JP2022068846A - Nucleic acid detection system and nucleic acid detection method - Google Patents

Abstract

To easily detect a nucleic acid.SOLUTION: A nucleic acid detection system according to an embodiment is a nucleic acid detection system to detect a target nucleic acid in a sample and includes a thermal inactivation chamber, an amplification chamber, and a detection chamber, all of which constitute a liquid flow path. In this system, liquid flows through the thermal inactivation chamber, the amplification chamber, and the detection chamber sequentially. The thermal inactivation chamber includes a reagent to thermally inactivate and decompose the sample. The amplification chamber includes a reagent to amplify the target nucleic acid. The detection chamber includes a test strip to conduct a Cas enzyme reaction with the target nucleic acid and a lateral flow detection.SELECTED DRAWING: Figure 3

Description

The embodiments disclosed herein and in the drawings relate to nucleic acid detection systems and nucleic acid detection methods.

The conventional nucleic acid detection technique is mainly a detection technique by PCR. The PCR detection technique has become the gold standard in the field of nucleic acid detection, and the specific nucleic acid detection flow includes steps such as sampling, nucleic acid extraction, amplification, detection, and result reporting, as shown in FIG. This technique requires expensive PCR equipment, suitable polymerases, primers and / or probes, a long total operating time, a high degree of specialization for the operator, and an experimental environment (certified PCR experiment). The room) also has specific requirements. Many attempts have been made by those skilled in the art to simplify the nucleic acid detection process and obtain detection results quickly. As a detection technique for integrating a plurality of steps, Patent Document 1 describes a system capable of amplifying a plurality of target nucleic acids in one reaction chamber, and the purpose of this system is to "fill in a sample and output a result". Can be achieved. However, since this technique is still a PCR technique, the problem of false positives cannot be avoided, and the detection device itself used is expensive, and specific experimental equipment is required for detection. Therefore, POCT (point-of-care testing) cannot be realized.

SHERLOCK technology (Specific High Sensitivity Enzymatic Reporter UnLOCKing) is a new rapid, high-sensitivity, low-cost diagnostic tool developed by Chinese-American Feng Zhang using a new system called CRISPR-Cas, such as Zika virus infection and dengue fever infection. It can be used to detect disease. This technique uses Cas13a protein with "collateral shear" activity and uses special amplification techniques to detect RNA in a sample to accurately detect a single nucleic acid molecule in serum, urine, or saliva. A possible detection system was formed (see Non-Patent Document 1). However, conventional SHERLOCK techniques and other IVD (In vitro Diagnosis) detection techniques by CRISPR, as shown in FIG. 1 or 2, are all sampling, nucleic acid extraction, amplification, Cas enzyme reaction and detection, etc. Multiple steps must be performed separately, during these steps there is a risk of contamination by operations such as opening the lid, there are specific requirements for the experimental environment, and storage in the liquid reaction system. There was also a problem that a transportation environment was required, and there was room for improvement in terms of integration and automation.

US Patent Application Publication No. 2008/0038737 US Pat. No. 7,279,811

Gootenberg, Jonathan S., et al. "Multiplexed and portable nucleic acid acid detection platform with Cas13, Cas12a, and Csm6." Science 360.6387 (2018): 439-444. Tsugunori Notomi et al. “Loop-mediated isothermal amplification of DNA” Nucleic Acids Res. 2000 Jun 15; 28 (12): e63.

One of the problems to be solved by the embodiments disclosed in the present specification and the drawings is to detect nucleic acid with high sensitivity. However, the problems to be solved by the embodiments disclosed in the present specification and the drawings are not limited to the above problems. The problem corresponding to each effect by each configuration shown in the embodiment described later can be positioned as another problem.

The nucleic acid detection system according to the embodiment is a nucleic acid detection system that detects a target nucleic acid in a sample, and includes a heat deactivation chamber, an amplification chamber, and a detection chamber that form a liquid flow path. The liquid flows through the heat deactivation chamber, the amplification chamber, and the detection chamber in order. The heat deactivation chamber contains reagents for heat deactivation and decomposition of the sample. The amplification chamber contains reagents for amplifying the target nucleic acid. The detection chamber contains a test strip for performing Cas enzymatic reaction with the target nucleic acid and lateral flow detection.

