spread function of the entity. This is easily done if the two closely spaced signals are emitted at different wavelengths. Second, it is possible to resolve the signal by allowing photobleaching, which is a stochastic process (J Biomed Opt. 2012 Dec;17(12):126008). Third, there are several hardware approaches described and commercially available, including scanning optical microscopes, 4Pi, STED, and SIM. For STED, a specific compatible fluorophore set must be used. Based on closely spaced signals separated in time, several molecular approaches have also been described, including STORM (sub-diffraction limited stochastic optical reconstruction microscopy (STORM) MJ Rust, M. Bates, X. Zhuang Nature Methods 3:793-795 (2006)), in which a specific set of compatible fluorophores must be used.

DNA PAINT (Jungmann et al Nano Lett. 2010, 10:4756), a single molecule localization method, may also be used in various embodiments of the invention. For DNA PAINT, each bound probe is labeled with an oligotag to which a complementary oligo anti-tag transiently binds. Each binding probe associates with a binding partner pair of different sequence complement. To distinguish, the antitag associated with each of the bound probes is distinguishable from other antitags. The elements that make them distinguishable can be luminescent labels of different wavelengths (e.g., Atto488, Cy3B, Alexa594, and Atto655/647N), labels with different lifetimes, or different antitags have different on/off binding kinetics. can be designed to have

DNA PAINT can be used to precisely assign the coordinates of signal localization. Localization is easier to determine if the signal-emitting fluorophore remains close to the site of incorporation. Therefore, the length and degree of flexibility of the linker or bridge that connects the wavelength-emitting moiety (e.g., fluorophore) to the base must be limited; used.

Another alternative for obtaining super-resolution images is by extension (eg described in Chen, Tillberg, and Boyden Science 30 January 2015: Vol. 347 no. 6221 pp. 543-548). Here, elongated polynucleotides are provided in a gel and then expanded, thus stretching the biomaterial. Specific labels associated with polynucleotides are covalently tethered to the swellable polymer network. Upon swelling, even if the polynucleotide is disrupted (or no longer has a continuous polyphosphate backbone), the order of the fragments is preserved and the invention can still be practiced.

Such super-resolution approaches do not require transient coupling. Thus, each cycle of probe binding can be performed by dipping a surface (eg, coverslip) into a different trough with a different repertoire of oligos or sets of oligos.

Advantages of Transient Conjugation The transient conjugation approach has the advantage that photobleaching of the conjugated fluorophore is not a problem as it is always replaced by fresh fluorophore. Therefore, fluorophore selection, anti-fade, provision of redox systems are less important, e.g. constructing simpler optics without f-stops to prevent illumination of molecules not in the field of view of the camera. can be done. Because the illumination transiently bleaches only the labels that enter the evanescent wave, these bleached labels are continuously replaced by molecules from the bulk solution.

The advantage of on-off coupling is that it avoids the problem of dark state or photobleaching of probes labeled with single dye molecules. If a particular probe molecule is bleached or in a dark state, no binding event for that probe will be detected. Nevertheless, the target location is likely to be detected by subsequent binding events to that location.

In some embodiments, an advantage of on-off coupling is that it allows multiple measurements to be made to increase confidence in detection. For example, in some cases, due to the typical stochastic nature of molecular processes, probes may bind in inappropriate locations, but such outliers can be discarded and multiple detected mutual Only those binding events that can be supported by action are accepted as valid detection events for sequencing purposes.

In some embodiments of the invention, the advantage of the transient binding approach is critical to how sequences are determined along the extended polynucleotide. The advantage of this is the fact that transient binding means that not all probe locations to be bound are bound at the same time. This allows binding events at sites closer than the diffraction limit of light to be detected. For example, if the sequence AAGCTT is repeated after 60 bases, a distance of approximately 20 nm (when the target is elongated and linearized to a Watson-Crick distance = 0.34 nm and linearized) is typically detected by optical imaging. indistinguishable. However, if the probe binds to two sites at different times during imaging, they can be detected separately. This allows super-resolution imaging of binding events by a method known as point integration for nanoscale topography (PAINT). Algorithms that allow nanometric or sub-nanometric localization of signals (eg, ThunderSTORM) can be used. This allows the exact location of the probes and hence the exact order of attachment to be determined. Nanometric precision is particularly important for resolving repeats and determining their number.

10x Inc. An advantage of this approach over the droplet-based partitioning and barcoded approach developed by , is that genomic structural and haplotype information can be obtained by direct visualization of the molecule rather than by inference or by computational reconstruction. . A unique advantage of this method is that, when performed efficiently, the genome from a single cell can be sequenced and the haplotypes therein resolved. Even if the method is not efficient, much fewer copies of the genome are required for de novo reconstruction of the genome than is required by approaches that require molecular partitioning and barcoding. Also, not only is the overall reagent usage lower, but fewer processing steps are required. Furthermore, since the method can work on genomic DNA without amplification, it does not suffer from amplification bias, errors and epigenomic marks are preserved, and can be detected orthogonally to sequence acquisition. Alkylation of carbon-5 (C5) occurs in mammals by several cytosine variants: C5-methylcytosine (5-mC), C5-hydroxymethylcytosine (5-hmC), C5-formylcytosine, and C5- carboxyl cytosine. Eukaryotes and prokaryotes also methylate adenine to N6-methyladenine (6-mA). N4-methylcytosine is also frequently found in prokaryotes. Antibodies to each of these modifications are available or can be produced. Affimers, nanobodies or aptamers that target modifications are of particular relevance due to their potentially smaller footprint. In addition, other naturally occurring DNA binding proteins such as methyl proteins (MBD1, MBD2, etc.) can be used.

Thus, in various aspects and embodiments, the invention provides methods of sequencing a single extended target polynucleotide molecule containing epigenomic information.

In various aspects and embodiments, the method can be used for stepwise sequencing in which haplotypes are resolved and the method of the preceding paragraph is used to determine the first target polynucleotide across the haplotype branches of the diploid genome. and sequencing a second target polynucleotide spanning the haplotype branch of the diploid genome using the method of the preceding paragraph, wherein the first and second target polynucleotides are different Haplotypes (linked alleles) on the first and second target polynucleotides are determined from the homologous chromosomes.

An advantage of the present invention is that by splicing together contiguous or overlapping sequence information obtained by conjugation of short oligos instead of actually performing each long read, which is expensive and time consuming, a long read can be obtained. Being able to get leads. Multiple short 3-, 4-, 5-, or 6-base bits of sequence information are obtained simultaneously along the length of a single polynucleotide molecule, so that they are all ligated, binding the polynucleotide on and off When saturated with oligos, their nanometric position, resolution, and order reveal the sequence of the entire molecule. Sequencing of polynucleotides is currently used because multiple bits of sequence information are obtained simultaneously, rather than a single long read (e.g., PacBio sequencing) obtained by SbS reactions from one place to another on the molecule. takes less time than the method of

Another major advantage of the present invention is that all kinds of structural variation (including microarray-based techniques, balanced copy number variations and inversions that are difficult for current mainstream approaches), both large and small. without being able to detect at resolutions and scales not approachable by microarrays, cytogenetics, or other current sequencing methods.

Furthermore, the method allows sequencing across repetitive regions of the genome. For conventional sequencing, the problem of reads across such parts of the genome is that such regions are not well represented in the reference genome, and Illumina, Ion Torrent, Helicos/SeqLL, and Complete Genomics Techniques such as typically address large genomes by aligning to a reference rather than by de novo assembly. Second, if the reads do not span the entire repetitive region, it is difficult to assemble the region via shorter reads across the region. This is because it can be difficult to determine which of multiple possible alignments between the repeat region on one molecule and the repeat region on another molecule is correct. Misalignment can lead to shortening or lengthening of repeat regions within the assembly. In the sequencing methods of the invention, if there is complete or near-complete coverage of a single molecule by multiple reads performed either simultaneously or one after the other (if the polynucleotide itself spans the repeat region ) can build assemblies spanning the repeat regions. The methods of the invention can be applied to sufficiently long polynucleotides that span the repeat region. A 1-10 Mb polynucleotide is sufficient to span most repetitive regions of the genome.

Impact on Various Sequencing Metrics Impact on Speed—This approach is simple and does not increase sample processing steps or cycle times. There are no enzymatic steps, just hybridization, and there are multiple means to speed things up.

Cost impact—This approach is very low cost and the reagents required are very small amounts of oligos, eg 0.5-3 nM of oligo probe.

Effect on read length—Read length is potentially as long as a molecule of DNA of any length, including an entire chromosome.

Impact on Accuracy—The proposed technique has the potential to be the most accurate sequencing technique. Except for a few outliers, the short oligos are highly specific as even a single base mismatch leads to a large loss of stability. Given proper binding conditions, a perfect match can in most cases be distinguished from a mismatch of one or more bases, and this ability can be enhanced by iterative matching of each sequence site. Additionally, the method can utilize discrepancy information in determining sequences. Furthermore, simultaneous sequence acquisition from both strands of a duplex improves accuracy. The accuracy level of this technique will be sufficient for detecting rare mutations.

Effect on sensitivity—This method is potentially very sensitive as it is a single molecule technique. No molecules are lost because there are no inefficient preparation steps such as ligation. Extraction can be integrated close to the site of sequencing so molecules are not lost by sticking to the container, and the inner walls of the microfluidic device itself can be passivated to prevent accumulation of molecules. Also, virtually all molecules released from the cell are accessible within the flow channel. Moreover, the method has the potential to yield a complete contiguous read from as little as one molecule. This is relevant for sequencing from a single cell and the method allows unprecedented coverage and low allele dropout.

Sequencing Applications and Uses In some embodiments, the present invention involves the use of sequence information obtained directly from a single extended polynucleotide, in the context of sequence reads obtained within longer polynucleotides (approximately 100 Kb to chromosomal). whole) is saved. Contextual information may only include information that a short read is derived from a particular polynucleotide. Context can also extend to knowing the exact or approximate location of a sequencing read within a polynucleotide.

Furthermore, when a polynucleotide is part of multiple polynucleotides of similar or different lengths that are derived from the same chromosome (or other type of complete polynucleotide, e.g., RNA transcripts), individual polynucleotides Longer distance information can be obtained than the nucleotide length (if sub-chromosomal length). In some embodiments, the sequence reads from each of the plurality of polynucleotides are obtained independently of the reads from other polynucleotides comprising the plurality of polynucleotides. In this case, sequencing data obtained from multiple polynucleotides are used to reconstruct or assemble the polynucleotides into the native polynucleotide sequence from which they were originally issued. This may be the case when sequencing is performed on genomic DNA extracted from many given cell types and it is expected that DNA from many of the same chromosomal homologues will be present. For example, in a cell extract from 1 million cells (e.g., a lymphoblastoid cell line from the CEPH panel, e.g., NA12878), 1 million maternally derived chromosomal homologues and 1 million paternally derived is expected in the extracted DNA.

In other embodiments, the context of short reads is preserved by sequencing long (approximately 50-200 Kb) single isolated polynucleotides. In some embodiments, the context of short reads is preserved by sequencing along the extended polynucleotide. In some embodiments, multiple copies of a single polynucleotide (with or without haplotype resolution) covering the same segment are used as targets to obtain multiple sequence reads per target. , using sequence reads to reconstruct polynucleotide segments of longer sequences than can be represented by one of the single polynucleotides. Thus, de novo assemblies of genomes or large genomes can be reconstructed. Duplicate segments are identified as belonging to one homologous chromosome or segments from another homologous chromosome if a sufficient portion of the polynucleotide is covered by the sequencing reads to create a haplotype-resolved de novo assembly. A distinction can be made (eg, based on SNPs or structural variants found therein). The methods of the invention can be used to determine or resolve the following features that can be found in genomes that are difficult to obtain by current sequencing techniques.

Inversion The orientation of a series of sequence reads along the polynucleotide reports whether an inversion event occurred. One or more leads in the opposite direction to the other leads relative to the reference indicates a reversal.

Translocations The presence of one or more reads that are not expected in the context of other reads in their vicinity indicates rearrangements or translocations compared to the reference. The location of the read in the reference indicates which part of the genome has shifted to another part. In some cases, the read at its new location is a duplication rather than a translocation.

Copy Number Variation Absence or repetition of a specific read indicates that a deletion or amplification has occurred, respectively. The methods of the invention are particularly applicable when multiple and/or complex rearrangements are present in the polynucleotide. Since the methods of the invention are based on analyzing single polynucleotides, the structural variants described above are resolved to rare occurrences in a small number of cells, e.g., as few as 1% of cells from a population. can do.

Duplicons Segment duplications, or duplicons, are persistent in the genome and seed many structural variations of individual genomes, including somatic mutations. Segmental duplications can occur in distal portions of the genome. With current next-generation sequencing, it is difficult to determine which segment duplication a read originates from. In some embodiments of the invention, reads are obtained over long molecules (eg, in the range of 0.1 to 10 megabases in length), so typically reads are simply used to determine which segment of the genome is a duplicon. It is possible to determine the genomic context of a duplicon by determining which is flanked by a particular segment of the genome corresponding to .

Repeat Regions The recurrent occurrence of reads with paralogous mutations or related reads can be observed by the methods of the invention (after data analysis) as multiple or very similar reads occurring at multiple locations in the genome. These multiple locations are either tightly packed together, as in satellite DNA, or dispersed throughout the genome, as in pseudogenes. The method of the invention can be applied to short tandem repeats (STR), variable number tandem repeats (VNTR), trinucleotide repeats, and the like.

Finding Breakpoints Breakpoints in structural variants can be identified by the method of the present invention. The present invention not only shows at a global level which two parts of the genome have fused, but also allows us to see the exact individual reads where breakpoints occurred. The read not only contains a chimera of the two fused regions, but all sequences on one side of the breakpoint correspond to one of the fused segments and the other side is the other of the fused segments. This increases the confidence in determining breakpoints. Even if the structure around the breakpoint is complex, the method of the present invention can resolve the structure. In some embodiments, precise chromosomal breakpoint information is used to understand disease mechanisms, to detect the occurrence of specific translocations, and to diagnose disease.

Haplotypes In some embodiments, haplotype resolution allows improved genetic studies to be performed. In other embodiments, haplotype resolution allows for better tissue typing. In some embodiments, haplotype resolution or detection of specific haplotypes allows diagnosis to be made.

In contrast to other speculative or distribution and tagging haplotyping/phasing approaches, the present invention is not based on computational reconstruction of probable haplotypes. The visual nature of the information obtained by the present invention actually physically or visually indicates a particular haplotype.

Thus, reads and assemblies resulting from embodiments of the present invention can be classified as haplotype-specific. The only case where haplotype-specific information is not always easily obtained over long distances is when the assembly is intermittent and still provides the location of the leads. Again, if multiple polynucleotides cover the same segment of the genome, the haplotype can be computationally determined.

Identification of Organisms One embodiment of the present invention is the identification of different individual organisms present in a mixed sample, such as a metagenomic sample, based on the sequence, epi-information and structural information provided by the present invention. The sequencing methods of the present invention are capable of sequencing a substantial portion of the genome from as little as one copy of the genome, thus enabling the sequencing of diverse metagenomic mixtures of organisms. Moreover, a single molecule map derived from one or a few bases of information is sufficient to distinguish microorganisms.

Identification and Validation of Cell Lines In some embodiments, genomic DNA is extracted from cells in culture and expanded, and methylation and/or sequence information is obtained from the expanded molecules using the methods of the invention. extracted. This information is used to verify the identity of the cell line, determine its molecular phenotype, and modify its epigenome throughout the course of passage or as experiments are performed (e.g., perturbation of growth conditions). Changes can be monitored.

