JP2022041955A - Agent for promoting the growth of akkermansia bacteria - Google Patents

Abstract

To provide a novel agent and composition that can promote the growth of Akkermansia bacteria in the intestines and can increase the share of the Akkermansia bacteria.SOLUTION: The inventive agent for promoting the growth of Akkermansia bacteria contains arctigenin and/or arctiin as an active ingredient. The arctigenin and/or arctiin may be contained as burdocks, burdock fruits, burdock sprouts or Forsythia fruits or extract thereof.SELECTED DRAWING: Figure 1

Description

The present invention relates to agents and food compositions that promote the growth of Akkermansia bacteria in the intestine.

Akkermansia muciniphila is a mucin-degrading bacterium present in the human intestine, with mucin as the sole source of carbon and nitrogen. Akkermansia muciniphila is abundant in the mucosal layer of the host's intestine, most often in the cecum. Within one year after the birth of a human, this bacterium stably forms a colony in the human intestine and increases as an adult, but gradually decreases in the elderly (Non-Patent Document 1). ..

Non-Patent Document 1, which is a review article on Akkermansia muciniphila, describes that Akkermansia muciniphila has an action of improving the metabolic function and immune function of the host. Furthermore, it has been suggested that Akkermansia muciniphila may have the effect of modifying cancer treatment. It has also been suggested that Akkermansia muciniphila has the effect of maintaining the intestinal microbial balance of the host by converting mucin into a beneficial by-product.

The mucosal layer of the intestine mainly protects epithelial cells from attack by microorganisms and provides the microorganisms with energy for growth used as nutrition. When the amount of Akkermansia muciniphila present in the intestine is low, the mucous membrane becomes thin and the barrier function of the intestine is weakened, and pathogenic toxins and lipopolysaccharide (LPS) or antigens derived from foods that cause allergies invade the host. It has been found to be easier to do. The relationship between Akkermansia muciniphila and the host affects not only the uptake, utilization and consumption of energy associated with glucose, protein and lipid metabolism, but also the health of the mucosal layer and the associated mucosal immune response. Akkermansia muciniphila not only participates in the immune regulation of the host, but also enhances the health of the epithelial cells of the intestine and the thickness of the mucosal layer, thereby promoting the health of the intestine (Non-Patent Document 1). ..

In this way, the intestine retains a barrier function that prevents harmful substances from entering the living body. Tight junctions that connect epithelial cells of the intestinal tract are composed of cell-cell adhesion factors and are involved in barrier function. In dyslipidemia and diabetes, this intestinal barrier function is reduced and LPS, which is the causative agent of metabolic endotoxin, flows into the body, which causes chronic inflammation in the body and increases inflammatory cytokines in the blood. LPS is also known to be involved in suppressing lipid metabolism in the liver and enhancing inflammation in adipose tissue. Furthermore, LPS is known to be involved in inflammation of nerve cells and deterioration of cognitive function in the brain.

As mentioned above, Akkermansia muciniphila in the intestine is closely involved in the host's intestinal microbial balance, metabolism and immune response. Therefore, increasing or maintaining the amount of Akkermansia muciniphila in the intestine is important for the treatment, improvement and prevention of various diseases related to intestinal microbial balance, metabolism and immune response, as well as improvement of quality of life.

Patent Document 1 discloses an Akkermansia muciniphila increase-promoting composition containing a sialyl glycopeptide in which a sugar chain is bound to a peptide having a threonine and / or serine residue.

Patent Document 2 discloses a method for ingesting and using a composition containing astaxanthin in order to increase the number of bacteria belonging to the genus Akkermansia in the intestinal flora.

Patent Document 3 discloses an Akkermansia bacterium growth-promoting agent containing a plant-derived pentamer or more proanthocyanidins or a pharmaceutically acceptable salt thereof as an active ingredient.

Japanese Unexamined Patent Publication No. 2019-43867 Japanese Unexamined Patent Publication No. 2019-131527 Japanese Unexamined Patent Publication No. 2018-8911

Ting Zhang, et al., Akkermansia muciniphila is a promising probiotic, “Microbial Biotechnology”, 2019, Volume 12, p.1109-1125

It is an object of the present invention to provide a novel agent and composition capable of promoting the growth of Akkermansia bacterium in the intestine and increasing the composition ratio of Akkermansia bacterium.

