JP2022521183A - A virus-encoded, regulatory T (CATVERT) or NK cell (CATVERN) linker that targets cancer - Google Patents

Abstract

Provided are recombinant polynucleotides and vectors containing an engineered (artificial) exon-intron-exon gene structure in a transgene that is spliced when expressed in a target cell. The present disclosure provides methods or vectors for expressing therapeutic genes for a disease or condition, optionally under external control. In some cases, the disease or condition is cancer. In some cases, the vector expresses a polypeptide (referred to herein as "dimart") that serves to bind immunocompetent cells together with the cancer cells to cause the killing of the cancer cells.

Description

Description of Government Support The invention was made with government support under grant number NF170075 awarded by the Department of Defense. The government has certain rights to the invention.

Cross-reference to related applications This application claims the priority of US Provisional Application No. 62 / 808,264 filed on February 20, 2019 under Article 119 (e) of the US Patent Act. Is incorporated herein by reference in its entirety.

Currently, gene transfer (ie, gene therapy) as a treatment for a disease has become a reality. In 2017, the FDA approved Laxtana, an adeno-associated virus (AAV) designed to stably express a normal copy of the RPE65 gene in retinal cells for the treatment of congenital retinal dystrophy. .. In 2019, the FDA approved Zolgensma, an AAV designed to express SMN1 in motor neurons to treat spinal muscular atrophy. Regarding the use of AAV vectors to replace gene function for other diseases, such as a mini-version of the dystrophin gene for Duchenne muscular dystrophy and factor VIII and Factor IX genes for hemophilia A and B, respectively. Extremely promising results have also been obtained in ongoing clinical trials.

In all of the above examples, the goal is long-term gene expression to replace the missing or defective gene. However, in the treatment of time-limited diseases such as infectious diseases or cancer, gene therapy applications exist only for short-term expression of introduced genes (genes expressed as therapeutic agents in gene therapy). obtain. Another exemplary example is that only transient expression of Cas9 is ideal, in order to minimize the potential immune response to Cas9 and to minimize off-target gene mutations, CRISPR / Expression of the bacterial protein Cas9 for inducing Cas9 gene editing. Another application would be the situation where gene therapy can cause unwanted side effects and it is desirable to inactivate the gene. In these cases, a method for activating and / or suppressing transgene expression is needed.

Therefore, there is a need for novel methods that can activate transgene expression in order to utilize gene therapy platforms for short-term gene expression (week to month). The ideal system puts the introduced gene expression under drug control so that administration of the drug activates gene expression and discontinuation of the drug returns to inactive gene expression. In such scenarios, drug administration is no longer required if side effects are present or expression of the transgene is no longer required. This disclosure meets this requirement and also provides related benefits.

The present disclosure provides methods or vectors for expressing therapeutic genes for a disease or condition, optionally under external control. In some cases, the disease or condition is cancer. In some cases, the vector expresses a polypeptide (referred to herein as "dimart") that serves to bind immunocompetent cells together with the cancer cells to cause the killing of the cancer cells.

(A) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first antibody or an antigen-binding fragment thereof; (b) an open reading encoding the first antibody or an antigen-binding fragment thereof. A second polynucleotide sequence comprising a second portion of the frame; (c) a third polynucleotide sequence encoding a second antibody or antigen-binding fragment thereof; (d) a first polynucleotide and a second. A recombinant polynucleotide or vector comprising, or essentially consisting of (a)-(d), or consisting of (a)-(d) with a gene-regulated polynucleotide sequence located between and between the polynucleotides of. Provided herein. In a further embodiment, the gene regulatory polynucleotide sequence comprises a splice donor site, an upstream intron, an exon containing more than one stop codon sequence in their respective reading frames, a downstream intron, and a splice acceptor site. , Or essentially from these, or from these. In a further embodiment, the gene regulatory polynucleotide sequence comprises one or more of the binding sequences to the antisense oligonucleotide. In a further embodiment, the antisense oligonucleotide is a morpholino oligonucleotide. In a further embodiment, the binding sequence for the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 24 (AATTGATACCAACAAATAGATAGGTAAATTTG) or SEQ ID NO: 25 (GATCCAACAAATAGAGGTAAATTTTGTTTTA). In another embodiment, the stop codon comprises an oligonucleotide in the group TAA, TAG or TGA. In a further embodiment, the stop codon sequence comprises the polynucleotide sequence of TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1) (where x is any nucleotide), or the stop codon sequence is the polynucleotide sequence of TAATTAGTTGATTTAGTAATTGAT (SEQ ID NO: 2). Or the equivalent thereof. In another embodiment, the recombinant polynucleotide or vector encodes a bispecific or trispecific engageer. In another embodiment, the bispecific cell engager is a bispecific engager. In another embodiment, the bispecific cell engager is a trispecific engager.

In a further embodiment, the first antibody or antigen-binding fragment thereof specifically binds to the activated antigen on immune effector cells, and the second antibody or antigen-binding fragment thereof binds to the tumor antigen. In another embodiment, the first antibody or antigen-binding fragment thereof specifically binds to a tumor antigen, and the second antibody or antigen-binding fragment thereof binds to an activated antigen on immune effector cells. In a further embodiment, the recombinant polynucleotide or vector also comprises a fourth polynucleotide sequence encoding a third antibody or antigen-binding fragment thereof, wherein the third antibody or antigen-binding fragment thereof is active on immune effector cells. It binds to a chemical or tumor antigen. In one embodiment, immune effector cells include dendritic cells, natural killer (“NK”) cells, macrophages, T cells, B cells, neutrophils, eosinophils, basophils, mast cells or combinations thereof. .. In one aspect, the immune effector cells are T cells. In another aspect, the immune effector cells are NK cells. In another embodiment, the third antibody or antigen-binding fragment thereof binds to the activated antigen on NK cells and induces an immune response mediated by NK cells.

In one embodiment, the activating antigen is a T cell surface molecule. In another embodiment, the activating antigen is an NK cell surface molecule. Non-limiting examples of activating antigens on immune effector cells are CD3, CD2, CD4, CD8, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, EphA2, DNAM, BT-H3, CD20, CD22 or these. Including combinations.

In one embodiment, the dimart (eg, bispecific or trispecific cell engager) comprises a polypeptide sequence that is at least 95% identical to any one of SEQ ID NOs: 7-10. In another embodiment, the polypeptide sequence encodes an antigen binding fragment to CD3, CD2, CD4, CD8, LFA1, CD45, IL21R, NKG2D, NKp44, NKp46, NKp30 or DNAM. In another embodiment, the polypeptide sequence encodes an antigen binding fragment for CD3, CD19, GD2 or NKG2D. In another embodiment, the polypeptide encodes a first antigen-binding fragment and a second antigen-binding fragment. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to CD19. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to GD2. In another embodiment, the first antigen-binding fragment binds to NKG2D and the second antigen-binding fragment binds to GD2.

In one embodiment, the dimart (eg, trispecific engager or antibody) comprises a first antigen binding fragment, a second antigen binding fragment and a third antigen binding fragment. In another embodiment, the trispecific engager or antibody individually comprises three antigen binding fragments that bind to NKG2D, IL21R and GD2. In a further embodiment, the trispecific engager or antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11.

In one embodiment, the antigen binding fragment that binds IL-21R is IL-21. The amino acid and cDNA sequences of IL-12 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

In one embodiment, the antigen-binding fragment that binds to NKG2D is MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, Rae-1α, Rae-1β, Rae-1γ, Rae-1δ, Rae-1ε, Includes H60a, H60b, H60c, MULT1 or fragments thereof. In one embodiment, the antigen binding fragment that binds to NKG2D is MICA or a fragment thereof. The amino acid and cDNA sequences of MICA are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

The MICA sequence, in one embodiment, comprises a wide-type variant. In one embodiment, the MICA variant is a sequence variant of MUC-30 containing a methionine variant instead of alanine at position 129 of the wide MICA sequence. The amino acid and cDNA sequences of the MUC-30 variant are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

In a further embodiment, the pre-mRNA that encodes a trispecific antibody is expressed when it is in contact with a morpholino oligonucleotide.

In one embodiment, the antigen binding domain is a single-stranded variable fragment or antibody.

In a further embodiment, the recombinant polynucleotide or vector comprises a polynucleotide sequence encoding a secreted peptide. In another embodiment, the recombinant polynucleotide or vector further comprises a polynucleotide sequence encoding a dimerization domain. In another embodiment, the recombinant polynucleotide or vector comprises a 5'end inverted sequence (ITR) and a 3'ITR. In another embodiment, the vector comprises the sequence of SEQ ID NO: 4, 6, 8, 12, 14, 16-23, 30-33 or 40-46. Non-limiting examples of such vectors include retrovirus vectors, lentivirus vectors, mouse leukemia virus (“MLV”) vectors, Epstein-Barvirus (“EBV”) vectors, adenovirus vectors, and herpesviruses (“MLV”) vectors. HSV ") vectors, adeno-associated virus (" AAV ") vectors, AAV vectors, or optionally recombinant viral vectors containing skeletal vectors selected from the group of self-complementary AAV vectors.

Recombinant polynucleotides or vectors can be contained within host cells such as prokaryotic or eukaryotic cells.

Recombinant polynucleotides, vectors and cells can be contained within compositions containing vectors and / or host cells and carriers such as pharmaceutically acceptable carriers. Recombinant polynucleotides, vectors and cells can be formulated for a variety of modes of administration and are effective amounts of polynucleotides, vectors and / or host cells for a patient, disorder or disease, vector and mode of administration. May contain. In one embodiment, the mode of administration is systemic or intravenous. In another embodiment, the administration is a topical administration by direct injection. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or subsequently from the polynucleotide or vector, eg, as a systemic or topical injection. Alternatively, the contact is before the polynucleotide or vector.

Recombinant polynucleotides or vectors are useful for treating a variety of diseases or disorders. In one aspect, a method of delivering a transgene is provided. The method comprises administering to the cell, tissue or patient to be treated an effective amount of a recombinant polynucleotide or vector containing the transgene. In one embodiment, the cell, tissue or patient to be treated is administered an effective amount of morpholino oligonucleotide. Non-limiting examples of transgenes are provided and selected based on the objectives of the method. The cell or tissue can be that of a mammal, such as a human. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector. Alternatively, the contact of the morpholino oligonucleotide is before the vector. In another embodiment, the vector is introduced into cells by transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof.

Methods of treating cancer are provided in subjects who require treatment of the cancer. The method comprises or consists of administering to the subject an effective amount of the recombinant polynucleotide or vector or cell described herein, essentially from, or being administered. In a further method, the method further comprises administering to the subject an effective amount of a morpholino oligonucleotide. In one embodiment, an effective amount of anti-cancer agent is administered to the subject. Non-limiting examples of anti-cancer agents include anti-cancer peptides, polypeptides, nucleic acid molecules, small molecules, viral particles or combinations thereof. In another embodiment, the vector is introduced into cells by transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof.

In one aspect of the disclosed method, the virus particles are oncolytic HSV particles.

A further method provided by the present disclosure comprises contacting, or contacting with, an effective amount of a morpholino oligonucleotide, the cells comprising the polynucleotides or vectors described herein are essentially or contacted. This is a method for producing a bispecific antibody or a trispecific antibody in a cell. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector. Alternatively, the contact of the morpholino oligonucleotide is before the polynucleotide or vector. In one embodiment, the morpholino oligonucleotide contains a sequence that is at least 95% identical to SEQ ID NO: 27 or 28. Non-limiting examples of bispecific antibodies include polypeptide sequences that are at least 95% identical to SEQ ID NO: 13 or 15. In one embodiment, the bispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 14, 16, 22, 23, 30-33 or 40-46. In another embodiment, the trispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11. In one embodiment, the trispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 12.

In another embodiment, the polynucleotide or vector is introduced into the cell by transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof. Non-limiting examples of cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melaninogenic cells, blood cells or combinations thereof.

Further provided are kits comprising one or more of the polynucleotides, vectors, cells or compositions described herein, optionally with instructional material.

FIG. 1 shows a strategic outline of the general concept of splicing using the 3-exon gene structure. Exons are written as 1, 2 or 3, and introns are represented by straight lines. The different splicing patterns are shown in lowercase letters (a, b, c) and the structure of the resulting RNA is shown based on which of them is used. Oligos capable of interfering with splice donor (1D, 2D) or acceptor (2A, 3A) sites are shown as short blue lines, and the expected expression of different possible RNA isoforms is at which site. It is shown as a "+" depending on whether it is blocked by the oligo.

FIG. 2 outlines the strategy of FIG. 1 using splice type 1 in which exons 2 are normally contained in gene transcripts. Transcripts containing all three exons spliced together are expected to predominate, but in the presence of exon 2 splice acceptors or oligos that block donor sites, exons 1 fused to exons 3 The transcript to have is predominant.

FIG. 3 outlines strategy # 1 for producing an engineered intron-exon STOP-intron within the transgene. Transcripts carrying these introns are non-functional because the introns have immature stop codons and / or are out of frame. The "a + b" transcript is non-functional due to the stop codon in exon 2. Only transcripts in which exon 2 was skipped (utilizing splice c) are functional, which transcripts are low at baseline and activated by oligos that block the splice site on exon 2.

FIG. 4 shows a map of transgene regulation for the strategy shown in FIG.

In FIG. 5, an intron-exon STOP- engineered into a transgene using a "type 2 splice" in which exon 2 is normally excluded in cancer cells but is contained in normal cells. A second strategy for making introns is shown. In this scenario, the exon skipping oligo activates the introduced gene expression (exon 1 + 3) in normal cells, and in certain off-target skipping of the cellular gene, the introduced gene expression is potentially a "bonus" therapeutic effect. Does not change (or perhaps higher).

FIG. 6 shows an intron engineered into a transgene using a "type 3 splice" that is normally contained in certain cancer cells but excluded in normal cells. A third strategy for making exon STOP-introns is shown. In this scenario, baseline high levels of active transgenes (exons 1 + 3) are present in normal cells, and exon skipping oligos activate expression in tumor cells.

FIG. 7 shows an exemplary CD3xGD2-HDD AAV construct.

FIG. 8 shows an illustrated representation of the assay for determining the structure and function of the dimart disclosed herein.

FIG. 9 shows SDS-PAGE of whole cytolytic lysates from transfected 293T cells. The three constructs # 1101, # 1040 and # 1124 of FIG. 7 containing the secreted peptide had CD3xGD2-HDD dimarts retained in the transfected 293T cells as compared to constructs # 1104 and the control pcDNA3-GFP construct. There were few.

FIG. 10 shows that the AAV vector secreted CD3xGD2-HDD dimart, which binds and activates human T cells.

FIG. 11 shows a secreted CD3xGD2-HDD dimart that activates human T cells.

FIG. 12A shows that the binding of CD3xGD2-HDD to T cells is dose-dependent.

FIG. 12B shows a bar graph of median staining levels normalized to unstained controls.

FIG. 13 shows an illustration of the binding assay for the anti-GD2 arm of CD3xGD2-HDD Dimart. This assay confirmed that both GD2 and CD3 binding were present on a single molecule.

FIG. 14 shows an exemplary CD3xGD2-HDD dimart that binds to both CD3 and GD2.

FIG. 15 shows a flow chart of an assay for determining whether CD3xGD2-HDD induces GD2 + target cell killing by T cells.

FIG. 16 shows that secreted CD3xGD2-HDD induces T cell killing of neuroblastoma cells.

FIG. 17 shows T cell-mediated cytotoxicity by CD3xGD2-HDD dimart associated with GD2 expression.

FIG. 18A shows a map of an exemplary AAV construct for testing CD19xCD3 dimart expression.

FIG. 18B shows an exemplary CD19TransJoin genomic structure. The elements of the transgene encoded by AAV are shown in the figure.

FIG. 18C shows an illustrated representation of CD19 dimart interacting with cancer cells and T cells. CD19 dimart is produced by cells containing CD19TransJoin. As shown in this figure, "Ca" represents a cancer cell and "T" represents a T cell.

FIG. 19 shows that supernatants from cells transfected with an AAV CD19xCD3 construct containing a secretory sequence bind and activate T cells.

FIG. 20 shows that supernatants from cells transfected with an AAV vector containing a secretory peptide activate human T cells.

FIG. 21 shows that AAV-secreted CD19xCD3 specifically binds CD19 but not CD45.

FIG. 22A shows that the binding of CD19xCD3 to T cells is dose-dependent.

FIG. 22B shows a bar graph of median staining levels normalized to unstained controls.

FIG. 23A shows that binding of CD19xCD3 to B cells is dose-dependent.

FIG. 23B shows a bar graph of median staining levels normalized to unstained controls.

FIG. 24 shows that CD3 dimart activates T cells with anti-CD28 co-stimulation better than anti-CD3 antibody.

FIG. 25 shows that 293T cells provide the highest transduction efficiency for the AAV8 vector.

FIG. 26 shows that the dimart concentration in the supernatant of AAV8 infected cells depends on the AAV dose and transduction efficiency.

FIG. 27 shows a single intravenous injection of CD19xCD3 TransJoin that selectively removes B cells in humanized mice.

FIG. 28 shows a single intravenous injection of CD19xCD3 TransJoin resulting in long-term B cell depletion in humanized mice.

FIG. 29 shows that a single intravenous injection of CD19xCD3 TransJoin eliminates CD19 + lymphoma in humanized mice.

FIG. 30 shows an overview of OncoSkip and TransSkip described herein.

FIG. 31 shows that KRAS OncoSkip antisense morpholino induces exon skipping of endogenous KRAS in lung cancer cells.

FIG. 32 shows an exemplary AAV vector map of a CD3xGD2-HDD TransSkip showing a reverse manipulated intron flanking an exon inserted in the CD3xGD2-HDD dimart code sequence.

FIG. 33 shows an exemplary strategy for testing the activities of OncoSkip and TransSkip described herein.

FIG. 34 shows an antisense morpholino that induces exon skipping of the CD3xGD2-HDD TransSkip transgene.

FIG. 35 shows a KRAS OncoSkip that induces secreted expression of CD3xGD2-HDD dimart in cells transfected with the CD3xGD2-HDD TransSkip AAV vector.

FIG. 36 shows that exon skipping of CD3xGD2-HDD TransSkip by KRAS OncoSkip is an on-target effect.

FIG. 37 shows that induction of CD3xGD2-HDD dimart expression as determined by T cell binding is an on-target effect.

FIG. 38 shows an AAV genomic map of an exemplary TransSkip splicing variant for reducing baseline TransSkip “leakage” but maintaining inducible exon skipping.

FIG. 39 shows a CD3xGD2-HDD TransSkip splicing variant K3 that removes baseline but maintains inducible exon skipping.

FIG. 40 shows the CD3xGD2-HDD TransSkip variant K3, which does not show baseline dimart production but is more inductive by KRAS OncoSkip compared to the other TransSkip variants tested.

FIG. 41 shows that OncoSkip-mediated induction of dimart expression from CD3xGD2-HDD TransSkip variants K3 and K5 is an on-target effect.

FIG. 42 shows that the secreted dimart induced by OncSkip from the AAV CD3xGD2-HDD TransSkip vector is functional in mediating T cell killing of neuroblastoma cells.

FIG. 43 shows that transgene exon skipping in cells infected with AV CD3xGD2-HDD TransSkip variant K3 is inducible and on-target by KRAS OncoSkip.

FIG. 44A shows an AAV genomic map of an exemplary CD19xCD3 TransSkip splicing variant.

FIG. 44B shows an exemplary CD19 TransSkip genomic structure. The elements of the transgene encoded by AAV are shown in the figure.

FIG. 44C shows an illustrated representation of CD19 dimart interacting with cancer cells and T cells. CD19 dimart is produced by cells containing CD19 TransSkip. As shown in this figure, "Ca" represents a cancer cell and "T" represents a T cell.

FIG. 45 shows that OncoSkip morpholino KTS1 and KTS2 induce on-target exon skipping of CD19xCD3 TransSkip K1.

FIG. 46 shows that KRAS OncoSkip induces secreted expression of CD19xCD3 dimart in cells transfected with the CD19xCD3 TransSkip K1 AAV vector.

FIG. 47 shows a CD19xCD3 TransSkip splicing variant K3 that removes baseline but maintains inducible exon skipping.

FIG. 48 shows that induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3 as determined by T cell binding is an on-target effect.

FIG. 49 shows that the induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3 is repeatable.

Detailed Description The embodiments according to the present disclosure are described more fully below. However, aspects of the present disclosure can be embodied in different forms and should not be construed as being limited to the embodiments described herein. Rather, these embodiments are provided so that the present disclosure is meticulous and complete and fully conveys the scope of the invention to those of skill in the art. The terms used in the description herein are intended only to describe a particular embodiment and are not intended to be limiting.

Unless otherwise defined, all terms used herein, including technical and scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art. Terms such as those defined in commonly used dictionaries should be construed to have a meaning consistent with their meaning in the context of this application and related technology, and expressly as used herein. It is further understood that if not defined as such, it should not be interpreted in an idealized or overly formal sense. Although not explicitly defined below, such terms should be construed according to their general meaning.

The terms used in the description herein are solely for the purpose of describing a particular embodiment and are not intended to limit the invention. All publications, patent applications, patents and other references referred to herein are incorporated by reference in their entirety.

Unless otherwise stated, the practice of this technique uses conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology and recombinant DNA that belong to the techniques of this art.

Unless the context dictates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Further, the present disclosure also contemplates that, in some embodiments, any feature or combination of features described herein can be excluded or omitted. For illustration purposes, if the specification states that the complex comprises components A, B and C, any or any combination of A, B or C or a combination thereof may be omitted, either alone or in any combination. Is specifically intended to be excluded from the scope of rights.

Unless otherwise stated, all specified embodiments, features and terms are intended to include both the listed embodiments, features or terms and their bioequivalence.

All numerical notations, including ranges, such as pH, temperature, time, concentration and molecular weight, as appropriate, by increments of 1.0 or 0.1, or +/- 15%, or +/- 10%, or. It is an approximate value that is changed to (+) or (-) by a change of +/- 5% or +/- 2%. Although not always explicitly stated, it should be understood that all numerical notations are prefixed with the term "about". Although not always explicitly stated, it is also understood that the reagents described herein are merely exemplary, and that reagents equivalent to such are known in the art. Should be.

Throughout this disclosure, various publications, patents and published patent specifications are referenced by discriminating citations or by Arabic numerals. The full citation of the publication identified by the Arabic numeral appears immediately before the claims. The disclosures of these publications, patents and published patent specifications are incorporated by reference in their entirety into this disclosure in order to more fully explain the state of the art in the field to which the invention pertains.
Definition

Unless otherwise stated, the practice of this technique uses conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology and recombinant DNA that fall within the technical scope of the art. do. For example, Sambrook, Fritzch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edition (1989); Current Protocols In Molecular Biology (F.M.Ausseel). , Inc.): PCR 2: A Practical Aproch (MJ MacPherson, BD Hames and GR Taylor eds. (1995)), Harlow and Line, eds. (1988) Antibodies, a Laboratory Manual, and Animal Cell Culture (RI Freshney, ed. (1987)).

As used in the description of the present invention and the appended claims, the singular forms "a", "an" and "the" may also include the plural unless the context clearly dictates otherwise. Intended.

As used herein, the term "contains" is intended to mean include the elements in which the composition and method are described, but do not exclude other elements. As used herein, the transitional phrase (and grammatical variation) of becoming essential is substantially in the enumerated materials or processes, as well as the basic and novel properties of the enumerated embodiments. It should be construed to include non-affecting materials or processes. Therefore, the term "becomes essential" as used herein should not be construed as equivalent to "contains." By "consisting of" is meant excluding substantive method steps for administering more than trace amounts of other ingredients and the compositions disclosed herein. The embodiments defined by each of these transitions fall within the scope of the present disclosure.

The term "about" as used herein to refer to a measurable value such as quantity or concentration is 20%, 10%, 5%, 1%, 0.5%, or the specified amount. Furthermore, it is intended to include a variation of 0.1%.

The terms "acceptable," "effective," or "sufficient" as used to describe the choice of any ingredient, range, dosage form, etc. disclosed herein are said to be the ingredient. , Scope, dosage form, etc. are intended to be appropriate for the disclosed purpose.

Also, as used herein, "and / or" is not only one or all possible combinations of one or more of the relevant listed items, but selectively ("or"). When interpreted, it also represents a lack of combination and includes these.

As used herein, the term "adeno-associated virus" or "AAV" is associated with this name and refers to a member of a class of viruses belonging to the genus Depended Parvoviridae of the family Parvoviridae. Multiple serotypes of this virus are known to be suitable for gene delivery, and all known serotypes can infect cells from a variety of tissue types. AAV serotypes with at least 11 serial numbers are known in the art. Non-limiting exemplary serotypes useful in the methods disclosed herein include 11 serotypes such as AAV2, AAV8, AAV9, or variant serotypes such as AAV-DJ and AAV PHP. Any of B is included. AAV particles contain three major viral proteins, VP1, VP2 and VP3. In one embodiment, AAV comprises serotypes AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP. B, AAVrh74 or AAV-DJ (chimera obtained by eight different AAV wild-type shufflings).

In some cases, AAV serotypes preferentially target histological types. In some cases, the charts below show exemplary tissue types and AAV serotypes that target each tissue type.

As used herein, the term "cell" may refer to either a prokaryotic cell or an eukaryotic cell and, as appropriate, is obtained from a subject or commercially available source.

"Eukaryotic cells" include all biological kingdoms except the Monera kingdom. Eukaryotic cells can be easily identified through the nucleus bound to the membrane. Animals, plants, fungi and protozoa are eukaryotes, that is, organisms in which their cells are organized into complex structures by internal membranes and cytoskeletons. The most characteristic membrane-bound structure is the nucleus. Unless otherwise stated, the term "host" includes eukaryotic hosts, including, for example, yeast, higher plant, insect and mammalian cells. Non-limiting examples of eukaryotic cells or eukaryotic hosts include monkeys, bovines, pigs, mice, rats, birds, reptiles and humans such as HEK293 cells and 293T cells.

Usually, "prokaryotic cells" that lack the nucleus or any other membrane-bound organelle are divided into two domains: bacteria and archaea. In addition to chromosomal DNA, these cells can also contain genetic information in a circular loop called an episome. Bacterial cells are very small, approximately the size of animal mitochondria (about 1-2 μm in diameter, 10 μm in length). Prokaryotic cells are characterized by three major shapes: rod-shaped, spherical and spiral. Instead of undergoing an elaborate replication process like eukaryotes, bacterial cells divide by dichotomy. Examples include, but are not limited to, Bacillus bacteria, Escherichia coli and Salmonella bacteria.

The term "encoding" when applied to a nucleic acid sequence is transcribed and / or translated into a polypeptide and / or its, in its original state or when manipulated by methods well known to those of skill in the art. The ability to produce mRNA for a fragment represents a polynucleotide referred to as "encoding" a polypeptide. The antisense strand is a complement to such nucleic acids, and the coding sequence can be deduced from the antisense strand.

The terms "equivalent" or "biological equivalent" are used interchangeably when referring to a particular molecule, biological or cellular material, with minimal homology while still maintaining the desired structure or function. Intended to have sex. Non-limiting examples of equivalent polypeptides include at least 60%, or at least 65%, or at least 70%, or at least 75%, or 80%, or at least 85 of the polypeptide sequence. %, Or at least 90%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99%. High stringency to a polypeptide having sex, or a polynucleotide encoding such a polypeptide sequence, which, in one embodiment, encodes a reference polypeptide, which has substantially the same or the same function as the reference polypeptide. Examples thereof include a polypeptide encoded by a polynucleotide or a complement thereof hybridizing under the above conditions. The conditions for high stringency are described herein and are incorporated herein by reference. Alternatively, the equivalent is at least 70%, or at least 75%, or 80%, or at least 85%, or at least to the reference polynucleotide, eg, wild-type polynucleotide or referenced polynucleotide. Have 90% identity or / or at least 95% identity, or at least 96% identity, or at least 97% sequence identity, or at least 98% identity, or at least 99% identity. , A polynucleotide encoded by a polynucleotide or its complement.

Non-limiting examples of equivalent polynucleotides are at least 60%, or at least 65%, or at least 70%, or at least 75%, or 80%, or at least relative to the reference polynucleotide. 85%, or at least 90%, or at least 95%, or at least 96% identity, or at least 97% sequence identity, or at least 98% identity, or at least 99% identity. Includes polynucleotides having sex. Equivalents are also intended for polynucleotides or their complements that hybridize with reference polynucleotides under high stringency conditions.

A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage (eg, 80%, 85%, 90% or 95%) of "sequence identity" with respect to another sequence is aligned. When the two sequences are compared, it means that the percentage of bases (or amino acids) are the same. Alignment and percent homology or sequence identity can be found in software programs known in the art, such as Current Protocols in Molecular Biology (Ausube et al., Eds. 1987) Supplement 30, section 7.7.18, Table 7.7.1. It can be determined using those described in. In certain embodiments, initialization parameters are used for alignment. A non-limiting exemplary alignment program is BLAST, which uses initialization parameters. In particular, exemplary programs include BLASTN and BLASTP using the following initialization parameters. Genetic code = standard; filter = none; strand = both; cutoff = 60; expected value = 10; matrix = BLOSUM62; description = 50 sequences; sort = high score; database = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + SwissProtein + SPupdate + PIR. Details of these programs can be found at the following Internet address: ncbi. nlm. nih. It can be found in gov / cgi-bin / BLAST. Sequence identity and percent identity can be determined by incorporating them into lustalW (web address: genome.jp/tools/clustalw/, last access date January 13, 2017).

"Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing the positions in each sequence that can be aligned for comparison. When a position in the compared sequence is occupied by the same base or amino acid, the molecule is homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by these sequences. An "irrelevant" or "non-homologous" sequence shares less than 40% or less than 25% identity with one of the sequences disclosed in the present disclosure.

"Homology" or "identity" or "similarity" may also refer to two nucleic acid molecules that hybridize under stringent conditions.