Disease Detection In some embodiments, the present invention is used for early detection of cancer, cancer diagnosis, cancer classification, analysis of cellular heterogeneity within cancer, cancer staging, cancer determining whether to apply drug therapy, drugs or drug combinations used, monitoring efficacy of treatment, monitoring recurrence, prognosticating outcome . In each of these cases, either a particular "biomarker" or set of biomarkers is sought, and the occurrence of a particular sequence, epivariant or structural variant, or general structural variation above a certain threshold level. detected. This aspect is
1. Obtaining a sample biomaterial from a human patient or individual being screened (e.g., screened for early signs of cancer);
2. performing sequencing and/or epi-analysis according to the method of the invention;
3. Exploring sequence, epivariation and/or structural variations in the data compared to a reference or compared to other body tissues from individuals/patients;
4. assessing the amount and/or type of variation and optionally providing a score;
5. making clinical decisions based on 4.

The same five steps can be applied to non-cancer disease cases and can be applied to non-human animals such as livestock, dogs, and cats. Sequence data can include RNA and DNA data. In some embodiments, sequence-only information, structure-only information, or methylation or other modification-only information is used to make clinical decisions.

In some embodiments, the five steps may include determining which zygote to select for pre-implantation screening diagnosis or screening. In some embodiments, FFPE sections are obtained, DNA is extracted and fixed, and transient binding of binding agents is performed.

Genotype-Phenotype Correlations In some embodiments, the methods of the invention are used to perform genotype-phenotype correlations by:
1. obtaining a sample biomaterial (e.g., RNA or DNA) from a population, cohort, or family of individuals;
2. performing sequencing and/or epi-analysis according to the methods of the invention;
3. Optionally, search for sequence, epimark, and/or structural variants within the data, taking into account ethnicity, phenotypic stratification, and phenotypic misclassification to identify specific diseases, phenotypes, or traits. 3. comparing them between cases and controls; Determining which sequences, epimotifs and/or structural motifs, or marker variants correlate with a phenotype.

In addition, phenotype-correlated sequences, epivariants and/or structural variants can be selected as candidate biomarkers of phenotype. Optionally, further studies are performed to fine tune or validate the candidate biomarkers.

Detailed Description of Experimental Methods Various aspects, embodiments, and features of the present invention are presented and described in further detail below. However, the foregoing and following descriptions are exemplary and explanatory only, and are not restrictive of the invention as claimed.

In some embodiments, the methods of the present invention include various washing steps between major functional elements of the process, and the need for washing steps at various points will be recognized by those skilled in the art. Generally, wash buffers can include phosphate buffered saline, 2×SSC, TEN, HEPES, supplemented with small amounts of Tween 20, TritonX, Sarkosyl, and/or SDS, and the like. Typically, 2-3 washes can be inserted between functional steps. For example, in some cases a wash step is performed when one oligo is replaced with another.

It should be understood that in most cases what is described for a particular oligo length may be similar for other oligo lengths. Also, when terms such as identifying, analyzing, and measuring are used, they are not mental acts, but rather acts performed on instrumentation, which may be performed by detectors and computer algorithms. It should be understood to include automated fluidics used in conjunction with .

Extraction and Extension of Genomic DNA in the Megabase Range on Surfaces There are many methods for extracting and extending high molecular weight (HMW) or long chain length DNA. See, eg, Allemand et al Biophysical Journal 73:2064-2070 1997, Michaelet et al Science 277:1518-1523 (1999)). In some embodiments, methods adapted from Kaykov et al (Scientific Reports 6:19636 2016) can be used to extract and extend DNA with average lengths in the megabase range. In such embodiments, genomic DNA is isolated from cells (1 1 x 104-105 per block), wash steps included 100 mM NaCl, and agarose blocks were incubated with β-agarase (NEB, USA) for extended periods (e.g., 16 h) at 42°C without mixing. Used, thawed and digested in a trough and then brought back to room temperature. DNA is combed in a buffer containing 50 mM MES, 100 mM NaCl, pH 6. A device that can pull a substrate (eg, a coverslip) out of a trough (eg, as described by Kaykov et al.) is used to generate smooth, low-friction z motion with minimal vibration. 900? A combing speed of m/sec is used to uniformly stretch the DNA molecules with minimal breakage. About 50% of the molecules are longer than 1 Mb, with an average length of 2 Mb and 5% over 4 Mb.

Several other methods for spreading to surfaces can be used (eg, described in ACS Nano. 2015 Jan 27;9(1):809-16). Alternatively, the extension on the surface can be done in a flow cell, including using the approach described by Petit and Carbeck (Nano. Lett. 3:1141-1146 (2003)). found that when combing in 20-100 uM channels, a fluid retraction rate of 4-5 μm/sec resulted in a flat air-liquid interface and provided well-aligned unidirectional polynucleotides. show. In addition to fluidic approaches, polynucleotides can be stretched by using an electric field (described, for example, in Giess et al. Nature Biotechnology 26, 317-325 (2008)). Several approaches are available for extending polynucleotides when they are not attached to a surface (e.g., Frietag et al Biomicrofluidics. 9(4):044114 (2015) and Marie et al. Proc. Natl Acad Sci U S A. 110:4893-8 (2013)).

As an alternative to using DNA in gel plugs, chromosomes suitable for loading onto the chip were prepared as described by Cram et al. (L.S. Cram, C.S. Bell and J.J. Fawcett, Methods Cell Sci., 2002, 24, 27-35). Petting is also possible. Proteins that bind to chromosomal DNA can be digested using proteases to liberate substantially naked DNA.

Preserving the Integrity of Biomacromolecules Prior to Analysis Much of the damage occurs in the process of extracting biomolecules from cells and tissues and in their subsequent handling (before they are analyzed). In the case of DNA, aspects of its handling that result in loss of its integrity can include pipetting, vortexing, freeze-thawing, and excessive heating. Mechanical stress can be minimized (ChemBioChem, 11:340-343 (2010). In addition, high concentrations of divalent cations such as EDTA, EGTA, or gallic acid (and analogues and derivatives thereof) In some embodiments, a 2:1 mass ratio of sample to divalent cations inhibits nucleases, even in samples such as stool where extreme levels of nucleases are present. is sufficient for

Extraction and Isolation of Nucleic Acids from Single Cells There are several different approaches available for extracting biopolymers from single cells or nuclei, and to extract biopolymers for the purposes of the present invention. can be used. Some suitable methods are described by Kim et al. Integr Biol 2009 vol. 1 (10) pp. 574-86. Cells can be treated with KCL to remove cell membranes. Cells can be ruptured by adding hypotonic solution. A variety of different chemical and physical lysis methods can be performed as known in the art and as previously tested in microfluidics.

Traps for single cells can be designed with microfluidic structures that retain cells while their nucleic acid content is released. This includes using the device designs of WO/2012/056192, WO/2012/055415***, but in the present invention, instead of extracting DNA and spreading it in nanochannels, micro/nanofluidic The coverslips or foils used to seal the structures are as described by Petit et al. Coat with polyvinylsilane (or similarly treated) to allow molecular combing by fluid movement, as described in Nano Letters 3:1141-1146 (2003). The milder conditions within the fluidic chip allow the extracted DNA to be retained in long strand lengths.

In some embodiments, the methods of the invention are those described in Strijp et al. Sci Rep. 7:11030 (2017). Prior to spreading, the nuclear and extranuclear components of a single cell provide at least one cell to a feed channel of a microfluidic device; capture at least one cell within at least one capture structure; lysing the cells trapped within the at least one trapping structure without affecting the nuclear integrity of the cells by supplying the cells with a lysis buffer of releasing extranuclear components of the cells into the flow cell; lysing the nuclei of the cells by supplying a second lysis buffer to the nuclei; are separately extracted by releasing into a flow cell where the Extracellular and intracellular components are immobilized at different locations on the same flow cell or on different flow cells within the device.

Capture Adapters In addition to capturing/immobilizing non-terminally modified polynucleotides, in some embodiments (particularly where short DNAs are analyzed) the ends of the DNA are captured on a surface/matrix. adapted to interact with molecules. This includes tailing using terminal transferase (eg, tailing with polyA) and binding to oligo d(T) capture probes on surfaces or matrices. Oligo d(T) capture probes are 20-50 nt long. It also includes using ligation or tagging to introduce adapters for Illumina sequencing onto polynucleotides to capture with complementary sequences on a surface or matrix. This allows users to prepare samples using well-established Illumina protocols, which are then captured and sequenced by the methods of the invention. Preferably, polynucleotides are captured prior to amplification, which tends to introduce errors and biases.

In some embodiments, short (less than about 300 nt) polynucleotides such as cell-free DNA or microRNA, or relatively short (less than 10,000 nt) polynucleotides such as mRNA are modified using a suitable capture molecule. or randomly immobilized on the surface by capturing unmodified ends. Native mRNAs with poly-A tails can be captured on lawns of oligo d(T) probes on the surface. Sequencing is then performed "perpendicularly" from the surface. In some embodiments, short or relatively short polynucleotides make multiple interactions with the surface and sequencing is performed "horizontally." This allows the organization of splicing isoforms to be resolved, for example delineating the location of exons that are repeated or shuffled in some isoforms.

In some embodiments, polynucleotides are captured on an ordered array of capture probes. A regular array is a spatially addressable array. Ordered arrays can take the form of molecular nanostructure arrays, such as can be formed using the DNA origami (Rothemund, Science) approach. Ordered arrays can take the form of 2D molecular lattices such as can be formed by DNA self-assembly (Woo and Rothemund, Nature Communications, 5:4889). Ordered arrays allow efficient sub-diffraction filling of molecules, which allows for a higher density of molecules per field of view (dense arrays), and the single-molecule localization method of the present invention allows for It allows to resolve molecules (eg 40 nm point-to-point distance).

Polynucleotide Repair Polynucleotides can become damaged during extraction, storage, or preparation. Nicks and adducts can be formed within naturally occurring double-stranded genomic DNA molecules. This is especially true when the sample polynucleotides are derived from FFPE material. A DNA repair solution is introduced before or after the DNA is immobilized. This can be done after DNA extraction in gel plugs. Such repair solutions may include DNA endonucleases, kinases, and other DNA modifying enzymes. Such repair solutions may include polymerases and ligases. Such a repair solution is New England Biolabs' pre-PCR kit. The following references are incorporated herein in their entirety. Karimi-Busheri et al. Nucleic Acids Res. 1998 Oct 1;26(19):4395-400 and Kunkel et al. (1981) Proc. Natl Acad Sci. USA, 78, 6734-6738.

Staining Polynucleotides Optionally, in some embodiments, other polynucleotide binding reagents can be used to follow the backbone of the polynucleotide DNA stain. Intercalating dyes, major groove binders, labeled non-specific DNA binding proteins, cationic conjugated polymers can bind to DNA. Intercalating dyes can be used at various nucleobase-to-dye ratios. Using multiple intercalating dye donors at a dye-to-base-pair ratio of about 1:5-10, there are enough dye molecules (eg, Sybr Green1 , Sytox Green, YOYO-1). Some DNA binding reagents can substantially cover a polynucleotide. These DNA stains can also function as FRET partners either homogeneously or in real-time sequencing. Adding an intercalating dye such as YOYO-1 keeps the DNA dark and adding a reagent such as BME is useful to prevent nicking of the DNA. In some embodiments, the polynucleotide is not pre-stained, but a stain is added during the binding process to the denatured DNA. Once the polynucleotide-oligo duplex is formed, the dye can be intercalated, at which point fluorescence is detected without label on the probe. In some embodiments, there is a label that is a FRET partner on the probe and there is a FRET interaction between the label and the intercalating dye.

In some embodiments, bound probes can be excited via a FRET donor, such as an intercalating dye, when a duplex between the bound probes is formed. Resolutions of a few nanometers can be obtained (eg, as described in Chemphyschem. 2014 Aug 25;15(12):2431-5).

Sequencing along stretched DNA using single-molecule localization The concept of transient binding extends to different types of binding probes as long as they can be transiently bound under the reaction conditions can do. Binding probes can be labeled with fluorophores having different flavors of label (eg, emission at different wavelengths).

In some embodiments, fluorescently modified DNA oligos are purchased from Biosynthesis. Streptavidin is purchased from Invitrogen (catalog number: S-888). Bovine serum albumin (BSA) and BSA-biotin are purchased from Sigma Aldrich (catalog number: A8549). Slides and coverslips are purchased from VWR. Three buffers are used for sample preparation and imaging: Buffer A (10 mM Tris-HCl, 100 mM NaCl, 0.05% Tween-20, pH 7.5), Buffer B (5 mM Tris-HCl, 10 mM MgCl2, 1 mM EDTA, 0.05% Tween-20, pH 8), and buffer C (1× phosphate buffered saline, 500 mM NaCl, pH 8).

In some embodiments, fluorescence imaging was performed on an inverted Nikon Eclipse Ti microscope (Nikon Instruments) equipped with a full focus system, using an oil immersion objective (CFI Apo TIRF 100×, NA 1.49, Oil). , apply an objective-type TIRF configuration using a Nikon TIRF illuminator. For 2D imaging, does it support a pixel size of 107 nm? An additional 1.5 magnification is used to obtain a final magnification of 150X. Three lasers are used for excitation: 488 nm (200 mW, Coherent Sapphire), 561 nm (200 mW, Coherent Sapphire), 647 nm (300 mW, MBP Communications). The laser beam was passed through a clean-up filter (ZT488/10, ZET561/10, and ZET640/20, Chroma Technology), and using a multi-band beam splitter (ZT488rdc/ZT561rdc/ZT640rdc, Chroma Technology) to the microscope objective. bind to Fluorescence is spectrally filtered with emission filters (ET525/50m, ET600/50m, and ET700/75m, Chroma Technology) and imaged with an EMCCD camera (iXon X3 DU-897, Andor Technologies).

In some embodiments, for sample preparation, coverslips (No. 1.5, 18 x 18 mm2, ~0.17 mm thick) and glass slides (3 x 1 in2, 1 mm thick) were prepared in duplicate. Sandwich together with double-sided tape to form a flow chamber with an internal volume of approximately 20 μL. First, 20 μL of biotin-labeled bovine albumin (1 mg/ml, dissolved in buffer A) is placed in the chamber and incubated for 2 minutes. The chamber is then washed using 40 μL of Buffer A. 20 μL of streptavidin (0.5 mg/mL, dissolved in buffer A) is then passed through the chamber and allowed to bind for 2 minutes. A wash with 40 μL of buffer A is followed by a wash with 40 μL of buffer B. Finally, biotin-labeled DNA oligo templates and primers (approximately 300 pM monomer concentration) and DNA origami drift markers (approximately 100 pM) in 20 μL of buffer B are placed in the chamber and incubated for 5 minutes.

Ideally, the temperature and oligo sequence are chosen to allow a suitable salt concentration for incorporation. The CCD readout bandwidth is set to 1 MHz for 16 bits and 5.1 MHz for preamplifier gain. Imaging is performed using TIR illumination with an excitation intensity of 294 W/cm2 at 561 nm.

Faster CMOS cameras are becoming available that allow faster imaging. For example, the Andor Zyla Plus allows up to 398 fps over 512x1024 with just a USB 3.0 connection, faster over a region of interest (ROI), or even a CameraLink connection. Therefore, by operating with shorter docking/imaging chains, or at higher temperatures, or at lower salt concentrations, it is possible to collect sufficient information for the required resolution in a short period of time. For this reason, high laser power (eg, 500 mW) is preferred, high camera quantum yield (eg, about 80%) is preferred, and high dye brightness is preferred. This can reduce the required acquisition time to a few seconds. However, it can give a resolution gain of more than 10 times that of the diffraction limited method.

In one embodiment of the present invention, a novel imaging method is implemented using time-delayed integration with a CCD or CMOS camera, where the sample stage moves synchronously with the camera readout, and the time resolution is over many pixels. let it spread out. This accelerates image acquisition as there is no delay in moving from one location on the surface to another. The result is an imaging strip where the first 1000 pixels in a row represent 10 seconds of imaging at one location and the next 1000 pixels represent 10 seconds of imaging at the next location. Also, Appl Opt. 54:8632-6 (2015) can also be adapted.

When light-scattering nanoparticles (eg, gold nanoparticles) or semiconductor nanocrystals are used, there is a substantial further step-up in speed due to the brighter, nearly non-exhaustive optical response of these particles. Again, when using such nanoparticle labels, the frame rate of the camera and the on/off speed of the imaging agent need to be adjusted to improve the maximum speed.