FIG. 1 is a schematic diagram comparing the present embodiment with the nucleic acid detection technique in the prior art. FIG. 2 is a schematic diagram showing a detection flow of the IVD detection technique by CRISPR. FIG. 3 is a schematic diagram showing a first embodiment of the nucleic acid detection system of the present embodiment. FIG. 4 is a schematic diagram showing a specific configuration of each chamber in the disposable detection unit of the nucleic acid detection system of the present embodiment. FIG. 5 is a schematic diagram showing a step of sampling using the nucleic acid detection system of the present embodiment. FIG. 6 is a schematic diagram showing the structure of the first chamber in the nucleic acid detection system of the present embodiment. FIG. 7 is a schematic diagram showing the structure of a wax valve in the nucleic acid detection system of the present embodiment. FIG. 8 is a schematic diagram showing a specific configuration of the fourth chamber in the nucleic acid detection system of the present embodiment. FIG. 9 is a schematic diagram showing the reaction performed in each region when a positive sample and a negative sample pass through the nucleic acid detection system of the present embodiment. FIG. 10A is a schematic diagram showing a state of color development of the test strip according to the present embodiment. FIG. 10B is a schematic view showing the state of color development of the test strip according to the present embodiment. FIG. 11 is a schematic diagram showing a second embodiment of the nucleic acid detection system of the present embodiment. FIG. 12 is a photograph of a test strip showing the detection result of Example 2.

Next, the present embodiment will be described in detail with reference to the drawings, but the present embodiment is not limited to these embodiments, and all the requirements described in the claims of the present application are satisfied. It includes embodiments.

In view of the above prior art, the object of the present embodiment is, for example, to be able to store and transport at room temperature without the need for expensive equipment, professional workers, or special laboratories, and the detection results. It is an object of the present invention to provide a highly integrated, automated and portable nucleic acid detection system capable of ensuring sequence specificity and not contaminating the inside and the outside.

The present embodiment utilizes the editable sequence specificity and collatoral shear activity of an enzyme such as Cas12 / 13 to detect the target nucleic acid in the sample and sequentially connect specific first to fourth chambers in sequence. In nucleic acid detection, eg, by forming a liquid flow path and reporting the nucleic acid detection results by color reaction on a lateral flow test strip, eg, by rationally placing the enzyme complex on a paper base material. , Sampling, nucleic acid extraction, amplification, Cas enzyme reaction, and detection and color development can be integrated to realize "sample entry, result output", and target nucleic acid in the sample can be detected, which is applicable to POCT. An automated and portable nucleic acid detection system was provided.

Further, the nucleic acid detection system of the present embodiment can realize simultaneous detection of a plurality of target nucleic acids by simultaneously including a plurality of fourth chambers in one system, and can be used for genotyping, for example, HPV genotyping. It can also be applied to MTB / RIF and simultaneous detection of DNA and RNA.

According to this embodiment, it is possible to provide a nucleic acid detection system that is compact and has high detection sensitivity.

(First Embodiment)
The first embodiment of the present embodiment is a nucleic acid detection system for detecting a target nucleic acid in a sample, which includes chambers 1 to 4 forming a liquid flow path, and the liquid is discharged from the first chamber. Flowing into the fourth chamber, the first chamber contains a swab inlet containing a swab to which the sample is attached, the second chamber contains a reagent for heat deactivating and degrading the sample, and the third chamber. Contains a reagent for isothermal amplification of the target nucleic acid, the fourth chamber contains a test strip for Cas enzymatic reaction with the target nucleic acid and for lateral flow detection, the third chamber and the first chamber. The present invention relates to a nucleic acid detection system comprising a wax valve for partitioning a chamber between the four chambers and a temperature control means for controlling the temperature of the third chamber and the wax valve.