"Hybridization" refers to a reaction in which one or more polynucleotides react to form a stabilized complex via hydrogen bonds between the bases of a nucleotide residue. Hydrogen bonds can occur by Watson-Crick base pairing, Hoogsteen binding, or in any other sequence-specific manner. The complex may include two chains forming a double-stranded structure, three or more chains forming a multi-chain complex, a single self-hybridizing chain or any combination thereof. Hybridization reactions can constitute steps during a larger process, such as initiating a PCR reaction or enzymatically cleaving a polynucleotide with a ribozyme.

Examples of stringent hybridization conditions are incubation temperatures of about 25 ° C to about 37 ° C; about 6 x saline sodium citrate (SSC) to about 10 x SSC hybridization buffer concentrations; about 0% to about. 25% formamide concentration; and wash solutions of about 4 x SSC to about 8 x SSC. Examples of moderate hybridization conditions are incubation temperatures of about 40 ° C to about 50 ° C; buffer concentrations of about 9 x SSC to about 2 x SSC; formamide concentrations of about 30% to about 50%; and about 5 Examples thereof include a washing solution of × SSC to about 2 × SSC. High stringency hybridization refers to a state in which the hybridization of an oligonucleotide to a target sequence is mismatch-free (ie, fully complementary). Examples of high stringency conditions are incubation temperatures of about 55 ° C to about 68 ° C; buffer concentrations of about 1 x SSC to about 0.1 x SSC; formamide concentrations of about 55% to about 75%; and about. Examples include 1 × SSC, 0.1 × SSC wash solution or deionized water. Generally, the hybridization incubation time is 5 minutes to 24 hours, with one, two or more wash steps, and the wash incubation time is about 1, 2 or 15 minutes. SSC is 0.15M NaCl and 15 mM citrate buffer. It is understood that SSC equivalents using other buffer systems can be used.

As used herein, "expression" refers to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide or protein. If the polynucleotide is derived from genomic DNA, expression can include splicing of mRNA in eukaryotic cells.

"Gene" refers to a polynucleotide containing at least one open reading frame (ORF) capable of encoding a particular polypeptide or protein after being transcribed and translated. A "gene product" or "gene expression product" refers to an amino acid (eg, a peptide or polypeptide) produced when a gene is transcribed and translated.

"Transcriptional control" is a well-understood term in the art where transcription of a polynucleotide sequence, usually a DNA sequence, is functionally a factor that contributes to or promotes transcription. Indicates that it depends on being concatenated. By "functionally linked" is intended that the polynucleotide is arranged so that it can function intracellularly. In one aspect, the invention provides a promoter operably linked to a downstream sequence.

The term "exon" refers to a nucleic acid sequence that contains a protein coding sequence. The gene typically contains more than one exon separated by an intron intervening.

As used herein, the term "intron" refers to a nucleic acid sequence sandwiched between a splice donor site at the 5'end and a splice acceptor site at the 3'end. In some embodiments, the intron is eliminated or removed by splicing from the RNA or mRNA sequence expressed from the vector in which the intron is present.

The term "splice donor site" is a nucleic acid sequence or domain at the 5'end of an intron. The splice donor site, in one embodiment, indicates the boundary of the intron with the coding sequence (or exon) immediately preceding and / or in the intron.

As used herein, the term "splice acceptor site" refers to a nucleic acid sequence or domain at the 3'end of an intron. In one embodiment, the splice acceptor site indicates the initiation of the intron and the subsequent coding sequence-the boundary of the intron with the exon. In another embodiment, the splice acceptor site comprises an intron bifurcation, where the 5'end of the intron is attached during the splicing process. In some embodiments, the splice acceptor sequence and the intron bifurcation site are located adjacent to each other as a single unit. In some embodiments, the splice acceptor sequence and the intron bifurcation site can be further separated by moving the branch site further to 5'of the splice acceptor sequence.

As used herein, the term "splice site" refers to a sequence or domain of nucleic acid present at either the 5'end or the 3'end of an intron as defined above.

As used herein, the term "exon skipping" refers to the modification of pre-mRNA splicing by targeting splice donors and / or acceptor sites within pre-mRNA with one or more complementary antisense oligonucleotides. By blocking access of spliceosomes to one or more splice donors or acceptor sites, one or more complementary antisense oligonucleotides can prevent splicing reactions, thereby being completely processed. Causes deletion of one or more exons from the mRNA. In one embodiment, exon skipping is achieved in the nucleus during the process of premRNA maturation. This includes shielding important sequences involved in the splicing of targeted exons by using antisense oligonucleotides that are complementary to the splice donor sequence in the pre-mRNA.

As used herein, the term "gene regulatory sequence" refers to a nucleic acid sequence capable of controlling transcription, splicing or modification of a gene, open reading frame or exon or intron. The gene regulatory sequences of the invention may include promoters, binding sites for antisense oligonucleotides and / or enhancers. Therefore, placing a gene under the regulatory control of a promoter or regulatory element means placing the gene so that expression of the gene is regulated by the regulatory sequence (s). Therefore, in constructing a promoter-gene combination, the promoter is preferably located upstream of the gene at a distance from the transcription start site that is approximately equal to the distance between the promoter and the gene that the promoter controls in natural circumstances. Will be done. This variation in distance can be tolerated without loss of promoter function. Similarly, for a heterologous gene placed under its control, the preferred arrangement of a regulatory element, such as an enhancer, reflects its natural position with respect to the structural gene that the regulatory element naturally regulates. Enhancers are considered to be relatively unaffected by position and orientation, as opposed to promoter elements. In some embodiments, the gene regulatory sequence comprises one or more of a binding sequence to an antisense oligonucleotide, a binding sequence to doxycycline or a polynucleotide sequence encoding a riboswitch. In some embodiments, the antisense oligonucleotide (ASO) comprises one or more modified nucleotides. In one embodiment, the antisense oligonucleotide is a morpholino oligonucleotide.

In some embodiments, the antisense oligonucleotides (ASOs) described herein comprise from about 8 to about 50 nucleotides in length. In some cases, ASOs are about 8 to about 30, about 8 to about 25, about 8 to about 20, about 8 to about 18, about 8 to about 15, about 10 to about 50, about 10 to about 30, about. 10 to about 25, about 10 to about 20, about 10 to about 18, about 10 to about 15, about 12 to about 50, about 12 to about 30, about 12 to about 25, about 12 to about 20, about 12 to It contains about 18 or about 12 to about 15 nucleotides in length. In some embodiments, ASOs are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or Contains 50 nucleotides in length.

In some cases, ASO comprises one or more modified nucleotides. In some cases, ASO comprises about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% modified nucleotides. In another example, the ASO is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or Contains modified nucleotides beyond that. In some cases, the modification is on the 2'hydroxyl group of the ribose moiety. In some cases, modifications include H, OR, R, halo, SH, SR, NH2, NHR, NR2 or CN, where R is an alkyl moiety in the formula. Exemplary alkyl moieties include, but are not limited to, halogens, sulfur, thiols, thioethers, thioesters, amines (primary, secondary or tertiary), amides, ethers, esters, alcohols and oxygen. In some cases, the alkyl moiety further comprises modifications. In some cases, the modifications are azo group, keto group, aldehyde group, carboxyl group, nitro group, nitroso group, nitrile group, heterocyclic (eg, imidazole, hydrazino or hydroxylamino) group, isocyanato or It contains a cyanato group, or a sulfur-containing group (eg, sulfoxide, sulfone, sulfide and disulfide). In some cases, the alkyl moiety further comprises a hetero-substitution. In some cases, the carbon of the heterocyclic group is replaced by nitrogen, oxygen or sulfur. In some cases, heterocyclic substitutions include, but are not limited to, morpholino, imidazole and pyrrolidino. In some cases, the modification at the 2'hydroxyl group is a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. In some cases, the modified nucleotide is a locked or cross-linked ribose modification (eg, locked nucleic acid or LNA), an ethylene nucleic acid (ENA) (eg, 2'-4'-ethylene cross-linked nucleic acid), a peptide nucleic acid or a morpholino. In some cases, the modified nucleotide further comprises one or more modified internucleotide bonds. Exemplary modified internucleotide bonds include phosphorothioate, phosphorodithioate, methylphosphonate, 5'-alkylene phosphonate, 5'-methylphosphonate, 3'-alkylene phosphonate, boron trifluoli. Dirt, 3'-5'bonded or 2'-5'bonded borane phosphart ester and selenophostate, phosphotriester, thionoalkylphosphotriester, hydrogen phosphonate bond, alkylphosphonate, alkylphosphonothioate , Arylphosphonothioate, Phosphoroserenoart, Phosphorodiselenoart, Phosphinate, Phosphoramidat, 3'-alkylphosphorumidate, Aminoalkylphosphorumidat, Thionophosphoramidat, Phosphoropiperadi Dirt, Phosphoraanilothioart, Phosphoraniridart, Ketone, Sulfon, Sulfonamide, Carbonate, Carbamate, Methylenehydrazo, Methylenedimethylhydrazo, Holmacetal, Thioformacetal, Oxym, Methyleneimino, Methylenemethylimino, Thioamidart , Bonds with riboacetyl groups, aminoethylglycine, silyl or siloxane bonds, eg, heteroatoms of 1-10 carbons containing saturated or unsaturated and / or substituted and / or heteroatoms. Includes alkyl or cycloalkyl bonds with or without, morpholino structures, amides, bonds with polyamides in which the base is directly or indirectly bonded to the acetal nitrogen of the skeleton, as well as combinations thereof. Not limited to.

As used herein, the term "morpholino" refers to a polymer molecule with a backbone supporting a base capable of forming hydrogen bonds with a polynucleotide. In some embodiments, the polymer on morpholino lacks a pentose skeleton moiety, more specifically a ribose skeleton linked by phosphodiester bonds typical of nucleotides and nucleosides. In one embodiment, the morpholino oligonucleotide contains a nitrogen ring. In another embodiment, the morpholino is a sterically pure oligonucleotide (eg, see wavelifesciences.com last accessed on January 25, 2019) or a derivative thereof. In another embodiment, the morpholino comprises a sequence that is at least 95% identical to the sterically pure polynucleotide.

In another embodiment, the morpholino comprises a targeting base sequence that is complementary to a selected pretreated mRNA or target region of the premRNA, such as the intron region of the premRNA, from about 8 to about 50, from about 8 to. It comprises a structure of about 30, about 10 to about 50, about 10 to about 30, or about 12 to about 30 nucleotides. In another embodiment, the morpholino antisense oligonucleotide promotes splicing of the target exon, resulting in a transcript lacking the target exon.

In some cases, antisense oligonucleotides (ASOs) are referred to herein as OncoSkip. As used herein, the term "OncoSkip" refers to an ASO designed to induce skipping of a target exon during splicing of the target transgene, thereby inducing expression of the target transgene. In some cases, the target transgene encodes a polypeptide that binds to a surface polypeptide (eg, a surface receptor) of the target cell. In some cases, the target cells are tumor cells or immune cells. In some cases, the target transgene is an oncogene. In such examples, the use of OncoSkip induces skipping of target exons during splicing to induce oncogene expression.

In some embodiments, the OncoSkip described herein comprises from about 8 to about 50 nucleotides in length. In some cases, OncoSkip is about 8 to about 30, about 8 to about 25, about 8 to about 20, about 8 to about 18, about 8 to about 15, about 10 to about 50, about 10 to about 30, about 30 10 to about 25, about 10 to about 20, about 10 to about 18, about 10 to about 15, about 12 to about 50, about 12 to about 30, about 12 to about 25, about 12 to about 20, about 12 to It contains about 18 or about 12 to about 15 nucleotides in length. In some embodiments, OncoSkip is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50. Includes nucleotide length.

In some embodiments, OncoSkip comprises one or more modified nucleotides, eg, about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% modified nucleotides. In some cases, OncoSkip is about 1, 2, 3, 4, 5, 6, 6, 7, 8, 9, 10, 11, 12, 13, 14, 14, Contains 15, 20, 25, 30, 35, 40 or more modified nucleotides. In some cases, OncoSkip contains one or more morpholino-modified nucleotides. In some cases, OncoSkip comprises about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% morpholino-modified nucleotides. In some cases, OncoSkip is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or more. Contains more than morpholino-modified nucleotides.

In some cases, OncoSkip works in concert with TransSkip. As used herein, the term "TransSkip" is a recombinant vector containing a transgene disrupted by the intron-exon-intron region (eg, a recombinant viral vector such as an AAV vector), exon. However, refers to a recombinant vector containing a stop codon that interferes with the normal expression of the polypeptide encoded by the intron gene. In some cases, the transgene is further encapsulated by a construct containing a polynucleotide encoding a dimart. In some cases, along with OncoSkip, OncoSkip skips exons from the intron-exon-intron region during splicing to produce mRNA that allows expression of the polypeptide encoded by the transgene. In the absence of OncoSkip, transgene expression from TransSkip is arrested due to the presence of a stop codon in the intron-exon-intron region.

As used herein, the term "dimart" recognizes a surface polypeptide (eg, a surface receptor) in which each scFv is expressed on a cell, and the two cells are different or two or it. Refers to an engineered protein molecule containing a single chain variable fragment (scFv) that exceeds. In some cases, Dimart targets two different cell types, such as cancer cells and immune cells, or two different immune cell types. Exemplary immune cell types include dendritic cells, natural killer (NK) cells, macrophages, T cells, B cells, monocytes or neutrophils. In some cases, immune cells are effector immune cells. In some cases, effector immune cells include effector T ( _Teff ) cells (also referred to herein as tumor infiltrating T cells). Exemplary T _eff cells include CD8 + T cells and non-regulatory CD4 + helper T cells. In some cases, dimart targets cancer cells and effector immune cells. In some cases, _dimart targets cancer cells and Teff cells. In some cases, Dimart targets two different cancer cells, eg, two different cancer cells from the same cancer.

In some cases, dimart 2 or more scFvs are linked by a linker. In some cases, the linker is a peptide linker that facilitates the binding of each scFv to its respective target polypeptide. In some cases, the linker comprises a series of poly-Ala, poly-Gly or combinations thereof. In some cases, a poly-Ala linker, a poly-Gly linker, or a peptide linker containing a combination of Ala and Gly, each independently, is about 2 to about 50 residues in length. In some cases, poly-Ala linkers, poly-Gly linkers or peptide linkers containing Ala and Gly combinations are independently about 2 to about 45 residues, about 4 to about 45 residues, and about 5 respectively. Residues to about 45 residues, about 8 residues to about 45 residues, about 10 residues to about 45 residues, about 15 residues to about 45 residues, about 20 residues to about 45 residues, about 30 Residues to about 45 residues, about 2 residues to about 40 residues, about 4 residues to about 40 residues, about 5 residues to about 40 residues, about 8 residues to about 40 residues, about 10 Residues to about 40 residues, about 15 residues to about 40 residues, about 20 residues to about 40 residues, about 30 residues to about 40 residues, about 2 residues to about 30 residues, about 4 Residues to about 30 residues, about 5 residues to about 30 residues, about 8 residues to about 30 residues, about 10 residues to about 30 residues, about 15 residues to about 30 residues, about 20 Residues to about 30 residues, about 2 residues to about 20 residues, about 4 residues to about 20 residues, about 5 residues to about 20 residues, about 8 residues to about 20 residues, about 10 Residues to about 20 residues or about 15 residues to about 20 residues in length. In some cases, the poly-Ala linker, the poly-Gly linker or the peptide linker containing the combination of Ala and Gly are independently about 2, 4, 5, 6, 8, 10, 12, 14, 15, 16 respectively. , 18, 20, 25, 30, 35, 40, 45 or 50 residues in length.

In some cases, the linker is a (Gly ₄ Ser) n linker, where n is an integer of 1-10. In some cases, n is an integer of 1-6, 1-4 or 1-3. In some cases, n is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In some cases, the linker is about 10 to about 50 amino acid residues in length and optionally about 10 to about 30, about 10 to about 25 or about 10 to about 20 amino acid residues in length. .. In some cases, the linker contains one or more unnatural amino acids.

In some cases, the dimart further comprises additional polypeptides. In some cases, additional polypeptides enhance Dimart's avidity for target cells. In some cases, an additional polypeptide is the dimerization domain of human hepatocyte nuclear factor 1α (HNF1α). In some cases, HNF1α comprises a polypeptide sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with MVSKLSQLQTELLAALLESGLSKEALIQALGE (SEQ ID NO: 47). In some cases, HNF1α is at least 90%, 95%, 96%, 97%, 98%, coded by 100%, 95%, 96%, 97%, 98%, 9%, 99% In some cases, the additional polypeptide does not induce any additional immunogenicity or toxicity.

In some embodiments, the additional polypeptide is linked to the rest of the dimart by a linker. In some cases, the linker comprises GSGGAP. As used herein, the GSGGAP peptide is also referred to herein as a spacer. In some cases, the linker comprises TPLGDTTHTSG. In some cases, the peptide TPLGDTHTSG is derived from the hinge region of IgG3.

As used herein, the term "TransJoin" encodes a dimart described herein, but is a recombinant vector containing a polypeptide in which an exon contains a stop codon and the intron-exon-intron region is absent. (For example, a recombinant viral vector such as an AAV vector). Therefore, TransJoin is different from TransSkip because TransJoin can express dimart without the need for OncoSkip.

In some embodiments, the TransJoin described herein is optimized for delivery of dimart to a target cell or tissue of interest. In some cases, TransJoin comprises a promoter and enhancer pair, or a promoter and regulatory element pair, that is optimized for delivery and / or expression to a target cell or tissue. In some cases, TransJoin is optimized for constitutive expression of dimart over a period of time (eg, by a promoter-enhancer pair or a promoter-regulatory element pair). In some cases, TransJoin is optimized for constitutive and stable expression of dimart over a period of time (eg, by a promoter-enhancer pair or a promoter-regulatory element pair). In some cases, TransJoin comprises a promoter and regulatory elements such as the Woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE) for enhanced expression, constitutive expression, stable expression or a combination thereof. include.

In some embodiments, TransJoin described herein is a promoter-enhancer pair or a promoter-regulatory element pair optimized for the balanced expression of dimart in a target cell or tissue. include. In some cases, balanced expression refers to the range of expression in which expression above this range induces toxicity, but below this range no therapeutic effect is exerted. In some cases, promoters and enhancers or promoters and regulatory elements (eg, WPRE) work together to balance dimart expression to reach the target range. In some cases, balanced manifestations include, for example, a wide range to provide a wide therapeutic range for dimart.

In some embodiments, the TransJoin described herein further comprises the secretory consensus sequence described below, which is optimized for the balanced expression of dimart in the target cell or tissue. .. In some cases, balanced expression refers to the range of expression in which expression above this range induces toxicity, but below this range no therapeutic effect is exerted. In some cases, secretory consensus sequences work in concert with promoters, enhancers, regulatory elements (eg, WPRE) or combinations thereof to balance dimart expression to reach the target range. In some cases, balanced manifestations include, for example, a wide range to provide a wide therapeutic range for dimart.

When used above, the period is 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 21 days, 28 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months. Includes months, 3 months, 4 months, 5 months, 6 months, 8 months, 10 months, 1 year, 2 years or more.

As used herein, the term "isolated" refers to a molecular or biopharmaceutical or cellular material in the absence of substantially other materials.

As used herein, the term "functional" may be used to modify any molecule, biologic or cellular material with the intention of achieving a particular specified effect. ..

As used herein, the terms "nucleic acid sequence" and "polynucleotide" are interchangeably used to describe the polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. used. For this reason, the term refers to single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or purines and pyrimidine bases or other natural, chemically or biochemically. Contains, but is not limited to, polymers containing modified, unnatural or derivatized nucleotide bases.

As used herein, the term "promoter" refers to any sequence that regulates the expression of a coding sequence such as a gene. Promoters can be, for example, constitutive, inducible, inhibitory or tissue-specific. A "promoter" is a regulatory sequence that is a region of a polynucleotide sequence in which the initiation and rate of transcription is controlled. Promoters can contain regulatory proteins and molecules to which regulatory proteins and molecules such as RNA polymerase and other transcription factors can bind. Non-limiting exemplary promoters include the Raus sarcoma virus (RSV) LTR promoter (with RSV enhancer, if desired), cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β- Includes the actin promoter, phosphoglycerol kinase (PGK) promoter, U6 promoter or EF1 alpha shortened (EFS) promoter.

またはその同等物を含む。 In some embodiments, the promoter is an EF1 alpha shortened (EFS) promoter. In some cases, the EF1 alpha shortened (EFS) promoter is

Or its equivalent.

Cytomegalovirus (CMV), human polypeptide chain elongation factor (EF1a), SV40, phosphoglycerate kinase (PGK), such as PGK1 (human or mouse), P5, Ubc, human betaactin, CAG, TRE, UAS, Ac5. , Polyhedrin, CaMKIIa, Gal1, TEF1, GDS, ADH1, CaMV35S, ubiquitin (Ubi), such as ubiquitin C (UbiC), H1, U6, alpha-1-antitrypsin, splenic lesion-forming virus (SFFV) and chicken beta-actin. Further non-limiting exemplary promoters having certain target specificities, including but not limited to (CBA), are provided herein below. Synthetic promoters can be used for ubiquitous or tissue-specific expression. In addition, virally derived promoters, some of which are described above, such as CMV, HIV, adenovirus and AAV promoters, may be useful in the methods disclosed herein.

In some embodiments, the promoter is a tissue-specific promoter. In some cases, tissue-specific promoters are endogenous promoters or promoters derived solely from genes expressed in the target cell type. Exemplary tissue-specific promoters include liver-specific promoters such as ApoE / hAAT, LP1, SV40 / hAlb (InvivoGen); photoreceptor-specific promoters such as human rhodopsin kinase (GRK1) and pyramidal arrestin (CAR). B cell-specific promoters such as B29 (InvivoGen); CD45 promoters from InvivoGen and hematopoietic cell-specific promoters such as SV40 / CD45; muscle cell-specific promoters such as desmin promoter (InvivoGen); elastase-1 promoter (InvivoGen) Pancreatic alveolar cell-specific promoters such as, but not limited to, endothelial cell-specific promoters such as the Flt-1 promoter (InvivoGen); and neuron-specific promoters such as the SYN1 promoter (InvivoGen).

In some embodiments, the promoter is attached to an enhancer to increase transcription efficiency. Non-limiting examples of enhancers include RSV enhancers, CMV enhancers and α-fetoprotein MERII enhancers.

Enhancers are regulatory elements that increase the expression of target sequences. A "promoter / enhancer" is a polynucleotide containing a sequence capable of providing both promoter and enhancer functions. For example, retrovirus terminal repeats contain both promoter and enhancer functions. Enhancers / promoters can be "endogenous," "extrinsic," or "heterogeneous." An "endogenous" enhancer / promoter is one that is naturally linked to a particular gene in the genome. An "extrinsic" or "heterologous" enhancer / promoter is juxtaposed to a gene using genetic manipulation (ie, molecular biology techniques) such that transcription of the gene is induced by the linked enhancer / promoter. Enhancer / promoter.

In some embodiments, the vector utilized herein (eg, a viral vector such as an AAV vector) further comprises one or more regulatory elements. Exemplary regulatory elements include, but are not limited to, transcription terminators, polyadenylation sites and terminal inversion sequences (ITRs) such as 5'ITR and 3'ITR. In some cases, regulatory elements include woodchuck hepatitis virus (WHP) post-transcriptional regulatory elements (WPRE). In some cases, the exemplary WPRE comprises the nucleic acid sequence of SEQ ID NO: 50 or an equivalent thereof. The sequence of SEQ ID NO: 50 is shown below:

The terms "protein", "peptide" and "polypeptide" are used interchangeably and, in their broadest sense, refer to compounds of two or more subunits of amino acids, amino acid analogs or peptide mimetics. The subunits can be linked by peptide bonds. In another embodiment, the subunits may be linked by other bonds, such as esters, ethers and the like. A protein or peptide must contain at least two amino acids and there is no limit to the maximum number of amino acids that can make up a sequence of proteins or peptides. As used herein, the term "amino acid" is either a natural and / or unnatural or synthetic amino acid, including both glycine and D and L-type optical isomers, amino acid analogs and peptide mimetics. Represents.

As used herein, the term "vector" refers to a non-chromosomal nucleic acid containing intact replicons such that the vector can be replicated when placed intracellularly, for example by the process of transformation. The vector can be viral or non-viral. Viral vectors include retroviruses, adenoviruses, herpesviruses, baculoviruses, modified baculoviruses, papovaviruses or otherwise modified naturally occurring viruses. Exemplary non-viral vectors for delivering nucleic acids include bare DNA; DNA complexed with cationic lipids alone or in combination with cationic polymers; anionic and cationic. Liplips; Particles containing DNA condensed with a cationic polymer contained in the liposome, such as DNA-protein complex and heterologous polylysine, oligopeptides of specified length and polyethyleneimine; and viruses and polylysine. -Includes the use of ternary complexes containing DNA. In another embodiment, the vector is a retroviral vector, a lentiviral vector, a mouse leukemia virus (“MLV”) vector, an Epstein-Vervirus (“EBV”) vector, an adenovirus vector, a herpesvirus (“HSV”) vector. Alternatively, it is a recombinant viral vector comprising a skeletal vector selected from the group of adeno-associated virus (“AAV”) vectors. In another embodiment, the vector is an AAV vector, or optionally a self-complementary AAV vector.

A "viral vector" is defined as a recombinantly produced virus or viral particle containing a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vivo. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenoviral vectors, alpha viral vectors and the like. Alpha viral vectors, such as semliki forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5: 434-439 and Ying et al., (1999) Nat. Med. 5 (7): See 823-827. In some cases, the viral vector may be an AAV vector such as AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP. B, AAVrh74 or AAV-DJ. In some cases, the viral vector is AAVrh74. In some cases, AAVrh74 comprises the vector sequence of GenBank accession number LP899424.1 (accessed February 7, 2020).

In some embodiments, the viral vector (eg, AAV vector) has a limited carrying capacity. For example, AAV vectors have a carrying capacity limit of 4.7 kb. Therefore, the combination of dimart with promoters, enhancers and other regulatory elements needs to be within the capacity of 4.7 kb. In such examples, the promoters utilized herein are selected based on their nucleic acid length to allow packaging of dimart and other regulatory elements into viral vectors, such as AAV vectors. .. In some cases, the promoter for such use is SFFV, EF1α, PGK, UbiC, CMV, CBA or EFS. In some cases, the promoter is EFS.

In another embodiment, the promoter is an inducible promoter. In certain related embodiments, the promoter is an inducible tetracycline promoter. With the Tet-Off and Tet-On gene expression systems, researchers immediately utilize the regulated high-level gene expression systems described by Gossen & Bujard (1992; Tet-Off) and Gossen et al. (1995; Tet-On). can. In the Tet-Off system, gene expression is turned on when tetracycline (Tc) or doxycycline (Dox; Tc derivative) is removed from the medium. In contrast, in the Tet-On system, the addition of Dox turns on expression. In either system, gene expression can be tightly regulated in response to changes in Tc or Dox concentrations. Maximum expression levels in the Tet system are very high and comparable to those obtained from potent constitutive mammalian promoters such as CMV (Yin et al., 1996). Unlike other inducible mammalian expression systems, gene regulation in the Tet system is highly specific, so pleiotropy or non-specific induction does not complicate the interpretation of the results. In E. coli, the Tet repressor protein (TetR) negatively regulates the gene for the tetracycline-resistant operon on the Tn10 transposon. TetR blocks transcription of these genes by binding to the tet operator sequence (tetO) in the absence of Tc. TetR and tetO provide the basis for regulation and induction for use in mammalian experimental systems. In the Tet-On system, the regulatory protein is based on a "reverse" Tet repressor (rTetR) created by four amino acid changes in TetR (Hillen & Berens, 1994; Gossen et al., 1995). The resulting protein rtTA (reverse tTA is also referred to as a tetracycline activated protein) is encoded by the pTet-On regulator plasmid.

In a related embodiment, the vector further comprises, or consists of, a nucleic acid encoding a tetracycline-activated protein and a promoter that regulates the expression of the tetracycline-activated protein.

Vectors, isolated cells, viral packaging systems and other inducible systems useful in the methods described herein include ecdysone, estrogen, progesterone, dimerization chemical inducers and isopropyl. -Includes regulation with β-D1-thiogalactopyranoside (EPTG).

As used herein, the term "recombination expression system" or "recombination vector" refers to one or more genetic constructs for the expression of a particular genetic material formed by recombination. ..

A "gene delivery vehicle" is defined as any molecule capable of carrying the inserted polynucleotide into a host cell. Examples of gene delivery vehicles are biocompatible polymers including liposomes, micelles, natural and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial viral envelopes; metal particles; and bacteria, or baculoviruses, adenos. It describes expression in viruses such as viruses and retroviruses, bacteriophage, cosmid, plasmids, fungal vectors and various eukaryotic and prokaryotic hosts, for simple protein expression as well as for genetic therapy. Other recombinant vehicles typically used in the art that can be used in.

The polynucleotides disclosed herein can be delivered to cells or tissues using a gene delivery vehicle. As used herein, "gene delivery," "gene transfer," "transduction," etc., are exogenous polynucleotides in host cells ("transgenes", regardless of the method used for transfer. It is a term that refers to the introduction of). Such methods include various well-known techniques such as vector-mediated gene transfer (eg, by viral infection / transfection, or other various protein-based or lipid-based gene delivery complexes), as well as "naked". Includes techniques for facilitating the delivery of polynucleotides, such as electrical perforations, "gene gun" delivery and various other techniques used for the introduction of polynucleotides. The introduced polynucleotide can be maintained stably or transiently in the host cell. For stable maintenance, the introduced polynucleotide contains an origin of replication that is compatible with the host cell, or in a host cell replicon such as an extrachromosomal replicon (eg, a plasmid) or in a nuclear or mitochondrial chromosome. It is usually required to be incorporated into it. Known in the art and described herein, many vectors are known to be able to mediate the introduction of genes into mammalian cells.