Examples of transient coupling approaches include little effect of photobleaching or dark conditions and no need for sophisticated field stops or Powell lenses to limit illumination. In addition, the effects of non-specific binding to the surface are mitigated by such non-persistence of probe binding to non-specific sites, allowing imaging agents to occupy non-specific binding sites (i.e. not on target docking). It then stays in place and blocks further binding to that location. Typically, the majority of non-specific binding sites that prevent resolution of imaging agent binding to target polynucleotides are occupied and bleached during the early stages of imaging, resulting in on/off of imaging agent to polynucleotide sites. Off-coupling is then readily observed. Thus, in one embodiment, high laser power is used to first bleach probes occupying on-specific binding sites, optionally no images are taken during this step, and then optionally Briefly, the laser power is reduced and imaging is initiated to capture on and off binding to polynucleotides. Further non-specific binding after the initial non-specific binding is infrequent (because the bleached probe can remain anchored to the non-specific binding site), e.g. Can be computationally filtered out by applying a threshold to be considered and binding to the same location must be persistent (e.g., should occur at the same site at least 5 times or at least 10 times) . Typically, about 20 specific binding events to the docking site are detected.

For our purposes, another means to filter out binding that is non-specific is that the signal must be correlated with linear chains stretched out on the surface, which is , by staining linear strands, or by tracing lines through other persistent binding sites. Signals that do not fall along the line, persistent or not, can be discarded. Similarly, if a supramolecular lattice is used, binding events uncorrelated with the structure of the lattice can be discarded.

Isolation of single cells and extraction of both DNA and RNA on surfaces Positive charges such as poly(L) lysine (PLL) (eg available from Microsurfaces Inc. or proprietary coating) is known to be capable of binding to cell membranes. A low flow channel height (less than 30 microns) is used so that cells are more likely to contact the surface. This can be enhanced by using a herringbone pattern in the ceiling of the flow cell that introduces turbulence. Cell attachment requires that the cells be seeded to the surface at a low density (enough space between cells so that the RNA and DNA extracted from each individual cell remain spatially separated). (to ensure that there is a Cells are ruptured using proteinase treatment such that both the cell and nuclear membranes are disrupted so that the cell contents are ejected into the medium and trapped on the surface adjacent to the isolated cells. Let For genomic DNA, this approach is preferred because of the established cytogenetic technique of Fiber FISH. Once immobilized, DNA and RNA are stretched. The stretching buffer flows unidirectionally across the coverslip surface, stretching and aligning the DNA and RNA polynucleotides in the direction of flow. Temperature, extension buffer composition, and the physical forces of flow can remove most of the secondary/tertiary structure of the RNA, making it available for antibody binding. Once the RNA is stretched, it can switch from the denaturation buffer to the binding buffer in its denatured form.

Alternatively, RNA is first extracted and immobilized by disrupting the cell membrane and inducing flow in one direction. Proteinases are then used to disrupt the nuclear envelope and induce flow in the opposite direction. In some embodiments, DNA is fragmented before or after release, eg, by using rare-cutting restriction enzymes (eg, NOT1, PMME1). This fragmentation aids in the dissociation of DNA, allowing individual strands to be isolated and combed. Immobilized cells ensure that the system is set up so that the RNA and DNA extracted from each cell are not intermingled and are well separated. This can be aided by transferring liquid to the gel before, after, or during cell rupture.

Spreading of RNA The spreading of nucleic acids on charged surfaces is affected by the concentration of cations in solution. At low salt concentrations, RNA is single-stranded, negatively charged along its backbone, and likely bound to surfaces randomly along its length.

One approach to this is to first promote its globular morphology by using high salt, in which case the termini, especially the polyA tail, are more accessible for interactions. Once bound in spherical form, a different buffer can be applied to the flow cell to act as a denaturing buffer. Alternatively, we have the option of precoating the PLL with oligo d(T) to capture the polyA tail of the mRNA. Several groups have demonstrated binding of mRNA to the surface using oligo(dT) binding to the polyadenylation 3' of mRNA (eg Ozsolak F, et al.) [4]. The homopolymeric nature of the polyA tail means that the region should be relatively free of secondary structure that could otherwise interfere with entrapment. Because the polyA tail is relatively long (250-3000 nt) in higher eukaryotes, long oligo d(T) capture probes were designed to be sufficient to melt a significant fraction of the intramolecular base pairing of RNA. Hybridization can be performed with relatively high stringency (temperature, salt conditions). Oligo d(T) can be tested with modifications that increase the stability of binding and tested with bridging modifications to immobilize RNA to capture probes after binding. By using denaturing conditions that can disrupt the intramolecular base-pairing of RNA, although it is not sufficient to abolish capture to transform the remaining RNA structures from a globular state to a linear state after binding. , and by fluid flow or electrophoretic forces.

Sequencing Instrumentation and Devices The sequencing methods of the invention have common instrumentation requirements. Basically, the instrument must be capable of imaging and exchange of reagents. Imaging requirements include one or more groups: objective lenses, relay lenses, beam splitters, mirrors, filters, cameras or point detectors. The camera contains a CCD or array CMOS detector. Point detectors include photomultiplier tubes (PMTs) or avalanche photodiodes (APDs). Several CESA high speed cameras are used. Other optional aspects, depending on the format of the method, include illumination sources (eg, lamps, LEDs, or lasers), and means for coupling the illumination to the substrate, such as prisms, gratings, sol-gel , lens, motion stage or movable objective lens, sample movement relative to the imaging device, sample mixing/stirring, temperature control, and electricity.

In single-molecule embodiments of the present invention, illumination is preferably via the generation of evanescent waves, e.g., prism-based total internal reflection, objective-based total internal reflection, grating-based waveguides, hydrogel-based Through a waveguide, or an evanescent waveguide created by bringing laser light to the edge of the substrate at a suitable angle, the waveguide may include a core layer and a first cladding layer. Illumination may alternatively include thin layer oblique light (HILO) illumination or a light sheet. Some single-molecule instruments mitigate the effects of light scattering by using synchronization of pulsed illumination and time-gated detection. Here light scattering is gated out. In some embodiments, darkfield illumination is used. Some instruments are set up for fluorescence lifetime measurements.

In some embodiments, the instrument also includes means for extracting polynucleotides from cells, nuclei, organelles, chromosomes, and the like.

A suitable instrument for most embodiments of the invention is the Genome Analyzer IIx from Illumina, which includes a prism-based TIR, 20× dry objective, light scrambler, 532 nm and 660 nm lasers, infrared-based It consists of an autofocus system, an emission filter wheel, a Photometrix CoolSnap CCD camera, temperature control, and a syringe pump-based system for reagent exchange. Refinement of this instrument with a combination of alternative cameras will allow better single-molecule sequencing. For example, the sensor preferably has low electronic noise, less than 2e. Also, the sensor has a large number of pixels. Syringe-pump based reagent exchange systems can also be replaced with pressure driven flow based systems. The system can be used with compatible Illumina flow cells or custom flow cells adapted to match the actual or modified plumbing of the instrument.

Alternatively, a laser bed (laser depends on label choice) or laser system and light scrambler from a genomic analysis device, EM CCD camera (e.g. Hamamatsu ImageEM) or Scientific CMOS (e.g. Hamamatsu Orca FLASH) and A coupled motorized Nikon Ti-E microscope and optionally temperature control can be used. In some embodiments, consumer sensors are used rather than scientific sensors. This has the potential to dramatically reduce the cost of sequencing. This is coupled with a system of pressure driven or syringe pumps and a specially designed flow cell. Flow cells are made of glass or plastic, each having advantages and disadvantages. In cyclic olefin copolymers (COC), such as TOPAS, other plastics, or PDMS, or silicon or glass, using microfabrication methods. Injection molding of thermoplastics offers a low cost route to industrial scale manufacturing. For some optical configurations, the thermoplastic should have good optical properties with minimal intrinsic fluorescence. Polymers containing, but not aromatic or conjugated systems are expected to have significant intrinsic fluorescence and should ideally be excluded. Zeonor 1060R, Topas 5013, PMMA-VSUVT (US8057852B2) are reported to have reasonable optical properties in the green and red wavelength range (eg for Cy3 and Cy5), with Zeonar 1060R being the most preferred. Methods are available for covalently attaching probes to some of these surfaces. Methods for bonding thermoplastics have been reported (eg Microfluidics and Nanofluidics, 19(4), 913-922). In some embodiments, the glass coverslip to which the biopolymer is attached is bonded to a thermoplastic fluidic architecture. Although glasses have excellent optical properties as well as several other advantages, it has been difficult to fabricate low-cost and complex microfluidic devices, despite currently available options (Scientific Reports 5:13276 (2015)).

Alternatively, a manually operated flow cell can be used on top of the microscope. This can be easily constructed by creating a flow cell using double-sided adhesive sheets, laser cutting to obtain channels of appropriate dimensions, and sandwiching between a coverslip and a glass slide.

From one reagent change cycle to another, the flow cell may remain on the instrument/microscope until frame-to-frame alignment. A motorized stage with a linear encoder can be used to ensure stage movement when imaging large areas, and fiducial markers can be used to ensure correct revisiting of the same locations and correct alignment. Alternatively, the flow cell is removed from the instrument/microscope after each imaging round, and the integrated reaction is e.g. elsewhere in a thermal cycler with flat blocks before being returned to the microscope for the next round of imaging. (the term imaging is used to include 2D arrays or 2D scanning detectors). In this case, it is important to have fiducial markings, such as etching of the flow cell or surface, immobilized beads within the flow cell that can be optically detected. If the polynucleotide backbone is stained (eg, by YOYO-1), the distribution of those fixed positions can be used to align images from one frame to the next.

In one embodiment, the illumination mechanism described in US7175811 or Ramachandran et al (Scientific Reports 3:2133) using laser or LED illumination is combined with a temperature control mechanism and a reagent exchange system to practice the methods of the invention. can be combined with In some embodiments, a smartphone-based imaging setup (ACS Nano7:9147) can be coupled with an optional temperature control module and reagent exchange system. Primarily, the phone's camera is used, but other aspects such as the lighting and vibration capabilities of an iPhone or other smart phone device can also be used.

Instead of using various microscope-like components of an optical sequencing system such as GAIIx, a more integrated integrated device can be built for sequencing. Here, the polynucleotides are attached directly onto the sensor array, or onto a substrate adjacent to the sensor array, and optionally elongated. Direct detection on sensor arrays has been demonstrated for DNA hybridization to the array (Lamture et al Nucleic Acid Research 22:2121-2125 (1994)). Because Rayleigh scattering is short-lived compared to emission from fluorochromes, the sensor can be time-gated to reduce background fluorescence.

In one embodiment, the sensor is a CMOS detector. In some embodiments, multiple colors are detected (US2009/0194799). In some embodiments, the detector is a Foveon detector (eg US6727521). The sensor array can be an array of triple junction diodes (US9105537). In some embodiments, different labels on oligos or other binding reagents are encoded by wavelengths of emission. In some embodiments, different labels are encoded by fluorescence lifetimes. In some embodiments, the different labels are encoded by fluorescence polarization. In some embodiments, different labels are encoded by a combination of wavelength, fluorescence lifetime.

Using a single wavelength as the light source and not having to use filters is advantageous both because of the simplicity of the setup and because of the inevitable loss of some light when using filters is. In some embodiments, different labels are encoded by repetitive on-off hybridization kinetics, and different binding probes with different association-dissociation constants are used. In some embodiments, probes are encoded by fluorescence intensity. Probes can be fluorescence intensities encoded by having different numbers of non-self-quenching fluorophores attached. Individual fluorophores usually need to be sufficiently separated to avoid quenching, and rigid linkers or DNA nanostructures that hold them in place at suitable distances are good ways to accomplish this. The method. One alternative embodiment for encoding by fluorescence intensity is to use dye variants that have similar emission spectra but differ in their quantum yields or other measurable optical properties, e.g. , Cy3B(558/572) are significantly brighter (quantum yield 0.67) than Cy3(550/570) (quantum yield 0.15), but have similar absorption/emission spectra. A 532 nm laser can be used to excite both dyes. Other dyes that can be used include Cy3.5 (591/604), which has upshifted excitation and emission spectra, while still being excited by a 532 nm laser, but emitting from Cy3. In a bandpass filter designed to select , Cy3.5 does not appear bright because it is excited by the suboptimal wavelength, even though both have similar quantum yields. Atto532 (532/553) has a quantum yield of 0.9 and is expected to be bright because the 532 nm laser hits its sweet spot. Despite these expectations, the dyes used must be empirically tested to adequately measure their performance. If dyes from the above set cannot be distinguished, other dyes can be tested. Another approach to obtaining multiple codes using a single excitation wavelength is to measure the emission lifetime of dyes. For this purpose, sets including Alexa Fluor 546, Cy3B, Alexa Fluor 555, and Alexa Fluor 555, as well as many other combinations can be used. In some embodiments, the code repertoire can also be expanded by using FRET pairs and by measuring the polarization of the emitted light. Thus, a large repertoire of distinguishable labels can be created at any desired combination of wavelength, lifetime, polarization, and FRET pair. Another means of increasing the number of signs is to code with multiple colors.

Current optical sequencing methods require an image processing step to extract the sequence signal from the image. This usually involves extracting the relevant signal from each frame of the image. In one embodiment, an alternative is to capture the signal vertically through every cycle from every pixel and calculate the array using an algorithm. One advantage of this approach is that when the signal trajectory is viewed vertically throughout the cycle, it is easier to filter out non-specific or background signals, which usually occur at the same location throughout the cycle. No, but the actual integration happens at the same place. The signal belonging to a particular elongated molecule is also easy to determine, as it can be traced by a straight line through a series of pixels.

Lipid Passivation When generating lipid bilayers (LBLs) on the surface of nanofluidic channels, we used 1% Lissamine™, which is added to allow observation of LBL formation in a fluorescence microscope. ) Rhodamine B 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine, triethylammonium salt (rhodamine-DHPE) zwitterionic POPC (1-palmitoyl-2-oleoyl-sn-glyceroyl) containing lipids -3-phosphocholine) lipids were used. Prior to each coating procedure, lipid vesicles with a diameter of approximately 70 nm were made by extrusion (see ESI). The extruded vesicle solution was flushed through one of the microchannels of the fluidics system. Subsequently, lipid vesicles settle to the surface, burst, form patches of LBLs, and within minutes connect into continuous LBLs, coating the entire microchannel. The LBL then diffuses spontaneously into the nanochannel, ensuring a steady supply of vesicles, while the flow of lipid vesicles is maintained within the coated microchannel. During the coating process, a countercurrent flow (approximately 80 μm/sec) is imposed on the coated microchannels through the nanochannels to avoid any debris or vesicles within the nanochannels. A slightly faster alternative method was also tested, which involved flushing lipid vesicles from an LBL-coated microchannel through the nanochannel, resulting in sedimentation and rupture of the lipid vesicles within the nanochannel. However, with this method, care must be taken to prevent vesicles and other debris from accumulating and potentially blocking the nanochannels.

Epi-Marking Reagents and Labeling Methods Genomic or epigenetic modifications (Epi-Marks) on polynucleotides can be detected using the methods of the invention. The focus here is on binding in the form of 5-methylcytosine in humans to methyl groups on genomic DNA that normally occur in the context of CpG motifs. However, the same principle can be applied to other modifications such as hydroxylmethyl C, as well as various types of DNA damage. Modifications on RNA can be similarly labeled. Synthetic DNA and RNA such as trRNA and RNA models containing one or more types and different numbers of modifications (various modifications are available for oligonucleotide synthesis) are available from commercial vendors (e.g. IDT, Trilink). Obtainable. For DNA, the affinity binding of antibodies to genomic methyl C (available from Diagenode, etc.), methyl-binding protein 1 (MBD1), and peptide fragments of MBD1 (all from Abcam) can be tested and optimized. can. For RNA, antibodies such as antibodies to methyladenosine (m6A) (available from Abcam) and m7G-cap (as a control) (available from SySy.com) can be tested and optimized. The efficiency of binding to DNA or RNA containing these modifications can be measured using two metrics. First, binding of affinity reagents to modified and unmodified versions of the oligonucleotide sequence, and to both DNA and RNA versions, can be tested using, for example, spotting and binding on filter paper. . The efficiency and specificity of binding of each antibody to synthetic oligonucleotides, either containing targeted, non-targeted, or no modifications, can be established. For anti-methyl antibodies, it is preferred to denature the genomic DNA in situ.