FIG. 3 is a schematic diagram showing a first embodiment of the nucleic acid detection system of the present embodiment. As shown in FIG. 3, the nucleic acid detection system 10 includes a disposable detection unit 100 and a temperature control unit 200. In the disposable detection unit 100, the first chamber 1 to the fourth chamber 4 are connected in order from the upper side to the lower side in the figure, and a continuous liquid flow path is formed. When the disposable detector is, for example, a paper-based material, the liquid can flow from the first chamber to the fourth chamber due to the siphon effect or capillarity.

The paper base material is not particularly limited, and various materials commonly used in the field for producing disposable test strips can be used.

The disposable detection unit 100 may be cylindrical or rectangular parallelepiped, and may have a shape such as a ballpoint pen refill, the length thereof is, for example, 5 to 15 cm, and the inner diameter thereof is, for example, 1 to 1 to 1. It is 5 mm, and the length and inner diameter thereof may be any numerical value within the above ranges, and the length may be, for example, 5 cm, 6 cm, 7 cm, 8 cm, 9 cm, 10 cm, 11 cm, 12 cm, 13 cm, 14 cm. , 15 cm and the like, and the inner diameter may be 1 mm, 2 mm, 3 mm, 4 mm, 5 mm and the like, and is not particularly limited.

The temperature control unit 200 may be disposable, or may be, for example, disposable by being integrated with the disposable detection unit 100, but is preferably non-disposable from the viewpoint of cost. .. The temperature control unit 200 may have a nested hollow case shape or a semi-open type tank shape that matches the disposable detection unit 100, and may be a hollow case shape such as a ballpoint pen rod. The temperature control unit 200 heats the corresponding chamber and wax valve of the disposable detection unit 100 to a set temperature by the heating block H. At the time of use, after inserting the sampled swab into the disposable detection unit 100, the whole or part of the disposable detection unit 100 is inserted or embedded in the temperature control unit 200, and then the temperature control unit 200 is started. Perform the set temperature control program. The temperature control unit is not indispensable, and when the reaction is at room temperature, the nucleic acid detection system of the present embodiment may not include the temperature control unit.

(1st chamber)
FIG. 4 is a schematic diagram showing a specific configuration of each chamber in the disposable detection unit of the nucleic acid detection system shown in FIG. As shown in FIG. 4, the first chamber 1 includes a swab inlet 5 into which the swab to which the sample is attached is inserted.

FIG. 5 is a schematic diagram showing a step of sampling using the nucleic acid detection system of the present embodiment. As shown in FIG. 5, after sampling with a swab, the liquid sample containing the target nucleic acid is placed in the liquid flow path by inserting it into the swab inlet 5 of the nucleic acid detection system and pressing the swab against the wall of the system, or by the extrusion passage 6. Then, the swab is folded, the disposable detection unit 100 is inserted and embedded in the temperature control unit 200, and the liquid sample entering the liquid flow path is subjected to the siphon effect or the capillary phenomenon from the first chamber 1 to the fourth chamber. It flows into the chamber 4.

FIG. 6 is a schematic diagram showing the structure of the first chamber in the nucleic acid detection system of the present embodiment. The structure of the first chamber is not particularly limited as long as the swab can be inserted, and the first chamber may have a structure such as an extrusion funnel 7, specifically, on an inner wall as shown in FIG. It may be funnel-shaped with a pressing protrusion 8. It is preferable that a filter 9 is further provided between the first chamber 1 and the second chamber 2 so that the sample is roughly filtered to purify the sample.

The first chamber does not necessarily have to be provided in the nucleic acid detection system. For example, if a lid with an extruded funnel 7 is provided in the second chamber, the first chamber may not be provided in the nucleic acid detection system. The first chamber is also referred to as a sample chamber.

(2nd chamber)
As shown in FIG. 4, the second chamber 2 contains a reagent for thermally inactivating and decomposing the sample, and the liquid sample is water after passing through the filter 9 and entering the second chamber 2. It is sum-activated and thermally inactivated and decomposed by the reagents in it. Reagents used for heat inactivation and degradation are, for example, enzyme-containing buffers used for inactivation and degradation.

Examples of the enzyme include protease K, RNase nuclease and / or peptidase. These enzymes can decompose membrane proteins, proteins bound to DNA, RNA, and the like, dissolve virusware, and release nucleic acids such as DNA and RNA into samples. The above-mentioned enzyme may react at room temperature, but it is also possible to select an enzyme species resistant to high temperature and react at high temperature. In this case, the target nucleic acid in the sample can be further inactivated by heating the chamber.