A "plasmid" is an extrachromosomal DNA molecule that is separate from chromosomal DNA and can replicate independently of chromosomal DNA. In most cases, the plasmid is circular and double-stranded. Plasmids provide a mechanism for horizontal gene transfer within a population of microorganisms and typically provide an advantage in selection under given environmental conditions. In a competitive ecological niche, plasmids can carry genes that confer resistance to naturally occurring antibiotics, or the proteins produced can act as toxins under similar circumstances.

The "plasmid" used in genetic engineering is called a "plasmid vector". Many plasmids are commercially available for this purpose. The gene to be replicated is a short region containing a gene that makes the cell resistant to a particular antibiotic and several commonly used restriction sites that facilitate the insertion of a DNA fragment at this location. Is inserted into a copy of a plasmid containing a multiple cloning site (MCS, or polylinker). Another major use of plasmids is to make large amounts of protein. In this case, the researcher grows a bacterium containing a plasmid carrying the gene of interest. Just as bacteria produce proteins that confer antibiotic resistance, they can be induced to produce large amounts of protein from the inserted gene.

In an embodiment in which gene transfer is mediated by a DNA viral vector such as adenovirus (Ad) or adeno-associated virus (AAV), the vector construct refers to a polynucleotide and a transgene containing the viral genome or a portion thereof. Adenovirus (Ad) is a group of relatively well-characterized homogeneous viruses containing over 50 serotypes. Adenovirus does not require integration into the host cell genome. Vectors derived from recombinant Ad, especially those that reduce the potential for recombinant and wild-type virus production, have also been constructed. Such vectors are commercially available from sources such as Takara Bio USA (Mountain View, CA), Vector Biolabs (Philadelphia, PA) and Creative Biogene (Shirley, NY). Wild-type AAV has high infectivity and specificity that integrates into the genome of host cells. World and Toth (2013) Curr. Gene. The. 13 (6): 421-433, Hermonat & Muzyczka (1984) Proc. Natl. Acad. Sci. USA 81: 6466-6470 and Lebkowski et al., (1988) Mol. Cell. Biol. 8: 3988-3996.

Vectors containing both a promoter and a cloning site into which the polynucleotide can be functionally linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo and are commercially available from sources such as Agilent Technologies (Santa Clara, California) and Promega Biotech (Madison, Wis.). .. To optimize expression and / or transcription in vitro, the 5'and / or 3'untranslated portion of the clone is removed, added or modified to interfere with expression at either the transcriptional or translational level. It may be necessary to remove extra potential improper translation initiation codons or other sequences that may be reduced. Alternatively, a consensus ribosome binding site can be inserted immediately 5'on the start codon to enhance expression.

As used herein, the terms "engager," "engager molecule," or "activating antigen" refer to a molecule secreted by a cell that is capable of activating immune cells. In certain embodiments, the engager specifically activates immune effector cells according to the domain present in the engager. Examples of cells that secrete engagers include, but are not limited to, T cells, NK cells, NKT cells, CAR-T cells, mesenchymal stem cells (MSCs), neural stem cells, hematopoietic stem cells or mixtures thereof. In another embodiment, immune effector cells include dendritic cells, natural killer (“NK”) cells, macrophages, T cells, B cells or combinations thereof.

The term "antigen recognition domain" or "antigen binding domain" refers to a portion of an engager molecule that recognizes an antigen. In certain embodiments, the antigen can be of any nature, including but not limited to proteins, carbohydrates and / or synthetic molecules.

As used herein, the term "activating antigen" or "activating domain" refers to a portion of an engager molecule that interacts with immune cells and induces positive or negative immunomodulatory signals. Examples of positive immunomodulatory signals include signals that induce cell proliferation, cytokine secretion or cytolytic activity. Examples of negative immunomodulatory signals include signals that inhibit cell proliferation, inhibit the secretion of immunosuppressive factors, or induce cell death.

As used herein, the term "natural immune cells" refers to immune cells that are naturally present in the immune system. Examples include, but are not limited to, T cells, NK cells, NKT cells, B cells and dendritic cells.

As used herein, the term "engineered immune cell" refers to a genetically modified immune cell.

As used herein, the term "T cell" refers to naive T cells, CD4 + T cells, CD8 + T cells, memory T cells, activated T cells, anergy T cells, resistant T cells, chimeric B cells and antigen specifics. Includes target T cells.

As used herein, the term "antibody" means not only an intact antibody molecule, but also a fragment of an antibody molecule that retains the ability to bind immunogen. Such fragments are also well known in the art and are used regularly both in vitro and in vivo. Thus, as used herein, the term "antibody" means not only intact immunoglobulin molecules, but also the well-known active fragments F (ab') ₂ and Fab. Fab fragments lacking F (ab') ₂ and the Fc fragment of the intact antibody can be removed more rapidly from the circulation and less non-specific tissue binding of the intact antibody (Wahl et al., J. Nucl. Med. 24). : 316-325 (1983)). The antibody of the present invention includes all-natural antibody (whole native antibodies), monoclonal antibody, human antibody, humanized antibody, camelized antibody, multispecific antibody, bispecific antibody, chimeric antibody, Fab, Fab', one. Chain V region fragment (scFv), single domain antibody (eg, nanobody and single domain camel antibody), _VNAR fragment, bispecific T cell engager (BiTE) antibody, minibody, disulfide-bound Fv ( sdFv), and includes anti-idiotype (anti-Id) antibodies, intrabodies, fusion polypeptides, non-conventional antibodies and antigen-binding fragments of any of the above. In particular, the antibody includes an immunoglobulin molecule and an immunologically active fragment of the immunoglobulin molecule, i.e. a molecule containing an antigen binding site. The immunoglobulin molecule can be of any type (eg, IgG, IgE, IgM, IgD, IgA and IgY), class (eg, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or a subclass.

In certain embodiments, the antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain consists of a heavy chain variable region (abbreviated herein as _VH ) and a heavy chain stationary ( _CH ) region. The heavy chain constant region is composed of three domains, CH1, CH2, and CH3. Each light chain is composed of a light chain variable region (abbreviated herein as _VL ) and a light chain constant _CL region. The light chain constant region is composed of one domain _CL . The _VH and _VL regions can be further subdivided into hypervariable regions called complementarity determining regions (CDRs), which are interspersed with more conserved regions called framework regions (FRs). Each V _H and _VL is composed of 3 CDRs and 4 FRs arranged in the following order from the amino terminus to the carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen. The constant region of the antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (eg, effector cells) and the first component (Clq) of the classical complement system. As used interchangeably herein, the terms "antigen-binding portion,""antigen-bindingfragment," or "antigen-binding region" are regions of an antibody that bind to an antigen and confer antigen specificity on the antibody. Alternatively, the antigen-binding protein, eg, a fragment of an antibody, includes one or more fragments of an antibody that retain the ability to specifically bind to an antigen (eg, a peptide / HLA complex). It has been shown that the antigen-binding function of an antibody can be performed by a fragment of a full-length antibody. Examples of antigen-binding moieties included in the term "antibody fragment" of an antibody are Fab fragments, which are monovalent fragments consisting of _VL , _VE , _CL and CHI domains; linked by disulfide bridges in the hinge regions. F (ab) ₂ fragments, which are bivalent fragments containing two Fab fragments; Fd fragments consisting of _VH domains and CHI domains; Fv fragments consisting of _VL and _VH domains of a single arm of an antibody; _VH domains Included are dAb fragments consisting of (Ward et al., Nature, 341: 544-546 (1989)); and isolated complementarity determining regions (CDRs).

Antibodies and antibody fragments, in whole or in part, are mammalian (eg, humans, non-human primates, goats, guinea pigs, hamsters, horses, mice, rats, rabbits and sheep) or non-mammalian antibody-producing animals (eg, humans, non-human primates, goats, guinea pigs, hamsters, horses, mice, rats, rabbits and sheep). For example, it can be derived from chickens, ducks, geese, snakes, amphibians of the order. Antibodies and antibody fragments can be produced in animals, or produced externally to animals, such as from yeast or phage (eg, as a single antibody or antibody fragment, or as part of an antibody library). Can be

In addition, the two domains of the Fv fragment, _VL and _VH , are encoded by separate genes, which are monovalent in pairs of the _VL and _VH regions using recombinant methods. It can be linked by a synthetic linker that allows it to be made as a single protein chain forming a molecule. These are known as single chain Fv (scFv), eg, Bird et al., Science 242: 423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. 85: 5879-5883 (1988). These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for usefulness, similar to intact antibodies.

An "isolated antibody" or "isolated antigen-binding protein" is one identified and isolated and / or recovered from a component of its natural environment. A "synthetic antibody" or "recombinant antibody" is generally produced using recombinant techniques or peptide synthesis techniques known to those of skill in the art.

As used herein, the term "single-chain variable fragment" or "scFv" refers to immunoglobulins covalently linked to form a VF: _{VL heterodimer} (eg, mice). Or a fusion protein of the variable regions of the heavy chain ( _VH ) and light chain ( _VL ) of humans). Heavy chains ( _VH ) and light chains ( _VL ) are peptides that are directly linked or connect the N-terminus of _VH to the C-terminus of _VL or the C-terminus of _VH to the N-terminus of _VL . It is linked by a coding linker (eg, about 10, 15, 20, 25 amino acids). Linkers are usually rich in glycine for flexibility and also for serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen binding domain.

Despite the removal of constant regions and the introduction of linkers, the scFv protein retains the specificity of the original immunoglobulin. Single-stranded Fv polypeptide antibodies include sequences encoding V _H and _VL as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85: 5879-5883 (1988)). It can be expressed from nucleic acids. See also U.S. Pat. Nos. 5,091,513, 5,132,405 and 4,965,778 and U.S. Patent Application Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (eg, Zhao et al., Hybridoma (Larchmt) 27 (6): 455-51 (2008); Peter et al., J Cachexia Sarcopenia Muscle (2012); Shieh et al., J. Mol. Immunol, 183 (4): 2277-85 (2009); Geomarelli et al., Tromb Haemost 97 (6): 955-63 (2007); Fife et al., J Clin Invst 116 (8): 2252-61 (2006); Blocks Et al., Immunotechnology 3 (3): 173-84 (1997); Moosmayer et al., The The Immunol 2 (10): 31-40 (1995); agonistic scFv with stimulatory activity is described (eg,). , Peter et al., J Biol Chem 25278 (38): 36740-7 (2003); Xie et al., Nat Biotech 15 (8): 768-71 (1997); Ledbetter et al., Crit Rev Immunol 17 (5-6): 427. -55 (1997); see Ho et al., BioChim Biophyss Acta 1638 (3): 257-66 (2003)).

As used herein, "F (ab)" refers to a fragment of an antibody structure that binds to an antigen but is monovalent and has no Fc moiety, eg, an antibody digested by the enzyme papain. It produces two F (ab) and Fc fragments (eg, heavy (H) chain constant regions; Fc regions that do not bind to the antigen).

As used herein, "F (ab') ₂ " refers to an antibody fragment produced by pepsin digestion of all IgG antibodies, which fragment is the two antigen bindings (ab') (divalent). Each (ab ¹ ) region comprises two distinct amino acid chains, i.e., a portion of the H chain linked by SS binding to bind the antigen and a light (L) chain. Here, the remaining H chain moieties are linked together. The "F (ab') ₂ " fragment can be divided into two individual Fab'fragments.

As used herein, "CDR" is defined as the complementarity determining region amino acid sequence of an antibody that is a hypervariable region of immunoglobulin heavy and light chains. For example, Kabat et al., Sequences of Products of Immunological Interest, 4th U.S.A. S. See Department of Health and Human Services, National Institutes of Health (1987). Generally, an antibody comprises three heavy chains and three light chain CDRs or CDR regions in a variable region. The CDR provides most of the contact residues for binding the antibody to the antigen or epitope. In certain embodiments, the CDR regions are defined by the Kabat systems (Kabat, EA et al., Sequences of Products of Immunological Interest, Fifth Edition, US. (1991)).

As used herein, the term "affinity" means a measure of binding strength. Without being bound by theory, affinity is the tightness of the stereochemical compatibility between the antibody combining site and the antigenic determinants, the size of the contact area between them, as well. It depends on the distribution of charged and hydrophobic groups. Affinity also includes the term "avidity", which refers to the strength of an antigen-antibody bond after the formation of a reversible complex (eg, either monovalent or polyvalent). Methods for calculating the affinity of an antibody for an antigen are known in the art and include the use of binding experiments to calculate the affinity. Antibody activity in functional assays (eg, flow cytometry assays) also reflects antibody affinity. Antibodies and affinities can be phenotypically characterized and compared using functional assays (eg, flow cytometry assays). Nucleic acid molecules useful in the subject matter of the present disclosure include any nucleic acid molecule encoding a polypeptide or fragment thereof. In certain embodiments, nucleic acid molecules useful in the subject matter of the present disclosure include nucleic acid molecules encoding antibodies or antigen-binding moieties thereof. Such nucleic acid molecules do not have to be 100% identical to the endogenous nucleic acid sequence, but typically exhibit substantial identity. A polynucleotide having "substantial homology" or "substantial identity" with an endogenous sequence can typically hybridize with at least one strand of a double-stranded nucleic acid molecule. By "hybridizing" is meant a pair that forms a double-stranded molecule between complementary polynucleotide sequences (eg, genes described herein) or parts thereof under various stringency conditions. .. (See, for example, Wahl, G. M. and S. L. Berger, Methods Enzymol. 152: 399 (1987); Kimmel, AR Methods Enzymol. 152: 507 (1987)).

The term "substantially homologous" or "substantially identical" refers to a reference amino acid sequence (eg, any one of the amino acid sequences described herein) or a nucleic acid sequence (eg, herein. Means a polypeptide or nucleic acid molecule that exhibits at least 50% or more homology or identity to any one of the nucleic acid sequences described). For example, such sequences are at least about 60%, about 65%, about 70%, about 75%, about at the amino acid level or nucleic acid with the sequences used for comparison (eg, wild-type or natural sequences). 80%, about 85%, about 90%, about 95%, or about 96%, or about 97%, or about 98%, or about 99% homologous or identical. In some embodiments, the substantially homologous or substantially identical polypeptide is substituted, inserted with one or more amino acid amino acids (amino acid amino acid) as compared to the sequence used for comparison. Or contains a deletion. In some embodiments, a substantially homologous or substantially identical polypeptide contains one or more unnatural amino acids, including D-amino acids and retroinverso amino acids, to replace homologous sequences. Or it contains an amino acid analog.

Sequence homology or sequence identity is typically described by sequence analysis software (eg, Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. Alternatively, it is measured using the PILEUP / PRETTYBOX program). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions and / or other modifications. An exemplary approach for determining the degree of identity can use the BLAST program, where the probability score between e- ³ and ^e-100 indicates a closely related sequence.

As used herein, the term "similar" refers to a structurally related polypeptide or nucleic acid molecule having the function of a reference polypeptide or nucleic acid molecule.

As used herein, the term "conservative sequence modification" refers to the binding properties of the engineered receptors of the present disclosure (eg, the extracellular antigen binding domain of the engineered receptor) containing its amino acid sequence. Refers to an amino acid modification that does not significantly affect or change. Conservative modifications can include amino acid substitutions, additions and deletions. Modifications can be introduced into human scFv of the engineered receptors of the present disclosure by standard techniques known in the art such as site-directed mutagenesis and PCR-mediated mutagenesis. Amino acids can be grouped by physicochemical properties such as charge and polarity. Conservative amino acid substitutions are those in which amino acid residues are replaced with amino acids within the same group. For example, amino acids can be classified by charge: positively charged amino acids include leucine, arginine, histidine, negatively charged amino acids include aspartic acid, glutamate, and neutrally charged amino acids include alanine. , Aspartic acid, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine and valine. In addition, amino acids can be classified by polarity: polar amino acids include arginine (basic polarity), asparagine, aspartic acid (acidic polarity), glutamate (acidic polarity), glutamine, histidine (basic polarity), lysine ( Basic polar), serine, threonine and tyrosine, and non-polar amino acids include alanine, cysteine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine. Thus, one or more amino acid residues within the CDR regions can be replaced with other amino acid residues from the same group, and altered antibodies are used with the functional assays described herein. The retained function (ie, the function described in (c)-(1) above) can be tested. In certain embodiments, one or less, two or less, three or less, four or less, or five or less residues in a given sequence or CDR region are altered.

As used herein, the term "ligand" refers to a molecule that binds to a receptor. In particular, the ligand binds a receptor on another cell, allowing cell-cell recognition and / or interaction.

As used herein, the term "co-stimulatory signaling domain" or "co-stimulatory domain" refers to a portion of an engineered receptor that comprises the intracellular domain of a co-stimulatory molecule. A co-stimulator is a cell surface molecule other than an antigen receptor or Fc receptor that, when bound to an antigen, provides a second signal required for efficient activation and function of T lymphocytes. be. Examples of such co-stimulatory molecules include CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS (CD278), LFA-1, CD2, CD7, Ligand. Includes ligands that specifically bind NKD2C, B7-H2 and CD83. Accordingly, the present disclosure provides exemplary co-stimulation domains derived from CD28 and 4-1BB, but other co-stimulation domains for use with the engineered receptors described herein. Is intended. Inclusion of one or more co-stimulation signaling domains can enhance the efficacy and expansion of T cells expressing the engineered receptor. The intracellular signaling domain and the co-stimulating signaling domain can be tandemly linked to the carboxyl terminus of the transmembrane domain in any order.

As used herein, the term "chimeric co-stimulatory receptor" or "CCR" refers to a chimeric receptor that binds to an antigen and provides a co-stimulation signal, but not a T cell activation signal.

The term "bispecific antibody" or "triple-specific antibody" refers to an antibody that has two different antigen-binding regions (bispecific antibodies) or three different antigen-binding regions (triple-specific antibodies). In some embodiments, bispecific antibodies are described by Brinkmann et al.,'' The making of bispecific antibodies,'' MABS9 (2): 182-212 (2017), FIG. 2 or Labrijn et al.,'' Bispicific antibody. a mechanistic review of the pipeline,'' Contains antibody formats (or antibody structures) as disclosed in FIG. 2 of Nature Reviews 18: 585-608 (2019).

In some embodiments, at least one of the antigen-binding regions of a bispecific antibody or trispecific antibody binds to an activated antigen on immune effector cells. This can be understood as different target binding, but also includes binding to different epitopes in one target. Non-limiting examples of activating antigens include CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3 (CD276), CD20, CD22 or combinations thereof. However, it is not limited to these. Non-limiting examples of bispecific antibodies include, but are not limited to, CD3xCD19, CD3xGD2, CD3xEphA2 and NKG2DxGD2 antibodies.

In one embodiment, the Dimart comprises a bispecific antibody. In some cases, Dimart may be a bispecific T cell engager (“BiTE”) antibody, a bispecific killer cell engager (“BiKE”) antibody, or one associated with a different immune cell. Includes other bispecific antibodies described in. In another embodiment, dimart comprises a trispecific antibody. In some cases, Dimart is described herein as being associated with a trispecific T cell engager (“TriTE”) antibody or a trispecific killer cell engager (“TriKE”) antibody, or a different immune cell. Includes other trispecific antibodies.

As used herein, the term "bispecific T cell engager" or "BiTE" refers to a first antigen-binding fragment that binds to a T cell receptor and to tumor cells via tumor-specific molecules. Refers to a bispecific monoclonal antibody containing a second antigen binding fragment that binds. As used herein, the term "triple-specific T cell engager" ("TiTE" or "TriTE") refers to a first antigen-binding fragment that binds to a T cell engager and via a tumor-specific molecule. Refers to a trispecific monoclonal antibody comprising a second antigen-binding fragment that binds to tumor cells and a third antigen-binding fragment that binds to a T cell engager or cytokine T cell activation domain. Tumor-specific molecules are, in one embodiment, Efluin type A receptor 2 (EphA2), interleukin (IL) -13ralpha2, EGFR VIII, PSMA, EpCAM, GD2 or GD3, fucosyl GM1, PSCA, PLAC1, sarcoma. Breakpoint, Wilms Tumor 1, Alpha Fet Protein (AFP), Carcinoembryonic Antigen (CEA), CA-125, MUC-1, Epidermal Tumor Antigen (ETA), Tyrosinase, Melanoma-Related Antigen (MAGE), Blood Differentiation Antigen, Surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2) ), B cell maturation antigen (BCMA), fibroblast activation protein (FAP) alpha or a combination thereof. Examples of BiTE include, but are not limited to, blinatumomab (MT103) and solitomab (MT110).

As used herein, the term "bispecific killer engager" or "BiKE" is mediated by a first antigen binding fragment that binds to a natural killer (NK) cell engager domain and a tumor-specific molecule. Refers to a bispecific monoclonal antibody containing a second antigen binding fragment that binds to tumor cells. As used herein, the term "triple-specific NK cell engager"("TiKE" or "TriKE") refers to a first antigen-binding fragment that binds to an NK cell engager and via a tumor-specific molecule. Refers to a trispecific monoclonal antibody comprising a second antigen-binding fragment that binds to tumor cells and a third antigen-binding fragment that binds to an NK cell engager or cytokine NK cell activation domain. The NKG2DxIL21RxGD2 antibody is one exemplary TriKE antibody. Examples of NK cell engager domains include, but are not limited to, ligands or molecules that bind CD16, CD16 ⁺ CD2, CD16 ⁺ DNAM and CD16 ⁺ NKp46. Examples of cytokine NK activation domains include, but are not limited to, IL-15, IL-12, IL-18, IL-21, or other NK cell-enhancing cytokines, chemokines and / or activating molecules. .. The NK engaging domain can include any moiety that binds to and / or activates NK cells and / or blocks inhibition of NK cells. In some embodiments, the NK engaging domain can comprise an antibody that selectively binds to the surface components of NK cells. In other embodiments, the NK engaging domain can comprise a ligand or small molecule that selectively binds to the surface components of NK cells.

In some embodiments, the NK engaging domain can selectively bind to a receptor that is at least partially located on the surface of an NK cell. In certain embodiments, the NK engaging domain is capable of binding NK cells, thereby providing spatial proximity of NK to a target to which the targeting domain selectively binds. However, in certain embodiments, the NK engaging domain can selectively bind to a receptor that activates NK cells and therefore also has an activating function. As mentioned above, activation of the CD16 receptor can induce antibody-dependent cellular cytotoxicity. Thus, in certain embodiments, the NK engaging domain can comprise at least a portion of an anti-CD16 receptor antibody that is effective for selectively binding to the CD16 receptor. In other embodiments, the NK engager cell domain can interfere with mechanisms that inhibit NK cells. In such embodiments, the NK engager domain may include, for example, anti-PDl / PDLl, anti-NKG2A, anti-TIGIT, anti-killer immunoglobulin receptor (KIR), and / or any other inhibition blocking domain. can.

In certain embodiments, by an engager molecule comprising at least an antigen recognition domain and an activation domain, optionally including a domain for inhibition of cytokines, co-stimulation domains and / or negative regulatory molecules of T cell activation. , Cells are genetically modified (including immune cells). The antigen recognition domain of an engager molecule binds to one or more molecules present in and / or on the target cell or secreted by the target cell. In certain embodiments, the target cell is a cancer cell, including at least solid tumor cells. When the engager molecule binds to the target molecule, the engager molecule can activate cells expressing the molecule recognized by the activation domain. The engager molecule can activate cells genetically modified with the engager molecule, or can activate unmodified cells.

Depending on the desired effect, activation can result in positive or negative signals. Examples of positive signals include signals that induce cell proliferation, cytokine secretion or cytolytic activity. Examples of negative signals include signals that inhibit T cell proliferation, inhibit the secretion of immunosuppressive factors, or induce cell death.

In certain embodiments, immune cells that secrete the engager molecule can redirect resident (naturally endogenous to a particular individual) immune cells to cancer cells.

The embodiments of the present disclosure are of modified immune cells that secrete the engagement molecule, as opposed to delivering the engagement molecule only to the individual itself (in the absence of production by the modified immune cell). Delivery of modified immune cells that secrete engager molecules to individuals in need of delivery (including certain cancers, known to have or suspected of having cancer) offer. In the present disclosure, an individual receives a modified immune cell that allows the production of an engager molecule. In certain embodiments, the cells produce immunostimulatory cytokines, proliferate antigen-specifically, kill suitable target cells, and cancer cells bystander immune cells, including at least T or NK cells. Redirects to, secretes engager molecules upon activation, and / or is locally or systemically effective against cancer. FIG. 3 shows an example of a modified T cell or NK cell that secretes an engager molecule. Certain T cells or NK cells can produce engagers capable of targeting the same cancer cell-specific antigen, but NK cells do not express CD3, so activation domains for T cells or NK cells. Must be different. Examples of activation domains for NK cells include, for example, at least CD16, NKG2D or NKp30.

Gene delivery vehicles also include DNA / liposomal complexes, mics, and targeted viral protein-DNA complexes. Liposomes that also contain a targeted antibody or fragment thereof can be used in the methods disclosed herein. In addition to the delivery of polynucleotides to cells or cell populations, non-limiting techniques for protein transfection are capable of direct introduction of the proteins described herein into cells or cell populations. Cultivation conditions that are, or can enhance the expression of the proteins disclosed herein and / or increase their activity, are other non-limiting techniques.

As used herein, the term "signal peptide" or "signal polypeptide" is intended for an amino acid sequence normally present at the N-terminal termination of a newly synthesized secretory or membrane polypeptide or protein. A "signal peptide" or "signal polypeptide" acts to direct the polypeptide to a particular cell location, eg, across the cell membrane, into or into the nucleus. In some embodiments, the signal peptide is removed after localization. Examples of signal peptides are well known in the art. Non-limiting examples are those described in US Pat. Nos. 8,853,381, 5,958,736 and 8,795,965.

As used herein, the term "virus capsid" or "capsid" refers to a proteinaceous shell or coat of viral particles. Capsids function to encapsulate, protect, transport, and release the viral genome into host cells. Capsids are generally composed of oligomeric subunits of proteins (“capsid proteins”). As used herein, the term "capsid encapsulated" means encapsulated within a viral capsid.

As used herein, the term "helper" for a virus or plasmid is an additional requirement for replication and packaging of modified or recombinant viral particles such as AAV disclosed herein. Refers to a virus or plasmid used to provide an ingredient. The components encoded by the helper virus may include any gene required for virion construction, capsid formation, genomic replication and / or packaging. For example, a helper virus may encode an enzyme required for the replication of the viral genome. Non-limiting examples of helper viruses and plasmids suitable for use with AAV constructs include pHELP (plasmid), adenovirus (virus) or herpesvirus (virus).

As used herein, the term "AAV" is a standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells that have been given a specific function by a co-infecting helper virus. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228 and Berns, 1990, Virology, pp. It can be found in 1743-1764, Raven Press, (New York). It is well known that the various serotypes are very closely related, both structurally and functionally, even at the genetic level, so the same principles described in these reviews are the same in these reviews. It is fully predicted that it will be applicable to additional AAV serotypes whose characteristics became apparent after the publication date of. (See, for example, Blackrowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, JR Pattison, ed .; and Rose, Polypropylene Virology 3: 1-61 (1974)). For example, all AAV serotypes clearly exhibit very similar replication properties mediated by homologous rep genes and all have three related capsid proteins, such as those expressed in AAV2. .. The degree of association reveals widespread cross-hybridization between serotypes along the length of the genome, with heteroduplex analysis and similar self-annealing segments corresponding to "terminally inverted sequences" (ITRs). Further suggested by its presence at the end of. Similar infectious patterns also suggest that replication function in each serotype is under similar regulatory control.

As used herein, "AAV vector" refers to a vector containing a polynucleotide (or transgene) of interest with one or more adjacent AAV terminal repeats (ITRs). Such AAV vectors can be replicated and packaged in infectious viral particles if present in host cells transfected with the vector that encodes and expresses the rep and cap gene products.

"AAV virion" or "AAV virus particle" or "AAV vector particle" refers to a virus particle composed of at least one AAV capsid protein and a polynucleotide AAV vector encapsulated with a capsid. When a particle contains a heterologous polynucleotide (ie, a polynucleotide other than the wild-type AAV genome, such as an introductory gene to be delivered to a mammalian cell), it is usually referred to as "AAV vector particle" or simply "AAV vector". Will be done. Therefore, since such a vector is contained within the AAV vector particle, the production of the AAV vector particle necessarily involves the production of the AAV vector.

In some embodiments, the AAV is a replication-deficient parvovirus, the single-stranded DNA genome having a length of about 4.7 kb containing two 145 nucleotide terminal inverted sequences (ITRs). There are multiple serotypes of AAV. The nucleotide sequence of the AAV serotype genome is known. For example, the complete genome of AAV-1 is provided by GenBank accession number NC_002077. The complete genome of AAV-2 is described by GenBank Accession No. NC_001401 and Srivastava et al., J. Mol. Vilol. , 45: 555-564 (1983). The complete genome of AAV-3 is provided by GenBank Accession No. NC_1829. The complete genome of AAV-4 is provided by GenBank accession number NC_001829. The AAV-5 genome is provided by GenBank accession number AF085716. The complete genome of AAV-6 is provided at GenBank Accession No. NC_00 1862. At least a portion of the AAV-7 and AAV-8 genomes are provided with GenBank accession numbers AX753246 and AX753249, respectively. The AAV-9 genome was described by Gao et al., J. Mol. Vilol. , 78: 6381-6388 (2004). The AAV-10 genome is Mol. The. , 13 (1): 67-76 (2006). The AAV-11 genome is provided in Virology, 330 (2): 375-383 (2004). AAV rh. The sequence of the 74 genomes is provided in US Pat. No. 9,434,928, which is incorporated herein by reference. U.S. Pat. No. 9,434,928 also provides sequences for capsid proteins and self-complementary genomes. In one embodiment, the genome is a self-complementary genome. A cis-acting sequence that directs viral DNA replication (rep), capsid encapsulation / packaging, and host cell chromosomal integration is contained within the AAV ITR. Three AAV promoters (named p5, pl9 and p40 relative to map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. The two rep promoters (p5 and pi9), coupled with the selective splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52 and rep40) from the rep gene. The Rep protein has multiple enzymatic properties that are ultimately involved in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes the three capsid proteins VP1, VP2 and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of three related capsid proteins. A single consensus sporiadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are outlined in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).