As a result of diligent studies to solve the above problems, the present inventors obtained the composition ratio of Akkermansia bacteria in the intestine by administering alktigenin and Gobous sprout extract and forsythia leaf extract containing arktigenin to mice. Found to increase. The present inventors have also found that arctigenin, burdock sprout extract and forsythia leaf extract have an action of increasing the amount of short-chain fatty acids in the cecum. The present invention has been made based on these findings.

The present invention provides an Akkermansia bacterium growth promoter containing alktigenin and / or alktiin as an active ingredient.

The present invention also provides an Akkermansia bacterium growth promoter in which the arktigenin and / or alktiin is contained as burdock, burdock, burdock sprout or forsythia or an extract thereof in the Akkermansia bacterium growth promoter. do.

The present invention also provides a food composition for promoting the growth of Akkermansia bacterium, which contains alktigenin and / or alktiin as an active ingredient.

The present invention also comprises the Akkermansia bacterium growth promoting food composition in which the alktigenin and / or alktiin is contained as gobo, goboushi, gobous sprout or renkyo or an extract thereof. Provide a food composition for use.

The invention also contains alcoholic hepatitis (ASH), IgE-related atopic dermatitis, and inflammatory bowel disease (ulcerative) through the growth-promoting action of Ackermancia, which contains arctigenin and / or arctiin as active ingredients. Treat and improve at least one disease selected from the group consisting of (such as colitis and Crohn's disease), irritable bowel syndrome, appendicitis, insulin resistance and diabetes due to increased LPS, atherosclerosis and autism. And / or provide a pharmaceutical composition for prevention.

The present invention also provides an intestinal short chain fatty acid production promoter containing alktigenin and / or alktiin as an active ingredient.

The present invention also comprises the above-mentioned intestinal short-chain fatty acid production-promoting agent, wherein the arktigenin and / or alktiin is contained as burdock, burdock, burdock sprout or renkyo or an extract thereof. I will provide a.

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to provide a novel agent and composition capable of promoting the growth of Akkermansia bacterium in the intestine and increasing the composition ratio of Akkermansia bacterium. In addition, by using the present invention, the amount of short-chain fatty acids in the intestine can be increased by inducing the growth of Akkermansia bacterium. Furthermore, the Akkermansia genus bacterial growth promoter of the present invention can be used to provide a method for improving the intestinal flora.

The figure which shows the change of the body weight (g) in a normal group, a control group, an arctigenin high dose group (AG), a burdock sprout extract high dose group (GSE) and a forsythia leaf extract high dose group (RLE). Graphs showing the expression levels of CD11c, PAI-1 and TNFα in the Normal group, Control group, Arctigenin high-dose group (AG), Gobous sprout extract high-dose group (GSE) and Forsythia leaf extract high-dose group (RLE). Normal group, Control group, Arctigenin low dose group (AG Low), Arctigenin high dose group (AG High), Gobous sprout extract low dose group (GSE Low), Gobous sprout extract high dose group (GSE High), Lengyo leaf extract low A graph showing the composition ratio of the genus level of bacteria contained in the contents of the cecum for the dose group (RLE Low) and the lotus leaf extract high dose group (RLE High). Normal group, Control group, Arctigenin low dose group (AG Low), Arctigenin high dose group (AG High), Gobous sprout extract low dose group (GSE Low), Gobous sprout extract high dose group (GSE High), Lengyo leaf extract low A graph showing the composition ratio of Ackermanncia bacteria in the bacteria contained in the contents of the cecum for the dose group (RLE Low) and the lotus leaf extract high dose group (RLE High). The figure which shows the change of the body weight (g) in a normal group, a control group, an arctigenin group (AG), a metformin group (MF), a burdock sprout extract group (GSE) and a forsythia leaf extract group (RLE). The figure which shows the visceral fat weight (g) in a normal group, a control group, an arctigenin group (AG), a metformin group (MF) a burdock sprout extract group (GSE) and a forsythia leaf extract group (RLE). A graph showing the composition ratio of the genus level of bacteria contained in feces for the Normal group, Control group, Arctigenin group (AG), Metoformin group (MF) Gobous sprout extract group (GSE) and Forsythia leaf extract group (RLE). Quantitative results of Akkermansia bacteria contained in feces of Normal group, Control group, Arctigenin group (AG), Metoformin group (MF) Gobous sprout extract group (GSE) and Forsythia leaf extract group (RLE) are shown. Graph. A graph showing the quantitative results of short-chain fatty acids contained in the contents of the cecum for the Normal group, Control group, Arctigenin group (AG), Metoformin group (MF) Gobous sprout extract group (GSE) and Forsythia leaf extract group (RLE).