In addition to the above-mentioned enzymes, the buffer agent may contain, for example, EDTA, Tris-HCl, and the like, which are common components contained in the preparation of a buffer solution in the present field, and is not particularly limited.

The reagent contained in the second chamber 2 of the nucleic acid detection system of the present embodiment is a lyophilized reagent ball R or a lyophilized reagent (similar to the following reagents) that is adsorbed on the holder material P. Is preferable.

FIG. 7 is a schematic diagram showing the structure of a wax valve in the nucleic acid detection system of the present embodiment. As shown in FIG. 7, a thermal instability valve for partitioning the chamber, for example, a wax valve W, may be provided between the second chamber 2 and the third chamber 3. The wax valve may be composed of a single wax layer, or may be adsorbed on the holder material P. An absorbent material S may be provided around the wax valve W, and is absorbed by the absorbent material S after the wax valve is melted. The wax valve W (the same applies to the wax valve W between the third chamber and the fourth chamber described later) opens (opens) during heating, so that the liquid sample flows from the second chamber to the third chamber.

In the present embodiment, the case where the wax valve is used has been described, but the present invention is not limited to this, and a known valve can be arbitrarily applied. As the known valve, for example, a valve that opens by melting by electrical stimulation, an electric valve, or the like can be applied. The second chamber is also called a heat deactivation chamber.

(Third chamber)
As shown in FIG. 4, the third chamber 3 contains a reagent for amplifying the target nucleic acid, and the liquid sample is amplified in the chamber, for example, isothermally amplified. The isothermal amplification may be any one selected from amplification by nucleic acid sequence, recombinant enzyme polymerase amplification, loop-mediated isothermal amplification, chain substitution amplification, ribonuclease-dependent amplification, and slit enzyme amplification. The temperature control unit 200 may be used to control the temperature of the third chamber 3 and / or the wax valve W may be further heated so as to facilitate amplification. This makes it possible to control the flow of the liquid sample between the chambers.

The reagent and method used for amplification may be carried out with reference to the description in the prior art, and for example, the description in Non-Patent Document 2 or Patent Document 2 is applicable, but is not particularly limited. The third chamber is also called an amplification chamber.

(4th chamber)
When the wax valve W between the third chamber 3 and the fourth chamber 4 is heated and melted and opened, the liquid sample flows into the fourth chamber 4.

As shown in FIG. 4, the fourth chamber 4 contains a test strip for performing Cas enzyme reaction and lateral flow detection with the target nucleic acid in the sample.

The reagent for carrying out the Cas enzyme reaction contains a Cas enzyme complex. Specifically, the Cas enzyme complex may include a Cas enzyme, a guide nucleic acid, and a probe. The guide nucleic acid contains a guide sequence capable of binding to the target nucleic acid in the sample and can form a complex with the Cas enzyme. The probe may be a DNA or RNA-based molecule containing a non-target nucleic acid sequence and can be sheared by the Cas enzyme to generate the molecule required for subsequent reactions.

The Cas enzyme is, for example, Cas12, Cas13, or Cas14. These may have the shear activity of the target nucleic acid, for example, at least one selected from Cas12a, Cas13a, Cas13b, Cas14a, Cas14b and Cas14c, and may have the shear activity of the target nucleic acid, for example. , DCas12a, dCas13a, dCas13b, dCas14a, dCas14b and dCas14c. For example, it is not necessary for the Cas enzyme to be active just by detecting the presence or absence of the target nucleic acid by the nucleic acid detection system of the present embodiment. However, it may be active. The fourth chamber is also referred to as a detection chamber.

FIG. 8 is a schematic diagram showing a specific configuration of the fourth chamber in the nucleic acid detection system of the present embodiment.

From left to right, sample pad 11, Cas enzyme reaction region 12 (Cas enzyme complex), Cas enzyme reaction termination region 13 (Cas enzyme antibody or inhibitor), gold-labeled anti-FAM antibody region 14, streptavidin region 15 ( The control band 1), the antibody capture region 16 (test band), the anhydrous copper sulfate band 17 (control band 2), and the absorption pad 18.