AAV has unique characteristics that make AAV attractive as a vector for delivering foreign DNA to cells, for example in gene therapy. AAV infections of cells in culture are non-cytotoxic, and natural infections of humans and other animals are asymptomatic and asymptomatic. In addition, AAV can infect many mammalian cells and target many different tissues in vivo. In addition, AAV can transduce slowly dividing and non-dividing cells and survive as transcriptionally active nuclear episomes (exchromosomal elements) substantially throughout the life of these cells. .. Since the AAV provirus genome is inserted as DNA cloned in a plasmid, it is possible to construct a recombinant genome. In addition, since signals directing AAV replication and genomic capsid formation are contained within the ITR of the AAV genome, a portion of approximately 4.3 kb inside the genome (encoding the replication and structural capsid protein, rep-cap) or All can be replaced with foreign DNA. To generate AAV vectors, rep and cap proteins can be provided trans. Another important feature of AAV is that it is a very stable and robust virus. AAV easily tolerates the conditions used to inactivate adenovirus (several hours at 56 ° to 65 ° C), making AAV cold storage less important. AAV can even be lyophilized. Finally, cells infected with AAV are not resistant to coinfection.

Multiple studies have demonstrated long-term (> 1.5 years) recombinant AAV-mediated protein expression in muscle. Clark et al., Hum Gene Ther, 8: 659-669 (1997); Kessler et al., Proc Nat. Acad Sc. USA, 93: 14082-14807 (1996); and Xiao et al., J Virol, 70: 8098-8108 (1996). See also Chao et al., Mol Ther, 2: 619-623 (2000) and Chao et al., Mol Ther, 4: 217-222 (2001). In addition, because the muscles are highly vascularized, recombinant AAV transduction was performed by Herzog et al., Proc Natl Acad Sci USA, 94: 5804-5809 (1997) and Murphy et al., Proc Natl Acad Sci USA, 94: 13921. As described in -13926 (1997), it resulted in the appearance of transgene products in the systemic circulation after intramuscular injection. In addition, Lewis et al., J Virol, 76: 8769-8775 (2002) demonstrated that skeletal muscle fibers have the necessary cellular factors for the correct antibody glycosylation, folding and secretion, and that muscle is a secretory protein. It shows that stable expression of therapeutic agents is possible. The AAV DNA in the rAAV genome includes AAV serum types AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10. , AAV-11, AAV-12, AAV-13, AAV PHP. It can be derived from any AAV serotype from which recombinant virus can be induced, including but not limited to B, AAVrh74 and AAV-DJ. The production of spoofed rAAV is disclosed, for example, in WO 01/83692. Other types of rAAV variants, such as rAAV with capsid mutations, have also been contemplated. See, for example, Marsic et al., Molecular Therapy, 22 (11): 1900-1909 (2014). Nucleotide sequences of the genomes of various AAV serotypes are known in the art.

As used herein, the term "external" with respect to a viral capsid protein refers to the surface, domain, region or end of the capsid protein facing outward in the assembled viral capsid. The term "inner" with respect to a viral capsid protein refers to the surface, domain, region or terminal (amino-terminal or carboxy-terminal) of the capsid protein facing inward in the assembled viral capsid. When used with respect to an assembled virus capsid, the term "inside" refers to the space enclosed by the capsid inside the virus capsid and the inwardly facing surface of the capsid exposed to this enclosed space. .. The internal space is surrounded by capsids by viral capsid proteins, during nucleic acids such as viral genomes, viral proteins, host or packaging cell proteins, and replication, virion assembly, capsid formation and / or packaging. It may contain any other ingredient or factor that is packaged or encapsulated with a capsid.

As used herein, the term "labeled" is used directly or indirectly with a composition to be detected, eg, a protein such as a polynucleotide or antibody, in order to produce a "labeled" composition. Means a directly or indirectly detectable compound or composition that is joined. The term also includes polynucleotide-conjugated sequences that provide a signal upon expression of the inserted sequence, such as green fluorescent protein (GFP). The label can be detectable alone (eg, radioisotope-labeled or fluorescent-labeled), or in the case of an enzyme label, it can catalyze the chemical changes in the detectable substrate compound or composition. Labels can be suitable for small-scale detection or for high-treatment screening. Thus, suitable labels include, but are not limited to, proteins including, but not limited to, radioisotopes, fluorescent dyes, chemiluminescent compounds, dyes, and enzymes. The label may simply be detected or quantified. Responses that are simply detected generally include responses that simply confirm their presence, whereas responses that are quantified are generally quantifiable, such as intensity, polarity and / or other properties. Includes responses with values (eg, numerically reportable). In a luminescence or fluorescence assay, the detectable response was associated directly or with another (eg, reporter or indicator) component using a chromophore or fluorophore associated with the assay component actually involved in binding. It can be indirectly generated using chromophores or fluorophores.

Examples of luminescent labels that generate signals include, but are not limited to, bioluminescence and chemiluminescence. The detectable luminescence response generally comprises a change or occurrence of the luminescence signal. Suitable methods and chromophores for luminescent labeling of assay components are known in the art and are described, for example, in Haugland, Richard P. et al. (1996) Handbook of Fluorescent Projects and Research Chemicals (6th ed.). Examples of luminescent probes include, but are not limited to, aequorin and luciferase.

Examples of suitable fluorescent labels include fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosine, coumarin, methylcoumarin, pyrene, Malacite green, stillben, Lucifer Yellow, Cascade Blue ™ and Texas Red. However, it is not limited to these. Other suitable optical dyes are described in Haugland, Richard P. et al. (1996) Handbook of Fluorescent Projects and Research Chemicals (6th ed.).

In another aspect, the fluorescent label is imparted with a functional group to facilitate covalent attachment to a cellular component present on or on the surface of a cell or tissue, such as a cell surface marker. Suitable functional groups include, but are not limited to, isothiocyanate groups, amino groups, haloacetyl groups, maleimides, succinimidyl esters and sulfonyl halides, all of which are fluorescently labeled second. Can be used to attach to molecules. The choice of functional group for a fluorescent label depends on the site of attachment to either the linker, drug, marker or second labeling agent.

Adhesion of the fluorescent label can be done directly on the cellular component or compound or via a linker. Suitable binding pairs for use in indirectly linking fluorescent labels to intermediates include, but are limited to, antigens / antibodies such as rhodamine / anti-rhodamine, biotin / avidin and biotin / streptavidin. Not done.

The term "solid support" refers to a non-aqueous surface such as a "culture plate", "gene chip" or "microarray". Such gene chips or microarrays can be used for diagnostic and therapeutic purposes by many techniques known to those of skill in the art. In one technique, oligonucleotides are on a gene chip to sequence DNA by a hybridization approach, such as those outlined in US Pat. Nos. 6,205,136 and 6,018,041. Attached and arranged. The polynucleotides of the invention can be modified into probes, which can then be used to detect gene sequences. Such techniques are described, for example, in US Pat. Nos. 5,968,740 and 5,858,659. Kayem et al., U.S. Pat. No. 952,172 and Kelley et al., (1999) Nucleic Acids Res. As described by 27: 4830-4738, the probe can also be attached or attached to the electrode surface for electrochemical detection of nucleic acid sequences.

"Composition" means a combination of an active polypeptide, polynucleotide or antibody with another compound or composition that is inert (eg, detectable label) or active (eg, gene delivery vehicle). Intended.

A "pharmaceutical composition" comprises a combination of an active polynucleotide, polynucleotide or antibody with an inactive or active carrier such as a solid support, making the composition suitable for in vitro, in vivo or ex vivo diagnostic or therapeutic applications. It is intended to be an antibody.

As used herein, the term "pharmaceutically acceptable carrier" refers to phosphate-buffered physiological saline solutions, water, and emulsions such as oil / water or water / oil emulsions, as well as various types of wetting. Includes any of the standard pharmaceutical carriers such as agents. The composition can also include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see Martin (1975) Remington's Pharm. Sci. , 15th Ed. (Mack Publ. Co., Easton).

As used herein, the term "cancer" includes solid tumors and hematological malignancies. Exemplary solid tumors include bladder cancer, bone cancer, brain cancer (eg, glioblastoma), breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, and kidney. Cancer, lung cancer, melanoma, mesotheloma, ovarian cancer, pancreatic cancer, prostate cancer or gastric cancer, but is not limited to these. Exemplary hematological malignancies include acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), follicular lymphoma (FL), and diffuse large B-cell lymphoma (diffuse large B-cell lymphoma). DLBCL), Mantle Cell Lymphoma (MCL), Waldenström Macroglobulinemia, Multiple Myeloma, Extranodal Marginal B Cell Lymphoma, Nodal Marginal B Cell Lymphoma, Barkit Lymphoma, Non-Berkit High-grade B-cell lymphoma, primary medial B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B lymphoblastic lymphoma, preB-cell lymphocytic leukemia, lymphoplasmic cell lymphoma, spleen margin Includes marginal zone lymphoma, plasmacytoid myeloma, plasmacytoma, mediastinal (chest gland) large cell type B cell lymphoma, intravascular large cell type B cell lymphoma, primary exudative lymphoma or lymphoma-like granulomatosis , Not limited to these. In some cases, the cancer is a metastatic cancer (eg, a metastatic solid tumor or a metastatic hematological malignancies). In some cases, the cancer is a relapsed or refractory cancer (eg, a relapsed or refractory solid tumor or a relapsed or refractory hematological malignancies).

In some embodiments, the cancer is a fibroblast-activating protein (FAP) (the amino acid sequence of human FAP is disclosed in GenPept Accession No. I38593 accessed February 10, 2020). It is characterized by upregulated expression. FAP, also known as FAP-alpha and prolyl endopeptidase FAP, is a membrane-bound glycoprotein and is part of the dipeptidyl peptidase (DPP) family. FAP has both postproline exopeptidase activity and gelatinase activity. In some cases, cancers characterized by upregulated expression of FAP (FAP-positive cancers) include bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, gastric cancer, and liver cancer. , But not limited to lung cancer, oral cancer, ovarian cancer, pancreatic cancer, parathyroid cancer and kidney cancer. In some cases, FAP-positive cancers include high levels of fibrosis. In some cases, this level is compared to an equivalent cancer in which FAP is not upregulated. In a further example, this level is compared to the level of fibrosis in a normal subject.

In some cases, the dimarts described herein bind to the extracellular portion of FAP-alpha. In some cases, dimart binds to human FAP-alpha (eg, to the extracellular portion of FAP-alpha having GenPept accession number I38593 or its equivalent). In some cases, dimart binds to FAP-alpha and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart binds to FAP-alpha for the treatment of FAP-positive cancers, optionally pancreatic cancers, and optionally FAP-positive cancers characterized by high levels of fibrosis. , If desired, bind to immune cell targets (eg, cell surface polypeptides expressed on T cells or NK cells).

In some embodiments, the cancer is also known as the B cell maturation antigen (BCMA) (tumor necrosis factor receptor superfamily member 17, TNFRSF17 and BCM), which are cell surface receptors of the TNF receptor superfamily. ) Is characterized by expression and / or upregulation. In some cases, the amino acid sequence of human BCMA is disclosed in GenPept Accession No. BAB6095.1 (accessed February 10, 2020). In some cases, the cancer characterized by expression and / or upregulation of BCMA is myeloma (or multiple myeloma).

In some cases, the dimarts described herein bind to the extracellular portion of BCMA. In some cases, dimart binds to human BCMA (eg, the extracellular portion of BCMA having GenPept accession number BAB6095.1 or its equivalent). In some cases, dimart binds to BCMA and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart binds to BCMA and optionally to immune cell targets (eg, cell surface polypeptides expressed on T cells or NK cells) for the treatment of myeloma.

In some embodiments, the cancer is characterized by the expression or upregulation of an epidermal growth factor receptor (EGFR) variant, such as EGFR variant III (EGFRvIII). EGFRvIII refers to a mutation in EGFR that includes a deletion of exons 2-7 of the EGFR gene. In some cases, cancers characterized by expression or upregulation of EGFRvIII (EGFRvIII positive cancers) include glioblastoma, bladder cancer, breast cancer, colorectal cancer, esophageal cancer, and squamous cell carcinoma of the head and neck. (HNSCC), lung cancer, melanoma, ovarian cancer, peripheral nerve sheath tumor (PNST), prostate cancer, sarcoma and thyroid cancer, but not limited to these.

In some cases, the dimarts described herein bind to the extracellular portion of EGFRvIII. In some cases, dimart binds to the extracellular portion of human EGFRvIII. In some cases, dimart binds to EGFRvIII and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, dimart binds to EGFRvIII for the treatment of EGFRvIII positive cancers, optionally glioblastoma, and is optionally expressed on immune cell targets (eg, T cells or NK cells). It binds to cell surface polypeptides).

In some embodiments, cancer is characterized by upregulation of human epidermal growth factor receptor 2 (HER2), also known as HER2 / neu, receptor tyrosine-protein kinase erbB-2, CD340 and ERBB2. In some cases, the amino acid sequence of human HER2 is disclosed in GenPept Accession No. NP-004439.2 (accessed February 10, 2020). In some cases, HER2-positive cancers include, but are not limited to, breast cancer, ovarian cancer, gastric cancer, colorectal cancer, pancreatic cancer and endometrial cancer.

In some cases, the dimarts described herein bind to the extracellular portion of HER2. In some cases, dimart binds to the extracellular portion of human HER2 (including, for example, the amino acid sequence set forth in GenPept accession number NP-004439.2 or equivalent). In some cases, dimart binds to HER2 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart binds to HER2 for the treatment of HER2-positive cancer, optionally breast cancer, and optionally expresses on immune cell targets (eg, T cells or NK cells). It binds to a polypeptide).

In some embodiments, the cancer is characterized by an upregulation of CD123, also known as the interleukin-3 receptor or IL-3RA. In some cases, the amino acid sequence of human CD123 is disclosed in GenPept Accession No. NP_002174.1 (accessed February 10, 2020). In some cases, CD123-positive cancers include acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), blastic plasmacytoid dendritic cell neoplasm, and hairy cell leukemia. Included, but not limited to.

In some cases, the dimarts described herein bind to the extracellular portion of CD123. In some cases, dimart binds to the extracellular portion of human CD123 (including, for example, the amino acid sequence set forth in GenPept accession number NP-002174.1 or an equivalent thereof). In some cases, dimart binds to CD123 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart binds to CD123 for the treatment of CD123-positive cancers, optionally AML, and optionally cell surfaces expressed on immune cell targets (eg, T cells or NK cells). It binds to a polypeptide).

In some embodiments, the cancer is characterized by an upregulation of CD38, also known as ADP-ribosyl cyclase 1 or ADPRC1. In some cases, the amino acid sequence of human CD38 is disclosed in GenPept Accession No. BAA1896.6.1 (accessed February 10, 2020). In some cases, CD38-positive cancers include, but are not limited to, multiple myeloma, acute myeloid leukemia, prostate cancer and lung cancer.

In some cases, the dimarts described herein bind to the extracellular portion of CD38. In some cases, dimart binds to the extracellular portion of human CD38 (including, for example, the amino acid sequence set forth in GenPept accession number BAA1896.6.1 or equivalent). In some cases, dimart binds to CD38 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart binds to CD38 for the treatment of CD38-positive cancers, optionally AML, and optionally cell surfaces expressed on immune cell targets (eg, T cells or NK cells). It binds to a polypeptide).

In some embodiments, the cancer is characterized by an upregulation of mesothelin (also known as MSLN). In some cases, the amino acid sequence of human mesothelin is disclosed in GenPept Accession No. AAV87530.1 (accessed February 10, 2020). In some cases, mesothelin-positive cancers include mesothelioma, pancreatic cancer, ovarian cancer, endometrial cancer, bile duct cancer, gastric cancer, lung adenocarcinoma and pediatric acute myeloid leukemia. Not limited to.

In some cases, the dimarts described herein bind to the extracellular portion of mesothelin. In some cases, dimart binds to the extracellular portion of human mesothelin (including, for example, the amino acid sequence set forth in GenPept accession number AAV87530.1 or an equivalent thereof). In some cases, it binds to dimart, mesothelin and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, dimart was bound to mesothelin and optionally expressed on immune cell targets (eg, T cells or NK cells) for the treatment of mesothelin-positive cancers, optionally mesothelioma. It binds to cell surface polypeptides).

In some embodiments, the cancer is characterized by an upregulation of interleukin-13 receptor alpha (IL13R alpha). In some cases, IL13R alpha includes IL13R alpha 1 (IL13Rα1) and IL13R alpha 2 (IL13Rα2). In some cases, the amino acid sequence of human IL13Rα1 is disclosed in GenPept Accession No. P7855.21 (accessed February 10, 2020). In some cases, the amino acid sequence of human IL13Rα2 is disclosed in GenPept Accession No. Q1427.1 (accessed February 10, 2020). In some cases, IL13R alpha-positive cancers include, but are not limited to, brain cancers (eg, glioblastoma) and renal cell carcinomas (RCCs).

In some cases, the dimarts described herein bind to the extracellular portion of IL13Ralpha. In some cases, dimart binds to the extracellular portion of human IL13Ralpha (including, for example, the amino acid sequence set forth in GenPept accession number P7855.2, Q14627.1 or equivalent). In some cases, dimart binds to IL13R alpha and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, dimart binds to IL13R alpha for the treatment of IL13R alpha-positive cancers, optionally brain cancers, and is optionally expressed on immune cell targets (eg, T cells or NK cells). It binds to the cell surface polypeptide).

In some embodiments, the cancer is characterized by an upregulation of B7-H3, also known as CD276, which is an immune checkpoint member. In some cases, the amino acid sequence of human B7-H3 is disclosed in GenPept Accession No. CAE47548.1 (accessed February 10, 2020). In some cases, B7-H3-positive cancers include lung cancer (eg, non-small cell lung cancer), breast cancer, prostate cancer, renal cell carcinoma, brain cancer, pancreatic cancer, kidney cancer, gastric cancer, ovarian cancer. , But not limited to melanoma and thyroid cancer.

In some cases, the dimarts described herein bind to the extracellular portion of B7-H3. In some cases, dimart binds to the extracellular portion of human B7-H3 (including, for example, the amino acid sequence set forth in GenPept accession number CAE47548.1. In some cases, dimart binds to B7-H3 and T cell or NK cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart can be B7-H3 positive cancer, optionally lung cancer (eg, non-small cell lung cancer), breast cancer, prostate cancer, renal cell carcinoma, brain cancer, pancreatic cancer, kidney cancer, Cell surface that binds to B7-H3 and is optionally expressed on T cells or NK cell targets (eg, T cells or NK cells) for the treatment of gastric, ovarian, melanoma or thyroid cancer It binds to a polypeptide).

In some embodiments, the cancer is characterized by upregulation of the receptor tyrosine kinase-like orphan receptor 1 (ROR1), also known as neurotrophic tyrosine kinase, receptor-related 1 or NTRKR1. In some cases, the amino acid sequence of human ROR1 is disclosed in GenPept accession number NP_005003 (accessed February 10, 2020). In some cases, ROR1-positive cancers include, but are not limited to, breast cancer, lung cancer, gastric cancer, ovarian cancer, chronic lymphocytic leukemia (CLL) and acute lymphocytic leukemia (ALL).

In some cases, the dimarts described herein bind to the extracellular portion of ROR1. In some cases, dimart binds to the extracellular portion of human ROR1 (including, for example, the amino acid sequence set forth in GenPept accession number NP_005003 or an equivalent thereof). In some cases, dimart binds to ROR1 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart binds to ROR1 for the treatment of ROR1-positive cancers, optionally breast, lung, gastric, gastric, ovarian, CLL or ALL, and optionally immune cell targets (eg, for example). It binds to cell surface polypeptides expressed on T cells or NK cells).

In some embodiments, the cancer is characterized by an upregulation of the Ephrin type A receptor 2 (EphA2), also known as EPH receptor A2, tyrosine-protein kinase receptor ECK or epithelial cell receptor protein tyrosine kinase. do. In some cases, the amino acid sequence of human EphA2 is disclosed in GenPept accession number NP_004422.2 (accessed February 10, 2020). In some cases, EphA2-positive cancers include breast cancer, bladder cancer, prostate cancer, skin cancer, lung cancer, ovarian cancer, brain cancer, mesodemas, thyroid cancer, colorectal cancer, gastric cancer, Includes, but is not limited to, esophageal cancer, endometrial cancer, cervical cancer, pancreatic, melanoma, renal cell carcinoma and liver cancer.

In some cases, the dimarts described herein bind to the extracellular portion of EphA2. In some cases, dimart binds to the extracellular portion of human EphA2 (including, for example, the amino acid sequence set forth in GenPept accession number NP_004422.2 or an equivalent thereof). In some cases, dimart binds to EphA2 and immune cell targets, such as cell surface polypeptides expressed on T cells or NK cells. In some cases, Dimart can be EphA2-positive cancer, breast cancer, bladder cancer, prostate cancer, skin cancer, lung cancer, ovarian cancer, brain cancer, mesodemas, thyroid cancer, colonic rectal cancer as needed. It binds to EphA2 and, if necessary, for the treatment of cancer, gastric cancer, esophageal cancer, endometrial cancer, cervical cancer, pancreatic cancer, melanoma, renal cell cancer or liver cancer. It binds to immune cell targets (eg, cell surface polypeptides expressed on T cells or NK cells).

In some embodiments, the cancer is B-cell leukemia or B-cell lymphoma. Exemplary B-cell leukemias include B-cell chronic lymphocytic leukemia (or B-cell small lymphocytic lymphoma); acute lymphoblastic leukemia, mature B-cell type; pre-B-cell lymphocytic leukemia; precursor B-lymphocytic leukemia. Includes globular leukemia; and hair cell leukemia. In some cases, B-cell leukemia, B-cell lymphoma or combinations thereof are characterized by elevated expression of CD20 and / or CD22 on B cells. In some cases, the dimarts described herein bind to CD20 or CD22. In some cases, dimart binds to CD20 expressed on B cells. In some cases, dimart binds to CD22 expressed on B cells. In some cases, dimart further binds to another cell target, eg, a cell surface polypeptide expressed on a cancer cell or a cell surface polypeptide expressed on a T cell or NK cell. In some cases, Dimart binds to CD20 or CD22 for the treatment of B-cell leukemia or B-cell lymphoma and optionally another cell target (eg, a cell surface polypeptide expressed on cancer cells). Alternatively, it binds to a cell surface polypeptide expressed on T cells or NK cells).

As used herein, "first-line treatment" includes first-line treatment for a subject, optionally with a subject with cancer. In some cases, under cancer conditions, the cancer is a primary cancer. In other cases, the cancer is a metastatic or recurrent cancer. In some cases, first-line treatment includes chemotherapy. In other cases, first-line treatment involves radiation therapy. Those of skill in the art will readily appreciate that different first-line treatments may be applicable to different types of cancer.

As used herein, second-line treatment includes treatments utilized after termination of first-line or first-line treatment. The third-choice treatment, the fourth-choice treatment or the fifth-choice treatment includes subsequent treatments. As indicated by naming convention, third-line treatment includes the course of treatment when first-line and second-line treatment ceases.

The "subject" of diagnosis or treatment is an animal or human, such as a cell or mammal. Subjects are not limited to specific species, including non-human animals to be diagnosed or treated, including those to be infected or animal models such as leporids such as monkeys, rats, mice, chinchillas, dogs. Leporids such as dogs, leporids such as rabbits, domestic animals, sports animals and pets. Human patients are also included in this term.

The term "tissue" is used herein to refer to the tissue of a living or dead organism, or any tissue derived from or designed to mimic a living or dead organism. Used for. Tissues can be healthy, sick, and / or have genetic variation. Biological tissue can include any single tissue (eg, a collection of cells that can be interconnected), or a group of tissues that make up an organ or part or region of the body of an organism. The tissue may contain homogeneous cellular material, or the tissue may be a complex structure as found in an area of the body including the chest, which may include, for example, lung tissue, skeletal tissue and / or muscle tissue. Exemplary tissues include liver, lung, thyroid, skin, pancreas, blood vessels, bladder, kidney, brain, bile duct, duodenum, abdominal aorta, iliac vein, heart and intestine (including any combination thereof). Includes, but is not limited to.

As used herein, the terms "specifically bind to" or "specifically bind to" or "specifically target" are biological molecules of interest (eg, specifically targeted). , A polypeptide, but does not substantially recognize and bind to a sample containing or expressing a tumor antigen, eg, another molecule in a biological sample, or a fragment thereof.

As used herein, "treating" a disease in a subject or "treating" a disease in a subject is (1) in a subject who has a predisposition to the symptoms of the disease or has not yet shown the symptoms of the disease. Preventing the development of a disease or disease, (2) stopping the disease or stopping its development, or (3) alleviating the disease or the symptoms of the disease or causing the symptoms of the disease or disease to recede. show. As understood in the art, "treatment" is an approach for obtaining beneficial or desired outcomes, including clinical outcomes. In the present art, the beneficial or desired consequences include alleviation or alleviation of one or more symptoms, reduction of the degree of condition (including disease), stabilization (ie, exacerbation) of condition (including disease). One or more of a situation, a delay or deceleration of a condition (including disease), a progression, alleviation or remission of a condition (including disease), a situation and remission (partial or complete) It can include, but is not limited to, whether it is detectable or undetectable. In one aspect, the term "treatment" excludes prevention.

As used herein, the term "effective amount" is intended to mean an amount sufficient to achieve the desired effect. In the context of therapeutic or prophylactic application, the effective amount is the type and severity of the condition in question, as well as the characteristics of the individual subject such as general health, age, gender, weight and resistance to the pharmaceutical composition. Depends on. In the context of gene therapy, in some embodiments, the effective amount is sufficient to result in the restoration of partial or complete function of the defective gene in the subject. In other embodiments, the effective amount of recombinant polynucleotide, vector or AAV viral particle is sufficient to result in gene expression in the subject. In some embodiments, the effective amount is the amount required to increase galactose metabolism in a subject in need of increased galactose metabolism. One of ordinary skill in the art can determine the appropriate amount depending on these and other factors.

In some embodiments, the effective amount depends on the size and nature of the application of the problem. The effective amount also depends on the nature and susceptibility of the subject of interest and the method used. One of ordinary skill in the art can determine the effective amount based on these and other considerations. Effective amounts may include administration of one or more of the compositions, depending on the embodiment.

As used herein, the term "administer" or "administer" is intended to mean delivery of a substance to a subject such as an animal or human. Administration can be carried out continuously or intermittently in one dose throughout the course of treatment. The most effective means of administration and methods of determining dosages are known to those of skill in the art and will vary depending on the composition used for treatment, the purpose of treatment and the age, health or gender of the subject being treated. .. Single or multiple doses can be performed and the dose level and pattern is selected by the treating physician or in the case of pets and animals by the treating veterinarian. Suitable dosage formulations and methods for administering the drug are known in the art. The route of administration can also be determined and methods of determining the most effective route of administration are known to those of skill in the art and the composition used for the procedure, the purpose of the procedure, the health status of the subject being treated or It depends on the stage of the disease and the target cells or tissues. Non-limiting examples of routes of administration include intravenous, intraarterial, intramuscular, intracardiac, intrathecal, subventricular, epidural, intrabrain, intraventricular, subretinal, intravitreal, intraarticular, Includes intraocular, intraperitoneal, intrauterine, intradermal, subcutaneous, transdermal, transmucosal and inhalation.

Mode for implementing this disclosure Cancer is the second leading cause of death worldwide, with an estimated 9.6 million deaths in 2018. There are many different types of cancer therapies that are clinically developed and marketed, such as immunotherapy, hormone therapy, targeted drug therapy, adoptive cell therapy and chemotherapy. Although advances have been made in many therapeutic areas, there are still challenges with factors such as half-life and toxicity that affect therapeutic efficacy. For example, treatments based on oncolytic viruses provide targeted delivery of the payload to the tumor microenvironment of interest. However, these oncolytic viruses express their loadings in tumor cells and induce cell-killing effects, thereby limiting the expression of loadings to at most days, often hours. Therefore, multiple doses are required to obtain a sustained and long-term therapeutic effect, which increases toxicity and results in a detrimental immune response. Adoptive cell therapies, such as chimeric antigen receptor (CAR) -T cell therapy, provide individuals with cancer with personalized treatment options. However, some of the most common side effects of CAR-T cell therapy include cytokine release syndrome; neurological events such as encephalopathy, aphasia, seizures and sense of balance; neutropenia; and anemia. .. In addition, the preparation of CAR-T cells involves several weeks of culture and proliferation prior to administration, which time can be crucial, especially for patients in the advanced stages of cancer.

In certain embodiments, a method of delivering a therapeutic transgene (eg, a dimart disclosed herein) using a gene therapy vector is disclosed herein. In some embodiments, the gene therapy vector provides stable and sustained expression of a therapeutic transgene (eg, dimart). In a further embodiment, the gene therapy vector provides constitutive expression. In a further embodiment, the gene therapy vector provides regulated expression. In some cases, the gene therapy vector is transduced into normal cells (eg, into organ cells such as hepatocytes or into muscle cells). In some cases, a single dose of the gene therapy vector is sufficient to induce stable and sustained expression of the therapeutic transgene (eg, dimart). In a further case, the gene therapy vector provides continuous and long-term expression of a therapeutic transgene (eg, dimart) that exerts long-term pressure on cancer cells.