The present invention provides an Akkermansia bacterium growth promoter containing alktigenin and / or alktiin as an active ingredient. By using the Akkermansia genus bacterial growth promoter of the present invention, it is possible to provide a method for improving the intestinal flora.

As used herein, the term "Akkermansia bacterium" is a bacterium belonging to the genus Akkermansia, and includes, for example, Akkermansia muciniphila.

As used herein, "promoting the growth of bacteria" means, for example, increasing the number of bacteria, maintaining the number of bacteria, suppressing the decrease in the number of bacteria, and increasing the weight of bacteria. Includes, maintaining the weight of the bacterium, suppressing the decrease in the weight of the bacterium, and increasing the composition ratio of the bacterium.

The Akkermansia bacterium growth promoter of the present invention can improve the intestinal flora by selectively changing the growth and activity of specific intestinal bacteria. By improving the intestinal flora, prebiotic-like effects can be obtained that have a beneficial effect on the host and induce systemic effects that are beneficial to the health of the host. Its beneficial effects include intestinal regulation (improvement of bowel movements), improvement of dyslipidemia, improvement of insulin resistance, promotion of mineral absorption, reduction of urinary nitrogen, prevention and improvement of colorectal cancer and inflammatory bowel disease. , Allergy-suppressing action and enhancement of intestinal immunity.

The present invention also provides an intestinal short chain fatty acid production promoter containing alktigenin and / or alktiin as an active ingredient. Short-chain fatty acids in the intestine are produced by intestinal bacteria, serve as an energy source for intestinal epithelial cells, are absorbed from the intestine, and are metabolized in the liver and muscles. Short-chain fatty acids have the function of acting on adipocytes and suppressing the accumulation of fat. In addition, short-chain fatty acids act on nerve cells and activate systemic metabolism via sympathetic nerves. Intestinal short-chain fatty acids also suppress the growth of pathogens and improve the balance of the intestinal flora by lowering the intestinal pH. In addition, short-chain fatty acids are known to regulate immune function. For example, short-chain fatty acids enhance the barrier function of the intestinal epithelium and suppress inflammation and pathogen infection. In addition, short-chain fatty acids induce the differentiation of B cells into antibody-producing cells, promote the secretion of IgA and IgG, and enhance intestinal immunity. In addition, short-chain fatty acids induce Treg cell proliferation and suppress excessive immune response. That is, by promoting the production of short-chain fatty acids, effects such as prevention of obesity and diabetes and regulation of immune function can be obtained.

In the present invention, short-chain fatty acids include acetic acid, propionic acid, butyric acid and the like. As used herein, "promoting the production of short-chain fatty acids in the intestine" includes increasing the amount of short-chain fatty acids present in the intestine. An increase in short-chain fatty acids includes an increase in at least one short-chain fatty acid or an increase in the total amount of multiple short-chain fatty acids. As used herein, the term "intestine" includes the large intestine. The colon is composed of a colon including the cecum, ascending colon, transverse colon, descending colon and sigmoid colon, and a rectum including the rectal sigmoid, upper and lower rectum. As used herein, the "intestine" can be any or more of these sites.