FIG. 9 is a schematic diagram showing the reaction performed in each of the above regions when a positive sample and a negative sample pass through the nucleic acid detection system of the present embodiment.

Next, with reference to FIGS. 8 and 9, the state of detection and color development in the case of positive and negative samples in the fourth chamber 4 will be described in the following steps S11 to S16.

Step S11: After the liquid sample (hereinafter, also simply referred to as “liquid”) is placed in the sample pad 11, the sample first passes through the Cas enzyme reaction region, in which the positive sample activates the Cas enzyme complex and the probe ( The probe was not cleaved in the negative sample, whereas the reported sequence) was cleaved to produce the separated FAM and biotin.

Step S12: After the Cas enzyme-reacted product passes through the Cas enzyme reaction end group, the Cas enzyme reaction ends, the Cas enzyme is captured, and the forward flow does not continue. This makes it possible to secure the reaction efficiency and time for detection.

Step S13: The reported sequence, in which the liquid continued to flow forward and was cleaved and not cleaved, bound to the anti-FITC, FAM antibody in the gold-labeled anti-FAM antibody region.

Step S14: As the liquid continued to reach the streptavidin region, biotin was captured and the gold-labeled particles aggregated and developed color (control band 1). In this region, the reported sequence develops color even though it has been cleaved or not cleaved.

Step S15: As the liquid continued to reach the antibody capture region, the FAM end + FITC, FAM antibody + gold-labeled particles of the cleaved report sequence bound to the antibody capture region, and the gold-labeled particles aggregated and developed color (ie,). Two-line coloring). In the case of a negative sample, the reported sequence was not cleaved and all the reported sequences were bound to the streptavidin region, so that the antibody capture region did not develop color.

Step S16: The liquid continues to pass through the anhydrous copper sulphate band to reach the absorption pad, and when the aqueous solution flows through the anhydrous copper sulphate band regardless of the presence of the target sequence in the sample, the color is blue. Become. A blue color indicates that the amount of liquid was sufficient and that the test strip had completely flowed. On the other hand, if the anhydrous copper sulfate band (control band 2) does not develop color, it is determined that the detection is invalid. This allows quality control of the effectiveness of detection of the entire test strip.

As is clear from the above, it can be determined that the detection result is valid only when the control band 1 and the control band 2 develop colors at the same time. As in the present embodiment, by installing an anhydrous copper sulfate band (control band 2) in addition to the control band 1, the sample amount of the test strip in the prior art when the control band is designed before and the test band is designed after. It is possible to solve the problem of false negatives (detection invalidity) due to lack of. From this, it can be seen that according to the present embodiment, the accuracy of nucleic acid detection is also improved.

10A and 10B are schematic views showing the state of color development of the test strip according to the present embodiment. FIG. 10A is a schematic diagram showing a state of color development determined to be effective when a positive sample and a negative sample pass through the nucleic acid detection system of the present embodiment, and FIG. 10B is a schematic diagram showing various color development determined to be invalid. It is a schematic diagram which shows the state of.

As described above, the nucleic acid detection system according to the first embodiment is a nucleic acid detection system that detects a target nucleic acid in a sample, and is a heat deactivation chamber, an amplification chamber, and a detection chamber that form a liquid flow path. including. The liquid flows through the heat deactivation chamber, the amplification chamber, and the detection chamber in order. The heat deactivation chamber contains reagents for heat deactivation and decomposition of the sample. The amplification chamber contains reagents for amplifying the target nucleic acid. The detection chamber contains a test strip for performing Cas enzymatic reaction with the target nucleic acid and lateral flow detection. According to this, the nucleic acid detection system according to the first embodiment can detect nucleic acid with high sensitivity.

Further, it is preferable that the nucleic acid detection system further includes a sample chamber including a swab inlet into which the swab to which the sample is attached is inserted in front of the heat deactivation chamber.

(Second embodiment)
A second embodiment of the present embodiment is a nucleic acid detection system that simultaneously detects a plurality of target nucleic acids in a sample, and includes the nucleic acid detection system according to the first embodiment, wherein the fourth chamber has 2 With respect to a nucleic acid detection system, including one or more test strips.