Local Depletion and Mitigation Effects of Laminar Flow Local depletion of the probe can be addressed by ensuring efficient mixing or agitation of the probe solution. It uses acoustic waves by including turbulence-generating particles in the solution and/or by constructing a turbulence-generating flow cell (e.g., a herringbone pattern on one or more surfaces). can be done by In addition, due to laminar flow within the flow cell, there is typically little mixing, and the solution near the surface may be poorly mixed with the bulk solution. This creates problems in removing reagents/bound probes near the surface and bringing fresh reagents/probes to the surface. To combat this, the turbulence generation approach described above can be implemented and/or large scale fluid flow/exchange at the surface can be performed. One approach is to attach non-fluorescent beads or spheres to the surface after aligning the target molecules, giving the surface landscape a rough texture for more effective mixing and/or exchange of fluids near the surface. Generate the required vortices and flows.

High speed imaging Single molecule localization microscopy (SMLM) relies on high photon counts. High photon counts improve the accuracy with which the centroid of fluorophore generation of Gaussian patterns can be determined, but the need for high photon counts is also compromised by long image acquisitions and reliance on bright, photostable fluorophores. Related. The speed of the process can be increased by combining high-frame detection with increasing concentrations of probe. However, high concentrations of labeled probe can cause high background fluorescence, which can obscure the detection of signal on the surface. This can be addressed by using DNA stains or intercalating dyes to label the duplexes formed on the surface. The dye does not intercalate when the target is single-stranded, nor does it intercalate with the single-stranded probe, but it does intercalate when a duplex is formed between them. In some embodiments, the probe is unlabeled and the detected signal is due solely to the intercalating dye. In some embodiments, probes are labeled with intercalating dyes or labels that function as FRET partners to DNA stains. The intercalating dye can be a donor and can be conjugated with acceptors of different wavelengths, thus allowing the probe to be encoded with multiple fluorophores.

Further Examples Detection of Epimark Locations on Polynucleotides

Optionally, transient binding of epigenome binding reagents occurs prior to (or sometimes after or during) the oligo binding process. Conjugation is performed before or after denaturation, depending on which binding reagent is used. In some embodiments, anti-methyl C antibody binding is performed on denatured DNA, whereas for methyl binding proteins, binding is performed on double-stranded DNA prior to any denaturation step.

Step 1—Transient attachment of methyl binding reagent.

After denaturation, the flow cell is flushed with a PBS wash, Cy3B labeled anti-methyl antibody 3D3 clone (Diagenode) is added in the transient protein binding reagent and binding is imaged.

Alternatively, prior to denaturation, the flow cell is flushed with phosphate-buffered saline, Cy3B-labeled MBD1 is added, and imaged in a transient protein binding reagent. Imaging for transient oligo binding is performed as described above.

The transient binding buffer is the elution buffer at pH 2.8. A typical elution buffer contains 50 mM HEPES (pH 7.9), 0.1 M NaCl, 1.5 mM MgCl2, 0.05% Triton X-10. A transient interaction can also be performed with 0.2% SDS and 0.1% Tween-20 for 7 minutes at room temperature. Additionally, transient protein interactions with DNA can be performed in 0.1 M glycine HCl, pH 2.5-3. This buffer effectively dissociates most protein or antibody binding interactions without permanently affecting protein structure. However, some antibodies and proteins are damaged by low pH, so the eluted protein fraction was washed with 1/10 volume of alkaline buffer (such as 1 M Tris.HCl, pH 8.5 or PBS buffer). It is best to neutralize immediately by adding

In some embodiments, PBS is used for binding and stable binding rather than transient binding is detected and location recorded.

Step 2—Removal of Methyl Binding Reagent

Typically, epi-analysis is performed prior to sequencing, so optionally, methyl binding reagents are flashed off prior to polynucleotides prior to initiating sequencing. This can be done by running multiple cycles of PBS/PBST and/or high salt or elution buffer and SDS followed by imaging to confirm that removal has occurred. If it is evident that more than a negligible amount of binding reagent remains, a more stringent treatment such as chaotropic salts, GuCL can be run through to remove the remaining reagent.

Step 3—Data Correlation After sequencing and epigenomics data are obtained, correlations are performed between sequencing binding sites to correlate epibinding sites to provide sequence context for methylation or omic information.

Preparation of RNA Poly RNA is hybridized to surface-attached oligo dT (0.1-1 uM). Oligo-dT contains one or more psoralen residues, which cross-link RNA to oligo-dT. Once the RNA is anchored in place, it is then electrophoretically stretched in fluid flow, a receding meniscus, or a denaturing solution to help release the ny secondary structure. Once the RNA is stretched or elongated, the oligo-ligation approach of the present invention is applied.

Preparation of Long ssDNA Using Rolling Circle Amplification A double-stranded DNA target is circularized and then subjected to rolling circle amplification to generate tandem single-stranded copies of one side of the duplex. dsDNA is polished by using T4 DNA polymerase 1 (Roche) and dNTPs (Promega). T4 polynucleotide kinase phosphorylates the 5' hydroxyl group. The stem-loop (8-200 base dT:dA stem, loop contains GGTTTTTCGCCCTTTCACGTTGGA) is then ligated to both ends of the polished DNA using T4 DNA ligase. Priming can occur from a nick or from a primer that binds within the stem-loop.

Rolling circle amplification can also be performed on circular single-stranded targets using primers, eg, 1 μL of 1 nM M13mp18 template (NEB) can be amplified with the following protocol. The protocol can also be applied to double-stranded DNA with stem-loops attached at both ends. In this case, 10 μL of 10× reaction buffer (10× phi29 DNA polymerase buffer (B7020, Enzymatics, 500 mM Tris-HCl, 100 mM (NH4)2SO4, 40 mM DTT, 100 mM MgCl2, pH 7.5), 2 .5 μL of 100 nM primer (TCCAACGTCAAAGGGCGAAAAACC, IDT), and 1.6 μL of dNTP mix (Enzymatics N2050L) are brought to a volume of 48 μL with water.The mixture is incubated at 95° C. for 1 minute and then at 60° C. for 1 minute. and then brought to 4° C. Place the mixture on ice and add 2 μL of phi29 DNA polymerase (10 U/μL, Enzymatics P7020-LC-L) The whole mixture is then incubated at 30° C. for 4 hours and then , brought to 4° C. and diluted with 450 μL of 1×PBS (pH 7.4).The recovered solution is then diluted 100-fold in PBS.Before sequencing, the stock solution was added to the complementary sequence (GGTTTTTCGCCCTTTGACGTTGGA, A rolling circle amplicon is added to a surface containing IDT) such that the amplicon becomes immobilized via multiple interactions along its length.

Alternatively, double-stranded DNA with single-stranded overhangs attaches to vinylsilane surfaces in MES buffer pH 5.5 via hydrophobic interactions between the exposed bases of the overhangs and the surface. . The buffer is then exchanged with a denaturing buffer (0.5 M to 1 M NaOH) and several washes are performed so that non-immobilized strands can be flashed off. The coverslip is then exposed to MES again and the DNA is elongated by the receding meniscus. Similarly, the ends of the DNA can be modified to add homopolymeric tails, eg, by terminal transferase (NEB), and the DNA can then be captured on complementary homopolymeric oligonucleotides. The uncaptured strand of double-stranded DNA can then be melted using heat and/or chemical denaturation or by using a motor protein such as a helicase (eg, Hel308) to separate the strands. Thus, the tail of the phone polymer can be tens to hundreds of nucleotides and the capture probe can be similarly long. Alternatively, a cross-linking reagent is provided to hold the tailed strand in place while the other strand is denatured. Tailed DNA can also be ligated at the other end with a stem-loop to join the two strands of the duplex, so that when the DNA is captured, both strands of the DNA are aligned. can be determined. In this case, the transient binding buffer is designed to weaken the base pairing of the duplex (preventing its reformation, Therefore, it is configured to prevent binding of oligos).

Binding of NNNXNNN Oligonucleotide Species to Nucleic Acids For sequencing using NNNXNNN, where N is a degenerate position and X is a designated position, four oligonucleotide libraries 5′NNNANN3′, 5 Each of 'NNNCNNN3', 5'NNNGNNN3', and 5'NNNANNN3' was differentially labeled with Atto488, Atto542, Alexa594, and Atto655, respectively, and 2.4-3. A 15 ul drop containing 5 M TMACl or 4×SSC and 0.01-0.1% Tween 20 is combined and applied to the surface on which the nucleic acid molecules are stretched or stretched. Coverslips are sealed to glass slides using epoxy, cow gum, or nail varnish. Coverslips were placed on the microscope IX2 nosepiece of an Olympus 1X81 inverted microscope and a quad-band TIRF filter cube (Chroma) using four combined laser lines (Agilent), 488 nm, 532 nm, 590, and 640 nm. and illuminate the sample simultaneously through a 1.45 NA Olympus TIRF objective. Optionally, a fiber optic scrambler (point source) is used to homogenize the beam. The laser power is adjusted at each wavelength from 40 to 150 mW to obtain comparable signal brightness. The TIRF angle is also adjusted to obtain optimal contrast images for each of the illumination channels. The radiation is divided into four quadrants on a Quad-view device (Photometrics) before being projected onto a 95B Scientific CMOS camera (Photometrics). Alternatively, the four emission wavelengths of the four dyes are split to multiple cameras using a series of dichroic and reflective mirrors. The camera settings are adjusted along with the laser power to give approximately equivalent signal intensities for each dye, but because the binding information collected is digital, the intensity of the signals from the four dyes are exactly equivalent. No need. The identity of each signal is determined by the software by taking into account the emission profile of each dye in different emission channels of quad view quadrants or multiple cameras. The previously determined emission profile can then be used to determine the identity of the dye.

Optionally, 1 nM YOYO-1 or similar intercalating dye is also added to the reaction mixture, and high concentrations of oligos up to 1 uM are used, combined with the high frame rate of the camera. Here, only a single 488 nm laser is used to excite the four dyes via a FRET mechanism.

Optionally, a DNA PAINT imaging agent is also added as part of the 15ul mixture along with a 1uM DNA origami grid as a fiducial marker.

The imaging data were processed using a super-resolution image processing package such as ImageJ/Fiji or Thunderstorm (J. Schnitzbauer*, M.T. Strauss*, T. Schlichthaerle, F. Scheder, R. Jungmann Super) which is a plug-in to Picasso. -Resolution Microscopy with DNA-PAINT.Nature Protocols (2017).12:1198-1228 DOI: https://doi.org/10.1038/nprot.2017.024).

The super-resolution image is then processed to find the coordinates of the binding positions along the nucleic acid strand and the data from different colors corresponding to different defined nucleotides are compiled to reconstruct the sequence of each of the nucleic acid strands. do. More complete information on image processing and sequence assembly is provided in the PCT and its offspring.

Drift To obtain the highest positioning accuracy (eg, nanometer or sub-nanometer), it is important to control vibration and drift (eg, caused by thermal fluctuations). To prevent drift, motorized stages should not be used. This is because motion often remains even when the stage is stopped, leading to a drift of several pixels or tens of pixels. Fiducial markers can be used to correct for drift. Gold or silver particles, semiconductor nanocrystals, nanodiamonds, along with fluorescently labeled latex particles are particularly preferred nanoparticle labels. They emit light with high quantum efficiency (QE), have high photostability, long fluorescence lifetime (17 ns) (can be used for time gating of light scattering/autofluorescence (1-2 ns)). , may be small (eg, 40 nm).

Drift can also be corrected computationally. Drift correction involves tracking the position of each marker through the time of each movie and averaging the trajectories of all detected markers to measure the global correct drift of the image. Fiji/ThunderSTORM as well as MatLab also have inherent drift correction algorithms that are reasonably effective and do not require fiducial markers, but rather correct drift by autocorrelation. The Nikon Ti microscope has a Perfect Focus and the Olympus has a Z-drift compensation module (IX3-ZDC2). Also, a low tech way to avoid drift is to rigidly attach the sample stage to the objective lens (eg, the Olympus nosepiece stage). Also, if the thermal environment is well controlled, the drift may become negligible and/or stabilize after a few minutes.

DNA origami, 100 nm gold nanoparticles, (Sigma Aldrich, 10 nM in buffer C, added before imaging), 100 nM Tetrasppeck beads (Thermofisher) or nanodiamonds can be used as drift and alignment markers. An off-the-shelf camera, such as the Photometrics Prime 95B, with particle tracking capabilities, can be used to bring the fiducial markers into focus.

Alternatively, focus position drift can be eliminated by custom-built focus stabilization. A near-infrared laser (LP785-SF20, Thorlabs) was completely internally reflected from the cover slide and the glass-water interface of the sample. The beam position is monitored with a CMOS camera (UI-3240CP-NIR-GL, Imaging Development Systems, Obersulm, Germany). Feedback control implemented in LabVIEW 2015 (National Instruments) maximized the cross-correlation between the image of the laser spot and the reference image. Adjust the axial sample position every 200 ms (P737.2SL and E-709.SRG, Physikalische Instrumente). Samples and objectives are stabilized at 23° C. (Okolab, Ottaviano, Italy, with H101-CRYO-BL stabilization unit, H101-MINI sample chamber and OKO-MOC objective stabilization).

Systems for Minimizing Bleaching, Triple State, and Photodamage Depending on the dye used to label the oligonucleotides, the following reagents are effective:
(a) pyranose oxidase, catalase, glucose, (b) protocatechuate-dioxygenase, 3,4-protocatechuate, (c) catalase, glucose oxidase, sucrose or glucose (a highly stable commercial version of FluMaXx (Hypermol) is Available).
(d) methylene blue and dithiotrol (DTT), (e) reducing agents including β-mercaptoethanol, TCEP, or dithiotrol (DTT), (f) Trolox, 1,3,5,7 cyclooctatetraene, and/or or triple-state quenchers/enhancers including 4-nitrobenzyl alcohol.

As oxygen scavengers, pyranose oxidase, catalase, glucose (PO+C) are particularly effective and are prepared as follows:

1× Trolox is added and incubated for 1 hour before PO+C is measured with a PO+C oxygen scavenger system (1×PO, 1×C, 0.8% glucose). Stock solution: 100×PO solution consists of 26 mg PO (P4234-250UN, Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany), 684 μL enzyme buffer, 100×C solution consists of 2 mg in 1 ml enzyme buffer of catalase. Both were filtered by centrifugation (Ultrafree MC-GV, Merck KGaA, Darmstadt, Germany; 0.22 μm), flash frozen in liquid nitrogen and ? Stored at 80°C. The 100× Trolox solution consisted of 100 mg Trolox (Sigma-Aldrich 238813-1G), 430 μL methanol, and 345 μL NaOH (1M) in 3.2 mL H2O, ? Stored at 20°C.

Fluorescent labels can induce photodamage in target DNA. To minimize this, it is useful to separate the fluorescent label from the target DNA in addition to adding one or more of the above additives. This is done in one or both of two ways. The first is simply to add a spacer between the oligonucleotide species and the fluorescent label. An 18 base long spacer can be added to the oligonucleotide probe and is effective when the label is Cy3B. A second method is to add a protein shield between the label and the oligonucleotide, so that when the oligonucleotide binds to the target polynucleotide/nucleic acid, the protein is protected from oxidation processes to the nucleic acid on the substrate. Acts as a shield to reduce impact. Many proteins can be used as shields, one example is streptavidin, which can be linked to biotinylated oligonucleotide species and labeled with one or more fluorescent dyes.