In certain embodiments, a method of using TransJoin to deliver a therapeutic transgene (eg, a dimart disclosed herein) is disclosed herein. In some cases, TransJoin provides constitutive expression of a therapeutic transgene (eg, dimart). In some cases, TransJoin provides sustained, stable, long-term expression of therapeutic transgenes (eg, dimart). In some cases, long-term onset is about 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, 10 months, 1 year or more. Including long. In some cases, TransJoin is transduced into normal cells (eg, into organ cells such as hepatocytes or into muscle cells). In some cases, a single dose of TransJoin is sufficient to induce stable and sustained expression of the therapeutic transgene (eg, dimart). In a further case, TransJoin provides continuous and long-term expression of a therapeutic transgene (eg, dimart) that exerts long-term pressure on cancer cells.

In certain embodiments, regulated expression, such as short-term gene expression (eg, weeks to months, and optionally 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months). A novel method for activating transgene expression (eg, dimart disclosed herein) that can be used as a gene therapy platform for (4 months, 5 months, 6 months, 8 months or longer). Is disclosed herein. In some cases, this method utilizes TransSkip. In one embodiment, transgene expression is placed under the control of a drug or an external agent (eg, OncoSkip) such that administration of the drug or drug modulates (activates or inactivates) gene expression. On the other hand, lack or discontinuation of drug or drug administration returns to the original state of gene expression prior to administration. For example, if a drug or drug can activate gene expression, if side effects are present, or if expression of the introduced gene is no longer required, discontinuation of administration can inactivate gene expression. , Thereby, even if side effects are present, the side effects can be minimized. In some cases, TransSkip is transduced into normal cells (eg, into organ cells such as hepatocytes or into muscle cells). In some cases, a single dose of TransSkip is sufficient to induce stable and sustained expression of the therapeutic transgene (eg, dimart). In a further case, TransSkip provides regulated but continuous expression of a therapeutic transgene (eg, dimart) that exerts long-term pressure on cancer cells.

Exon skipping is a technique used to treat certain hereditary disorders that are defective in short regions of the gene. DNA due to the appearance of false amino acids in the protein, or because DNA mutations generate stop mutations to result in truncated proteins, or because DNA mutations change the reading frame to produce both of these. Mutations result in damaged proteins. Mammalian genes are typically encoded in exons, that is, they are divided into multiple gene segments (exons) that are spliced together during the processing of mRNA, thus underlying many diseases. DNA mutations (base pair changes or deletions) are contained within a single exon. If the exon is skipped and may not be included in the final spliced mRNA, the mutated region will not be included in the final protein. Proteins can be shorter and lack some parts, but proteins are still "in-frame" and can retain some of their function.

For example, Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common pediatric muscular dystrophy, dystrophin, the cytoskeleton and extracellular to maintain the stability of muscle fibers during contraction. It is caused by a genetic defect in the DMD gene that encodes the muscle protein required for interaction with the matrix. DMD mutations in the dystrophin gene are characterized by frameshift insertions or deletions or nonsense point mutations, resulting in a lack of functional dystrophin. BMD mutations generally leave the reading frame intact and allow the synthesis of partially functional dystrophin. Exon skipping-based treatment converted out-of-frame mutations present in DMD patients into in-frame mutations that partially encode functional dystrophins. In 2016, the FDA approved eteprilsen ™ (Sarepta Therapeutics), the first exon skipping drug for Duchenne muscular dystrophy with a mutation in exon 51 of the dystrophin gene. When this drug (which is a modified short sequence of DNA, also called an oligo) is administered, the exon 51 is "skipped" to restore a nearly full-length, more functional protein. Similar techniques have been developed to skip exons in other disease-causing genes as well as other dystrophin exons.

In contrast to exon skipping, the present disclosure utilizes transgene activation in gene therapy applications. Most, if not all, gene therapy approaches currently use complementary (cDNA) sequences of genes. That is, the gene sequence of the transgene is only the coding sequence (exon only) and does not contain any intervening (intron) sequence. Therefore, the gene is not subject to RNA splicing.

The present disclosure and techniques utilize intervening sequences containing splice donor and acceptor sites as well as RNA spliceosome binding sites to allow the transgene to undergo normal exon splicing. Thus, a "reverse-engineered" (artificial) exon-intron-exon gene structure is provided in the transgene, which is spliced when expressed in the target cell. However, splicing is regulated on the principle of exon skipping. In one embodiment, a deliberately inserted exon containing a stop codon at the center of the gene regulates gene expression, i.e., only if the exon is skipped will the normal functional transgene be produced by artificial structure. It is expressed. In one embodiment, the functional transgene encodes an antibody. In another embodiment, the antibody is a bispecific or trispecific antibody (eg, dimart). In another embodiment, the antibody (eg, dimart) is a bispecific T cell engager (BiTE), a bispecific NK cell engager (BiKE), a trispecific T cell engager (TriTE) or a triple. It is a specific NK cell engager (TriKE).

In a further embodiment, the degree and type of splicing is modified by cell type as many genes are usually subject to alternative splicing, which occasionally changes with cell type. In addition, splicing changes occasionally in certain cancer cells (some exons of a particular gene can be ruled out in normal cells as opposed to cancer cells). This technique can leverage these features to achieve different transgene regulation in normal cells as opposed to cancer cells. Also, antibodies encoded by functional transgenes, such as bispecific or trispecific antibodies, can be used to treat cancer. Thus, in one aspect, the modulation of transgene splicing in the present disclosure provides a method of treating cancer.

Embodiments of the Construct In certain embodiments, the polynucleotide or vector is (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding the first polypeptide; (b). ) A second polynucleotide sequence comprising a second portion of the open reading frame encoding the first polypeptide; (c) a third polynucleotide sequence encoding the second polypeptide; (d). ) Containing or consisting essentially of (a)-(d) with a gene-regulated polynucleotide sequence located between the first polynucleotide and the second polynucleotide; The polynucleotide or vector consisting of (d) is provided herein. In some cases, the first polypeptide binds to the surface polypeptide (eg, surface receptor) of the first target cell and the second polypeptide is the surface polypeptide of the second target cell (eg, eg). It binds to surface receptors). In some cases, the first target cell and the second target cell are different. For example, the first target cell can be a tumor cell and the second target cell can be an immune cell. In the second example, the first target cell can be an immune cell and the second target cell can be a tumor cell. In the third example, the first target cell can be the first immune cell, the second target cell can be the second immune cell, and the first immune cell is different from the second immune cell. It is a cell type. In the fourth example, the first target cell is the first cancer cell, the second target cell is the second cancer cell, and the first cancer cell and the second cancer cell are. They are derived from the same type of cancer, eg, associated with the same genetic defect or of the same histological type.

In some embodiments, the first polypeptide is the first antibody or binding fragment thereof and the second polypeptide is the second antibody or binding fragment thereof. In some cases, (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first antibody or an antigen-binding fragment thereof; (b) a first antibody or an antigen-binding fragment thereof. A second polynucleotide sequence comprising a second portion of the encoding open reading frame; (c) a third polynucleotide sequence encoding a second antibody or antigen-binding fragment thereof; (d) first poly. A polynucleotide comprising, or essentially consisting of (a)-(d), or a polynucleotide consisting of (a)-(d), comprising a gene-regulated polynucleotide sequence located between a nucleotide and a second polynucleotide. Vectors are provided herein. Polynucleotide complements are also provided. In one embodiment, the polynucleotide, its complements and / or vectors are detectably labeled. In some cases, the first antibody binds to the first target and the second antibody binds to the second target. In some cases, the first target is a surface polypeptide on the first cell (eg, a surface receptor) and the second target is a surface polypeptide on a second cell (eg, a surface receptor). Is. In some cases, the first target cell and the second target cell are different. For example, the first target cell can be a tumor cell and the second target cell can be an immune cell. In the second example, the first target cell can be an immune cell and the second target cell can be a tumor cell. In the third example, the first target cell can be the first immune cell, the second target cell can be the second immune cell, and the first immune cell is different from the second immune cell. It is a cell type. In the fourth example, the first target cell is the first cancer cell, the second target cell is the second cancer cell, and the first cancer cell and the second cancer cell are. They are derived from the same type of cancer, eg, associated with the same genetic defect or of the same histological type. In some cases, the first target is the first epitope, the second target is the second epitope, and both epitopes are on the same antigen. In some cases, the first and second antibodies have different amino acid sequences. In one embodiment, the polynucleotide is contained within a gene expression vector, and non-limiting examples of such include plasmids, DNA viral vectors or gene delivery vehicles.

In some embodiments, a vector for use in gene therapy, wherein a first polynucleotide sequence encoding a first antibody or an antigen-binding fragment thereof and a second antibody or an antigen-binding fragment thereof are encoded. Vectors comprising a second polynucleotide sequence are also disclosed herein. Polynucleotide complements are also provided. In one embodiment, the polynucleotide, its complements and / or vectors are detectably labeled. In some cases, the first antibody binds to the first target and the second antibody binds to the second target. In some cases, the first target is a surface polypeptide on the first cell (eg, a surface receptor) and the second target is a surface polypeptide on a second cell (eg, a surface receptor). Is. In some cases, the first target cell and the second target cell are different. For example, the first target cell can be a tumor cell and the second target cell can be an immune cell. In the second example, the first target cell can be an immune cell and the second target cell can be a tumor cell. In the third example, the first target cell can be the first immune cell, the second target cell can be the second immune cell, and the first immune cell is different from the second immune cell. It is a cell type. In the fourth example, the first target cell is the first cancer cell, the second target cell is the second cancer cell, and the first cancer cell and the second cancer cell are. They are derived from the same type of cancer, eg, associated with the same genetic defect or have the same histological type. In some cases, the first target is the first epitope, the second target is the second epitope, and both epitopes are on the same antigen. In some cases, the first and second antibodies have different amino acid sequences.

In a further embodiment, the gene regulatory polynucleotide sequence comprises a splice donor site, an upstream intron, an exon containing a stop codon sequence in all three reading frames, a downstream intron, and a splice acceptor site. In a further embodiment, the gene regulatory polynucleotide sequence comprises one or more of the binding sequences to the antisense oligonucleotide. In a further embodiment, the antisense oligonucleotide is morpholino. In a further embodiment, the binding sequence to the morpholino oligonucleotide is at least 95% identical to, or at least 96% or at least 97%, or 98%, the same as, or at least 96%, or at least 97%, or 98% of SEQ ID NO: 24 (AATTGATACCAACAAATAGATAGGTAAATTTG) or SEQ ID NO: 25 (GATCCAACAAATAGAGGTAAATTTTGTTTTA). Or or it contains at least 99% identical polynucleotide sequences. In one embodiment, the morpholino oligonucleotide is at least 95% identical to, or at least 96% or at least 97%, or 98%, with SEQ ID NO: 27 (CAAGATTTACCTCATTTGTTGGATACATT) or SEQ ID NO: 28 (TAAAAAAGATTTACCTCTTTGTTGGATC). Or or it contains at least 99% identical polynucleotide sequences. Splice donor sites and splice acceptor sites are well known in the art. One of skill in the art knows the sequences of splice donor and splice acceptor sites, such as consensus sequences. An exemplary splice site consensus sequence for a U2 intron can include a 5'splice site MAG- GT RAGT, where M is A or C, R is A or G, and the underlined nucleotide is ". "GT" indicates that it is invariant, and a dash "-" indicates a splice site. The 3'splice site for the U2 intron can be CAG-G, underlined nucleotides indicate that " AG " is invariant, and a dash "-" indicates the splice site. Further examples of consensus price site sequences include, but are not limited to:

p53 exon 105'splice site (donor): CAG-gtgagt, in the formula, the dash "-" indicates the splice site;

Brd2 exon 35'ss: AAG-gtgagt, in the formula, the dash "-" indicates the splice site;

BRCA1 exon 225'splice site: CAG-gtagut, in the formula, the dash "-" indicates the splice site;

SMN1 exon 15'ss: CAG-gtgagg, in the formula, the dash "-" indicates the splice site;

BRD2 3'Splice site acceptor intron 1 (lowercase) / exon 2 (uppercase): cccatctttagag-GCTCCC, in the formula, the dash "-" indicates the splice site;

BCL-X 3'Splice Acceptor Intron 2 (lowercase) / Exxon 3 (uppercase): ctctctccctgcag-GATACT, in the formula, the dash "-" indicates the splice site;

Fibronectin 3'Splice Acceptor Intron 28 (lowercase) / Exon 29 (uppercase): ctttttcatacag-GAGGAA, in the formula, the dash "-" indicates the splice site;

Survivin 3'Splice Acceptor Intron 2 (lowercase) / Exxon 3 (uppercase): tctttatttccag GCAAAG, in the formula, the dash "-" indicates the splice site.

In some embodiments, the splice site consensus sequence is // science. umd. edu / labs / mount / RNAinfo / matrix. Obtained from html.

In some embodiments, the stop codon comprises an oligonucleotide in the group TAA, TAG or TGA. In a further embodiment, the stop codon sequence comprises the polynucleotide sequence of TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1) (where x is any nucleotide), or the stop codon sequence is the polynucleotide sequence of TAATTAGTTGATTTAGTAATTGAT (SEQ ID NO: 2). including. In still further embodiments, the gene-regulated polynucleotide is at least 95% identical to SEQ ID NO: 2, or at least 96% or at least 97%, or at least 98%, or at least 99% identical to SEQ ID NO: 2. Contains nucleotide sequences.

In a further embodiment, the first antibody or antigen-binding fragment thereof specifically binds to the activated antigen on immune effector cells, and the second antibody or antigen-binding fragment thereof binds to the tumor antigen. In another embodiment, the first antibody or antigen-binding fragment thereof specifically binds to a tumor antigen, and the second antibody or antigen-binding fragment thereof binds to an activated antigen on immune effector cells. In a further embodiment, the vector also comprises a fourth polynucleotide sequence encoding a third antibody or antigen-binding fragment thereof, wherein the third antibody or antigen-binding fragment thereof is an activated antigen or tumor antigen on immune effector cells. Combine to. In one embodiment, immune effector cells include dendritic cells, natural killer (“NK”) cells, macrophages, T cells, B cells or combinations thereof. Non-limiting examples of immune effector cells include T cells or NK cells.

Non-limiting examples of activating antigens on immune effector cells include CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM or combinations thereof.

Non-limiting examples of target antigens on antigen presenting cells include, but are not limited to, B7-H3 (CD276).

Non-limiting examples of target antigens on B cells include, but are not limited to, CD20 and CD22.

Non-limiting examples of tumor antigens include Efluin type A receptor 2 (EphA2), interleukin (IL) -13ralpha2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor 1, alphafet protein (AFP), cancer fetal antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma-related antigen (MAGE), blood differentiation antigen, surface glycoprotein , Ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epithelial growth factor receptor 2 (HER2), B It contains one or more of Cell Maturation Antigen (BCMA), Fibroblastic Activating Protein (FAP) Alpha or a combination thereof. Further examples are found in the art and are incorporated herein by reference, for example. In another embodiment, the recombinant vector expresses the premRNA encoding the dimart described herein. In some cases, dimarts are bispecific or trispecific antibodies when the premRNA is in contact with the morpholino oligonucleotide. Non-limiting examples of dimarts are from the following group: bispecific T cell engagers (BiTE) or bispecific NK cell engagers (BiKE); trispecific antibodies are trispecific T. Includes Cell Engager (TriTE) or Trispecific NK Cell Engager (TriKE). In one embodiment, the trispecific antibody comprises a first antibody or an antigen-binding fragment thereof and a second antibody or an antigen-binding fragment thereof.

In one embodiment, the dimart (eg, bispecific or trispecific cell engager) has at least 95% sequence identity with SEQ ID NO: 11, optionally at least 96%, at least 97%, with SEQ ID NO: 11. Includes a polypeptide sequence of at least 98% or at least 99% sequence identity. In another embodiment, the polypeptide sequence is CD3; CD2; CD4; CD8; CD19; lymphocyte function-related antigen 1 (LFA1); CD45; interleukin 21 receptor (IL21R); natural killer group 2 member D (NKG2D). ); Natural cytotoxic receptor (NCR) such as NKp44, NKp46 or NKp30; or antigen binding to DNAX accessory molecule-1 (also referred to as DNAM or DNAM-1; CD226 or lymphocyte and T cell activating antigen 1 (PTA1)). Code the fragment. In another embodiment, the polypeptide sequence encodes an antigen binding fragment for CD3, CD19, GD2 or NKG2D. In another embodiment, the polypeptide encodes a first antigen-binding fragment and a second antigen-binding fragment. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to CD19. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to GD2. In another embodiment, the first antigen-binding fragment binds to NKG2D and the second antigen-binding fragment binds to GD2.

In one embodiment, the trispecific engager or antibody comprises a first antigen binding fragment, a second antigen binding fragment and a third antigen binding fragment. In another embodiment, the trispecific engager or antibody individually comprises three antigen binding fragments that bind to NKG2D, IL21R and GD2. In a further embodiment, the trispecific engager or antibody has at least 95% sequence identity with SEQ ID NO: 11, or at least 96%, or at least 97%, or 98%, or at least with SEQ ID NO: 11. Contains 99% sequence-identical polypeptide sequences.

In one embodiment, the antigen binding fragment that binds IL-21R is IL-21. The amino acid and cDNA sequences of IL-12 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. In one embodiment, the antigen-binding fragment that binds to NKG2D is MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, Rae-1α, Rae-1β, Rae-1γ, Rae-1δ, Rae-1ε, Includes H60a, H60b, H60c, MULT1 or fragments thereof. In one embodiment, the antigen-binding fragment that binds to NKG2D is MICA (SEQ ID NO: 5) or a fragment thereof or an equivalent thereof.

The MICA sequence, in one embodiment, comprises a wide-type variant. In one embodiment, the MICA variant is a sequence variant of wild-type MICA (eg, the wild-type MICA sequence set forth in SEQ ID NO: 5). In another embodiment, the MICA variant is a sequence variant of MUC-30 (SEQ ID NO: 7), which comprises a methionine variant instead of alanine at position 129 of the wide MICA sequence (MICA-129Met). An equivalent of the MICA variant (MICA-129Met) carries the methionine mutation at position 129 of wild-type MICA. In another embodiment, the antigen-binding fragment of a bispecific or trispecific engager or antibody is separated by a linker sequence. One embodiment of the linker sequence comprises or comprises GGGGGSGGGGGSGGGGS (SEQ ID NO: 9) or an equivalent thereof, or consists essentially of SEQ ID NO: 9 or an equivalent thereof, or comprises SEQ ID NO: 9 or an equivalent thereof. The linker sequence is encoded by the polynucleotide sequence of GGCGGGCGCGCGCGCAGGCGCGCGCGCGCGCAGGCGCGCGCGCGCGCAGC (SEQ ID NO: 10) or an equivalent thereof. In one embodiment, the two antigen-binding fragments separated by the linker sequence are IL21 and MICA (eg, wild-type MICA or MICA variants such as MUC-30 or MICA-129Met), fragments thereof, or fragments thereof. Each is an equivalent. In one embodiment, the two antigen-binding fragments separated by the linker sequence are GD2 and MICA (eg, wild-type MICA or MICA variants such as MUC-30 or MICA-129Met), or fragments thereof, or fragments thereof. Each is an equivalent. In one embodiment, the two antigen-binding fragments separated by the linker sequence are IL21 and GD2, or fragments thereof or their respective equivalents. In another embodiment, the linker is inserted between the antigen binding fragments of any of the following trispecific engagers:
IL21-MICA129-GD2
MICA129-IL21-GD2
GD2-IL21-MICA129
GD2-MICA129-IL21
IL21-MICA / V129M-GD2-HDD
MICA / V12M-IL21-GD2-HDD
GD2-IL21-MICA129-HDD
GD2-MICA129-IL21-HDD

In another embodiment, the dimart (eg, bispecific or trispecific engager) comprises a secretory consensus sequence (also referred to herein as sec0A). In some cases, the secretory consensus sequence (sec0A) comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to MWWRLLWWLLLLLLLWPMVWA (SEQ ID NO: 51), or It consists of SEQ ID NO: 51. In some cases, sec0A is encoded by a polynucleotide comprising ATGTGGTGGAGACTGTGGTGCGCTGCTGCTGCTGCTGCTGCTGCTGGCCCATGGTGTGGGCC (SEQ ID NO: 52) or an equivalent thereof.

In some cases, the secretory consensus sequence further comprises 1, 2, 3, 4 or more residues at the C-terminus of the sequence. In some cases, residues 1, 2, 3, 4 or more are residues having an aliphatic side chain (eg, Ala, Met, Ile, Val or Leu). In some cases, 1, 2, 3, 4 or more residues are Ala residues, Gly residues, Val residues, Ile residues or combinations thereof. In some cases, 1, 2, 3, 4 or more residues are Ala residues, Gly residues, Val residues or combinations thereof. In some cases, 1, 2, 3, 4 or more residues are Ala residues, Gly residues or combinations thereof. In some cases, the secretory consensus sequence further comprises 1, 2, 3, 4 or more Ala residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises 1, 2, 3, 4 or more Gly residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises 1, 2, 3, 4 or more Val residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises 1, 2, 3, 4 or more Ile residues at the C-terminus of the sequence.

In some cases, the secretory consensus sequence further comprises one, two or three residues having an aliphatic side chain (eg, Ala, Met, Ile, Val or Leu). In some cases, 1, 2 or 3 residues are Ala residues, Gly residues, Val residues, Ile residues or combinations thereof. In some cases, 1, 2 or 3 residues are Ala residues, Gly residues, Val residues or combinations thereof. In some cases, one, two or three residues are Ala residues, Gly residues or a combination thereof. In some cases, the secretory consensus sequence further comprises one, two or three Ala residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one, two or three Gly residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one, two or three Val residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one, two or three Ile residues at the C-terminus of the sequence.

In some cases, the secretory consensus sequence further comprises one or two residues having an aliphatic side chain (eg, Ala, Met, Ile, Val or Leu). In some cases, one or two residues may be an Ala residue, a Gly residue, a Val residue, an Ile residue or a combination thereof. In some cases, one or two residues are Ala residues, Gly residues, Val residues or a combination thereof. In some cases, one or two residues are Ala residues, Gly residues or a combination thereof. In some cases, the secretory consensus sequence further comprises one or two Ala residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one or two Gly residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one or two Val residues at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one or two Ile residues at the C-terminus of the sequence.

In some cases, the secretory consensus sequence further comprises one residue with an aliphatic side chain (eg, Ala, Met, Ile, Val or Leu). In some cases, one residue is Ala, Gly, Val or Ile. In some cases, the secretory consensus sequence further comprises one Ala at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one Gly at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one Val at the C-terminus of the sequence. In some cases, the secretory consensus sequence further comprises one Ile at the C-terminus of the sequence.

In some cases, secretory consensus sequences further contain one or two Ala residues at the C-terminus of the consensus sequence, such sequences having secrecon 1A (or sec1A) with one Ala at the C-terminus. ) And the secretory 2A (or sec2A) having two Ala residues at the C-terminus. In some cases, sec1A comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to MWWRLWWLLLLLLLWPMBWAA (SEQ ID NO: 53). In some cases, sec1A is encoded by a polynucleotide comprising ATGTGGTGGAGACTGTGGTGTGCGCTGCTGCTGCTGCTGCTGCTGGCGCCCATGGGTGTGGCGCCGCC (SEQ ID NO: 54) or an equivalent thereof. In some cases, sec2A comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to MWWRLWWLLLLLLLWPMAAA (SEQ ID NO: 55). In some cases, sec2A is encoded by a polynucleotide comprising ATGTGGTGGAGACTGTGGTGCGCTGCTGCTGCTGCTGCTGCTGCTGGCCCATGGGTGTGGCGCCGCCGCC (SEQ ID NO: 56) or an equivalent thereof.

In some embodiments, the secretory consensus sequence modulates the expression and / or secretion of dimart. In some cases, secretory consensus sequences (eg, sec1A or sec2A) enhance dimart expression and / or secretion. In some cases, secretory consensus sequences (eg, sec1A or sec2A) increase the expression of dimart approximately 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold. Modulate (eg, enhance) 20-fold, 50-fold or more. In some cases, the secretory consensus sequence (eg, sec1A or sec2A) increases the secretion of dimart by about 1x, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x. Modulate (eg, enhance) 20-fold, 50-fold or more.

In some embodiments, the dimarts (eg, trispecific engagers) described herein are secretory consensus sequences (eg, sec0A, sec1A or sec2A), IL21 sequences (eg, SEQ ID NO: 3), and the like. Includes MICA sequences (eg, wild-type sequences, MUC-30 or MICA-129Met), anti-GD2 peptide sequences or one or more equivalents thereof. In some cases, the dimart (eg, trispecific engager) comprises a secreton 1A sequence, an IL21 sequence, a MICA129 sequence, an anti-GD2 peptide sequence or one or more equivalents thereof. In one embodiment, the dimart (eg, trispecific engager) comprises Secrecon 1A-linker-IL21-linker-MICA129-linker-anti-GD2 peptide or one or more equivalents thereof. In one embodiment, the dimart (eg, trispecific engager) comprises the polypeptide sequence of SEQ ID NO: 11.

またはその同等物。 SEQ ID NO: 11

Or its equivalent.

またはその同等物。 In one embodiment, the dimart (eg, trispecific engager) is encoded by the sequence of SEQ ID NO: 12.
SEQ ID NO: 12

Or its equivalent.

またはその同等物。 In one embodiment, the dimart (eg, bispecific engager) comprises a secrecon 1A sequence (sec1A), a CD3 sequence and an anti-GD2 peptide sequence or one or more equivalents thereof. In one embodiment, the bispecific engager comprises the polypeptide sequence of SEQ ID NO: 13 arranged as sec1A-anti-CD3-linker-anti-GD2-HDD. The sec1A portion is underlined. The anti-CD3 part is in bold. The anti-GD2 portion is underlined and shown in italics. The gray shaded area indicates the HDD portion, which includes the bold HDD peptide, the lowercase hinge region upstream of the HDD peptide, and the lowercase spacer region downstream of the HDD peptide.
SEQ ID NO: 13

Or its equivalent.

またはその同等物。 In another embodiment, the dimart (eg, bispecific engager) comprises a sec1A sequence, an anti-CD3 sequence and an anti-GD2 peptide sequence, or an equivalent of one or more of these, in one embodiment, SEQ ID NO: 14. Encoded by an array of.
SEQ ID NO: 14

Or its equivalent.

またはその同等物。 In another embodiment, the dimart (eg, bispecific engager) comprises a secrecon 1A sequence, an anti-CD19 sequence and an anti-CD3 sequence arranged as sec1A-anti-CD19-linker-anti-CD3. The bispecific engager comprises the polypeptide sequence of SEQ ID NO: 15. The sec1A portion is underlined.
SEQ ID NO: 15

Or its equivalent.

またはその同等物。 In another embodiment, the dimart (eg, bispecific engager) is sequenced as sec1A-anti-CD19-linker-anti-CD3, secreton 1A sequence, anti-CD19 sequence and anti-CD3 sequence, or one or one of these. Includes equivalents beyond that. In one embodiment, it is encoded by the polynucleotide sequence of SEQ ID NO: 16.
SEQ ID NO: 16

Or its equivalent.

またはその同等物。 In some embodiments, the dimart comprises a secretory signal called secretory AA (sec2A). In some cases, the dimart comprises an amino acid sequence derived from blinatumomab (targeting CD3 and CD19) and a tandemly linked secreton AA. In some cases, Secrecon AA-blinatumomab (or sec2A-CD19xCD3) comprises the polypeptide sequence of SEQ ID NO: 29 with the Secrecon AA moiety underlined.
SEQ ID NO: 29

Or its equivalent.

またはその同等物。 In some embodiments, the dimart comprising sec2A-CD19xCD3 is encoded by the polynucleotide sequence of SEQ ID NO: 30.
SEQ ID NO: 30

Or its equivalent.

またはその同等物。 In some embodiments, the dimart comprises a secreton A (sec1A) sequence, CD19 and CD3, or one or more equivalents thereof located on sec1A-CD19xCD3. In one embodiment, it is encoded by the polynucleotide sequence of SEQ ID NO: 31.
SEQ ID NO: 31

Or its equivalent.

またはその同等物。 In some embodiments, the dimart comprises the secreton (sec0A) sequence, CD19 and CD3, or one or more equivalents thereof, and in one embodiment is arranged as sec0A-CD19xCD3, the polynucleotide of SEQ ID NO: 32. Encoded by an array.
SEQ ID NO: 32

Or its equivalent.

またはその同等物。 In some embodiments, the dimart comprises a CD19 and CD3 sequence without a secreton sequence, or an equivalent of one or both of them, arranged as CD19xCD3, in one embodiment by the polynucleotide sequence of SEQ ID NO: 33. Coded.
SEQ ID NO: 33

Or its equivalent.

In one embodiment, the bispecific T cell engager is at least 95% identical or at least 96%, or at least 97%, or 98%, or at least one of SEQ ID NOs: 12 and 13. Contains 99% identity polypeptide sequence. In one embodiment, the trispecific antibody comprises a first antibody or an antigen-binding fragment thereof, a second antibody or an antigen-binding fragment thereof, and a third antibody or an antigen-binding fragment thereof. In a further embodiment, the trispecific antibody has at least 95% sequence identity with SEQ ID NO: 11 or at least 96%, or at least 97%, or 98%, or at least 99% with SEQ ID NO: 11. Contains sequence-identical polypeptide sequences.

In a further embodiment, the recombinant polynucleotide expresses this pre-mRNA when the pre-mRNA encoding the trispecific antibody is in contact with the morpholino oligonucleotide.

In one embodiment, the antigen binding domain is a single-stranded variable fragment of an antibody.