Arctigenin and arctiin are one of the diphenylpropanoids (lignans) contained in plants such as burdock. Arctiin is a precursor of arctigenin and is known to be metabolized in vivo to become arctigenin. As the arctigenin and / or arctiin, chemically synthesized arctigenin and / or arctiin may be used, or plant-isolated arctigenin and / or arctiin may be used. Further, as alktigenin and / or alktiin, the plant itself containing alktigenin and / or alktiin or an extract of this plant may be used. Plants containing arctigenin and / or arctiin include, for example, forsythia viridis (sprouts, leaves, rhizomes, forsythia viridis), forsythia viridis (flowers, leaves, fruits, rhizomes), forsythia viridis (flowers, leaves, fruits, rhizomes), forsythia viridis (flowers).・ Leaves / Fruits / Rhizome), Forsythia viridis (Flowers / Leaves / Fruits / Rhizome), Benibana, Yagurumagiku, American Oniazami, Santorisou (Gibanaazami), Cardon, Gorotsuki thiszami, Aniurocoazami, Sesame, Momijihirugao, Shinchikuhimehagi, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis, Forsythia viridis. Of these, burdock (particularly burdock and burdock sprout) and forsythia (particularly leaves) are preferred because of their high content of arktigenin and / or arktiin. When the plant itself is used, it can be raw or dried and chopped, or dried and powdered.

When using a plant extract as arctigenin and / or arctiin, the extract may be prepared from the plant, for example by the following methods. The extract used in the present invention may be extracted from a plant containing, for example, arctigenin and / or arctiin by two steps, an enzymatic conversion step and an extraction step with an organic solvent.

The enzyme conversion step is a step of enzymatically converting arctiin contained in the plant into arctigenin by β-glucosidase, which is an enzyme inherent in the plant. Specifically, by keeping the dried and cut plants at an appropriate temperature, the endogenous β-glucosidase acts to promote the reaction from arctiine to arctigenin. For example, the plant can be kept at an arbitrary temperature by adding an arbitrary solution such as water to the cut plant and stirring the mixture at a temperature of around 30 ° C (20 to 50 ° C).

The extraction step with an organic solvent is a step of extracting arctigenin and arctiin from a plant using any suitable organic solvent. That is, it is a step of extracting an extract from a plant by adding an appropriate solvent in a state where the content of arctigenin is high by the above-mentioned enzyme conversion step. For example, the appropriate solvent is added to the plant and the extract is extracted by heating and stirring for an appropriate period of time. In addition to heating and stirring, the extract can be extracted using any extraction method known to those skilled in the art, such as heating / reflux, drip extraction, immersion extraction, or pressure extraction.

Since arctigenin is sparingly soluble in water, the yield of arctigenin can be improved by adding an organic solvent. As the organic solvent, any organic solvent can be used. For example, alcohols such as methanol, ethanol and propanol, as well as acetone can be used. In terms of safety, it is preferable to use 30% ethanol as the organic solvent. Distilling off the solvent from the extract gives a paste-like concentrate, and further drying the concentrate gives a dried product.

The Akkermansia bacterium growth-promoting agent and the intestinal short-chain fatty acid production-promoting agent of the present invention are the above-mentioned plants themselves or extracts of the above-mentioned plants as arctigenin and / or arctiin, and the above-mentioned dried and chopped plants. Alternatively, the above-mentioned plant may be dried and powdered. By containing these, a superior effect can be obtained as compared with the case where alktigenin and / or alktiin is contained alone.

The Akkermansia bacterium growth promoter and the intestinal short-chain fatty acid production promoter of the present invention have more excellent effects when taken in combination with dietary fiber, oligosaccharides, polyphenols, fish oil, bifidobacteria, lactic acid bacteria and the like. Obtainable. Dietary fiber includes, for example, root vegetables rich in dietary fiber, indigestible fiber such as indigestible dextrin, and water-soluble dietary fiber contained in konjac and yam. Polyphenols include, for example, polyphenols contained in blueberries and soybeans. Fish oils include fish oils containing omega 3 fatty acids such as DHA and EPA. Bifidobacterium and lactic acid bacteria include probiotics such as bifidobacteria and lactic acid bacteria that produce short chain fatty acids such as acetic acid, butyric acid and / or propionic acid.

The Akkermansia bacterium growth-promoting agent and the intestinal short-chain fatty acid production-promoting agent of the present invention can be formulations of any form. Ackermanncia bacterial growth promoters and intestinal short chain fatty acid production promoters are orally administered preparations such as tablets such as sugar-coated tablets, buccal tablets, coated tablets and chewable tablets; troches; pills; powders; hard capsules and Capsules containing soft capsules; granules; and liquids such as suspensions, emulsions, syrups and erixyls.