Large Area Sensor To obtain a large field of view for long molecules, a camera with many pixels is coupled with a low magnification objective lens. A camera containing a Sony IMX253 sensor with 12 million 3.5 micron pixels and low electronic noise can be used. The sensor is connected to a 10 GigE interface for high speed data transfer (HR1200 by Emergent Vision Technologies (Canada) allows 80 frames per second). This camera is coupled to a 20×0.75 NA Nikon objective and can image stretched DNA approximately 2 megabases long in one axis of the sensor.

Temperature Control and Reagent Exchange Temperature control and reagent exchange are provided by the CherryTemp (France) fast switching and accurate temperature control system as well as fixed and stretched/extended nucleic acid and multiple reagent inlet and pressure driven flow systems (Elvesys, France). It is performed using a system that includes a perfusion chamber coupled onto a coverslip that includes one or more outlets connected to. To deliver multiple reagents, an Elvesys pressure generator pipe is placed into the splitter, applying pressure within the tubing of the reagents to be delivered, pushing the reagents into the valve, then switching the valve to the flow cell through the capillary tubing. deliver specific reagents to A flow sensor is integrated into the flowline to measure flow rates from 0-80 ul/min and provide feedback to adjust the pressure generator to the appropriate level for the required flow rate (eg, 10 ul/min). be.

The invention is most thoroughly understood in light of the teachings herein and the references cited therein. The embodiments within the specification provide an illustration of embodiments of the invention and should not be construed as limiting the scope of the invention. The skilled artisan readily recognizes that many other embodiments are encompassed by the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be covered by the claims (below).

Additional Embodiments 1 . A method for identifying sequences of subunits in a single polymer molecule comprising:
i. immobilizing the polymer;
ii. contacting the polymer with a molecular probe that recognizes a subunit of the polymer;
iii. locating the binding site of the molecular probe;
iv. determining the location of the subunit by determining the binding location of the molecular probe.

2. 2. The method of 1, comprising repeating steps (ii) and (iii) multiple times.

3. 3. The method of 2, comprising binding probes of the same specificity multiple times.

4. 3. The method of 2, wherein each iteration of (ii) comprises a bound probe of different specificity.

5. 2. The method of Claim 1, wherein contacting the molecular probe comprises multiple transient binding events of the probe with the polymer.

6. A method for sequencing nucleotide modifications and/or bases on a single target polynucleotide, comprising:
i. immobilizing the polynucleotide on a surface or matrix;
ii. The addition of one or more probe species under conditions in which the probes bind transiently to their binding sites, such transient binding of multiple probes to each binding site in turn. allowing binding to target sites to be distinguished from binding to non-target sites (e.g., by differences in duration of binding), adding
iii. Continuously imaging (or taking multiple frames) the polynucleotide on the 2D detector such that a threshold number of binding events has accumulated and recording the pixel coordinates of the binding;
iv. removing the probe of ii;
v. repeating steps ii-iv using a different one or more probe species each time;
vi. The data from each iteration of step iii are compiled using a single-molecule localization algorithm to determine the nanometric or sub-nanometric location of each of the binding sites to which the probe persistently binds (e.g., 10 or more binding events of the
vii. determining the order (sequence) of binding species at each of the nanometric locations using vi to compile the nucleotide modification and/or base sequence of the polynucleotide.

7. 7. The method of 1 and 6, comprising extending and immobilizing.

8. 2. The method of 1, wherein the identity of the probes of each specificity is known or can be determined.

9. 7. The method of 1 and 6, wherein the binding probe is an oligonucleotide.

10. 7. The method of 1 and 6, wherein the binding probe is an antibody, affibody, affimer, nanobody, aptamer, or nucleic acid binding protein.

11. 7. The method of 6, wherein probe species can be distinguished.

12. The method of 1 and 6, wherein binding is detected via a spatially resolvable signal.

13. 13. The method according to 12, wherein the spatially resolvable signal results from one or more labels on the probe.

14. 14. The method of 13, wherein the identity of the probe is encoded.

15. the binding probe comprises a complete repertoire of recognition sequences (e.g., 64 3 bases long, 245 4 bases long, 1024 5 bases long, or 4096 6 bases long), optionally 10. The method of 9, including additional degenerate bases or universal bases.

16. 7. The method of 6, wherein the single target polynucleotide is derived from a chromosome or portion thereof.

17. 7. The method of 6, wherein the single target polynucleotide is about 10< ² >, 10< ³ >, 10<^4> , 10< ⁵ >, 10< ⁶ >, 10< ⁷ >, 10< ⁸ >, 10< ⁹ > bases in length.

18. 7. The method of 6, further comprising extracting the single target polynucleotide molecule from cells, organelles, chromosomes, viruses, exosomes, or bodily fluids/substances with minimal disruption of the polynucleotide.

19. 7. The method of 1 and 6, wherein the target polymer/polynucleotide molecule is immobilized on a surface.

20. 7. The method of 1 and 6, wherein the target polymer/polynucleotide molecule is placed in a gel or matrix.

21. 7. The method of 1 and 6, wherein the target polymer/polynucleotide molecule is placed in a microfluidic or nanofluidic channel.

22. 7. The method of 1 and 6, wherein the target polymer/polynucleotide molecule is substantially intact.

23. 7. The method of 6, wherein the sequence is determined without using another copy of the target polynucleotide molecule or a reference sequence of the target polynucleotide molecule.

24. A method for haplotype resolved sequencing of a diploid or polyploid genome comprising:
i. sequencing the first target polynucleotide representing the first haplotype of the diploid/polyploid genome using the method of 1 or 6;
ii. sequencing a second target polynucleotide representing a second haplotype of the diploid/polyploid genome using the method of 1 or 6;
iii. For polyploid genomes, the method of claim 1 or 6 is used to sequence further target polynucleotides representing further haplotypes of the polyploid genome, thereby sequencing the first, second and further haplotypes of the genome. and sequencing that the first and second target polynucleotides, as well as the additional target polynucleotides, are from different homologous chromosomes (chromosomal homologues).

25. A method of obtaining long-contiguous sequencing reads, comprising:
i. obtaining a first short read based on a probe binding event;
ii. obtaining a second short read adjacent to the first read based on the probe binding event;
iii. obtaining additional short reads that flank the first or second short reads based on probe binding events;
iv. splicing together at least two short reads to obtain a continuous long read.

26. 26. The method of 25, wherein some of the haplotype-resolved sequencing reads are obtained from separate polynucleotides of each homologue (eg, from multiple cells).

27. The method of 6, wherein inferring location using one or more reference sequences facilitates nanometric localization or ordering.

28. The method of any preceding claim, wherein the target polynucleotide is in contact with a gel or matrix.

29. The method according to 1 and 10, wherein sequencing is combined with epi-mark analysis (eg methylation) by labeling of epi-marks orthogonal to the base sequence.

30. A method of determining the chemical structure of a polymer comprising stretching the polymer and attaching multiple temporally resolvable labels at multiple sites along the stretched polymer, comprising: A method comprising: binding sites that are not resolvable by diffraction-limited optical imaging; and determining their location with nanometric or sub-nanometric accuracy.

31. 7. The method of 6, wherein transient binding comprises active unbinding.

32. 32. The method according to 31, wherein the binding comprises a stable binding.

33. 33. The method according to 32, wherein active dissociation comprises breaking the bond by means including heat, pH change, salt concentration change, chemical degradation or biochemical degradation of the probe.

34. 32. The method according to 31, wherein binding and active dissociation are performed using temperature cycling in a homogeneous reaction.

35. A method according to any preceding claim, wherein the binding probes are bound to discrete sequence bits (defined according to the specification).

36. The method of any preceding claim, wherein the bound probes are localized with nanometric accuracy and precision.

37. The method of any preceding claim, wherein the binding site is located with sub-nanometric accuracy and precision.

38. A method according to any preceding claim, wherein two or more arrayed bits bound by two or more binding probes are super-resolved with respect to each other.

39. The method according to 1-38, wherein the probe is directly labeled.

40. The method according to 1-38, wherein the probe is indirectly labeled.

41. 41. The method of 40, wherein the indirectly labeled probe comprises a target binding domain and at least one labeling domain.

42. 42. The method of 41, wherein said target binding domain comprises at least 3 nucleotides and is capable of transiently binding to a target nucleic acid.

43. 42. The method according to 41, wherein said labeling domain comprises a nucleic acid sequence capable of stably binding a complementary nucleic acid molecule to be labeled.

44. 42. The method of 41, wherein the probe comprises a target binding domain and multiple labeling domains.

45. 45. The method according to 44, wherein said plurality of labeling domains each comprises a nucleic acid sequence capable of stably binding a complementary nucleic acid molecule to be labeled.

46. 45. The method according to 44, wherein each binding domain comprises a different sequence.

47. 45. The method according to 44, wherein each different binding domain corresponds to one of the at least three nucleotides.

48. 48. The method according to 47, wherein the identity of one of the at least three nucleotides is determined by different labels.

49. 49. The method according to 48, wherein at least 12 different labels are used, or 11 different labels and 1 blank.

50. 45. The method of 41 and 44, wherein the target binding domain comprises at least 3 nucleotides and one or more degenerate nucleotide positions.

51. 49. The method according to 48, wherein the labels differ by wavelength, lifetime, brightness, polarization, etc. of emitted, emitted, or scattered light.

52. The method of the preceding embodiment, wherein the polynucleotide is tailed at the end and captured via a sequence complementary to the tail.

53. 53. The method according to 52, wherein the tail-complementary sequences are organized in an ordered array.

54. 53. The method according to 52, wherein the ordered array comprises a supramolecular grid (eg DNA origami) comprising a spatially ordered array complementary to the tails.

55. 53. The method of 52, wherein the polynucleotide is tailed using terminal transferase.

56. 53. The method of 52, wherein the target polynucleotide is a short nucleic acid, a cell-free nucleic acid, or a circulating nucleic acid.

57. 53. The method of 52, wherein the target polynucleotide is mRNA and is already naturally tailed at one end.

58. 53. The method according to 52, wherein the target polynucleotide is RNA not already naturally tailed at one end.

59. The method of any preceding embodiment, wherein the polymer/polynucleotide is denatured prior to probe binding.

60. A method according to previous embodiments, wherein a single polymer/polynucleotide is stretched or elongated.

61. The method of the preceding embodiment, wherein a single polymer/polynucleotide is immobilized on the surface.

62. The method of the preceding embodiment, wherein a single polymer/polynucleotide is immobilized in a gel or matrix.

63. A method of identifying and ordering the chemical structures of a heterogeneous polymer comprising extending the polymer and attaching a plurality of probes to identify chemical structures at multiple sites along the extended polymer, comprising: are closer than can be resolved by diffraction-limited optical imaging, but are resolvable from the temporal separation of their labels, and the binding locations of probes that identify chemical structures are nanometric (sub- diffraction) precision, whereby the spatial order of the chemical structures of heterogeneous polymers is determined.

64. A method of sequencing a polymer in which the sequence of the polymer is determined through the emergence properties of binding interactions of a repertoire of molecular probes to the polymer.

Example 1: Sample preparation for sequencing.
Step 1: Extraction of long-length genomic DNA.
NA12878 or NA18507 cells (Coriell Biorepository) are grown in culture and harvested. Cells are mixed with low melting point agarose heated to 60°C. Pour the mixture into a gel mold (eg, purchased from Bio-Rad) and allow to set in the gel plug, resulting in approximately 4×10 ⁷ cells (this number may be higher depending on the desired density of polynucleotides). or less). Cells within the gel plug are lysed by soaking the plug in a solution containing proteinase K. Gel plugs are gently washed in TE buffer (eg, in a 15 mL Falcon tube, filled with wash buffer, leaving small air bubbles to aid mixing, and placed on a tube rotator). The plug is placed in a trough of approximately 1.6 mL volume and the DNA is extracted by digesting the DNA using the agarase enzyme. Apply 0.5 M MES pH 5.5 solution to the digested DNA. This step is carried out using the FiberPrep kit (Genomic Vision, France) and accompanying protocol, resulting in DNA molecules with an average length of 300 Kb. Alternatively, the genomic DNA itself extracted from these cell lines is available from Corriel and pipetted directly into 0.5 M MES pH 5.5 solution using a wide-bore pipette (in 1.2 mL 10 uL), giving an average spacing of less than 1 μM.

Step 2: Stretching of molecules on the surface.
The last part of step 1 provides the extracted polynucleotides in a trough in a 0.5 M MES pH 5.5 solution. Substrate coverslips coated with vinylsilane (eg, CombiSlips from Genomic Vision) are immersed in the trough and incubated for 1-10 minutes (depending on the density of target nucleic acid required). The coverslip is then slowly withdrawn using a mechanical puller such as a syringe pump fitted with a clip to grip the coverslip (alternatively, the FiberComb system from Genomic Vision is used). . The DNA on the coverslip is crosslinked to the surface using a crosslinker (Stratagene, USA) with an energy of 10,000 microjoules. Careful execution of this process results in surface extended high molecular weight (HMW) polynucleotides with an average length of 200-300 Kb, with some populations of polynucleotides containing molecules greater than 1 Mb in length. , or even molecules as long as 10 Mb. With more care and optimization, the average length shifts into the megabase range (see the megabase range combing section above).

Alternatively, as described above, pre-extracted DNA (eg, human male genomic DNA, from Novagen cat. No. 70572-3 or Promega) is used, which contains a significant proportion of genomic molecules greater than 50 Kb. including. Here, at a concentration of about 0.2-0.5 ng/μL, a soak of about 5 minutes is sufficient to provide a molecular density in which a high proportion of the molecules are individually resolved using diffraction-limited imaging. is.

Step 3: Fabrication of flow cell.
Press the cover slip onto the gasket of the flow cell made from double-sided adhesive 3M sheet already attached to the glass slide. Gaskets (both sides of the protective layer on the double-sided adhesive sheet) are made using a laser cutter to create one or more flow channels. The length of the flow channel is greater than the length of the cover slip, so that when the cover slip is centered in the flow channel, each portion of the channel's opposite ends not covered by the cover slip will allow fluid flow into the flow channel. are used as inlets and outlets, respectively, for loading and unloading. The fluid is passed over the elongated polynucleotide attached to the vinylsilane surface. A safety swab (Johnsons, USA) is used at one end to create aspiration and the other end to pipette the fluid and the fluid flows through the channel. Channels are pre-wetted with phosphate-buffered saline-Tween and phosphate-buffered saline (PBS wash).

Step 4: Denaturation of double-stranded DNA.
Before the next target nucleic acid is added, the previous target nucleic acid must be effectively washed away. This can be done by exchanging the buffer up to 4 times, optionally by using a denaturant such as DMSO or an alkaline solution to remove persistent binding. Double-stranded target nucleic acids are denatured by flushing alkali (0.5 M NaOH) through the flow cell and incubating at room temperature for about 20-60 minutes. This is followed by a PBS/PBST wash. Alternatively, incubate with 1M HCL for 1 hour, followed by a PBS/PBST wash.

Step 5: Passivation
Optionally, pour in a blocking buffer such as BlockAid (Invitrogen, USA) and incubate for about 5-15 minutes. This is followed by a PBS/PBST wash.

Example 2: Sequencing by Transient Binding of Oligonucleotides to Denatured Polynucleotides Step 1: Addition of Oligonucleotide Probe Species Under Transient Binding Conditions Precondition with A (10 mM Tris-HCl, 100 mM NaCl, 0.05% Tween-20, pH 7.5). About 1-10 nM of each oligonucleotide probe species was added to buffer B (5 mM Tris-HCl, 10 mM MgCl ₂ , 1 mM EDTA, 0.05% Tween-20, pH 8) or buffer B + 5 mM Tris-HCl. , 10 mM MgCl ₂ , 1 mM EDTA, 0.05% Tween-20, pH 8, 1 mM PCA, 1 mM PCD, 1 mM Trolox). The length of the oligonucleotide probe species typically ranges from 5-7 nucleotides and the reaction temperature depends on the Tm of the oligonucleotide probe species. One probe type that was used was of the general formula 5′-Cy3-NXXXXXN-3′ (where X is the specified base and N is the degenerate position), where the LNA nucleotides are at positions 1, 2, 4 , 6, and 7, with DNA nucleotides at positions 3 and 5. Probes were purchased from Sigma Proligo and were previously used by Pihlak et al. The temperature of binding was related to the Tm of each oligonucleotide probe species sequence.