Similar to the principle and operation in the nucleic acid detection system of the first embodiment, the liquid flows from the first chamber 1 to the fourth chamber 4. However, in the present embodiment, the fourth chamber is branched into a plurality of channels to detect a plurality of target nucleic acids in parallel. The editable Cas complex for each channel may be different to detect different target nucleic acids.

FIG. 11 is a schematic diagram showing a second embodiment of the nucleic acid detection system of the present embodiment. Since this nucleic acid detection system has two fourth chambers (lateral flow test strips), simultaneous detection of two target nucleic acids can be achieved.

According to the nucleic acid detection system according to the second embodiment of the present embodiment, it can be used for genotyping, for example, HPV genotyping and MTB / RIF, and can be applied to simultaneous detection of DNA and RNA. .. For example, if each Cas complex contained in two or more test strips is designed for a different target sequence, the genotype of the target nucleic acid in the sample can be determined.

Thereby, this embodiment is a method for determining the genotype of the target nucleic acid in the sample, and is a method using the nucleic acid detection system according to the second embodiment. Further, in the present embodiment, the Cas complex contained in the two or more test strips is designed for different target sequences.

Further, this embodiment is a method for detecting a target nucleic acid in a sample, in which the swab is sampled using the nucleic acid detection system according to the first or second embodiment, and the swab is used in the detection system. The present invention relates to a method including a step of inserting into a swab inlet, a step of turning on the temperature control means, and a step of observing a change in color of a test strip in the fourth chamber. The sample may be urine, blood, serum, cerebrospinal fluid, saliva, or the like.

(Example)
Hereinafter, the nucleic acid detection system and the nucleic acid detection method of the present embodiment will be specifically exemplified by using a new type coronavirus (hereinafter, also referred to as “Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)”) as an example. The embodiments are not limited to these examples. The new coronavirus infection is also described as "COVID-19".

(Example 1: Preparation of nucleic acid detection system)
From the new coronavirus genomic sequence, we designed a crRNA sequence to detect the N gene using a LAMP primer for LAMP isothermal amplification and Cas12 enzyme.

The template is a plasmid containing the N gene fragment of SARS-CoV-2, and the N gene is as follows (SEQ ID NO: 1).

配列番号１：CCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAG GCCTAA

Table 1 below shows the LAMP primer sequences used in this example.

The designed crRNA sequence (SEQ ID NO: 8) is as follows.

SEQ ID NO: 8: UAAUUUCUACUAAGUGUAGAUUGAACUGUUGCGACUACGU

Probe sequence: FITC-T12-Biotin

All of the above materials are synthesized and purchased from Nanjing Kinsui Company.

The LAMP amplification method may be performed with reference to the specification of the WarmStart® LAMP kit.

The detection test paper for SARS-CoV-2 was prepared in the following steps S21 to S29.

Step S21: Glass fiber filter paper (Whatman, 1827-021) was cut to a desired size.

Step S22: High-pressure sterilization is performed for 90 minutes (high-pressure sterilizer, MKII).

Step S23: Block for 12 hours in BSA (EM Millipore, 126609-10GM) without 5% nuclease.

Step S24: Wash three times with nuclease-free water (Life Technologies, AM9932).

Step S25: Add 4% RNASure (Life Technologies, AM7006), leave at 60 ° C. for 20 minutes, then wash 3 times with nuclease-free water.

Step S26: The treated paper is dried in an oven (DHG-9140A, Shanghai Kazunori) at 80 ° C. for 15 minutes.

Step S27: By design, the components of each chamber are placed on the test strip processed as described above. Specifically, it becomes as follows (a) to (d).

a) Second chamber

b) Third chamber: Amplified mixture is shown in Table 3.

c) Here, carnauba wax is used as the wax valve (C804522, MACKLIN).

d) Fourth Chamber: Reagents and other components contained in the Cas enzyme reaction region are shown in Tables 4 and 5, respectively.

Step S28: Quench with liquid nitrogen and freeze-dry overnight.