In a further embodiment, the recombinant polynucleotide or vector further comprises a polynucleotide sequence encoding a secreted peptide. In another embodiment, the vector further comprises a polynucleotide sequence encoding a dimerization domain. In another embodiment, the vector comprises a 5'end inverted sequence (ITR) and a 3'ITR. In another embodiment, the vector is a sequence of SEQ ID NOs: 4, 6, 8, 12, 15, 16, 30-33 or an equivalent thereof, or a polynucleotide, or at least 95%, or at least 96%, or. Alternatively, it comprises at least 97%, or / or 98%, or at least 99% identity. Non-limiting examples of vectors include retrovirus vectors, lentivirus vectors, mouse leukemia virus (“MLV”) vectors, Epstein-Barvirus (“EBV”) vectors, adenovirus vectors, herpesviruses (“HSV”). Included are recombinant viral vectors, including vectors, adeno-associated virus (“AAV”) vectors, AAV vectors, or optionally skeletal vectors selected from the group of self-complementary AAV vectors. These are labeled detectably as needed. Detectably labeled polynucleotide complements are also provided, if desired.

The recombinant polynucleotide vector can be contained within a host cell, such as a prokaryotic cell or eukaryotic cell. Cells are used to recombinantly express or replicate polynucleotides by culturing cells containing polynucleotides under conditions that allow polynucleotide replication and, optionally, polynucleotide expression. be able to. Polynucleotides and / or expression products are isolated from cell cultures as needed.

The present invention also provides a virus packaging system including the above-mentioned vector whose skeleton is derived from a pramid or virus, a packaging plasmid, and an envelope plasmid. The packaging plasmid contains nucleosides, capsids and matrix proteins. Examples of packaging plasmids are also described in patent documents such as US Pat. Nos. 7,262,049; 6,995,258; 7,252,991 and 5,710,037. Has been done. This system also contains a plasmid that encodes the enveloped protein provided by the enveloped plasmid.

The present disclosure also provides suitable packaging cell lines. In one embodiment, the packaging cell line is a HEK-293 cell line. Other suitable cell lines are known in the art and are described, for example, in US Pat. Nos. 7,070,994; 6,995,919; 6,475,786; 6,372. , 502; described in the patent documents in the same Nos. 6,365,150 and 5,591,624.

The invention further comprises or essentially transduces the packaging cell line in a viral system as described above under conditions suitable for packaging the viral vector. , Or even transduction, provides a method of making AAV particles. Such conditions are well known in the art and are briefly described herein. Viral particles can be isolated from cell supernatants using methods known to those of skill in the art, such as centrifugation. Such isolated particles are further provided by the present invention.

The invention further provides isolated AAV viral particles produced by this method. Viral particles contain or consist essentially of the polynucleotides described herein, or consist of the polynucleotides described herein.

Host Cell Isolated, comprising, or essentially consisting of, isolated polynucleotides, viral particles, vectors and packaging systems described above and incorporated herein by reference. Further provided cells or populations of cells. In one embodiment, the isolated cell is a packaging cell line.

An isolated cell or population of cells comprising or consisting essentially of the polynucleotide sequence described herein, or consisting of the polynucleotide sequence described herein. Is also provided.

The isolated cells described herein are those of species of the group of mice, rats, rabbits, monkeys, cows, sheep, pigs, dogs, cats, farm animals, sports animals, pets, horses and primates. Either can be, in particular a human cell.

Vectors and cells can be contained within compositions containing vectors and / or host cells and carriers, such as pharmaceutically acceptable carriers. The vector and cell may be formulated for a variety of modes of administration and may contain an effective amount of vector and / or host cell that is effective for the patient, disorder or disease, vector and mode of administration. In one embodiment, the mode of administration is systemic or intravenous. In another embodiment, the administration is a topical administration by direct injection. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector. Alternatively, the morpholino oligonucleotide is contacted prior to the vector.

Methods of Use Polynucleotides and vectors are useful for treating a variety of diseases or disorders. In one aspect, a method of delivering a transgene is provided. The method comprises administering to the cell, tissue or patient to be treated an effective amount of a polynucleotide or vector containing the transgene. In one embodiment, the cell, tissue or patient to be treated is administered an effective amount of an antisense oligonucleotide (eg, a morpholino oligonucleotide). Non-limiting examples of transgenes are provided and selected based on the objectives of the method. The cell or tissue can be that of a mammal, such as a human. In one embodiment, the antisense oligonucleotide (eg, a morpholino oligonucleotide) is contacted simultaneously with or following the vector. Alternatively, the contact of the morpholino oligonucleotide is before the vector. In another embodiment, the vector is introduced into cells by transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof.

Methods for treating cancer in subjects in need of cancer treatment are also provided herein. The method comprises or consists of administering to the subject an effective amount of the recombinant viral vector or cell described herein, essentially from, or being administered. In a further embodiment, the method further comprises administering to the subject an effective amount of an antisense oligonucleotide (eg, a morpholino oligonucleotide). In one embodiment, an effective amount of anti-cancer agent is administered to the subject. Non-limiting examples of anti-cancer agents include anti-cancer peptides, polypeptides, nucleic acid molecules, small molecules, viral particles or combinations thereof. In another embodiment, the vector is introduced into cells by transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof. Treatment may be given as first-line treatment, second-line treatment, third-line treatment, fourth-line treatment or fifth-line treatment. Treatment may be adjuvant therapy or may be combined with other cancer therapies.

In one aspect of the disclosed method, the virus particles are oncolytic HSV particles.

Administration Administration of recombinant polynucleotides and / or vectors (eg, AAV), viral particles or compositions of the present disclosure can be carried out continuously or intermittently in one dose throughout the duration of treatment. Administration is intravenous, intraarterial, intramuscular, intracardiac, intrathecal, subventricular, epidural, intracerebral, intraventricular, subretinal, intravitreal, intra-articular, intraocular, intraperitoneal, intrauterine. Can be done through any suitable mode of administration, including but not limited to intradermal, subcutaneous, transdermal, transmucosal and inhalation. In some cases, the mode of administration includes parenteral administration. In one embodiment, the recombinant polynucleotide or vector or composition is administered by intramuscular or intravenous injection. In another embodiment, the recombinant polynucleotide or vector or composition is administered systemically. In another embodiment, the recombinant polynucleotide or vector or composition is parenterally administered by injection, infusion or transplantation.

The most effective means of administration and methods of determining dosages are known to those of skill in the art and will vary depending on the composition used for treatment, the purpose of treatment and the subject being treated. Single or multiple doses may be performed at the dose level and pattern selected by the treating physician. Note that the dose can be influenced by the route of administration. Suitable dosage formulations and methods of administering the drug are known in the art. Non-limiting examples of such suitable doses can be from a minimum of 1E + 9 vector genome to a maximum of 1E + 17 vector genome per dose.

In some embodiments of the methods described herein, the number of viral particles (eg, AAV) administered to a subject ranges from about ¹⁰⁹ to about ¹⁰¹⁷ . In a particular embodiment, about 10 ¹⁰ to about 10 ¹⁶ pieces, about 10 ¹⁰ to about 10 ¹⁵ pieces, about 10 ¹⁰ to about 10 ¹² pieces, about 10 ¹¹ to about 10 ¹³ pieces, about 10 ¹¹ to about 10 ¹² pieces. , About 10 ¹¹ to about 10 ¹⁴ pieces, about 10 ¹¹ to about 10 ¹⁵ pieces, about 10 ¹¹ to about 10 ¹⁶ pieces, about 5 x 10 ¹¹ to about 5 x 10 ¹² pieces or about 10 ¹² to about 10 ¹³ pieces Viral particles are administered to the subject. In some cases, about 10 ¹¹ to about 10 ¹² virus particles are administered to the subject. In some cases, about 10 ¹³ to about 10 ¹⁵ virus particles are administered to the subject. ^In some cases, about 109 to about ¹⁰¹² virus particles are administered to the subject. ^In some cases, about 109 to about ¹⁰¹¹ virus particles are administered to the subject. In some cases, the amount of viral particles administered is based on the body weight of the subject. Those skilled in the art will deliver a total of about 10 ⁹ to about 10 ¹⁷ virus particles, optionally about 10 ¹⁰ to about 10 ¹⁶ pieces, about 10 ¹⁰ to about 10 ¹⁵ pieces, about 10 ¹⁰ to. About 10 ¹² pieces, about 10 ¹¹ to about 10 ¹³ pieces, about 10 ¹¹ to about 10 ¹² pieces, about 10 ¹¹ to about 10 ¹⁴ pieces, about 10 ¹¹ to about 10 ¹⁵ pieces, about 10 ¹¹ to about 10 ¹⁶ pieces, Understand how to modulate the amount of virus particles delivered to be in the range of about 5 × 10 ¹¹ to about 5 × 10 ¹² or about 10 ¹² to about 10 ¹³ virus particles. In some cases, the subject is a pediatric subject (eg, a subject under the age of 18). In some cases, about 10 ⁹ to about 10 ¹² , about 10 ¹⁰ to about 10 ¹² , about 10 ¹¹ to about 10 ¹² or about 10 ⁹ to about 10 ¹⁰ virus particles are administered to a pediatric subject.

In a further embodiment, the viral particles and compositions of the present disclosure can be administered in combination with other treatments, eg, approved treatments suitable for cancer and its associated disorders or conditions.

Successful treatment and / or repair is determined when one or more of the following are detected: Alleviation or amelioration of one or more of the symptoms of the treated subject's disease, disorder or symptom: , Decreased degree of disease, disorder or symptom of subject, stable (ie, not exacerbated) condition of disease, disorder or symptom, delay or slowing of progression of disease, disorder or symptom and disease, disorder or symptom Improvement or mitigation. In some embodiments, the success of the procedure is determined by detecting the presence of the repaired target polynucleotide in one or more cells, tissues or organs isolated from the subject. In some embodiments, successful treatment is determined by detecting the presence of a polypeptide encoded by the repaired target polynucleotide in one or more cells, tissues or organs isolated from the subject. Will be done.

Kits The agents, vectors or compositions described herein are, in some embodiments, pharmaceutical or diagnostic or research to facilitate their use in therapeutic, diagnostic or research applications. Can be assembled into a kit. In some embodiments, the kits of the present disclosure are described herein, modified viral capsid proteins, isolated polynucleotides, vectors, host cells, recombinant viral particles, recombinant expression systems. Includes one or more of modified AAV, modified cells, isolated tissues, compositions or pharmaceutical compositions.

In some embodiments, the kit further includes instructions for use. Specifically, such a kit may include one or more of the agents described herein, along with instructions explaining the intended use and proper use of these agents. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit and / or for isolating and mixing a sample and applying it to a subject. In certain embodiments, the agents in the kit are pharmaceutical formulations and dosages suitable for a particular application and method of administration of the agent. The kit for research purposes may contain the ingredients in appropriate concentrations or amounts to carry out various experiments.

The kit can be designed to facilitate the use of the methods described herein and can take many forms. Each composition of the kit may be provided in liquid form (eg, in solution) or solid form (eg, dry powder), if applicable. In certain cases, some of the compositions may or may not be provided, for example, by the addition of a suitable solvent or other species (eg, water or cell culture medium) that may or may not be provided (eg, water or cell culture medium). Can be configurable or otherwise processable. In some embodiments, the composition may be provided in a storage solution (eg, a cryopreservation solution). Non-limiting examples of storage solutions include DMSO, paraformaldehyde and CryoStor® (Stem Cell Technologies, Vancouver, Canada). In some embodiments, the conservative solution contains a certain amount of metalloprotease inhibitor.

As used herein, the "instruction manual" can specify elements of instruction and / or encouragement, typically on the package of the claimed method, recombinant vector or composition. Or include written instructions that accompany the packaging. The instructions include any verbal or electronic instructions provided in any form that allows the user to clearly recognize that the instructions should be associated with the kit, eg, audiovisual (eg, audiovisual). Videotapes, DVDs, etc.), Internet and / or web-based communication means, etc. may also be included. In some embodiments, the written instructions are in the form prescribed by a government agency that regulates the manufacture, use or sale of pharmaceuticals or biological products, the instructions being manufactured, used for animal administration. Alternatively, approval by the selling agency can be reflected.

In some embodiments, the kit contains any one or more of the components described herein in one or more containers. Thus, in some embodiments, the kit may include a container containing the agents described herein. The agent can be in the form of a liquid, gel or solid (powder). The drug may be aseptically prepared, packaged in a syringe, refrigerated and shipped. Alternatively, it may be contained in a vial or other container for storage. The second container may contain other aseptically prepared agents. Alternatively, the kit may include an activator premixed and shipped in a syringe, vial, tube or other container. The kit may have one or more or all of the components required to administer the drug to the subject, such as a syringe, topical application device or IV needle tube and bag.

The treatments described herein can be combined with appropriate diagnostic techniques to identify and select patients for that treatment.

Methods of Production In a further method provided by the present disclosure, bispecific or trispecific antibodies in cells comprising contacting cells containing the vectors described herein with an effective amount of morpholino oligonucleotides. Is a method of producing. In one embodiment, the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 27 (CAAGATTTACCTCATTTGTTGGACATCATT) or SEQ ID NO: 28 (TAAAAAAGATTTACCTCTTTGTTGGATC) or their respective equivalents. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or following the vector. Alternatively, the contact of the morpholino oligonucleotide is before the vector. Non-limiting examples of bispecific antibodies are at least 95% identical to any one of SEQ ID NOs: 13 and 15, or at least 96% or at least 97% to any one of SEQ ID NOs: 13 and 15. Or it comprises a polypeptide sequence of at least 98%, or at least 99% sequence identity. In another embodiment, the trispecific antibody is at least 95% identical to SEQ ID NO: 11 or at least 96%, or at least 97%, or at least 98%, or at least 99% sequence identity to SEQ ID NO: 11. Includes polypeptide sequence.

In another embodiment, the vector is introduced into cells by transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof. Non-limiting examples of cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melaninogenic cells, blood cells or combinations thereof.

In addition, kits containing one or more of the vectors, cells or compositions described herein are provided, optionally with instructions or materials.

Specific Embodiments There are several ways to modulate gene expression through the principle of exon skipping.

In one aspect, at least three exons are required to be able to skip exons in this strategy. In the three exon structure, there are two splice donors and two splice acceptor sites, as shown in FIG. The first donor site is spliced to the first acceptor site (“a” in FIG. 1) or to the second acceptor site (“c” in FIG. 1). The second donor site can only be spliced to the second acceptor site (“b” in FIG. 1). Thus, depending on whether splicing does not occur, only one splice event occurs (a, b or c), or two splices occur (a + b), it can result from such a 3-exon / 2 intron structure. There are five possible RNA structures.

Sequence-specific oligonucleotides (“oligos”) that specifically interfere with each of the splicing events, typically at the site of the splice donor or acceptor site or at the binding site for one of the spliceosome components (sometimes in the center of the intron). Is constructed. In this embodiment, as shown in FIG. 1, each oligo is 1-donor (1D), 2-acceptor (1A), 2-donor (2D) or based on whether it interferes with the donor or acceptor. Classified as 3-acceptor (3D).

For example, due to alternative splicing or interference by oligos, the gene exon 2 is skipped in cancer cells but remains in normal cells. In this embodiment, the skipped exon-containing normal gene is not expressed in cancer cells, but expresses the protein in normal cells. The sequence of introns flanking exon 2 in this construct can be used to reproduce the same splicing pattern in the transgene. As a result, constructs containing transgenes in typical intron-exon-intron structures spliced in both normal and tumor cells maintain relatively efficient splicing and are fully spliced at high levels. Brings a transcript (using exons 1 + 2 + 3, splices a + b). Further, if the oligo blocks splicing of intron a and / or intron b, exon 2 is skipped, producing a transcript that fuses exon 1 to exon 3. Therefore, the relative expected abundance of the "theoretically possible" transcripts shown in FIG. 1 has been modified in FIG. 2 to indicate transcripts that may be abundant. ..

In one embodiment, based on the splicing concept described above, oligonucleotides and "exon skipping" techniques transfer the introduced gene from a transcript containing exon 1, exon 2 and exon 6 to a transcript containing exon 1 and exon 3. Used to switch to things. Thus, the construct or vector creates a functional polypeptide encoded by a transcript having exon 1 fused to exon 3. In one embodiment, the stop codon is functionally linked to the exon 2 so that transcription is stopped at the stop codon prior to translation of the exon 3 without interference by the oligonucleotide to skin the exon 2. It is operated to be done. The immature stop codon results in a non-functional transcript containing exon 1, exon 2 and exon 3. In one embodiment, stop codons are placed in all three reading frames to ensure complete arrest. The ribosome ceases to translate the transcript after the stop codon, which contains exons 3, so in which case, as illustrated in FIG. 3, the base of the non-functional transcript (exons 1 + 2 + 3). The line switches to a functional transcript (exon 1 + 2).

In that case, the construction of such a transgene is fairly straightforward, but the intron-exon STOP-intron structure that is properly "spliced in" under normal circumstances is selected. Intron-Exon STOP-Intron can be engineered using sequences flanking a successfully spliced exon and cloned to a specific site in a transgene that results in a splice donor and acceptor consensus sequence in the flanking base. .. Exons should be carefully selected, as exons in the normal gene from which the sequence was extracted are also skipped. For example, an intron-exon-intron can be derived from a spliced DNA viral gene, in which case normal cellular genes are expected to be unaffected. Alternatively, if the gene therapy application is for cancer, it may be considered to utilize the intron-exon-intron boundary from the oncogene that can result in an incomplete oncogene. Such strategies utilize off-target skipping of cellular genes, potentially as a "bonus" therapeutic effect.

Some exons are differentially regulated in cancer cells compared to normal cells. For example, splice type 2 exons are "spliced in" in normal cells, but are excluded from the same gene in certain cancer cells. In that case, when the intron-exon-intron boundary of splice type 2 exons is used in the construction (see Figure 4), the baseline and skipped expression of the transgene is normal cells as shown in Figure 5. And cancer cells. Since the engineered exon STOP is normally not present in cancer cells, the transgene is activated in cancer cells but not in normal cells (FIG. 5). Such exons can be used to selectively express the transgene in cancer cells and prevent it from being expressed in normal cells even in the absence of any exon skipping. Such scenarios can be desirable, for example, for toxin genes or prodrug enzymes. Skipping exons 2 using oligos activates the transgene in normal cells and increases expression in cancer cells when baseline skipping in cancer cells is less than 100%. obtain.

Conversely, splice type 3 exons are eliminated in normal cells but are "spliced in" in certain cancer cells. Therefore, utilizing such exon-controlled splicing results in the opposite of splice type 2, as shown in FIG.

In summary, strategies for achieving the following with respect to controlling transgene expression in gene therapy are disclosed.

Strategy # 1: Activation of transgene expression depends on administration of exon skipping oligonucleotides. This effect is seen in both normal and cancer cells.

Strategy # 2: In the absence of a drug or an externally added drug, activation of transgene expression is usually high in certain cancer cells (only in certain cancers) and low in normal cells. .. This application can be used for cancer selective expression for cancers with appropriately regulated splicing. Administration of exon skipping oligonucleotides activates expression in normal cells in addition to certain cancer cells.

Strategy # 3: Activation of transgene expression is high in normal cells but low in certain cancer cells. Administration of exon skipping oligonucleotides activates their expression in cancer cells.

While the principle of controllable gene expression can be applied to any gene therapy application, gene therapy for cancer treatment is a specific application. In this embodiment, the therapeutic agent expressed in normal cells and secreted from normal cells can be activated when needed via administration of the appropriate exon skipping oligonucleotide.

For these purposes, Applicants have introns from exon 1 of the KRAS gene as an example of a construct of strategy # 1 for insertion into a transgene of interest to achieve controllable gene expression. -Exxon STOP-Designed an intron cassette. Oligos that induce exon skipping are selected for therapeutic use.

In one aspect, the applicant utilizes the structure of the KRAS gene, which is one of the most commonly mutated genes in cancer. KRAS was not an enzyme and could not be targeted by drugs because it clearly has no drug binding pockets on its surface. Therefore, to the best of our knowledge, this skipping technique is the first method for targeting KRAS in cancer. For these purposes, Applicant's construct utilizes the first exon of KRAS in the 5'untranslated region, and the ATG start codon for protein translation is inside the second exon. (Therefore, the second exon is often referred to as exon 1 and the first exon is exon 0.) Since the ATG start codon is missing, an oligo that induces exon skipping of exons containing ATG. Will result in transcripts that are not translated successfully.

From the KRAS-based intron-exon STOP-intron Genbank sequence (NCBI reference sequence: NG_007524.1, last access on February 20, 2019), the KRAS exons are 4990. .. 5170, 10526. .. 10647, 28509. .. 28687, 30148. .. 30307, 46010. .. Located at 51132, cDNA binds: 10537. .. 10647, 28509. .. 28687, 30148. .. 30307, 46010. .. 46126.

The first ATG of the normal KRAS gene is at position 10537

Exons to skip are between 10526 and 10647 (122bp).

The construct contains a pseudo version with a stop codon in each reading frame.

In one embodiment, for KRAS1 exons, shaded and underlined nucleotides (including KRAS ATG) are replaced with stop codons.

Exemplary stop codons are TAA, TAG and TGA. In one embodiment, all three reading frames are: TAAxTAGxTGA, where x is any nucleotide.

。 Stop codons can be inserted to design all three stop codons twice in a row. Furthermore, by using the sequence: TAAxTAGxTGAxTAGxTAAxTGAx (24bp) (SEQ ID NO: 1) (where x is any nucleotide), 11 base pair repeats can be avoided. Specific embodiments are as follows: TAATTAGCTGAGTAGATAAGTGAT (SEQ ID NO: 2). As a result, one embodiment comprising exon Kras1STOP (stop codons are underlined) is:

..

The usual upstream intron is NCBI reference sequence NG_007524.1: 5171-10525 (5,355bp) of "gtacg ... ataga" and the rest of the upstream intron is shown as "...".

The usual downstream intron is 10648-28508 (17,861 bp) of NCBI reference sequence NG_007524.1: "gtaa ... ctcag" and the rest of the downstream intron is shown as "...".

。 In one embodiment, the upstream and downstream ends of both introns contain approximately 75 base pairs (“bps”). In one embodiment, the upstream intron sequence is:

..

。 In one embodiment, the downstream intron sequence is:

..

Thus, in one embodiment, the sequence below is the intron-exon Kras1STOP-intron sequence (the unhighlighted sequence is the upstream intron, the gray sequence is the intron containing the STOP sequence, and the underlined sequence is. It is a downstream intron).

In one aspect, since exon skipping can be triggered, a series of oligos that span the junction of the exon-downstream intron boundary can be added. Exon skipping oligos tend to be 20-30 base pairs, which is antisense to DNA.

。 In one embodiment, the morpholino binding site is an intron-exon STOP-intron morpholino site (SEQ ID NO: 26) from Kras1. Sequences of the K1ExonStopIntron3'junction sequence listed below (exons are grayed out and introns are underlined):

..

Applicants created and tested two morpholino binding sites called KTS1 (SEQ ID NO: 24) and KTS2 (SEQ ID NO: 25). The KTS1 morpholino sequence comprises the sequence of SEQ ID NO: 27. The KTS2 morpholino sequence comprises the sequence of SEQ ID NO: 28. Applicants used the KTS2 morpholino reverse sequence (SEQ ID NO: 29) as a negative control.

In some cases, the splice donor site comprises A / C AG ^*** GT A / G AGT (SEQ ID NO: 34), where " ^*** " indicates an exon-intron boundary and an intron-exon STOP-intron sequence. The insertion site of is also shown.

In some cases, splice acceptors include (Py) XCAG ^*** GG / T (SEQ ID NO: 35), where " ^*** " indicates an intron-exon boundary.

In some cases, exemplary splice donor sites for inserting the intron-exon STOP-intron sequence include AAG-GG (SEQ ID NO: 36), CAG-GG (SEQ ID NO: 37), AAG-GT (SEQ ID NO: 38). ) Or CAG-GT (SEQ ID NO: 39), where "-" indicates the insertion site.

CATAAVERT Constructs Cancer Targeted AAV Expression ( expressed ) Regulated T ( CATAAVERT ) Linker (also known as " TransSkip ") to create a consensus splice donor and acceptor site. The intron-exon Kras1STOP-intron sequence is inserted into the site of the coding region that produces the. In one embodiment, the vector containing the conditioned CATAAVERT expresses CD3 and GD2.

In another embodiment, the vector comprises a sequence encoding a secreton-AA-CD3xGD2-HDD dimart. For this construct, the sequence of Secrecon-AA-CD3xGD2-HDD dimart is an intron to generate a consensus splice donor / acceptor (insert the sequence after the third of 5 bp at one or more potential sites). Exxon Kras1 Stop-Contains all potential sites (highlighted in gray) for inserting introns, and provides:

。 In one embodiment, an insertion is made at the most upstream site to minimize the length of the CD3xGD2 dimart translated before the stop codon (the underlined sequence is the mRNA when the intron is spliced). The splice junction retained therein, the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence, and the sequence shown in gray is the exon containing the STOP sequence. Yes, the sequence shown in bold is the downstream intron). In some cases, this sequence is referred to as CD3xGD2K1 dimart:

..

。 In some cases, the upstream splicing factor binding site is modified (modified regions are shown in italics and bold). The underlined sequence is the splice junction retained in the mRNA when the intron is spliced, and the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence. The gray sequence is an exon containing the STOP sequence, and the bold sequence is a downstream intron. In some cases, this sequence is referred to as CD3xGD2K2 dimart:

..

In some cases, the CD3xGD2 dimart construct contains one or more additional modifications in the polynucleotide sequence. In some cases, the CD3xGD2 dimart construct is sec2A-CD3xGD2-HDD-K3 and the sequence of sec2A-CD3xGD2-HDD-K3 is shown as SEQ ID NO: 41. The underlined sequence is the splice junction retained in the mRNA when the intron is spliced, and the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence. The gray sequence is an exon containing the STOP sequence, and the bold sequence is a downstream intron.
SEQ ID NO: 41

In some cases, the CD3xGD2 dimart construct is sec2A-CD3xGD2-HDD-K4 and the sequence of sec2A-CD3xGD2-HDD-K4 is shown as SEQ ID NO: 42. The underlined sequence is the splice junction retained in the mRNA when the intron is spliced, and the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence. The gray sequence is an exon containing the STOP sequence, and the bold sequence is a downstream intron.
SEQ ID NO: 42

In some cases, the CD3xGD2 dimart construct is sec2A-CD3xGD2-HDD-K5 and the sequence of sec2A-CD3xGD2-HDD-K5 is shown as SEQ ID NO: 43. The underlined sequence is the splice junction retained in the mRNA when the intron is spliced, and the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence. The gray sequence is an exon containing the STOP sequence, and the bold sequence is a downstream intron.
SEQ ID NO: 43

In some embodiments, the dimarts described herein include a CD3 sequence, a CD19 sequence, and optionally a secreton sequence. In some cases, Dimart highlights all of the potential sites for inserting the intron-exon-Kras1 stop-intron sequence to generate a consensus splice donor / acceptor site, the CD3xCD19 construct set forth in SEQ ID NO: 44. including. Each potential insertion site is highlighted in gray.
SEQ ID NO: 44

In some cases, the insertion is made at the most upstream site. In some cases, dimart further comprises a secreton sequence. In some cases, the CD3xCD19 construct is sec1A-CD3xCD19-K1 and its sequence is shown as SEQ ID NO: 45. As shown below, the underlined sequences are the splice junctions that are retained in the mRNA when the introns are spliced, and the italic and bold sequences are the upstream intron sequences. The gray sequence is the exson containing the STOP sequence and the bold sequence is the downstream intron.
SEQ ID NO: 45

In some cases, the CD3xCD19 construct is sec1A-CD3xCD19-K3, the sequence of which is shown as SEQ ID NO: 46. As shown below, the underlined sequences are the splice junctions that are retained in the mRNA when the intron is spliced, and the italic and bold regions are modified upstream splicing factor binding sites. Regions, gray sequences are exons containing STOP sequences, bold sequences are downstream introns.
SEQ ID NO: 46

These examples are provided for purposes of illustration only and are not intended to limit the scope of the claims provided herein.
[Example 1]
Generation of CD3xGD2-HDD dimart using exemplary CD3xGD2-HDDTransJoins

Map of an exemplary AAV construct for testing CD3xGD2-HDD expression.

As a proof of principle, previously described bispecific molecules targeting human CD3 on T cells and disialoganglioside GD2 on neuroblastoma and other types of cancer cells were expressed. Ahmed et al., OncoImmunology, 4: 4, e989776, DOI: 10.4161/2162402X. As reported in 2014.989776, this bispecific protein is scFv against GD2 from clone 5F11 by a short linker (L) linked as a dimer by the HNF1a dimerization domain (HDD). It has the amino acid sequences of heavy and light variable regions for human CD3 from clone OKT3 fused to the construct (single chain variable fragment, using format for scFv). In order to reverse engineer the optimal human DNA coding sequence for CD3xGD2-HDD, vectorbuilder. A com codon optimization tool (//en.vectorbuilder.com/tool/codon-optimization.html) was used. The resulting DNA sequences starting at the ATG start codon were synthesized and cloned downstream of the chicken-actin-b-globin promoter (CAGp) in an adeno-associated virus expression cassette with an AAV2-derived terminally inverted sequence. Based on the finding that alanine enhances protein-dependent secretion, a consensus secretory signaling domain (based on "Secrecon", Barash et al., Biochem Biophyss Res Commun. 2002; 294: 835-842) downstream of the ATG initiation site. Three other versions containing and ending with 0, 1 or 2 alanine were made (Gueller-Gane et al., PLoS ONE 11 (5): e0155340. Doi: 10.1371 / journal.pone. 0155340). The proteins derived from these constructs were called heterodimer scFv or dimart. FIG. 7 shows four exemplary CD3xGD2-HDD dimart constructs.

Assay to determine the structure and function of Dimart.

The AAV expression vector (or control) was transduced into 293T cells, and the supernatant was collected and stored. For the presence of the correct size protein on electrophoresis (SDS-PAGE), for binding to CD3 by a binding competition assay using flow cytometry, for activation of T cells by flow cytometry, and with T cells. The supernatant was tested for killing of tumor cells when incubated. See FIG. 8 showing an illustration of the assay to determine the structure and function of the dimart disclosed herein.