After washing with A+ and B+ solutions, the transient binding of the oligonucleotide probe species is as follows: Performed at room temperature with 0.5-100 nM oligos (typically 3-10 nm) in B+ solution. Different temperature and/or salt conditions (as well as concentration conditions) are used for different oligonucleotide probe species sequences according to their Tm and binding behavior. Much higher concentrations of oligos up to 1 uM can be used if a FRET mechanism is used for detection. In some embodiments, FRET is used from intercalating dye molecules (YOYO-1, Sytox Green, Sytox Orange, Sybr Gold, etc. (Life Technologies) that intercalate into transiently formed duplexes). 1000-fold to 10,000-fold dilution depending on the intercalating dye) and the label on the oligo. In some embodiments, intercalating dyes are used directly as labels without FRET. In this case the oligonucleotide probe species is unlabeled. In addition to being inexpensive, the unlabeled oligonucleotide probe species has a background from the intercalating dye upon duplex formation that is 100-1000 brighter than the non-intercalating dye (e.g., which intercalating agent used), so higher concentrations than labeled oligonucleotide probe species can be used.

Step 2: Capture—Capture multiple frames.
The flow channel is placed on an inverted microscope (eg, Nikon Ti-E) equipped with a Perfect Focus, TIRF attachment and TIRF objective laser, and a Hamamatsu 512×512 back-thinned EMCCD camera. Probes are added to buffer B+, optionally supplemented with an imaging agent.

Probes that bind to the surface-disposed polynucleotides are passed through a 1.49 NA 100x Nikon oil immersion objective on a Nikon Ti-E with TIRF attachment, via a fiber optic scrambler (Point Source) at approximately 61.5 nm. Illuminated by an evanescent wave generated by total internal reflection of 75-400 mW laser light (eg, 532 nm green light) tuned at a TIRF angle of 5°. Images are collected through the same lens at an additional magnification of 1.5x and projected onto a Hamamatsu ImageEM camera through a dichroic mirror and emission filter. 5000-30,000 frames of 50-200 ms are taken with EM gain of 100-140 using Perfect Focus. In some embodiments, high laser power (e.g., 400 mW) is used in the first few seconds to bleach initial non-specific binding, thereby reducing the almost blanket signal from the surface to a lower density. reduced and individual binding events are resolved. The laser power is then optionally reduced.

Figures 22A-22E show examples of illumination of oligonucleotide probe species that transiently bind to target nucleic acids. In these figures, the target nucleic acid is human DNA. Darker spots indicate areas of probe fluorescence, darker spots indicate more areas bound more frequently by the oligonucleotide probe species (eg, more photons collected). Figures 22A-22E are images from a time series (eg, video) captured during sequencing of one target nucleic acid. As examples of regions of a target nucleic acid, points 2202, 2204, 2206, 2208 are shown through time, over time (e.g., when different sets of oligonucleotide probe species are exposed to the target nucleic acid). , joined with greater or lesser strength.

Imaging buffer was added. In some embodiments, the imaging buffer is supplemented or replaced with a buffer containing β-mercaptoethanol, an enzymatic redox system, and/or ascorbic acid and gallic acid. A fluorophore is detected along the line to indicate that binding of the oligonucleotide probe species has occurred. Optionally, if the flow cell is made with two or more channels, one of the channels is illuminated (e.g., with Intensilight or 488 nm laser illumination) to check the density of polynucleotides and the quality of polynucleotide elongation. using) stained with YOYO-1 intercalating dye.

Step 3: Imaging-Transfer to another location (optional step).
A cover glass mounted in a Nikon Ti-e slide holder (via attachment to the glass slide as part of the flow cell) is moved relative to the objective lens (and thus the CCD) and separate locations are imaged. Imaging may be performed at multiple other locations such that oligonucleotide probe species that bind to target nucleic acids or portions of target nucleic acids provided at different locations are imaged (outside the field of view of the CCD at its first location). is done in Image data from each location is stored in computer memory.

Step 4: Addition of next set of oligos.
The next set of oligonucleotide probe species is added and steps 1-3 are repeated until the entire target nucleic acid has been sequenced.

Step 5: Determining the Site of Bonding and Identity.
The location of each instance of optical activity is determined and the location of the pixel where the fluorescence from the bound labeled oligonucleotide probe species is projected is recorded. The identity of the bound oligonucleotide probe species is determined by determining which labeled oligonucleotide probe species is bound (e.g., using wavelength selection by optical filters), where the fluorophore has multiple The emission signature of each fluorophore detected across the filter, where it is across the filter set, is used to determine the identity of the fluorophore (and thus the identity of the oligonucleotide probe species). Optionally, if the flow cell is made with two or more channels, one of the channels is illuminated (e.g., with Intensilight or 488 nm laser illumination) to check the density of the target nucleic acid and the quality of the target nucleic acid elongation. by using), stained with YOYO-1 intercalating dye. One or more images or movies are taken, one for each fluorescence wavelength used to label the oligonucleotide probe species.

Step 6: Data processing.
When both strands of a double-stranded target nucleic acid remain attached to the surface, binding of the oligonucleotide probe species occurs simultaneously at their complementary locations on both strands of the double-stranded target nucleic acid. The entire data set is then analyzed to find a set of oligonucleotide probe species that give close localization signals to specific locations on the target nucleic acid, those locations corresponding to selected points in the polynucleotide. Confirmed by overlapping the sequences of the oligonucleotide probe species, this then reveals two overlapping tiling series of the oligonucleotide probe species at each point. Which tiling series the next signal in the region applies to indicates which strand it is attached to.

As the target nucleic acid strand remains immobilized on the surface, the binding sites recorded for each oligonucleotide probe species can be overlaid using a software script that runs the algorithm. This allows the tiling pathways of the two oligonucleotide probe species sequences where the oligonucleotide probe species binding site is a separate pathway for each strand of the denatured duplex target nucleic acid (but it must be complementary). A signal is provided to indicate that it is within the framework of Each tiling path, if complete, spans the entire length of the chain. The tiled sequences of each strand are then compared to provide a double-stranded (also known as 2D) consensus sequence. If there is a gap in one tiling path, the alignment of the complementary tiling path is taken. In some embodiments, a sequence is compared to multiple copies of the same sequence or compared to a reference to aid in base assignment and fill in gaps.

Example 3: Detection of epimark locations on polynucleotides.
Optionally, transient binding of epigenome binding reagents is performed prior to (or sometimes after or during) the oligo binding process. Conjugation is performed before or after denaturation, depending on which binding reagent is used. In some embodiments, for anti-methyl-C antibodies, binding occurs on the denatured target nucleic acid, whereas for methyl-binding proteins, binding occurs on the double-stranded target nucleic acid prior to any denaturation step. will be

Step 1—Transient attachment of methyl binding reagent.
After denaturation, the flow cell is flushed with a PBS wash and a Cy3B-labeled anti-methyl antibody 3D3 clone (Diagenode) is added in PBS.

Alternatively, prior to denaturation, the flow cell is flushed with PBS and Cy3B-labeled MBD1 is added.

Imaging is performed as described above for transient oligonucleotide probe species binding.

Step 2: Removal of methyl binding reagent.
Typically epi-analysis is performed prior to sequencing. Therefore, optionally, methyl binding reagents are flushed out prior to initiating sequencing of the target nucleic acid. This is done by running multiple cycles of PBS/PBST and/or high salt buffer and SDS followed by imaging to confirm that elimination has occurred. If it is evident that more than a negligible amount of binding reagent remains, a harsher treatment such as chaotropic salt, GuCL is run through to remove the remaining reagent.

Step 3: Data Correlation.
After the sequencing epigenomics data are obtained, correlations are made between the binding sites of the sequencing probe species to correlate the epibinding sites to provide sequence context for the methylation.

Example 4: Fluorescence collected from transient binding in lambda phage DNA.
Figures 23A, 23B, and 23C show examples of transient binding events. These collectively show the transient binding of oligo IDs. Lin2621, Cy3-labeled 5'NAgCgGN3' (1.5 nM concentration in buffer B+ at room temperature). Target nucleic acids are lambda phage genomes manually combed onto a vinylsilane surface (Genomic Vision) in MES pH 5.5 buffer + 0.1 M NaCl. 400 mW 532 nm laser through a point source fiber optic scrambler. Fluorescence was collected with a TIRF attachment and multichroic, including a 532 nm excitation band, a 100x 1.49 NA TIRF objective, and an additional 1.5x magnification. No anti-vibration was implemented. Images were captured with Perfect Focus on a Hamamatsu ImageEM 512×512 with a 100 EM Gain setting. 10000 frames were collected over 100 ms. The concentration of Cy3 in the oligonucleotide probe set was approximately 250-300 nM. FIG. 23A shows fluorescence collected before cross-correlation drift correction in ThunderSTORM. FIG. 23B shows fluorescence collected after cross-correlation drift correction with scale bar. FIG. 23C shows the fluorescence in the magnified area of FIG. 23B. FIG. 23C shows a long polynucleotide chain traced by persistent binding of Lin2621 to multiple sites. It is clear from the images that the target nucleic acid strand was immobilized and extended on the imaging plane at a distance closer than the diffraction limit of Cy3 emission.

Example 5: Fluorescence Collected from Transient Binding in Synthetic DNA Figure 24 shows an example of fluorescence data collected from three different polynucleotide strands. Multiple probing and washing steps on synthetic 3 kilobase denatured double-stranded DNA are shown. Synthetic DNA was combed and denatured with MES (pH 5.5) on the vinylsilane surface. A series of binding and washing steps were performed, video recorded and processed in ImageJ using ThunderSTORM. For the following series of experiments performed with 10 nM oligos in buffer B+ at ambient temperature, three exemplary strands (1, 2, 3) were cropped from super-resolution images. Bind oligonucleotide probe species 3004, wash, bind oligo 2879, wash, bind oligo 3006, wash, and bind oligonucleotide probe species 3004 (again). This suggests that binding maps can result from transient binding, that binding patterns can be erased by washing, and that different binding patterns can then result in different oligonucleotides on the same first and second strand of synthetic DNA. It shows that it is obtained with the probe species. The return to oligonucleotide probe species 3004 at the end of the series, and the similarity of the pattern when used as the beginning of the series, indicates that the process is robust without any optimization attempts.

The experimentally determined binding sites correspond to the expected positions, with duplexes 1 and 3 showing 3 of the 4 possible perfect match binding sites and duplex 2 showing 4 All binding sites and one significant discrepancy site are indicated. It is observed that the second probing with oligonucleotide probe species 3004 appears to give a cleaner signal, presumably due to fewer mismatches. This is consistent with the possibility of a slight increase in temperature due to heating from prolonged exposure to laser light.

The oligo sequences used for this experiment are as follows (bases in capital letters are locked nucleic acids (LNA)):
Oligonucleotide probe species 3004: 5'cy3 NTgGcGN
Oligonucleotide probe species 2879: 5'cy3 NGgCgAN
Oligonucleotide probe species 3006: 5'cy3 NTgGgCN:

A sequence listing (at the bottom of the document) of the sequence of the 3 kbp synthetic template follows:
（配列番号２）ＡＡＡＡＡＡＡＡＡＣＣＧＧＣＣＣＡＧＣＴＴＴＣＴＴＣＡＴＴＡＧＧＴＴＡＴＡＣＡＴＣＴＡＣＣＧＣＴＣＧＣＣＡＧＧＧＣＧＧＣＧＡＣＣＴＣＧＣＧＧＧＴＴＴＴＣＧＣＴＡＴＴＴＡＴＧＡＡＡＡＴＴＴＴＣＣＧＧＴＴＴＡＡＧＧＣＧＴＴＴＣＣＧＴＴＣＴＴＣＴＴＣＧＴＣＡＴＡＡＣＴＴＡＡＴＧＴＴＴＴＴＡＴＴＴＡＡＡＡＴＡＣＣＣＴＣＴＧＡＡＡＡＧＡＴＡＧＧＡＴＡＧＣＡＣＡＣＧＴＧＣＴＧＡＡＡＧＣＧＡＧＧＣＴＴＴＴＴＧＧＣＣＴＣＴＧＴＣＧＴＴＴＣＣＴＴＴＣＴＣＴＧＴＴＴＴＴＧＴＣＣＧＴＧＧＡＡＴＧＡＡＣＡＡＴＧＧＡＡＧＴＣＡＡＣＡＡＡＡＡＧＣＡＧＣＴＧＧＣＴＧＡＣＡＴＴＴＴＣＧＧＴＧＣＧＡＧＴＡＴＣＣＧＴＡＣＣＡＴＴＣＡＧＡＡＣＴＧＧＣＡＧＧＡＡＣＡＧＧＧＡＡＴＧＣＣＣＧＴＴＣＴＧＣＧＡＧＧＣＧＧＴＧＧＣＡＡＧＧＧＴＡＡＴＧＡＧＧＴＧＣＴＴＴＡＴＧＡＣＴＣＴＧＣＣＧＣＣＧＴＣＡＴＡＡＡＡＴＧＧＴＡＴＧＣＣＧＡＡＡＧＧＧＡＴＧＣＴＧＡＡＡＴＴＧＡＧＡＡＣＧＡＡＡＡＧＣＴＧＣＧＣＣＧＧＧＡＧＧＴＴＧＡＡＧＡＡＣＴＧＣＧＧＴＴＣＴＴＡＴＡＣＡＴＣＴＡＡＴＡＧＴＧＡＴＴＡＴＣＴＡＣＡＴＡＣＡＴＴＡＴＧＡＡＴＣＴＡＣＡＴＴＴＴＡＧＧＴＡＡＡＧＡＴＴＡＡＴＴＧＡＧＴＡＣＣＡＧＧＴＴＴＣＡＧＡＴＴＴＧＣＴＴＣＡＡＴＡＡＡＴＴＣＴＧＡＣＴＧＴＡＧＣＴＧＣＴＧＡＡＡＣＧＴＴＧＣＧＧＴＴＧＡＡＣＴＡＴＡＴＴＴＣＣＴＴＡＴＡＡＣＴＴＴＴＡＣＧＡＡＡＧＡＧＴＴＴＣＴＴＴＧＡＧＴＡＡＴＣＡＣＴＴＣＡＣＴＣＡＡＧＴＧＣＴＴＣＣＣＴＧＣＣＴＣＣＡＡＡＣＧＡＴＡＣＣＴＧＴＴＡＧＣＡＡＴＡＴＴＴＡＡＴＡＧＣＴＴＧＡＡＡＴＧＡＴＧＡＡＧＡＧＣＴＣＴＧＴＧＴＴＴＧＴＣＴＴＣＣＴＧＣＣＴＣＣＡＧＴＴＣＧＣＣＧＧＧＣＡＴＴＣＡＡＣＡＴＡＡＡＡＡＣＴＧＡＴＡＧＣＡＣＣＣＧＧＡＧＴＴＣＣＧＧＡＡＡＣＧＡＡＡＴＴＴＧＣＡＴＡＴＡＣＣＣＡＴＴＧＣＴＣＡＣＧＡＡＡＡＡＡＡＡＴＧＴＣＣＴＴＧＴＣＧＡＴＡＴＡＧＧＧＡＴＧＡＡＴＣＧＣＴＴＧＧＴＧＴＡＣＣＴＣＡＴＣＴＡＣＴＧＣＧＡＡＡＡＣＴＴＧＡＣＣＴＴＴＣＴＣＴＣＣＣＡＴＡＴＴＧＣＡＧＴＣＧＣＧＧＣＡＣＧＡＴＧＧＡＡＣＴＡＡＡＴＴＡＡＴＡＧＧＣＡＴＣＡＣＣＧＡＡＡＡＴＴＣＡＧＧＡＴＡＡＴＧＴＧＣＡＡＴＡＧＧＡＡＧＡＡＡＡＴＧＡＴＣＴＡＴＡＴＴＴＴＴＴＧＴＣＴＧＴＣＣＴＡＴＡＴＣＡＣ ＣＡＣＡＡＡＡＣＣＴＧＡＡＡＣＴＧＧＣＧＣＧＴＧＡＧＡＴＧＧＧＧＣＧＡＣＣＧＴＣＡＴＣＧＴＡＡＴＡＴＧＴＴＣＴＡＧＣＧＧＧＴＴＴＧＴＴＴＴＴＡＴＣＴＣＧＧＡＧＡＴＴＡＴＴＴＴＣＡＴＡＡＡＧＣＴＴＴＴＣＴＡＡＴＴＴＡＡＣＣＴＴＴＧＴＣＡＧＧＴＴＡＣＣＡＡＣＴＡＣＴＡＡＧＧＴＴＧＴＡＧＧＣＴＣＡＡＧＡＧＧＧＴＧＴＧＴＣＣＴＧＴＣＧＴＡＧＧＴＡＡＡＴＡＡＣＴＧＡＣＣＴＧＴＣＧＡＧＣＴＴＡＡＴＡＴＴＣＴＡＴＡＴＴＧＴＴＧＴＴＣＴＴＴＣＴＧＣＡＡＡＡＡＡＧＴＧＧＧＧＡＡＧＴＧＡＧＴＡＡＴＧＡＡＡＴＴＡＴＴＴＣＴＡＡＣＡＴＴＴＡＴＣＴＧＣＡＴＣＡＴＡＣＣＴＴＣＣＧＡＧＣＡＴＴＴＡＴＴＡＡＧＣＡＴＴＴＣＧＣＴＡＴＡＡＧＴＴＣＴＣＧＣＴＧＧＡＡＧＡＧＧＴＡＧＴＴＴＴＴＴＣＡＴＴＧＴＡＣＴＴＴＡＣＣＴＴＣＡＴＣＴＣＴＧＴＴＣＡＴＴＡＴＣＡＴＣＧＣＴＴＴＴＡＡＡＡＣＧＧＴＴＣＧＡＣＣＴＴＣＴＡＡＴＣＣＴＡＴＣＴＧＡＣＣＡＴＴＡＴＡＡＴＴＴＴＴＴＡＧＡＡＴＧＣＧＧＣＧＴＴＴＴＣＣＧＧＡＡＣＴＧＧＡＡＡＡＣＣＧＡＣＡＴＧＴＴＧＡＴＴＴＣＣＴＧＡＡＡＣＧＧＧＡＴＡＴＣＡＴＣＡＡＡＧＣＣＡＴＧＡＡＣＡＡＡＧＣＡＧＣＣＧＣＧＣＴＧＧＡＴＧＡＡＣＴＧＡＴＡＣＣＧＧＧＧＴＴＧＣＴＧＡＧＴＧＡＡＴＡＴＡＴＣＧＡＡＣＡＧＴＣＡＧＧＴＴＡＡＣＡＧＧＣＴＧＣＧＧＣＡＴＴＴＴＧＴＣＣＧＣＧＣＣＧＧＧＣＴＴＣＧＣＴＣＡＣＴＧＴＴＣＡＧＧＣＣＧＧＡＧＣＣＡＣＡＧＡＣＣＧＣＣＧＴＴＧＡＡＴＧＧＧＣＧＧＡＴＧＣＴＡＡＴＴＡＣＴＡＴＣＴＣＣＣＧＡＡＡＧＡＡＴＣＣＧＣＡＴＡＣＣＡＧＧＡＡＧＧＧＣＧＣＴＧＧＧＡＡＡＣＡＣＴＧＣＣＣＴＴＴＣＡＧＣＧＧＧＣＣＡＴＣＡＴＧＡＡＴＧＣＧＡＴＧＧＧＣＡＧＣＧＡＣＴＡＣＡＴＣＣＧＴＧＡＧＧＴＧＡＡＴＧＴＧＧＴＧＡＡＧＴＣＴＧＣＣＣＧＴＧＴＣＧＧＴＴＡＴＴＣＣＡＡＡＡＴＧＣＴＧＣＴＧＧＧＴＧＴＴＴＡＴＧＣＣＴＡＣＴＴＴＡＴＡＧＡＧＣＡＴＡＡＧＣＡＧＣＧＣＡＡＣＡＣＣＣＴＴＡＴＣＴＧＧＴＴＧＣＣＧＡＣＧＧＡＴＧＧＴＧＡＴＧＣＣＧＡＧＡＡＣＴＴＴＡＴＧＡＡＡＡＣＣＣＡＣＧＴＴＧＡＧＣＣＧＡＣＴＡＴＴＣＧＴＧＡＴＡＴＴＣＣＧＴＣＧＣＴＧＣＴＧＴＴＡＡＴＴＧＡＧＴＴＴＡＴＡＧＴＧＡＴＴＴＴＡＴＧＡＡＴＣＴＡＴＴＴＴＧＡＴＧＡＴＡＴＴＡＴＣＴＡＣＡＴＡＣＧＡＣＴＧＧＣＧＴＧＣＣＡＴＧＣＴＴＧＣＣＧ ＧＧＡＴＧＴＣＡＡＡＴＴＴＡＡＴＡＡＧＧＴＧＡＴＡＧＴＡＡＡＴＡＡＡＡＣＡＡＴＴＧＣＡＴＧＴＣＣＡＧＡＧＣＴＣＡＴＴＣＧＡＡＧＣＡＧＡＴＡＴＴＴＣＴＧＧＡＴＡＴＴＧＴＣＡＴＡＡＡＡＣＡＡＴＴＴＡＧＴＧＡＡＴＴＴＡＴＣＡＴＣＧＴＣＣＡＣＴＴＧＡＡＴＣＴＧＴＧＧＴＴＣＡＴＴＡＣＧＴＣＴＴＡＡＣＴＣＴＴＣＡＴＡＴＴＴＡＧＡＡＡＴＧＡＧＧＣＴＧＡＴＧＡＧＴＴＣＣＡＴＡＴＴＴＧＡＡＡＡＧＴＴＴＴＣＡＴＣＡＣＴＡＣＴＴＡＧＴＴＴＴＴＴＧＡＴＡＧＣＴＴＣＡＡＧＣＣＡＧＡＧＴＴＧＴＣＴＴＴＴＴＣＴＡＴＣＴＡＣＴＣＴＣＡＴＡＣＡＡＣＣＡＡＴＡＡＡＴＧＣＴＧＡＡＡＴＧＡＡＴＴＣＴＡＡＧＣＧＧＡＧＡＴＣＧＣＣＴＡＧＴＧＡＴＴＴＴＡＡＡＣＴＡＴＴＧＣＴＧＧＣＡＧＣＡＴＴＣＴＴＧＡＧＴＣＣＡＡＴＡＴＡＡＡＡＧＴＡＴＴＧＴＧＴＡＣＣＴＴＴＴＧＣＴＧＧＧＴＣＡＧＧＴＴＧＴＴＣＴＴＴＡＧＧＡＧＧＡＧＴＡＡＡＡＧＧＡＴＣＡＡＡＴＧＣＡＣＴＡＡＡＣＧＡＡＡＣＴＧＡＡＡＣＡＡＧＣＧＡＴＣＧＡＡＡＡＴＡＴＣＣＣＴＴＴＧＧＧＡＴＴＣＴＴＧＡＣＴＣＧＡＴＡＡＧＴＣＴＡＴＴＡＴＴＴＴＣＡＧＡＧＡＡＡＡＡＡＴＡＴＴＣＡＴＴＧＴＴＴＴＣＴＧＧＧＴＴＧＧＴＧＡＴＴＧＣＡＣＣＡＡＴＣＡＴＴＣＣＡＴＴＣＡＡＡＡＴＴＧＴＴＧＴＴＴＴＡＣＣＡＣＡＣＣＣＡＴＴＣＣＧＣＣＣＧＡＴＡＡＡＡＧＣＡＴＧＡＡＴＧＴＴＣＧＴＧＣＴＧＧＧＣＡＴＡＧＡＡＴＴＡＡＣＣＧＴＣＡＣＣＴＣＡＡＡＡＧＧＴＡＴＡＧＴＴＡＡＡＴＣＡＣＴＧＡＡＴＣＣＧＧＧＡＧＣＡＣＴＴＴＴＴＣＴＡＴＴＡＡＡＴＧＡＡＡＡＧＴＧＧＡＡＡＴＣＴＧＡＣＡＡＴＴＣＴＧＧＣＡＡＡＣＣＡＴＴＴＡＡＣＡＣＡＣＧＴＧＣＧＡＡＣＴＧＴＣＣＡＴＧＡＡＴＴＴＣＴＧＡＡＡＧＡＧＴＴＡＣＣＣＣＴＣＴＡＡＧＴＡＡＴＧＡＧＧＴＧＴＴＡＡＧＧＡＣＧＣＴＴＴＣＡＴＴＴＴＣＡＡＴＧＴＣＧＧＣＴＡＡＴＣＧＡＴＴＴＧＧＣＣＡＴＡＣＴＡＣＴＡＡＡＴＣＣＴＧＡＡＴＡＧＣＴＴＴＡＡＧＡＡＧＧＴＴＡＴＧＴＴＴＡＡＡＡＣＣＡＴＣＧＣＴＴＡＡＴＴＴＧＣＴＧＡＧＡＴＴＡＡＣＡＴＡＧＴＡＧＴＣＡＡＴＧＣＴＴＴＣＡＣＣＴＡＡＧＧＡＡＡＡＡＡＡＣＡＴＴＴＣＡＧＧＧＡＧＴＴＧＡＣＴＧＡＡＴＴＴＴＴＴＡＴＣＴＡＴＴＡＡＴＧＡＡＴＡＡＧＴＧＣＴＴＧＡＣＣＴＡＴＴＴＣＴＴＣＡＴＴＡＣＧＣＣＡＴＴＡＴＡＣＡＴＣＴＡＧＣＣＣＡＣＣＧＣＴＧＣＣＡＡ AAAAAAA

Example 6: Integrated isolation of single cells, nucleic acid extraction and sequencing.
Step 1: Design and Fabrication of the Microfluidic Architecture The microchannels are designed to accommodate cells from a human cancer cell line with a typical diameter of 15um, so that the microfluidic network has minimal depth and It has a width of 33um. The device includes an inlet for cells and an inlet for buffer to merge into a single channel and feed the single cell trap (shown in Figure 17). At the intersection between the cell inlet and the buffer inlet, the cells are aligned along the side walls of the feed channel where one or more traps are located. Each trap is a simple constriction sized to trap cells from a human cancer cell line. The cell trapping constriction is trapezoidal in cross-section: 4.3 um wide at the bottom, 6 um mid-depth, 8 um wide at the top, and 33 um deep. Each cell trap connects a supply channel to a branch point, one of the branches is a waste channel (not shown in FIG. 17) and the other is a flow channel (for nucleic acid extension and sequencing). Channels containing extension sections, one per cell. The flow extension section consists of a channel that is 20um wide (or up to 2mm), 450um long and 100nm deep (or up to 2um). In some embodiments, the flow extension channels are narrower at the beginning and widen to the stated dimensions.

Step 2: Device Fabrication The device is fabricated by replicating nickel shims using injection molding of TOPAS5013 (TOPAS). Briefly, a silicon master is produced by UV lithography and reactive ion etching. A 100 nm NiV seed layer is deposited and nickel is electroplated to a final thickness of 330 um. The Si master is chemically etched in KOH. Injection molding is carried out at a melt temperature of 250° C., a mold temperature of 120° C., a maximum holding pressure of 1,500 bar for 2 seconds, and different injection rates from 20 cm 3 /s to 45 cm 3 /s. Finally, either a cover glass (1.5) is glued to the device or a 150 um TOPAS foil is used to seal the device using a combination of UV and heat treatment under a maximum pressure of 0.51 MPa. . The surface roughness of the foil is reduced by pressing the foil for 20 minutes at 140°C and 5.1 MPa between two flat nickel platings electroplated from a silicon wafer before sealing the device. . This ensures that the lid of the device is optically flat, enabling high NA optical microscopy. The device is mounted on an inverted fluorescence microscope (Nikon Ti-E) equipped with an oil immersion TIRF objective (100x/NA 1.49) and an EMCCD camera (Hamamatsu ImageEM 512). Liquids are driven through the device using pressure controllers (MFCS, Fluigent) at pressures ranging from 0 to 10 mbar. The device is primed with ethanol, then degassed and FACS Flow Sheath Fluid (BD Biosciences) is loaded into all microchannels except the microchannel connecting the flow extension device. Selective loading maintains a positive pressure at the inlet of the supply channel where the solution was introduced, while applying a positive pressure at the outlet of the flow extension channel while applying a negative pressure at the outlet of the waste channel, or aspiration. It is realized by A buffer suitable for single-molecule imaging and electrophoresis (0.5×TBE + 0.5% (v/v) Triton-X100 + 1% (v/v) β-mercaptoethanol, BME) was used in the flow extension device. filled into the channel. This buffer prevents DNA from sticking in the flow extension section and suppresses the electroosmotic flow that can oppose the introduction of the extracted DNA if the height of the flow extension section is low.

Step 3: Cell preparation LS174T colorectal cancer cells were grown in Dulbecco's Modified Eagle's Medium (DMEM; Gibco) containing 10% fetal bovine serum (FBS; Autogen-Bioclear UK Ltd.) and 1% penicillin/streptomycin (Lonza). ) and then frozen at a concentration of 1.7 10 6 cells per milliliter in FBS containing 10% DMSO. After thawing, the cell suspension is mixed 1:1 with FACSFlow buffer, centrifuged at 28.8×g (A-4-44, Eppendorf) for 5 minutes, and resuspended in FACSFlow buffer. . Finally, cells are stained with 1 uM Calcein AM (Invitrogen) and loaded onto the chip at 0.35 10 ⁶ cells per milliliter. Approximately 5-10,000 cells are loaded and the first cells captured in each trap are analyzed.

Step 4: Operation Cells and buffer are introduced simultaneously to align the cells along the sidewalls of the microchannel where the traps are located. Single cells are captured and retained within the trap due to buffer flow through the trap of up to 30 nL/min. A lysis buffer consisting of 0.5×TBE + 0.5% (v/v) Triton-X100 + 0.1 uM YOYO-1 (Invitrogen) was loaded into one of the inlets and pumped through the trap at 10 nL/min. Infuse for minutes. The solution is then replaced with buffer without YOYO-1 in all wells to stop staining. Cell nuclei are then exposed to a dose of 1 nW/(um) ² of blue excitation light for up to 300 seconds, causing partial photonicking of DNA (www.pnas.org/cgi/doi/10.1073/ See SI Annex of pnas.1804194115). The buffer was then changed to a solution containing BME (0.5 x TBE + 0.5% (v/v) Triton-X100 + 1% (v/v) BME), and the intensity of the fluorescent lamp was still adjusted for fluorescence imaging. to the lowest intensity possible. The temperature was then raised to 60° C. and proteolysis solution (>200 μg mL ⁻¹ Proteinase K (Qiagen), 0.5×TBE + 0.5% (v/v) Triton-X100 + 1% (v/v) BME+200 g/mL) is introduced and the lysate is sent to the trap. DNA migrates to adjacent flow extension sections. The oil immersion objective is moved into position for single molecule imaging (100×, NA 1.49, additional 1.5× magnification yields an image size of 120 nm pixels). DNA fragments are introduced from the microchannel into the flow extension device using electrophoresis with the application of a voltage of 5-10 V across the flow extension section. When both ends of the DNA fragment are in opposite microchannels, the voltage is turned off. A 450 um portion of the molecule stretched at 100-150% corresponds to over 1 megabase of genomic DNA extracted from a single cell. In some embodiments, after proteolysis, the DNA content is pushed through the device by replacing 0.5×TBE with the capture buffer, and in such embodiments the dimensions of the flow extension section are optionally However, it is larger, so that thousands of megabase fragments can be simultaneously captured (by hydrophobic or electrostatic interactions) and extended within the channel. This is done by using a pH 8 buffer (e.g. HEPES), where the coverslips to be bonded are positively charged such as with APTES or polylysine, or vinylsilane coverslips are bonded, 0.5 M MES buffer at pH 5.5-5.7 is used to wash in the DNA and then combed by following the MES buffer with air. Or if the foil contains Zeonex, molecular combing can be done with 0.6 M MES buffer at pH 5.7.