Step S29: Assemble the test paper prepared in the dry environment into the sleeve material.

(Example 2: Detection of SARS-CoV-2 by the nucleic acid detection system of Example 1)
The detection test paper for SARS-CoV-2 in Example 1 and the temperature control unit are combined, and 50 μL of a positive plasmid solution (positive sample) and a solution containing no SARS-CoV-2 (negative sample) in the first chamber. Was dropped. The temperature control means operated according to a preset program, and the sample flowed from the first chamber to the second chamber. In this embodiment, a simulated sample was adopted, and since heat deactivation and decomposition in the second chamber were not required, the sample flowed into the third chamber as it was. The temperature of the third chamber was controlled to 65 ° C., LAMP amplification was performed in the chamber, and after 10 minutes, the wax valve opened and flowed into the fourth chamber. The temperature of the fourth chamber was controlled to 37 ° C. In this chamber, the liquid first enters the Cas enzyme reaction region, the lyophilizing reagent in the region hydrates, the predesigned Cas enzyme recognizes the target nucleic acid, and the probe is sheared. The reaction time is 5 minutes. The sheared probe continues to move toward the water absorption pad of the test strip, and according to the designed principle, the control band 1 turns red first, then the test band turns red, and finally the anhydrous copper sulfate band (control band). 2) turned blue. In the positive sample, all the above three bands develop color, whereas in the negative sample, the test band does not develop color. A photograph of the test strip (fourth chamber) showing the above detection results is shown in FIG.

As can be seen from the above, according to this embodiment, storage and transportation at room temperature are possible without the need for expensive equipment, specialized workers, and special laboratories, and the sequence specificity of the detection result is ensured. It is possible to provide a highly integrated, automated and portable nucleic acid detection system that can realize "sample entry, result output" without contaminating the inside and outside, and can be applied to POCT. Further, the nucleic acid detection system of the present embodiment can simultaneously detect a plurality of target nucleic acids by including a plurality of fourth chambers, and can be applied to, for example, genotyping and simultaneous detection of DNA and RNA. be.

According to at least one embodiment described above, nucleic acid can be detected with high sensitivity.

Although some embodiments have been described, these embodiments are presented as examples and are not intended to limit the scope of the invention. These embodiments can be implemented in various other embodiments, and various omissions, replacements, changes, and combinations of embodiments can be made without departing from the gist of the invention. These embodiments and variations thereof are included in the scope of the invention described in the claims and the equivalent scope thereof, as are included in the scope and gist of the invention.

10 Nucleic acid detection system 100 Disposable detector 200 Temperature control unit 1 1st chamber 2 2nd chamber 3 3rd chamber 4 4th chamber 5 Swab inlet 6 Extrusion passage 7 Extrusion funnel 8 Pressing protrusion 9 Filter W Wax valve R Freezing and drying reagent Ball P Holder material S Absorbent material H Heating block 11 Sample pad 12 Cas enzyme reaction region 13 Cas enzyme reaction end region 14 Gold-labeled anti-FAM antibody region 15 Streptavidin region 16 Antibody capture region 17 Anhydrous copper sulfate band 18 Absorption pad

Claims (25)