The three constructs containing the secreted peptide indicate less CD3xGD2-HDD dimart retained intracellularly.

Whole cytolysis of 293T cells transfected with a different AAV CD3xGD2-HDD expression plasmid was collected 48 hours after transfection. Polyacrylamide gel electrophoresis (PAGE) was performed using 50 ug of total protein per lane and gels were stained with Ponso S. The results showed more protein when construct # 1104 lacking the secretory sequence was used, but all three constructs with the secretory sequence showed less protein. Controls included cells alone or cells transfected with a control plasmid (pcDNA3-GFP). KDa, kilodalton; Sec, secretory domain; GFP, green fluorescent protein; MW, molecular weight. See FIG.

Only supernatants from cells transfected with the AAV CD3xGD2-HDD construct containing the secretory sequence bind and activate T cells.

The supernatant was tested for binding to human T cells and activation of human T cells. Binding was determined by competition with a fluorescently labeled anti-CD3 antibody pre-bound to T (Jurkat) cells. The stained cells showed 77.6%, 79.24% and 78.7% (Q2 + Q3) CD3 positive in the control group (DMEM, Trl, GFP), respectively, from the AAV vector # 1104 lacking the secretory peptide. It showed 77.7%. In contrast, binding of fluorescently labeled anti-CD3 antibodies was reduced to 2.15%, 3.67% and 3.99% by supernatants from cells transfected with each vector containing secretory peptides. (Q2 + Q3). In addition, cells were co-stained with anti-CD69 as a marker for T cell activation. The control group and AAV vector # 1104 all showed less than 13.4% CD69 positive (Q1 + Q2), whereas the three different secretory-containing AAV vectors showed 58.87-68.5% CD69 positive. Indicated. See FIG.

Method Details: Jurkat2e5 cells / well in 400 ul RPMI + 10% FBS were seeded in a 24-well plate, then 100 ul supernatant (20% of total culture) from 293 T transfected cells was added to each well. bottom. After 48 hours of incubation, Jurkat cells are centrifuged, washed once with PBS and then stained with PE-anti-hCD69 (1: 100) and PerCP-anti-hCD3e (1: 300 # OKT3) for 30 minutes on ice. bottom. After washing with FACS buffer, each sample was fixed in 1% PFA and analyzed by flow cytometry. DMEM is only medium added to Jurkat, Ctrl is the supernatant added from untransfected 293T cells, and GFP is added from 293T cells transfected with the AAV plasmid expressing GFP. It is a supernatant.

Only supernatants from cells transfected with AAV vectors containing secretory peptides activate human T cells.

Human T (Jurkat) cells were incubated with supernatants from 293T cells transfected with various AAV vectors, stained against CD69 with PE-labeled antibody, and examined under fluorescence microscopy. See FIG. 11, where the left panel is the phase difference and the right panel is the fluorescence. Neither the EGFP vector control nor the vector # 1104 lacking the secretory peptide showed positive staining, while the other three vectors showed high levels of staining (red). Method Details: Jurkat2e5 cells / well in 400 ul RPMI + 10% FBS were seeded in a 24-well plate, then 100 ul supernatant (20% of total culture) from 293 T transfected cells was added to each well. bottom. After 48 hours of incubation, Jurkat cells were centrifuged, washed once with PBS and then stained with phycoerythrin (PE) -anti-hCD69 (1: 100) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes. Scale bar: 100um.

Binding of CD3xGD2-HDD to T cells is dose-dependent.

Various amounts of supernatants from 293T cells transfected with AAV plasmids containing different secretory peptides were incubated and tested for competition with peridinin chlorophyll protein complex (PerCP) conjugated anti-hCD3 on JurkatT cells. .. See FIG. 12A, where the left panel shows the FACS plot and the right panel shows the median number of stain levels. The gray shades in the left panel are unstained, and the dark gray lines in each panel indicate the largest stained cells without the supernatant added. FIG. 12B shows a bar graph of median staining levels normalized to unstained controls.

Method Details: Jurkat2e5 cells / well in 400 ul RPMI + 10% FBS were seeded in a 24-well plate and then 10 ul, 25 ul, 50 ul or 100 ul supernatants from 293T transfected cells (2-20 of total culture). %) Was added to each well. After 24 hours of incubation, Jurkat cells were centrifuged, washed once with PBS and then stained with PerCP-anti-hCD3e (1: 300 # OKT3) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and then analyzed by flow cytometry. Sec = secretory peptide, A = alanine.

Binding assay for the anti-GD2 arm of CD3xGD2-HDD dimart and confirmation that both GD2 and CD3 binding are on a single molecule.

The binding of CD3xGD2-HDD to GD2 was indirectly measured by first incubating the supernatant from the 293T-transfected cells with either GD2-positive or GD2-negative cells and then repeating the CD3T cell binding competition assay. Proteins that bind GD2 should be absorbed by GD2-positive cells but not by GD2-negative cells, resulting in a loss of competition for T cell binding. This assay was so designed to confirm that GD2 binding is co-bound to CD3 binding, in other words, a single molecule is bispecific. See FIG. 13 for an illustrated representation of the binding assay.

The CD3xGD2-HDD combines both CD3 and GD2.

As shown in FIG. 13, supernatants derived from 293T cells transfected with the # 1101 CD3xGD2-HDD AAV vector were collected and pre-collected with GD2-positive SK-N-Be (2) or GD2-negative Raji cells. Incubated. After centrifugation and washing, a binding competition assay was performed on CD3 T (Jurkat) cells.

FIG. 14 shows an exemplary CD3xGD2-HDD dimart that binds to both CD3 and GD2. The gray shades on the top panel with black contours are unstained JurkatT cells, and the dark gray lines are JurkatT cells completely stained for CD3 without the addition of supernatant. Sample Jurkat_cd3e showed fully competing CD3 binding when the supernatant was used without preincubation and almost overlapped with the supernatant preincubated with GD2-negative Raji cells. In contrast, sample Jurkat_cd3e sknbe2 shows loss of competition when the supernatant is preincubated with GD2-positive SK-N-Be (2) neuroblastoma cells, and the same molecule binds both CD3 and GD2. It was confirmed.

Assay to determine if CD3xGD2-HDD induces GD2 + target cell killing by T cells.

FIG. 15 shows a flow chart of an assay for determining whether CD3xGD2-HDD induces GD2 + target cell killing by T cells. As shown in FIG. 15, GD2 + neuroblastoma (SK-N-Be (2)) cells were seeded into the wells followed by primary human T cells (purchased from StemExpress) and AAV vectors. The supernatant from the 293T cells obtained is seeded. CellTiter-Glo from Promega (Madison, WI) is used to assess cell viability.

The secreted CD3xGD2-HDD induces T cell killing of neuroblastoma cells.

Using the assay shown in FIG. 15, GD2 + SK-N-Be (2) neuroblastoma in human T cells + supernatant (derived from 293 T cells transfected with various AAV vector plasmids). Tested against cells. A 10: 1 T cell to target cell ratio was used. After 48 hours in co-culture, cells were assayed for viability. Above from cells transfected with constructs expressing an unrelated dimart (CD19xCD3) or vector lacking secretory peptide (# 1104) as compared to supernatants from untransfected cells (“without dimart”). No recognizable cytotoxicity was present with Qing (Fig. 16). In contrast, supernatants from cells transfected with each of the secreted peptide-containing vectors induce statistically significant cytotoxicity (p <0.001), 25-30% of the cells. Was killed (Fig. 16).

T cell-mediated cytotoxicity by CD3xGD2-HDD dimart is associated with GD2 expression.

A group of neuroblastoma cell lines were tested for susceptibility to killing by human T cells combined with supernatants from AAV vector # 1101 (upper figure in FIG. 17) and their GD2 expression was measured by flow cytometry. Measured (graph 17 below, shaded curves are isotype controls). CHP-134 cells showed the highest cytotoxicity and highest GD2 expression.
[Example 2]
Generation of CD19xCD3 dimart using exemplary CD19xCD3TransJoins

Map of an exemplary AAV construct for testing CD19xCD3 dimart expression.

An FDA-approved protein therapy known as blinatumomab, the so-called bispecific T-cell engager (BiTE), targets human CD19 on B-cell / B-cell malignancies and human CD3 on T cells. Made to do. Using the publicly available amino acid sequence of blinatumomab (//www.drugbank.ca/drugs/DB09052), vectorbuilder. An optimal human DNA coding sequence for CD19xCD3 was reverse engineered using a com codon optimization tool (//en.vectorbuilder.com/tool/codon-optimization.html). The resulting DNA sequences starting at the ATG start codon were synthesized and cloned downstream of the chicken-actin-b-globin promoter (CAGp) in an adeno-associated virus expression cassette with an AAV2-derived terminally inverted sequence. Based on the finding that alanine enhances protein-dependent secretion, a consensus secretory signaling domain (based on "Secrecon", Barash et al., Biochem Biophyss Res Commun. 2002; 294: 835-842) downstream of the ATG initiation site. Three other versions containing and ending with 0, 1 or 2 alanine were made (Gueller-Gane et al., PLoS ONE 11 (5): e0155340. Doi: 10.1371 / journal.pone. 0155340). The proteins derived from these constructs were called heterodimer scFv or dimart. 18A and 18B show five exemplary CD19xCD3 constructs.

FIG. 18C shows an illustrated representation of CD19 dimart interacting with cancer cells and T cells. CD19 dimart is produced by cells containing CD19TransJoin. When administered intravenously to a subject, eg, AAV TransJoin (eg, AAV CD19 TransJoin as shown in this figure) enters normal cells such as liver or muscle and expresses the polypeptide encoded by AAV TransJoin. The secretory signal peptide is cleaved during secretion, leaving an active dimart that binds cancer cells (Ca) on one end and T-immune cells on the other end.

Only supernatants from cells transfected with the AAV CD19 × CD2 construct containing the secretory sequence bind and activate T cells.

The supernatant was tested for binding to human T cells and activation of human T cells. Binding was determined by competition with a fluorescently labeled anti-CD3 antibody pre-bound to human T (Jurkat) cells. Stained cells showed 77.6%, 79.24% and 78.7% (Q2 + Q3) CD3 positivity in controls (DMEM, Ctrl, GFP), respectively, and 79 from vector # 1323 lacking secretory peptides. It showed 0.4%. In contrast, binding of fluorescently labeled anti-CD3 antibodies was reduced to 23.88%, 18.59% and 30.76% by supernatants from cells transfected with each vector containing secretory peptides. (Q2 + Q3). In addition, cells were co-stained with anti-CD69 as a marker for T cell activation. The control group and # 1323 all showed less than 13.38% CD69 positivity (Q1 + Q2), whereas the three different secretion-containing vectors showed 63.9%, 67.3% and 66.6% CD69 positivity. Shown (Fig. 19).

Method Details: Jurkat2e5 cells / well in 400 ul RPMI + 10% FBS were seeded in a 24-well plate, then 100 ul supernatant (20% of total culture) from 293 T transfected cells was added to each well. bottom. After 48 hours of incubation, Jurkat cells are centrifuged, washed once with PBS and then stained with PE-anti-hCD69 (1: 100) and PerCP-anti-hCD3e (1: 300 # OKT3) for 30 minutes on ice. bottom. After washing with FACS buffer, each sample was fixed in 1% PFA and analyzed by flow cytometry. DMEM is only medium added to Jurkat, Ctrl is the supernatant added from untransfected 293T cells, and GFP is added from 293T cells transfected with the AAV plasmid expressing GFP. It is a supernatant.

Only supernatants from cells transfected with AAV vectors containing secretory peptides activate human T cells.

Human T (Jurkat) cells were incubated with supernatants from 293T cells transfected with various AAV vectors, stained against CD69 with PE-labeled antibody, and examined under fluorescence microscopy. See FIG. 20, the left panel is the phase difference and the right panel is the fluorescence. Neither the EGFP vector control nor the AAV vector # 1323 lacking the secretory peptide showed positive staining, while the other three vectors showed high levels of staining (red).

Method Details: Jurkat2e5 cells / well in 400 ul RPMI + 10% FBS were seeded in a 24-well plate, then 100 ul supernatant (20% of total culture) from 293 T transfected cells was added to each well. bottom. After 48 hours of incubation, Jurkat cells were centrifuged, washed once with PBS and then stained with phycoerythrin (PE) -anti-hCD69 (1: 100) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes. Scale bar: 100um.

AAV-secreted CD19xCD3 specifically binds CD19, but not CD45.

Using a binding competition assay, the supernatant from the supernatant from 293T cells transfected with the AAV vector is two different antibodies, one antibody that stains the B cell marker CD19, and one panleukocyte. It was determined whether Epstein-Barr virus (EBV) interferes with staining of transformed human B cells with an antibody that stains the marker CD45.

Cells in the three control groups (DMEM, Trl, GFP) showed 93%, 93.1% and 93.2% positive staining (Q1 + Q2) for CD19, respectively, and were characterized by AAV vector # 1323 lacking secretory peptides. See FIG. 21, where the supernatants from the transferred cells did not compete for their staining and showed 93.2% positive for CD19. In contrast, each of the AAV vectors containing the secreted peptide competitively reduced the CD19 signal to 33.33%, 31.07% and 35.88%. The cutoff is set so that unstained cells are 14.58% positive for CD19, and supernatants from cells transfected with these three AAV vectors compete for background. Note that it is suggested that it was reduced by a factor of two. In contrast, none of the vectors competed for CD45 staining, 78.89%, 79.14% and 78.32% positive (Q2 + Q3) in the three controls and 82.9% in the vector lacking the secretory peptide. It was positive and was 80.5%, 78.5% and 79.4% positive using supernatants from cells transfected with the other three vectors.

Method Details: EBV (Gene Ther. July 2013; 20 (7): 761-9. Doi: 10.1038 / gt.2012.93) called NB122R at 2e5 cells / well in 400 ul RPMI + 10% FBS. B cells transformed with) were seeded in 24-well plates, and then 100 ul supernatant (2-20% of total culture) from 293T-transfected cells was added to each well. After 24 hours of incubation, cells were centrifuged, washed once with PBS and then stained with PEcy7-anti-hCD45 (1: 100) and APC-anti-hCD19 (1: 300) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and then flow cytometric analysis was performed. DMEM is only medium added to Jurkat, Ctrl is the supernatant added from untransfected 293T cells, and GFP is added from 293T cells transfected with the AAV plasmid expressing GFP. It is a supernatant.

Binding of CD19xCD3 to T cells is dose-dependent, and vectors containing a single alanine downstream of the secreted peptide consensus sequence are superior compared to other vectors tested.

Various amounts of supernatants from 293T cells transfected with AAV plasmids containing different secretory peptides were incubated and tested for competition with peridinin chlorophyll protein complex (PerCP) conjugated anti-hCD3 on JurkatT cells. .. See FIG. 22A, where the left panel shows the FACS plot and the right panel shows the median number of stain levels. The gray shades in each of the left panels were unstained cells, and the dark gray lines in each of the left panels were maximally stained cells without the addition of supernatant. FIG. 22B shows a bar graph of median staining levels normalized to unstained controls. A vector with a single alanine downstream of the secreted peptide consensus sequence, # 1325, showed the greatest competition compared to other tested vectors and was selected for further experimentation.

Method Details: Jurkat2e5 cells / well in 400 ul RPMI + 10% FBS were seeded in a 24-well plate and then 10 ul, 25 ul, 50 ul or 100 ul supernatants from 293T transfected cells (2-20 of total culture). %) Was added to each well. After 24 hours of incubation, Jurkat cells were centrifuged, washed once with PBS and then stained with PerCP-anti-hCD3e (1: 300 # OKT3) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and then analyzed by flow cytometry. MFI = average fluorescence intensity, Sec = secreted peptide, A = alanine.

Binding of CD19xCD3 to B cells is dose-dependent, and vectors containing a single alanine downstream of the secreted peptide consensus sequence are superior to other vectors tested.

Various amounts of supernatants from 293T cells transfected with AAV plasmids containing different secretory peptides were incubated and tested for competition with allophycocyanin (APC) conjugated anti-hCD19 on human B cells. See FIG. 23A, where the left panel shows the FACS plot and the right panel shows the median number of stain levels. The gray shades in each of the left panels were unstained, and the dark gray lines in each of the left panels were maximally stained cells without the addition of supernatant. FIG. 23B shows a bar graph of median staining levels normalized to unstained controls. A vector with a single alanine at the end of the secreted peptide, # 1325, showed the greatest competition consistent with the results for T cell binding shown in FIGS. 22A and 22B and was selected for further experimentation. ..

Method Details: NB122R human B cells at 2e5 cells / well in 400 ul RPMI + 10% FBS were seeded in 24-well plates and then 10 ul, 25 ul, 50 ul or 100 ul supernatants from 293T transfected cells (total). 2-20% of the culture) was added to each well. After 24 hours of incubation, cells were centrifuged, washed once with PBS and then stained with APC-anti-hCD19 (1: 300) on ice for 30 minutes. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes and then analyzed by flow cytometry. MFI = average fluorescence intensity, Sec = secreted peptide, A = alanine.

CD3 dimart activates T cells by anti-CD28 co-stimulation better than anti-CD3 antibodies.

Human T (Jurkat) cells were co-incubated with supernatants derived from anti-CD28 antibody and AAV vector-transfected 293T cells (left panel of FIG. 24) or increasing concentrations of anti-CD3 antibody (right panel of FIG. 24). Cellular mRNA was collected and subjected to quantitative reverse transcriptase polymerase chain reaction (RT-PCR) on IL-2 (upper panel in FIG. 24) and IL-8 (lower panel in FIG. 24) mRNA. Expression was calculated in comparison to the keeping mRNA GAPDH. Only the supernatant from cells transfected with the AAV vector construct containing the secretory domain exceeds the control (gfp, 293t) and the vector construct lacking the secretory domain (# 1104 for CD3xGD2-HDD, # 1323 for CD19xCD3). ), Which showed stimulation of any gene.

293T cells provide the highest transduction efficiency for AAV8.

Infect 4 different cell lines with 2 different concentrations of AAV8 expressing green fluorescent protein (GFP) with infectivity (MOI) = 1e4 or 1e5 genomic copy (gc) using 2% fetal bovine serum-containing medium. I let you. Forty-eight hours after viral infection, GFP signal was assessed by fluorescence microscopy. See FIG. 25. AML-12: normal mouse hepatocytes; 293T: human fetal kidney cells transformed with SV40-T antigen; H441-CRM: human lung cancer cells with KRAS mutations; SK-N-Be (2): NMYC amplified Human neuroblastoma cells.

The dimart concentration in the supernatant of AAV8 infected cells depends on the AAV dose and transduction efficiency.

T (Jurkat) binding assays were performed on supernatants derived from 293T cells and H441 cells transfected with the TransJoin vector or AAV-GFP control. See FIG. 26, where the gray shades in the panels are unstained control cells and the dark gray lines in each panel are T cells completely stained with anti-CD3 antibody. The CD19xCD3 dimart appeared to be much more effective than the CD3xGD2-HDD dimart in the competition for binding, but the effect was dose-dependent (the higher the MOI, the more left the curve shifted). It was not found in cell lines (H441 cells) with low AAV8 transduction efficiency. MOI, infection efficiency.

A single intravenous injection of CD19xCD3 TransJoin selectively eliminates B cells in humanized mice.

Immunodeficient mice (NSG-SGM3, Jackson Labs) that were irradiated and intravenously injected with human CD34 + hematopoietic stem cells were purchased. By 12 weeks, mice showed engraftment of human blood cells by flow cytometry of peripheral blood containing T and B lymphocytes. As shown in FIG. 27, mice were given single injections of CD19xCD3 TransJoin (AAV8-Sec1A-CAG-193, vector # 1325 packaged in AAV8 capsid) at various doses at various time points. Blood was analyzed by flow cytometry for collected human lymphocytes. Low doses (5e9 and 5e10 vector genome (vg) / kilogram (kg) body weight) had no effect, while higher doses (5e11 and 5e12 vg / kg) circulated without affecting CD4 + T cells or CD8 + T cells. It was enough to eliminate B cells.

A single intravenous injection of CD19xCD3 TransJoin results in long-term B cell depletion in humanized mice.

Humanized mice were treated with a single dose of CD19xCD3 AAV8 TransJoin, followed by measurement of lymphocyte subsets in blood. Long-term selective B cell depletion was observed in all the mice analyzed, as long as these mice remained alive, as shown in FIG. 28 for a single mouse.

It is shown that a single intravenous injection of CD19xCD3 TransJoin eliminates CD19 + lymphoma in humanized mice.

Human CD19 + Razi cells (derived from a patient with Burkitt lymphoma) were transplanted into the flanks of two humanized mice and waited until they reached a size greater than 250 mm ³ . The tail vein of one animal was then injected with the control AAV virus AAVGFP and the tail vein of the second animal was injected with CD19xCD3 AAV8 TransJoin. Tumors in control mice eventually grew rapidly and required the animals to be euthanized. Tumors in TransJoin-treated mice grew slowly and then eventually shrank almost completely. See FIG. 29. Although animals had to be sacrificed due to the symptoms of graft-versus-host disease, which is a known result in humanized mice, this experiment is based on the principle that a single TransJoin injection can treat cancer. Proving the proof.
[Example 3]
Use of OncoSkip and TransSkip to simultaneously target oncogene expression and activate therapeutic transgenesis expression

An overview of OncoSkip and TransSkip described herein.

OncoSkip is an antisense morpholino that induces exon skipping of oncogenes. In some embodiments, OncoSkip is designed as an antisense morpholino that induces exon skipping of important exons in oncogenes (left side of FIG. 30). For proof of principle, KRAS (exons 1, 2, 3 represented by black-gold-gray on the left side of FIG. 30) is used, and KRAS exons 2 are used so that the normal expression of oncogenes is reduced. Morphorinos containing ATG initiation sites designed to skip (shown in FIG. 30 as small light gray bars above the oncogene) were tested. Derivatives of the same exon to be skipped are then made, but mutated to include multiple stop codons in each reading frame, along with adjacent intron sequences. A new intron-exon (stop) -intron is then inserted into the transgene coding sequence at the site that reshapes the donor and acceptor splice sites so that they are spliced into the transgene mRNA and interrupt the normal coding sequence. do. In the presence of antisense morpholino (a small light gray bar above the oncogene), newly inserted exons are skipped and the coding sequences are reconnected to produce a functional product. The class of AAV vectors containing genes interrupted by the intron-exon-intron sequence is called the TransSkip virus, and the class of morpholino designed to downregulate the oncogene is called the OncoSkip.

KRAS OncoSkip antisense morpholino induces exon skipping of endogenous KRAS in lung cancer cells.

Lung cancer cell lines A549 and H441 (not shown) were incubated with KTS1 and KTS2 OncoSkip antisense morpholino, as well as reverse control morpholino for KTS2. Both KTS1 and KTS2 were designed to bind to the 3-prime end of the exon-intron junction of KRAS exon 2 and induce exon 2 skipping because exon 2 contains the ATG initiation site. Intrinsic KRAS mRNA was then analyzed by reverse transcriptase RT-PCR for the presence of exon 2 by PCR with primers present in exon 1 (forward) and exon 2 (reverse). Primers in exon 4 were used as a control against total KRAS mRNA. A dose-dependent decrease in the exon 2 -containing transcript (“exon 1 + 2”) was observed by both OncoSkip morpholinos. See FIG. 31.

AAV vector map of the CD3xGD2-HDD TransSkip showing an inverted intron adjacent to an exon inserted in the CD3xGD2-HDD dimart code sequence.

A 3-prime sequence of human intron (Ki1) upstream of KRAS exon 2, a derivative of KRAS exon 2 (STOP) mutated to multiple stop codons in all three reading frames, and a human intron downstream of KRAS exon 2. A 5-prime sequence of (Ki) was synthesized and the cassette was cloned into the gene sequence encoding the GD2 dimart in a specific sequence that reproduces the consensus splice donor and acceptor sites. See FIG. 32. When new STOP exons are spliced into the transcript, no functional dimart is produced. When cells are exposed to antisense morpholino that binds the 3-prime exon-intron junction, STOP exons are skipped and full-length dimart mRNA is expressed. Antisense morpholino designed to cause exon 2 skipping simultaneously alters mRNA splicing of the TransSkip transducing gene, resulting in full-length dimart expression in transduced cells, exon 2 containing the KRAS ATG start codon. Therefore, KRAS sequences were selected to reduce or eliminate native KRAS expression in cancer cells.

An exemplary strategy for testing the activity of OncoSkip and TransSkip.

As shown in FIG. 33, cell pellets and supernatants were recovered from 293T cells transduced with AAV dimart vector. MRNA was isolated from cell pellet and subjected to reverse transcriptase RT-PCR to determine the extent to which artificial exons in the transgene were spliced into the mRNA. Supernatants for dimart expression were analyzed by T cell binding and killing assays.

Antisense morpholino induces exon skipping of the CD3xGD2-HDD TransSkip transgene.

293T cells were transfected with CD3xGD2-HDD dimart plasmid # 1042. Cells were harvested 48 hours after transfection for total RNA isolation. About 1 ug of RNA was used for RT-PCR. Lane # 9 shows the full length transgene RNA between the non-splicing primers using the DNA plasmid as a template, see FIG. 34. Lanes 7 and 8 and control lanes are without antisense morpholino, indicating that the majority of the transcript contains internal exons (striped rectangles). There are some exon-excluded transcripts (smallest bands), suggesting that this construct has some "leakage" of activated transcripts. Inclusion of any of the morpholinos (KTS1, KTS2) results in a dose-dependent decrease in the proportion of inactivated exon-containing transcripts (219bp) and an increase in activated transcripts (97bp) that eliminate exons. do.

KRAS OncoSkip induces secreted expression of CD3xGD2-HDD dimart in cells transfected with the CD3xGD2-HDD TransSkip AAV vector.

Supernatants were collected from the transfected 293T cells and tested for T cell binding (interference with fluorescently labeled anti-CD3 antibodies). As shown in FIG. 35, the gray lines in the upper panel are unstained T (Jurkat) cells and the dark gray lines in the upper panel are completely stained with anti-CD3 antibody. It is a T cell. As a positive control, supernatants from cells transfected with constitutively expressed CD3xGD2-HDD TransJoin # 1011 competed almost completely with anti-CD3 staining. Supernatants from cells transfected with CD3xGD2-HDD TransSkip # 1042 show intermediate competition consistent with some "leakage" of exon-skipped dimart mRNA, either OncoSkip morpholino (KTS1, KTS2). Was further induced in.

Exon skipping of CD3xGD2-HDD TransSkip by KRAS OncoSkip is an on-target effect.

Exon skipping induced by targeted antisense morpholino KTS2 was compared to morpholino containing the same base but the reverse sequence (FIG. 36). KTS2 induced exon skipping to nearly 100% transcript (97bp), but sequence-reversed control morpholino was ineffective compared to Endoporter alone (carrier for morpholino) control.

Induction of CD3xGD2-HDD dimart expression as determined by T cell binding is an on-target effect.

Supernatants from 293T cells transfected with CD3xGD2-HDD TransJoin (positive control) and CD3xGD2-HDD TransSkip incubated with or without various antisense morpholinos were collected and flowed through a human T (Jurkat) cell binding assay. It was performed by cytometry (competition for fluorescently labeled anti-CD3 antibody binding). See FIG. 37, in which the gray lines in the upper panel are unstained T cells and the dark gray lines in the upper panel are fully stained T cells. The line indicating the # 1101 CD3xGD2-HDD TransJoin is an almost completely competing signal obtained from the constitutively expressed GD3 TransJoin. As mentioned above, supernatants from CD3xGD2-HDD TransSkip-transfected cells show slight competition at baseline (# 1042 CD3xGD2-HDD TransSkip, no morpholino), which is the control morpholino (CD3xGD2-HDD TransSkip + "KTS2-". Invert ctl ”) did not change, but was induced to compete with more signals by the on-target“ OncoSkip ”morpholino, KTS2 (CD3xGD2-HDD TransSkip + KTS2).

An AAV genomic map of an exemplary TransSkip splicing variant produced and tested to reduce baseline TransSkip "leakage" but maintain inducible exon skipping.

The Splicing variant of TransSkip was engineered to reduce the baseline exon skipping observed on the CD3xGD2-HDD TransSkip. A post-transcriptional regulatory element (WPRE) for Woodchuck hepatitis virus downstream of the coding sequence was used to increase the expression of the introduced gene. Due to AAV packaging size constraints, shorter promoters need to be used to include the WPRE sequence, so the new set of vectors will be in the shorter form of the human eukaryotic translation elongation factor 1α1 promoter (EFSp). It was made using the promoter from which it was derived. Variants were created by altering specific base pairs in the U2 cofactor (U2AF) binding site located in the 3-prime terminal polypyrimidine track of the first intron (Ki1-5). See FIG. 38.

CD3xGD2-HDD TransSkip splicing variant K3 removes baseline but maintains inducible exon skipping.

293T cells were transfected with a new panel of 5 different CD3xGD2-HDD TransSkip constructs with and without KTS2 antisense "OncoSkip" morpholino and compared to "Endo only" controls with morpholino carrier but no morpholino. MRNA transcripts were analyzed by reverse transcriptase RT-PCR and different phenotypes were found. As shown in FIG. 39, variant K4 had similar (or slightly higher) levels of baseline exon skipping to K1 and had higher skip inducibility than K1. Variants K2, K3 and K5 did not effectively exhibit baseline skipping. Of these three, variant K3 was most capable of inducing exons to be skipped.

The CD3xGD2-HDD TransSkip variant K3 does not show baseline dimart production, but is most inducible by KRAS OncoSkip.