Once the double-stranded target nucleic acid is immobilized, a denaturing solution of 0.5 M NaOH and/or 6% DMSO is flushed through. A single cell sample is then ready for the sequencing method of the invention, the complete set of oligonucleotide probe species is flowed, and the binding of the oligonucleotide probe species is imaged.

In some embodiments, cell lysis is in two steps, so RNA does not contaminate the flow extension section and cause fluorescence. Here, a first lysis buffer (eg, 0.5×TBE with 0.5% (v/v) Triton X-100 with added DNA intercalating YOYO-1 dye) is applied. This buffer lyses the cell membrane and releases the cytoplasmic contents into the trap outlet filled with 10-20 μl of nuclease-free HO, leaving the nuclei containing DNA within the trap (see, eg, van Strijp et al. Sci. Rep. 7:11030 (2017)). The cytoplasmic contents of each cell are either removed after lysis and flushed to a waste outlet, or the device is designed to have a flow-extending section for RNA separate from that for DNA. In some embodiments, RNA is directed to a separate flow extension section coated with oligo-dT that captures poly-A RNA. In some embodiments, the flow extension section of RNA comprises nanowells or nanopits (Marie et al, Nanoscale DOI: 10.1039/c7nr06016e) 2017), in which RNA is captured and treated using enzymatic reagents (e.g. (using poly-A addition by terminal transferase) to add capture sequences. Nuclear lysis is performed using a second buffer (0.5×TBE with 0.5% (v/v) Triton X-100 and proteinase K) and the DNA is flowed through the DNA flow extension section. .

The distance from the trap and flow extension section is short and the device walls are well passivated (including passivation by coating with lipids) to minimize nucleic acid loss (e.g., Persson et al. , Nanoletters 12:2260-5 (2012)).

REFERENCES AND ALTERNATIVE EMBODIMENTS All references cited in this specification are specifically and implied that each individual publication or patent or patent application is incorporated by reference in its entirety for all purposes. To the same extent as if individually indicated, they are hereby incorporated by reference in their entireties for all purposes.

All headings and subheadings are used herein for convenience only and should not be construed as limiting the invention in any way.

The use of any and all examples, or exemplary language (e.g., "for example"), provided herein is merely intended to better clarify the invention, and may not be construed as otherwise claimed. is not intended to limit the scope unless No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

It should also be understood that although the terms first, second, etc. are used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another. For example, a first subject could be termed a second subject, and, similarly, a second subject could be termed a first subject, without departing from the scope of this disclosure. Both the first object and the second object are the same object, but they are not the same object.

The terminology used in this disclosure is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the description and the appended claims, the singular forms "a," "an," and "the" refer to the plural forms as well, unless the context clearly indicates otherwise. intended to be included in It should also be understood that the term "and/or" as used herein refers to and includes any and all possible combinations of one or more of the associated listed items. Furthermore, the terms “comprises” and/or “comprising”, as used herein, do not include the presence of a recited feature, integer, step, operation, element, and/or component. , does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, constituents, and/or groups thereof.

As used herein, the term “if,” depending on the context, is “when,” or “upon,” or “in is taken to mean "response to determining" or "in response to detecting". Similarly, the phrases "when it is determined" or "when [the stated condition or event] is detected" are, depending on the context, "upon determination" or "upon determination" or " It is taken to mean "upon detection of (the stated condition or event)" or "in response to detection of (the stated condition or event)".

The citation and incorporation of patent documents herein is done for convenience only and does not reflect any view as to the validity, patentability and/or enforceability of such patent documents.

The present invention may be implemented as a computer program product comprising a computer program mechanism embedded in a non-transitory computer-readable storage medium. For example, a computer program product could include the program modules shown in any combination in FIG. 1A. These program modules may be stored on CD-ROMs, DVDs, magnetic disk storage products, USB keys, or other non-transitory computer readable data or program storage products.

The embodiments within the specification provide an illustration of embodiments of the invention and should not be construed as limiting the scope of the invention. The skilled artisan will recognize that many other aspects and embodiments are encompassed by the method of the invention. The embodiments of the present invention and the technical details provided below can be varied, tested and systematically optimized without undue experimentation or reinvention by those skilled in the art.

The invention is most thoroughly understood in light of the teachings herein and the references cited therein. Many modifications and variations can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Certain embodiments described herein are provided as examples only. The embodiments were chosen and described in order to best explain the principles and practical application thereof, thereby enabling those skilled in the art to make various modifications suitable for the invention and the particular uses contemplated. Embodiments can be best utilized. The invention is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.

Claims (37)

A method of sequencing a nucleic acid, comprising:
(a) immobilizing the nucleic acid in a linearized, elongated/extended form on a test substrate, thereby forming an immobilized elongated/extended nucleic acid;
(b) exposing the fixed extended/extended nucleic acid to each oligonucleotide probe species in the set of oligonucleotide probe species, each oligonucleotide probe species in the set of oligonucleotide probe species comprising: A library of probe species of defined length, comprising one defined nucleotide from the bases A, C, G, T, and one or more degenerate positions, each degenerate position corresponding to A, C , G, T bases or any mixture of universal base analogues, and said exposing (b) is such that the individual probes of said respective oligonucleotide probe species are complementary to said respective oligonucleotide probe species. exposing, performed under conditions that permit transient and reversible binding to one or more portions of said immobilized nucleic acid, thereby giving rise to each instance of optical activity When,
(c) using an imaging device to measure the location on said test substrate of each respective instance of optical activity occurring during or after said exposure (b);
(d) repeating said exposing (b) and measuring (c) for each oligonucleotide probe species in said set of oligonucleotide probe species, thereby obtaining a set of multiple locations on said test substrate; obtaining each respective set of locations on the test substrate corresponding to an oligonucleotide probe species in the set of oligonucleotide probe species;
(e) determining the sequence of at least a portion of the nucleic acid from the set of locations on the test substrate by compiling the locations on the test substrate represented by the set of locations; and, including, methods. 2. The method of claim 1, wherein said optical activity results from a label on said oligonucleotide species, said label comprising nanoparticles, fluorescent molecular structures. 3. The method of claim 2, wherein each oligonucleotide species is labeled with a different label that allows it to be distinguished from other labels. 2. The method of claim 1, wherein said optical activity results from said labeling of binding interactions by a duplex recognition moiety comprising one or more intercalating dye molecules. 2. The method of claim 1, wherein said optical activity is detected only in the vicinity of said fixed, elongated/stretched nucleic acid and not in the bulk solution. 10. The optical activity is detected via FRET, or the label is quenched or fluorogenic until it is in the vicinity of the fixed elongated/stretched nucleic acid. 5. The method described in 5. The oligos are double-labeled, the double-labels containing Cy3 moieties at each end, which are substantially quenched by dye-dye interactions in bulk solution, but which fluoresce upon binding. 6. The method of claim 5, wherein 2. The method of claim 1, wherein said fixed and elongated/stretched nucleic acid is single stranded. 2. The method of claim 1, wherein drift is minimized by locking the substrate stage to the objective lens. 2. The method of claim 1, wherein said drift is corrected. 2. The method of claim 1, wherein a reference drift correction marker is provided on the substrate in the vicinity of the fixed elongated/stretched nucleic acid. 11. The method of claim 10, wherein the fiducial drift-corrected marker comprises an Origami grid containing spatially addressable fluorescent signals. 12. The method of claim 11, wherein said spatially addressable fluorescent signal is transient and results from binding of an imaging agent by PAINT or DNA PAINT methods. wherein said set of oligo probe species are simultaneously exposed to said fixed, elongated/stretched nucleic acid and their distinct labels are each detected, allowing them to be distinguished from other labels. Item 3. The method according to item 3. Four probe species are used, each comprising a library of sequences 5'NNNXNNN3', where N is a degenerate position and X is each of the four differentially labeled nucleotides. The method of claim 1. A method of sequencing a nucleic acid, comprising:
(a) immobilizing the nucleic acid in a linearized, elongated/extended form on a test substrate, thereby forming an immobilized elongated/extended nucleic acid;
(b) exposing the fixed extended/extended nucleic acid to each oligonucleotide probe species in the set of oligonucleotide probe species, each oligonucleotide probe species in the set of oligonucleotide probe species comprising: A library of probe species of defined length, comprising two or more defined nucleotide positions each comprising an A, C, G, T base, and one or more degenerate positions, each degenerate position comprising , A, C, G, T bases or any mixture of universal base analogues, wherein said exposure (b) is such that the individual probes of said respective oligonucleotide probe species are is performed under conditions that allow it to transiently and reversibly bind to one or more portions of said immobilized nucleic acid that are complementary to, thereby giving rise to each instance of optical activity, exposing and
(c) using an imaging device to measure the location on said test substrate of each respective instance of optical activity occurring during or after said exposure (b);
(d) repeating said exposing (b) and measuring (c) for each oligonucleotide probe species in said set of oligonucleotide probe species, thereby obtaining a set of multiple locations on said test substrate; obtaining each respective set of locations on the test substrate corresponding to an oligonucleotide probe species in the set of oligonucleotide probe species;
(e) determining the sequence of at least a portion of the nucleic acid from the set of locations on the test substrate by compiling the locations on the test substrate represented by the set of locations; and, including, methods. A method of sequencing a nucleic acid, comprising:
(a) immobilizing the nucleic acid in a linearized, elongated/extended form on a test substrate, thereby forming an immobilized elongated/extended nucleic acid;
(b) exposing the fixed extended/extended nucleic acid to each oligonucleotide probe species in the set of oligonucleotide probe species, wherein each oligonucleotide probe species in the set of oligonucleotide probe species is A library of probe species of defined length, comprising two or more defined nucleotide positions each comprising an A, C, G, T base, and one or more degenerate positions, each degenerate position comprising , A, C, G, T bases or any mixture of universal base analogues, and wherein said exposure (b) is such that an individual probe of said respective oligonucleotide probe species comprises said respective oligonucleotide probe under conditions that allow stable binding to one or more portions of said immobilized nucleic acid that are complementary to the species, thereby, upon irradiation, one or more exposing, causing each instance of optical activity at one or more locations on the substrate corresponding to a portion;
(c) bleaching the instances of optical activity such that the gradual loss of instances of optical activity is measured/recorded using an imaging device;
(d) exposing said fixed and elongated/extended nucleic acid to conditions that allow bound oligonucleotide probes to dissociate, and for each oligonucleotide probe species in said set of oligonucleotide probe species, repeating said exposing (b) and measuring (c), thereby obtaining a plurality of sets of locations on said test substrate, each respective set of locations on said test substrate corresponding to said oligo obtaining corresponding oligonucleotide probe species in the set of nucleotide probe species;
(e) using a single-molecule localization algorithm to calculate the nanometric/fine-tuned location of each instance of optical activity;
(f) determining the sequence of at least a portion of the nucleic acid from the set of locations on the test substrate by compiling the locations on the test substrate represented by the set of locations; and, including, methods. said oligonucleotide species comprising:
17. The method of claim 16, comprising 5'NNnNnNN3', wherein N or n are designated or degenerate positions, N = LNA moiety and n = deoxyribose moiety. 17. The method of claim 16, wherein said oligonucleotide species comprises 5'cy3 NTgGcGN3', 5'cy3B NTgGcGN3', 5'Atto542 NTgGcGN3'. When the nucleic acid is double-stranded, the duplex is denatured, both strands are located on the substrate, and the strand to which individual probes are attached is of the oligonucleotide probe species attached to the substrate. 17. The method of claim 16, wherein deconvolution is performed by constructing tiling pathways for each strand from sequence overlaps. A method of sequencing a nucleic acid, comprising:
(a) immobilizing/immobilizing said nucleic acid on a test substrate, thereby forming an immobilized/immobilized nucleic acid;
(b) exposing said immobilized/immobilized nucleic acid to each oligonucleotide probe species of a set of oligonucleotide probe species;
said exposing (b) enables individual probes of said respective oligonucleotide probe species to bind to one or more portions of said immobilized/immobilized nucleic acid that are complementary to said respective oligonucleotide probe species; exposing, performed under conditions that cause the respective instances of optical activity to occur; and
(c) using an imaging device to measure the location on said test substrate of each respective instance of optical activity occurring during or after said exposure (b);
(d) repeating said exposing (b) and measuring (c) for each oligonucleotide probe species in said set of oligonucleotide probe species, thereby obtaining a set of multiple locations on said test substrate; obtaining each respective set of locations on the test substrate corresponding to an oligonucleotide probe species in the set of oligonucleotide probe species;
(e) determining the sequence of at least a portion of the nucleic acid from the set of locations on the test substrate by compiling the locations on the test substrate represented by the set of locations; and, including, methods. 21. The method of claim 20, wherein multiple on-off coupling events of each probe species are used to obtain a set of locations on the test substrate. 23. The method of claim 21 or 22, wherein a significant number (eg, >70%) of the events are single molecules located with sub-diffraction accuracy. The oligonucleotide has the structure:
A probe sequence-spacer-shield-label, wherein the probe sequence comprises a nucleic acid sequence containing degenerate base positions and/or specific base positions, and wherein said spacer comprises a chemical linker (e.g., some of hexaethylene glycol). binding) or a nucleic acid sequence (e.g., an 18 base long sequence), the linker being bifunctional and capable of linking the probe sequence to the shield or label, the shield comprising: Claim 21, wherein the label comprises a probe sequence-spacer-shield-label comprising a protein (e.g. streptavidin) and comprising a fluorescent label or tag (functioning as a docking site for a fluorescent label or molecular imaging agent). described method. 22. The method of claim 21, wherein said spacer and/or shield are absent. An oxygen scavenging/fluorescence enhancing molecular system is provided during imaging, said system comprising (a) pyranose oxidase, catalase, glucose, (b) protocatechuate-dioxygenase, 3,4-protocatechuate, (c) catalase, reducing agents including glucose oxidase, sucrose or glucose, (d) methylene blue and dithiotrol (DTT), (e) beta-mercaptoethanol, TCEP, or dithiotrol (DTT), (f) Trolox, 1,3,5,7 - Cyclooctatetraene, and/or a triplet state quencher/fluorescence enhancer comprising 4-nitrobenzyl alcohol. By using mechanisms in which said oligos contain fluorescently labeled oligonucleotides at high concentrations (greater than 100 nM) and background from such high concentrations includes FRET, quenching, fluorogenesis, photoactivation, and fluorescence cages. 22. The method of claim 21, which is avoided. 21. The method of claim 20, wherein said nucleic acid is a cell-free nucleic acid. Immobilization comprises attaching the ends of an unmodified nucleic acid to a hydrophobic surface, and adding said cell-free base to one of said ends of said nucleic acid in the presence of MES ph 5.5-6, vinylsilane or Zeonex. 28. The method of claim 27, wherein the surface of the 28. The method of claim 27, wherein immobilizing comprises tailing the ends of the cell-free nucleic acid with nucleotides using a terminal transferase to hybridize the tails to complementary nucleic acids immobilized on the surface. described method. 28. The method of claim 27, wherein immobilizing comprises circularizing the cell-free nucleic acid, amplifying by rolling circle amplification, and immobilizing single stranded amplicons. A method according to any one of claims 21 to 31, wherein said amplicons are stretched or spread on said substrate. 31. The method of claim 30, wherein said amplicons are condensed into ball-like structures and immobilized/fixed on said substrate. 28. The method of claim 27, wherein the genomic origin of said cell-free nucleic acid is determined/identified by said binding of one or more oligonucleotide species. 34. The method of claim 33, wherein the proportion of different chromosomal or genomic regions is determined by counting the number of nucleic acid molecules that are distinguished according to their genomic origin. 35. The method of claim 34, wherein the fetal fraction of the sample is determined. 34. The method of claim 33, wherein single nucleotide variants or indels are determined by analyzing binding of one or more oligos to nucleic acid molecules (identified according to their genomic origin).

Images