A nucleic acid detection system that detects target nucleic acids in a sample.
Includes a heat deactivation chamber, an amplification chamber, and a detection chamber that form a liquid flow path.
The liquid flows through the heat deactivation chamber, the amplification chamber, and the detection chamber in this order.
The heat deactivation chamber contains reagents for heat deactivation and decomposition of the sample.
The amplification chamber contains reagents for amplifying the target nucleic acid.
The detection chamber comprises a test strip for performing Cas enzymatic reaction with the target nucleic acid and lateral flow detection.
Nucleic acid detection system. A sample chamber including a swab inlet into which the swab to which the sample is attached is inserted is further provided in front of the heat deactivation chamber.
The nucleic acid detection system according to claim 1. A filter for purifying the sample is provided between the sample chamber and the heat deactivation chamber.
The nucleic acid detection system according to claim 2. The sample chamber further comprises an extrusion passage.
The nucleic acid detection system according to claim 2 or 3. A valve for partitioning the chamber is provided between the heat deactivation chamber and the amplification chamber.
The nucleic acid detection system according to any one of claims 1 to 4. A valve for partitioning the chamber is provided between the amplification chamber and the detection chamber.
The nucleic acid detection system according to any one of claims 1 to 5. The valve is a wax valve.
The nucleic acid detection system according to claim 5 or 6. The wax bulb is composed of a single wax layer or is adsorbed on a holder material.
The nucleic acid detection system according to claim 7. A temperature control means for controlling the temperature of the amplification chamber is provided.
The nucleic acid detection system according to any one of claims 1 to 8. The wax valve is opened by heating the temperature control means.
The nucleic acid detection system according to claim 7. The reagent in the heat deactivation chamber and the amplification chamber is a lyophilizer.
The nucleic acid detection system according to any one of claims 1 to 10. The lyophilizer is adsorbed on the lyophilized reagent balls or holder material.
The nucleic acid detection system according to claim 11. The reagent used for the Cas enzyme reaction contains a Cas enzyme complex and contains.
The Cas enzyme complex comprises a Cas enzyme, a guide nucleic acid and a probe.
The guide nucleic acid comprises a guide sequence capable of binding to the target nucleic acid and can form a complex with the Cas enzyme.
The probe is a DNA or RNA-based molecule containing a non-target nucleic acid sequence that, when sheared by the Cas enzyme, produces the molecule required for subsequent reactions.
The nucleic acid detection system according to any one of claims 1 to 12. The reagent for carrying out the Cas enzyme reaction is a lyophilizer.
The nucleic acid detection system according to any one of claims 1 to 13. The lyophilizer is a lyophilized reagent ball or is adsorbed on a holder material.
The nucleic acid detection system according to claim 14. The amplification is one selected from amplification by nucleic acid sequence, recombinant enzyme polymerase amplification, loop-mediated isothermal amplification, chain substitution amplification, ribonuclease dependent amplification, or slit enzyme amplification.
The nucleic acid detection system according to any one of claims 1 to 15. The detection chamber includes, in order, a sample pad, a Cas enzyme reaction region, a gold-labeled anti-FAM antibody region, a streptavidin region, and an antibody capture region along a liquid flow path.
The nucleic acid detection system according to any one of claims 1 to 16. The detection chamber further comprises a Cas enzyme reaction termination region containing a Cas enzyme antibody or inhibitor after the Cas enzyme reaction region and before the gold-labeled anti-FAM antibody region.
The nucleic acid detection system according to claim 17. The detection chamber further comprises an anhydrous copper sulphate band after the antibody capture region.
The nucleic acid detection system according to claim 17 or 18. The detection chamber is
Includes 2 or more test strips
Using the two or more test strips, multiple target nucleic acids in a sample can be detected simultaneously.
The nucleic acid detection system according to any one of claims 1 to 19. A nucleic acid detection method for detecting a target nucleic acid in a sample.
Using a nucleic acid detection system, which comprises a heat deactivation chamber, an amplification chamber, and a detection chamber forming a liquid flow path, the liquid flows through the heat deactivation chamber, the amplification chamber, and the detection chamber in sequence.
In the heat deactivation chamber, the sample is heat deactivated and decomposed.
In the amplification chamber, the target nucleic acid is amplified and
In the detection chamber, Cas enzyme reaction with the target nucleic acid and lateral flow detection are performed.
Nucleic acid detection method including. The nucleic acid detection system further comprises a sample chamber including a swab inlet into which the swab to which the sample is attached is inserted in front of the heat deactivation chamber.
In the sample chamber, the swab is inserted into the swab inlet.
The nucleic acid detection method according to claim 21. Observe the color change of the test strip in the detection chamber,
The nucleic acid detection method according to claim 21 or 22. The sample is urine, blood, serum, cerebrospinal fluid or saliva,
The nucleic acid detection method according to any one of claims 21 to 23. The detection chamber comprises two or more test strips.
Each Cas complex contained in the two or more test strips was designed for a different target sequence.
Using the two or more test strips, a plurality of target nucleic acids in the sample are simultaneously detected.
The nucleic acid detection method according to any one of claims 21 to 24.

Images