In addition, the Ackermanncia bacterial growth promoter and the intestinal short chain fatty acid production promoter of the present invention are intravenous injection, subcutaneous injection, intraperitoneal injection, intramuscular injection, transdermal administration, nasal administration, transpulmonary administration, and enteral administration. It can be a parenteral preparation such as intestinal administration, oral administration and enteral administration. The Akkermansia bacterial growth promoter and the intestinal short chain fatty acid production promoter of the present invention can be, for example, injections, transdermal absorption tapes, aerosols and suppositories.

In addition, the Akkermansia genus bacterial growth promoter and the intestinal short-chain fatty acid production promoter of the present invention can be provided as an external preparation. The external preparation of the present invention can be a pharmaceutical product, a cosmetic product, or the like. The external preparation of the present invention can be an external preparation for application to the skin, scalp, hair, mucous membranes, nails and the like. External preparations include, for example, creams, ointments, liquids, gels, lotions, emulsions, aerosols, sticks, sheet masks, solids, foams, oils and ticks; It includes patches such as agents, plasters, tapes and patches; and sprays.

In addition, the Akkermansia genus bacterial growth promoter and the intestinal short-chain fatty acid production promoter of the present invention can be in an edible form, for example, solid, liquid, granular, granular, powdery, capsule-like. , Creamy and pasty.

The present invention also provides a composition for promoting the growth of Akkermansia bacterium, which contains alktigenin and / or alktiin as an active ingredient. The present invention also provides a composition for promoting the production of short-chain fatty acids in the intestine, which contains alktigenin and / or alktiin as an active ingredient. The composition of the present invention can be a composition for use in pharmaceuticals, cosmetics, foods and the like. The compositions of the present invention may further comprise any ingredient commonly used in pharmaceuticals, cosmetics and foods. For example, the compositions of the invention may further comprise pharmaceutically acceptable bases, carriers, excipients, binders, disintegrants, lubricants and colorants.

Examples of carriers and excipients used in the compositions of the invention include lactose, glucose, sucrose, mannitol, dextrin, arabic gum, potato starch, corn starch, calcium carbonate, calcium phosphate, calcium sulfate and crystalline cellulose. ..

Examples of binders include starch, gelatin, syrup, tragant rubber, polyvinyl alcohol, polyvinyl ether, polyvinylpyrrolidone, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, carboxymethyl cellulose and the like.

Examples of disintegrants include starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium hydrogencarbonate, sodium alginate, sodium carboxymethyl cellulose and calcium carboxymethyl cellulose.

Examples of lubricants include magnesium stearate, hydrogenated vegetable oils, talc and macrogol. As the colorant, any colorant that is allowed to be added to pharmaceuticals, cosmetics and foods can be used.

Further, the composition of the present invention comprises sucrose, gelatin, purified cellulose, gelatin, glycerin, sorbitol, ethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, polyvinylpyrrolidone, phthalate cellulose acetate, hydroxypropylmethyl cellulose phthalate, as required. It may be coated with one or more layers such as methyl methacrylate and methacrylic acid polymer.

Further, the composition of the present invention is added with a pH adjuster, a buffer, a stabilizer, a preservative, a preservative, a diluent, a coating agent, a sweetener, a fragrance, a solubilizer and the like, if necessary. May be good.