A panel of CD3xGD2-HDD TransJoin splice variants was tested for the production of secreted CD3xGD2-HDD dimart expression with or without KRAS KTS2 OncoSkip antisense morpholino using a T (Jurkat) cell binding assay (far right). ). As shown in FIG. 40, the gray lines in each of the right panels are unstained T cells, dark gray is fully stained T cells, and blue is constitutively expressed CD3xGD2. -HDD TransJoin, green is each CD3xGD2-HDD TransSkip ("Endo only") without OncoSkip. The sequence shows a polypyrimidine U2AF binding site with a gray base pair variant (underlined and italic) engineered relative to the wild-type KRAS intron sequence (K1). The upper band in the RT-PCR gel is a transcript containing exons and the lower band is a transcript with skipped exons. Variants K1 and K4 show some detectable baseline exon skipping and prominent baseline dimart expression by RT-PCR (green, far right), whereas variants K2, K3 and K5 all show. No baseline exon skipping by RT-PCR and no dimart expression by binding competition (green, far right). All three of these variants show small amounts of inducible exon skipping by RT-PCR expression in the presence of KRAS antisense morpholino OncoSkip KTS2 and show varying degrees of dose-dependent dimart expression in the presence of KRAS OncoSkip. (Light purple and dark purple represent low and high concentrations, respectively). The K3 variant appeared to be the most inducible, so K3 was selected as the lead construct for further research.

OncoSkip-mediated induction of dimart expression from CD3xGD2-HDD TransSkip variants K3 and K5 is an on-target effect.

RT-PCR and T (Jurkat) binding assays were repeated with CD3xGD2-HDD TransSkip variants K2, K3 and K5, including "inverted KTS2" antisense morpholino as a control. See FIG. 41. Reverse KTS2 contains the same nucleotide bases as KTS2, except that the order is reversed. Reverse KTS2 was unable to induce exon skipping in both K3 and K5 (lower band on the gel), but the correct KTS2 sequence induced exon skipping in both K3 and K5 (K2 variant). In, none of them induced exon skipping). In the T cell binding assay for dimart expression (rightmost panel), gray was unstained T cells, dark gray was fully stained T cells, and blue was constitutively expressed. CD3xGD2-HDD TransJoin, purple is KRAS OncoSkip KTS2 (lighter colors are lower, darker colors are higher), and yellow is the reverse KTS2 control. The dimart protein assay is consistent with RT-PCR; neither morpholino induces dimart expression from the K2 variant, only KTS2 OncoSkip induces dimart expression from the K3 and K5 variants, but no reverse control. rice field.

Secreted dimarts induced by OncoSkip from the AAV CD3xGD2-HDD TransSkip vector are functional in mediating T cell killing of neuroblastoma cells.

Cells for GDS2 + SK-N-Be (2) neuroblastoma cells with supernatant from 293T cells transfected with various AAV CD3xGD2-HDD TransSkip variants with and without KRAS OncoSkip KTS2 Injuries were tested (Fig. 42). A 10: 1 T cell to target cell ratio was used. After 48 hours in co-culture, cells were assayed for viability. Results were normalized to supernatants from non-implanted cells. CD3xGD2-HDD TransSkip variants K1 and K4 showed cytotoxicity in the absence of KRAS OncoSkip KTS2, consistent with baseline exon skipping, and showed further inducible cytotoxicity with K4. The CD3xGD2-HDD TransSkip variant K2 showed neither baseline cytotoxicity nor inducible cytotoxicity, consistent with its known efficient splicing and exon introduction. In contrast, CD3xGD2-HDD TransSkip variants K3 and K5 did not show baseline, but showed inducible cytotoxicity, and the K3 variant was dose-dependent.

Transgene exon skipping in cells infected with AAV CD3xGD2-HDD TransSkip variant K3 is inducible and on-target by KRAS OncoSkip.

Exon skipping in the context of AAV viral infection was examined to determine if it reflected what was seen by transfection of the AAV plasmid in other studies. CD3xGD2-HDD TransSkip variants K1 and K3 were packaged in AAV8 and exon introduction (“inactivation”) and elimination (“activation”) were analyzed by RT-PCR 48 hours after AAV infection of 293T cells. Cells were incubated with or without antisense morpholino KRAS OncoSkip KTS2 or reverse control (“InvtKTS2 Ctrl”) (“Endo only”). As shown in FIG. 43, by vector plasmid, the AAV GD2 K1 variant showed exon skipping at baseline, which was further induced by KRAS OncoSkip KTS2 but not by the control. In contrast, no exon skipping was observed at baseline in the K3 variant, but it was observed to be induced in OncoSkip KTS2 (either alone or in combination with the carrier "Vivo-KTS2"). In contrast, control morpholino did not induce baseline exon skipping.

AAV genome map of CD19xCD3 TransSkip splicing variants.

Variant K3 showed a lower baseline compared to K1, but K1 and K1 inserted into the CD19xCD3 dimart transgene based on findings from the CD3xGD2-HDD TransSkip study that still showed inducible dimart expression. A K3 intron variant was made. Similar to the GD2 series, WPRE downstream of the coding sequence was used to increase transgene expression, requiring the use of the shorter promoter EFSp. A sequence derived from a part of Ki and KRAS introns. STOP, exon 2 from KRAS mutated to include a stop codon in all three reading frames. See FIGS. 44A and 44B for an illustration of the CD19xCD3 TransSkip construct.

FIG. 44C shows an illustrated representation of CD19 dimart interacting with cancer cells and T cells. CD19 dimart is produced by cells containing CD19 TransSkip. When administered to a subject, eg, intravenously, the AAV TransSkip (eg, the AAV CD19 TransSkip as shown in this figure) enters normal cells such as the liver or muscle, but is introduced with exons containing introns and stop codons. Since it is inserted into the normal coding sequence of the gene, it does not express the polypeptide. In the presence of antisense polynucleotides that induce exon skipping (eg, morpholino antisense oligonucleotides), mRNA transcripts treated with antisense oligonucleotides contain a complete transgene that is not interrupted by STOP exons. Under these circumstances, the polypeptide is synthesized and secreted, the secretory signal peptide is cleaved during secretion, binding cancer cells (Ca) on one end and T-immune cells on the other end. Leaves the active dimart to bind.

OncoSkip morpholino KTS1 and KTS2 induce on-target exon skipping of CD19xCD3 TransSkip K1.

As shown in FIG. 45, with no co-incubation (lane # 4) or with co-incubation with control morpholino (lane # 3) or two different KRAS OncoSkip morpholino (lanes 1 and 2), CD19xCD3 TransJoin (positive). 293T cells were transfected with an AAV vector containing controls, # 1325) and CD19xCD3 TransSkip K1 (# 1098). CD19xCD3 TransSkip K1 shows some baseline exon skipping (the presence of lower "activation" bands in lanes 3 and 4), consistent with our findings in the corresponding construct for CD3xGD2-HDD TransSkip. These results indicate that the engineered TransSkip design functions similarly with multiple different transgenes.

KRAS OncoSkip induces secreted expression of CD19xCD3 dimart in cells transfected with the CD19xCD3 TransSkip K1 AAV vector.

Supernatants were collected from the transfected 293T cells and tested for T cell binding (interference with fluorescently labeled anti-CD3 antibodies). As shown in FIG. 46, the gray lines in the upper panel are unstained T (Jurkat) cells and the dark gray lines in the upper panel are completely stained with anti-CD3 antibody. It is a T cell. As a positive control, supernatants from cells transfected with constitutively expressed CD19xCD3 TransJoin # 1325 competed for anti-CD3 staining (# 1325). Supernatants from cells transfected with CD19xCD3 TransSkip # 1098 in the presence of a morpholino control show some baseline competition (KTS2 reverse Ctl) consistent with the "leakage" of exon-skipped dimart mRNA. Further induced by any Onco Skip morpholino (KTS1; KTS2) to the level achieved by the target CD19xCD3 TransJoin.

CD19xCD3 TransSkip splicing variant K3 removes baseline but maintains inducible exon skipping.

As shown in FIG. 47, with or without KTS2 antisense "OncoSkip" morpholino or control morpholino ("InvtKTS2 Ctl"), 293T cells are transfected with K1 and K3 CD19xCD3 TransSkip constructs and have a morpholino carrier. Compared to "Endo only" controls without morpholino. MRNA transcripts were analyzed by reverse transcriptase RT-PCR. Consistent with the corresponding CD3xGD2-HDD TransJoin construct, variant K1 showed baseline exon skipping. In contrast, variant K3 did not show baseline skipping (“Endo only”) or skipping on a morpholino control. Skipping was observed by KTS2 OncoSkip with the K3 (# 1168) variant and confirmed by analyzing protein expression via a T cell binding assay.

Induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3 as determined by T cell binding is an on-target effect.

Flow cytometry was performed on human T (Jurkat) cell binding assays by collecting supernatants from 293T cells transfected with CD3xGD2-HDD TransJoin (positive control) and CD19xCD3 TransSkip incubated with or without various antisense morpholinos. Competition for fluorescently labeled anti-CD3 antibody binding). As shown in FIG. 48, gray in each of the upper panels is unstained T cells, dark gray is fully stained T cells, and pink is transfected. Not fully stained T cells in the presence of supernatants from 293 T cells, the blue color is a signal competed by the supernatants from cells transfected with constitutively expressed CD19xCD3 TransJoin # 1073. be. All supernatants from CD19xCD3 TransSkip K1 # 11166 showed high expression comparable to positive control CD19xCD3 TransJoin at baseline and with control morpholino, demonstrating that this construct is not suitable for controlling gene expression. In contrast, in line with experience with CD3xGD2-HDD TransSkip, CD19xCD3 TransSkip variant K3 # 1168 has baseline expression (green) or control morpholino (light orange and dark orange, "IntCtl") -induced expression. Although not shown, dose-dependent expression was shown by KRAS OncoSkip morpholino KTS2 (light purple and dark purple).

Induction of CD19xCD3 dimart expression from CD19xCD3 TransSkip K3 is repeatable.

Exon skipping and T cell binding assays were repeated to confirm the absence of leakage and the presence of inducibility by the K3 CD19xCD3 TransSkip as compared to the K1 CD19xCD3 TransSkip (FIG. 49). See also FIG.

Embodiment

Embodiment 1: A vector for use in gene therapy, wherein a first polynucleotide sequence encoding a first antibody or an antigen-binding fragment thereof and a second polynucleotide encoding a second antibody or an antigen-binding fragment thereof. A vector containing a polynucleotide sequence of.

Embodiment 2: The vector according to Embodiment 1, wherein the vector is a recombinant vector.

Embodiment 3: The vector according to embodiment 1 or 2, wherein the vector is a viral vector.

Embodiment 4: The vector according to any one of embodiments 1 to 3, wherein the viral vector is a retroviral vector.

Embodiment 5: The viral vector is an adenovirus vector, an adeno-associated virus (AAV) vector, a lentivirus vector, a mouse leukemia virus (“MLV”) vector, an Epstein-Barvirus (“EBV”) vector or a herpesvirus (“HSV”). ”) The vector according to any one of embodiments 1 to 4, which is a vector.

Embodiment 6: AAV vectors are AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP. B. The vector according to any one of embodiments 1-5, which is an AAVrh74 or AAV-DJ vector.

Embodiment 7: The vector according to embodiment 6, wherein the AAV vector is AAVrh74 (GenBank accession number LP899424.1).

Embodiment 8: The first antibody or an antigen-binding fragment thereof specifically binds to an activated antigen on an immune effector cell, and the second antibody or an antigen-binding fragment thereof binds to a tumor antigen, embodiments 1 to 7. The vector according to any one of.

Embodiment 9: First antibody or antigen-binding fragment thereof specifically binds to a tumor antigen, and the second antibody or antigen-binding fragment thereof binds to an activated antigen on immune effector cells, embodiments 1-7. The vector according to any one of.

Embodiment 10: Further comprises a third polynucleotide sequence encoding a third antibody or antigen-binding fragment thereof, the third antibody or antigen-binding fragment thereof binds to an activated antigen or tumor antigen on immune effector cells. , The vector according to any one of embodiments 1-9.

11: The vector according to any one of embodiments 8-10, wherein the immune effector cells include dendritic cells, natural killer (“NK”) cells, macrophages, T cells or B cells.

Embodiment 12: The vector according to any one of embodiments 8 to 11, wherein the immune effector cells are T cells or NK cells.

Embodiment 13: The activating antigen on immune effector cells is CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3, CD20, CD22 or a combination thereof. The vector according to any one of embodiments 8 to 12, which comprises.

Embodiment 14: The tumor antigens are efrin type A receptor 2 (EphA2), interleukin (IL) -13ralpha2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor. 1. Alphafet protein (AFP), cancer fetal antigen (CEA), CA-125, MUC-1, epidermal tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), blood differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, interstitial antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B cell maturation The vector according to any one of embodiments 8 to 13, comprising one or more of an antigen (BCMA), a fibroblast activation protein (FAP) alpha or a combination thereof.

Embodiment 15: The vector according to any one of embodiments 1 to 14, wherein the first antibody or an antigen-binding fragment thereof and the second antibody or an antigen-binding fragment thereof form a dimart.

Embodiment 16: The vector according to embodiment 15, wherein Dimart is a bispecific antibody.

17: The vector according to embodiment 15, wherein the dimart is a trispecific antibody.

18: The vector according to embodiment 15 or 16, wherein the bispecific antibody comprises a polypeptide sequence that is at least 95% identical to any one of SEQ ID NOs: 13 or 15.

Embodiment 19: The vector according to embodiment 15 or 17, wherein the trispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11.

20: The vector according to any one of embodiments 1-19, wherein the vector further comprises a polynucleotide sequence encoding a secreted peptide.

21: The vector according to embodiment 20, wherein the secretory peptide comprises a secretory consensus sequence.

22: The vector according to embodiment 20 or 21, wherein the secretory consensus sequence comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 51. ..

23: The vector according to embodiment 20 or 21, wherein the secretory consensus sequence comprises SEQ ID NO: 51.

Embodiment 24: The vector according to any one of embodiments 20-23, wherein the secretory consensus sequence is encoded by a polynucleotide comprising SEQ ID NO: 52 or an equivalent thereof.

25: The vector according to any one of embodiments 20-24, wherein the secretory consensus sequence further comprises 1, 2, 3, 4 or more residues at the C-terminus of the sequence.

26: The vector according to any one of embodiments 20-25, wherein the secretory consensus sequence further comprises 1, 2, 3, 4 or more Ala residues at the C-terminus of the sequence.

27: The vector according to any one of embodiments 20-26, wherein the secretory consensus sequence further comprises one, two or three Ala residues at the C-terminus of the sequence.

28: The vector according to any one of embodiments 20-27, wherein the secretory consensus sequence further comprises two Ala residues at the C-terminus of the sequence.

Embodiment 29: Embodiment 29, wherein the secretory consensus sequence comprises, or consists of, SEQ ID NO: 55, at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 55. 28. Vector.

30: The vector according to embodiment 28 or 29, wherein the secretory consensus sequence is encoded by a polynucleotide comprising SEQ ID NO: 56 or an equivalent thereof.

31: The vector according to any one of embodiments 20-30, wherein the secretory consensus sequence further comprises one Ala residue at the C-terminus of the sequence.

Embodiment 32: Embodiment 32, wherein the secretory consensus sequence comprises or consists of SEQ ID NO: 53 with at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity. 31. Vector.

33: The vector according to embodiment 31 or 32, wherein the secretory consensus sequence is encoded by a polynucleotide comprising SEQ ID NO: 54 or an equivalent thereof.

Embodiment 34: The vector according to any one of embodiments 1-33, wherein the secretory consensus sequence modulates the expression and / or secretion of dimart.

35: The vector according to any one of embodiments 1-34, wherein the secretory consensus sequence enhances expression and / or secretion of dimart.

36: The vector according to any one of embodiments 1-35, wherein the vector further comprises a polynucleotide sequence encoding a dimerization domain.

37: The vector according to embodiment 36, wherein the dimerization domain comprises a dimerization domain of human hepatocellular nuclear factor 1α (HNF1α).

Embodiment 38: The dimerized domain of HNF1α comprises a polypeptide sequence comprising at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 47. The vector according to embodiment 37.

39: The vector according to any one of embodiments 1-38, wherein the vector further comprises a promoter.

40: The vector according to embodiment 39, wherein the promoter is a constitutive promoter.

41: The vector according to embodiment 39 or 40, wherein the promoter is a tissue-specific promoter.

Embodiment 42: The promoters are Raus sarcoma virus (RSV) LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerol kinase (PGK) promoter, U6 promoter, EF1. Includes alpha shortened (EFS) promoter, phosphoglycerate kinase (PGK) promoter, ubiquitin C (UbiC) promoter, alpha-1-antitrypsin, spleen foci-forming virus (SFFV) promoter or chicken beta-actin (CBA) promoter , The vector according to any one of embodiments 39 to 41.

43: The vector according to any one of embodiments 39-42, wherein the promoter is EFS or an equivalent thereof, optionally comprising SEQ ID NO: 49.

Embodiment 44: The vector according to any one of embodiments 1-43, wherein the vector further comprises an enhancer.

45: The vector according to embodiment 44, wherein the enhancer is an RSV enhancer, a CMV enhancer and an α-fetoprotein MERII enhancer.

46: The vector according to any one of embodiments 1-45, wherein the vector further comprises one or more regulatory elements.

47: The invention of any one of embodiments 1-46, comprising a woodchuck hepatitis virus (WHP) post-transcriptional regulatory element (WPRE), optionally a regulatory element comprising SEQ ID NO: 50 or an equivalent thereof. vector.

Embodiment 48: The vector according to any one of embodiments 1-47, wherein the vector comprises a 5'end inverted sequence (ITR) and a 3'ITR.

49: The embodiment according to any one of embodiments 1-48, wherein the vector comprises the sequences set forth in SEQ ID NOs: 4, 6, 8, 12, 14, 16-23, 30-33 or 40-46. vector.

Embodiment 50: The composition comprises the vector according to any one of embodiments 1-49, a carrier, and optionally a pharmaceutically acceptable carrier.

51: The composition according to embodiment 50, wherein the composition is formulated for systemic administration.

52: The composition according to embodiment 50, wherein the composition is formulated for topical administration.

Embodiment 53: The composition according to any one of embodiments 50-52, wherein the composition is formulated for parenteral administration.

Embodiment 54: A method of treating cancer in a subject in need of treatment of the cancer, wherein an effective amount of the vector according to any one of embodiments 1 to 49 or any of embodiments 50 to 53. A method comprising administering to the subject the pharmaceutical composition according to one of the above, wherein the vector expresses a therapeutic anti-cancer antibody or an antigen-binding fragment thereof.

55: The method of embodiment 54, further comprising administering to the subject an anti-cancer agent.

56: The method of embodiment 55, wherein the anticancer agent comprises an agent selected from peptides, polypeptides, nucleic acid molecules, small molecules, viral particles or combinations thereof.

57: The method of embodiment 56, wherein the virus particles are oncolytic HSV particles.

58: The method of any one of embodiments 54-57, wherein the subject is a mammal.

59: The method according to any one of embodiments 54-58, wherein the subject is a human.

Embodiment 60: A method of producing a bispecific antibody or a trispecific antibody in a cell comprising contacting the cell with the vector according to any one of embodiments 1-49.

61: The method of embodiment 60, wherein contacting comprises transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof.

62: The method of embodiment 60 or 61, wherein the cell comprises fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melaninogenic cells, blood cells or a combination thereof.

63: The method of any one of embodiments 60-62, wherein the bispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 13 or 15.

Embodiment 64: The method of any one of embodiments 60-62, wherein the trispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11.

Embodiment 65: Any of embodiments 60-62, wherein the bispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NOs: 14, 16, 22, 23, 30-33 or 40-46. The method described in one.

Embodiment 66: The method of any one of embodiments 60-62, wherein the trispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 12.

Embodiment 67: A kit comprising the vector according to any one of embodiments 1 to 49 or the pharmaceutical composition according to any one of embodiments 50 to 53.

Embodiment 68: The kit of embodiment 67, further comprising instructional material.
Equal

Although the present disclosure has been described in connection with the embodiments described above, it is understood that the above description and examples are intended to illustrate and not limit the scope of the present disclosure. Should. Other aspects, advantages and modifications that fall within the scope of this disclosure will be apparent to those of skill in the art.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All nucleotide sequences provided herein are written in the 5'to 3'direction.

The embodiments exemplified herein are suitable in the absence of any one or more elements, one or more limitations not specifically disclosed herein. Can be carried out. Thus, for example, terms such as "comprising," "inclating," and "contining" should be read extensively and without limitation. Moreover, the terms and expressions used herein are used as descriptive terms rather than limited terms, and in the use of such terms and expressions, the features shown and described or parts thereof. There is no intention to exclude any of the equivalents of, and it is acknowledged that various modifications are possible within the scope of the present disclosure.

Accordingly, although this disclosure is specifically disclosed by a particular embodiment and features that may be present as required, modifications, improvements and variations of the embodiments disclosed herein are used by those of skill in the art. It should be understood that gains, as well as such modifications, improvements and variations, are considered to be within the scope of this disclosure. The materials, methods, and examples provided herein are representative of a particular embodiment, are exemplary, and are not intended to be a limitation to the scope of the present disclosure.

The scope of this disclosure is broadly and comprehensively described herein. Each of the narrower species and subgroups within the general disclosure also forms part of this disclosure. This includes a proviso to remove any subject matter from the genus or a comprehensive statement of the present disclosure with negative limitations, whether or not the deleted material is specifically listed herein.

Further, where the features or embodiments of the present disclosure are described in terms of Markush groups, those skilled in the art will appreciate that the embodiments of the present disclosure will also be in view of any component or subgroup of components of the Markush group. Recognize that it can be described.

Description of Government Support The invention was made with government support under grant number W81XWH-19-1-0371 awarded by the Department of Defense. The government has certain rights to the invention.

Claims (49)

Polynucleotide or vector,
(A) With the first polynucleotide sequence containing the first part of the open reading frame encoding the first polypeptide;
(B) With a second polynucleotide sequence comprising a second portion of the open reading frame encoding the first polypeptide;
(C) With a third polynucleotide sequence encoding a second polypeptide;
(D) A gene-regulated polynucleotide sequence located between the first polynucleotide and the second polynucleotide;
A polynucleotide or vector containing. Claim 1 wherein the gene-regulated polynucleotide sequence comprises a splice donor site, an upstream intron, an exon containing more than one stop codon sequence in each reading frame, a downstream intron, and a splice acceptor site. The polynucleotide or vector described. The polynucleotide according to claim 1 or 2, wherein the gene-regulated polynucleotide sequence comprises one or more of a binding sequence to an antisense oligonucleotide, a binding sequence to doxycycline, or a polynucleotide sequence encoding a riboswitch. vector. The polynucleotide or vector according to any one of claims 1 to 3, wherein the antisense oligonucleotide is a morpholino oligonucleotide. The polynucleotide or vector according to claim 4, wherein the binding sequence to the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 24 or 25. The polynucleotide or vector according to claim 4, wherein the morpholino oligonucleotide contains a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 27 or 28. The stop codon is
Oligonucleotides in the TAA, TAG or TGA group;
The polynucleotide sequence of TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1) (where x is any nucleotide); or the polynucleotide sequence of TAATTAGTTGATTTAGTAATTGAT (SEQ ID NO: 2) or its equivalent;
2. The polynucleotide or vector according to claim 2. The polynucleotide or vector according to any one of claims 1 to 7, wherein the gene-regulated polynucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 21. The invention according to any one of claims 1 to 8, wherein the first polypeptide is a first antibody or an antigen-binding fragment thereof, and the second polypeptide is a second antibody or an antigen-binding fragment thereof. Polynucleotide or vector. Any of claims 1 to 9, wherein the first antibody or an antigen-binding fragment thereof specifically binds to an activated antigen on an immune effector cell, and the second antibody or an antigen-binding fragment thereof binds to a tumor antigen. The polynucleotide or vector according to one item. Any of claims 1 to 9, wherein the first antibody or an antigen-binding fragment thereof specifically binds to a tumor antigen, and the second antibody or an antigen-binding fragment thereof binds to an activated antigen on an immune effector cell. The polynucleotide or vector according to one item. It further comprises a fourth polynucleotide sequence encoding a third antibody or antigen-binding fragment thereof, wherein the third antibody or antigen-binding fragment thereof binds to an activated antigen or tumor antigen on immune effector cells. Item 6. The polynucleotide or vector according to any one of Items 1 to 11. The polynucleotide or vector according to any one of claims 10 to 12, wherein the immune effector cell comprises a dendritic cell, a natural killer (“NK”) cell, a macrophage, a T cell, a B cell, or a combination thereof. .. The polynucleotide or vector according to any one of claims 10 to 12, wherein the immune effector cell is a T cell or an NK cell. The activating antigen on the immune effector cell comprises CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3, CD20, CD22 or a combination thereof. The polynucleotide or vector according to any one of claims 10 to 12. The tumor antigens are effrin type A receptor 2 (EphA2), interleukin (IL) -13ralpha2, EGFRVIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor 1, alpha. Fet protein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epidermal tumor antigen (ETA), tyrosinase, melanoma-related antigen (MAGE), blood differentiation antigen, surface glycoprotein, ganglioside (GM2) , Growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B cell maturation antigen (BCMA) ), The polynucleotide or vector according to any one of claims 10 to 12, comprising one or more of the fibroblast activation protein (FAP) alpha or a combination thereof. Expressing the pre-mRNA when the vector is a recombinant vector, optionally a viral vector, and the pre-mRNA encoding dimart is in contact with an antisense oligonucleotide, optionally a morpholino oligonucleotide. The polynucleotide or vector according to any one of claims 1 to 16. 17. The polynucleotide or vector according to claim 17, wherein the dimart is a bispecific antibody. 17. The polynucleotide or vector of claim 17, wherein the dimart is a trispecific antibody. The polynucleotide according to claim 18 or 19, wherein the bispecific antibody or the trispecific antibody comprises the first antibody or an antigen-binding fragment thereof and the second antibody or an antigen-binding fragment thereof. Or vector. The polynucleotide or vector of claim 18, wherein the bispecific antibody comprises a polypeptide sequence that is at least 95% identical to any one of SEQ ID NOs: 13 or 15. One of claims 1 to 21, wherein the vector expresses the pre-mRNA when the pre-mRNA encoding the trispecific antibody is in contact with an antisense oligonucleotide and optionally a morpholino oligonucleotide. The polynucleotide or vector according to. The trispecific antibody is the first antibody or an antigen-binding fragment thereof, the second antibody or an antigen-binding fragment thereof (the second antibody it antigen-binding fragment), and the third antibody or an antigen-binding fragment thereof. 22. The polynucleotide or vector according to claim 22. 22. The polynucleotide or vector of claim 22, wherein the trispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11. The polynucleotide or vector according to any one of claims 1 to 24, wherein the first antibody and the second antibody are independently single-stranded variable fragments. The polynucleotide or vector according to any one of claims 1 to 25, further comprising a secretory peptide, optionally a polynucleotide sequence encoding a secretory consensus sequence. The polynucleotide or vector according to any one of claims 1 to 26, further comprising a polynucleotide sequence encoding a dimerization domain. The polynucleotide or vector according to any one of claims 1-27, further comprising a 5'end inverted sequence (ITR) and a 3'ITR. The polynucleotide according to any one of claims 1 to 28, wherein the vector comprises the sequence of SEQ ID NO: 4, 6, 8, 12, 14, 16-23, 30-33 or 40-46. vector. The vector may be a retrovirus vector, a lentivirus vector, a mouse leukemia virus (“MLV”) vector, an Epstein-Barvirus (“EBV”) vector, an adenovirus vector, a herpesvirus (“HSV”) vector, or an adeno-associated virus ("HSV"). "AAV") The polynucleotide or vector according to any one of claims 1 to 29, which is a recombinant viral vector comprising a skeletal vector selected from the group of vectors. The polynucleotide or vector according to any one of claims 1 to 30, wherein the vector is an AAV vector, optionally a self-complementary AAV vector, and optionally an AAVrh74 vector. The composition comprises the polynucleotide or vector according to any one of claims 1 to 31, a carrier, and optionally a pharmaceutically acceptable carrier. The recombinant polynucleotide or vector according to any one of claims 1 to 31, or the recombinant polynucleotide or vector according to claim 32, which is a method for treating cancer in a subject in need of treatment for cancer. A method comprising administering a pharmaceutical composition to said subject, wherein the polynucleotide or vector expresses a Therapeutic anti-cancer antibody or antigen-binding fragment thereof. 33. The method of claim 33, further comprising administering to the subject an effective amount of an antisense oligonucleotide, optionally a morpholino oligonucleotide. 33 or 34. The method of claim 33 or 34, further comprising administering to the subject an anti-cancer agent. 35. The method of claim 35, wherein the anti-cancer agent comprises an agent selected from peptides, polypeptides, nucleic acid molecules, small molecules, viral particles or combinations thereof. 36. The method of claim 36, wherein the virus particles are oncolytic HSV particles. The method according to any one of claims 33 to 37, wherein the subject is a mammal. The method according to any one of claims 33 to 38, wherein the subject is a human. A method for producing a bispecific antibody or a trispecific antibody in a cell, wherein an effective amount of the cell containing the vector according to any one of claims 1 to 31 is used, if necessary. A method comprising contacting with a Morphorino oligonucleotide. 40. The method of claim 40, wherein the morpholino oligonucleotide contains a sequence that is at least 95% identical to a sterically pure polynucleotide. 40. The method of claim 40, wherein the vector is introduced into the cell by transfection, infection, transformation, electroporation, injection, microinjection or a combination thereof. The method according to any one of claims 40 to 42, wherein the cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, nerve cells, endocrine cells, melanin-forming cells, blood cells or a combination thereof. .. The method of any one of claims 40-43, wherein the bispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 13 or 15. The method of any one of claims 40-44, wherein the trispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 11. Claim 40-43, wherein the bispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NOs: 14, 16, 22, 23, 30-33 or 40-46. The method described. The method of any one of claims 40-44, wherein the trispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 12. A kit comprising the polynucleotide or vector according to any one of claims 1 to 31 or the pharmaceutical composition according to claim 32. The kit of claim 48, further comprising instructional material.

Images