The present invention also provides a pharmaceutical composition for promoting Akkermansia bacterium growth, which comprises the Akkermansia bacterium growth promoting agent of the present invention. The present invention also provides a pharmaceutical composition for promoting the production of intestinal short-chain fatty acids, which comprises the agent for promoting the production of short-chain fatty acids in the intestine of the present invention. The pharmaceutical composition of the present invention is a pharmaceutical composition for treating, ameliorating and / or preventing various symptoms or diseases that can be treated, ameliorated or prevented by increasing the composition ratio of Akkermansia bacterium in the intestinal flora. Can be. The pharmaceutical composition of the present invention can also be a pharmaceutical composition for treating, ameliorating and / or preventing various symptoms or diseases that can be treated, ameliorated or prevented by increasing intestinal short chain fatty acids. .. The pharmaceutical composition of the present invention comprises, for example, alcoholic hepatitis (ASH), IgE-related atopic dermatitis, inflammatory bowel disease (such as ulcerative colitis and Crohn's disease), through the growth-promoting action of Ackermanncia. It can be a pharmaceutical composition for treating, ameliorating and / or preventing irritable bowel syndrome, appendicitis, insulin resistance and diabetes caused by increased LPS, atherosclerosis and autism. The pharmaceutical compositions of the present invention treat, improve and treat obesity, diabetes, autoimmune diseases, atopic dermatitis, allergic diseases, malignant tumors, and inflammatory bowel diseases, for example through an increase in intestinal short chain fatty acids. / Or can be a pharmaceutical composition for prevention.

The present invention also provides a food composition for promoting the growth of Akkermansia bacterium, which contains alktigenin and / or alktiin as an active ingredient. The present invention also provides a food composition for promoting the production of short-chain fatty acids in the intestine containing alktigenin and / or alktiin as an active ingredient. The food composition of the present invention can be configured in the same manner as the above-mentioned agents and compositions of the present invention. The food composition of the present invention comprises, for example, alcoholic hepatitis (ASH), IgE-related atopic dermatitis, inflammatory bowel disease (such as ulcerative colitis and Crohn's disease), through the growth-promoting action of Ackermancia bacteria. It can be a food composition for ameliorating and / or preventing irritable bowel syndrome, appendicitis, insulin resistance and diabetes due to increased LPS, atherosclerosis and autism. The food compositions of the present invention also address obesity, diabetes, autoimmune diseases, atopic dermatitis, allergic diseases, infection protection, malignant tumors, and inflammatory bowel diseases, for example through an increase in intestinal short chain fatty acids. It can be a food composition for improvement and / or prevention.

As used herein, the term "food composition" includes not only general foods and drinks, but also foods for the sick, health foods, functional foods, foods for specified health uses, dietary supplements and supplements. Common foods and drinks include, for example, various beverages, various foods, processed foods, liquid foods (soups and the like), seasonings, energy drinks and confectionery. As used herein, the term "processed food" refers to natural foodstuffs (animals, plants, etc.) that have been processed and / or cooked, such as processed meat products, processed vegetable products, processed fruit products, and frozen foods. Includes retort foods, canned foods, bottled foods and instant foods. The food composition of the present invention may be a food labeled to promote the growth of Akkermansia bacteria or to promote the production of intestinal short-chain fatty acids. Further, the food composition of the present invention may be provided in a form enclosed in a bag, a container or the like. The bag and container used in the present invention can be any bag and container normally used for food.

The content of arctigenin and / or arctiin in the agent, composition and food composition of the present invention may be an amount capable of exerting an effect of promoting the growth of Akkermansia bacterium, and the subject, purpose and administration method to which it is applied ( It can be appropriately set according to the intake method). For example, when given orally to humans, it can preferably contain alktigenin and / or alktiin so that the daily intake is 10-2000 mg.

Examples are shown below, and embodiments of the present invention will be described in more detail, but the present invention is not limited to the following examples.

(Example 1 Production of burdock extract 1)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from burdock. Burdock (enzyme activity 8.23 U / g) was cut and passed through a 9.5 mm sieve and further passed through a 0.85 mm sieve, and it was confirmed that 75% remained. 80 kg of this burdock shredded was added to 560 L of water kept at 29 to 33 ° C, and stirred for 30 minutes. Then, 265 L of ethanol was added, the temperature was raised to 85 ° C., and the mixture was heated under reflux for another 60 minutes. This solution was centrifuged to obtain a burdock extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, 25% of dextrin was added to the solid content of the extract, and the mixture was spray-dried. The contents of arktigenin and alktiyne were 6.2% and 7.1%, respectively, and burdock extract powder (containing 20% dextrin) having arktigenin / alktiin (weight ratio) = 0.89 was obtained.

(Example 2 Production of burdock extract 2)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from burdock. Burdock (enzyme activity 8.23 U / g) was cut and passed through a 9.5 mm sieve and further passed through a 0.85 mm sieve, and it was confirmed that 75% remained. 80 kg of this burdock shredded was added to 560 L of water kept at 30 to 33 ° C. and stirred for 30 minutes, then 265 L of ethanol was added to raise the temperature to 85 ° C., and the mixture was heated under reflux for another 30 minutes. This solution was centrifuged to obtain a burdock extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, 25% of dextrin was added to the solid content of the extract, and the mixture was spray-dried. The contents of arktigenin and alktiyne were 6.0% and 6.8%, respectively, and burdock extract powder (containing 20% dextrin) having arktigenin / alktiin (weight ratio) = 0.87 was obtained.

(Example 3 Production of burdock extract 3)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from burdock. Burdock (enzyme activity 7.82 U / g) was cut and passed through a 9.5 mm sieve and further passed through a 0.85 mm sieve, and it was confirmed that 75% remained. 80 kg of this burdock shredded was added to 560 L of water kept at 30 to 32 ° C. and stirred for 40 minutes, and after 60 minutes, 258 L of ethanol was added to raise the temperature to 85 ° C., and the mixture was heated under reflux for another 30 minutes. This solution was centrifuged to obtain a burdock extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, 25% of dextrin was added to the solid content of the extract, and the mixture was spray-dried. The contents of arktigenin and alktiyne were 6.2% and 6.7%, respectively, and burdock extract powder (containing 20% dextrin) with arktigenin / alktiin (weight ratio) = 0.93 was obtained.

(Example 4 Production of burdock extract 4)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from burdock. Burdock (enzyme activity 7.82 U / g) was cut and passed through a 9.5 mm sieve and further passed through a 0.85 mm sieve, and it was confirmed that 75% remained. 80 kg of this burdock shredded was added to 560 L of water kept at 30 to 32 ° C. and stirred for 30 minutes, then 253 L of ethanol was added to raise the temperature to 85 ° C., and the mixture was heated under reflux for another 40 minutes. This liquid was centrifuged to obtain the obtained extract. The extracts obtained by repeating this operation twice were combined, concentrated under reduced pressure, 25% of dextrin was added to the solid content of the extract, and the mixture was spray-dried. The contents of arktigenin and alktiyne were 6.4% and 7.2%, respectively, and burdock extract powder (containing 20% dextrin) having arktigenin / alktiin (weight ratio) = 0.89 was obtained.

(Example 5 Production of burdock sprout extract)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from burdock sprout. To 125 kg of dried burdock sprout, 1680 kg of water was added, and the mixture was heated to 35 ± 5 ° C. and stirred for 60 minutes. Then, 720 kg of ethanol was added, the temperature was raised, the mixture was further stirred for 2 hours, and filtered through an 80 mesh filter to obtain a burdock sprout extract. This was sterilized at 70 ° C. for 1 hour, about 30% of dextrin was added to the solid content of the extract, concentrated under reduced pressure, and spray-dried. The burdock genin and arktiin contents were 13.7% and 0.4%, respectively, and 13.9% of burdock sprout extract powder was obtained as the equivalent amount of arktigenin.

(Example 6 Production of Forsythia viridis leaf extract 1)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from the leaves of Forsythia viridis. 350 mL of water was added to 50 g of forsythia leaf chopped containing 2.53% of arctiin and 0.76% of arctigenin, and the mixture was kept warm at 37 ° C. for 30 minutes, then 150 mL of ethanol was added and extracted by heating for 30 minutes. This solution was solid-liquid separated using a 100-mesh sieve and freeze-dried to obtain 18.62 g of Forsythia viridis leaf extract having an arctigenin content of 5.62%.

(Example 7 Production of Forsythia viridis leaf extract 2)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from the leaves of Forsythia viridis. Forsythia leaf chopped 720 g containing 7.38% alktiyne and 0.78% alktigenin were added with 5 L of water and kept warm at 37 ° C for 30 minutes, then 2.16 L of ethanol was added and heat-extracted for 30 minutes. This solution was solid-liquid separated using a 100-mesh sieve and freeze-dried to obtain 343.07 g of Forsythia viridis leaf extract having an arctigenin content of 9.55%.

(Example 8 Production of Forsythia viridis leaf extract 3)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from the leaves of Forsythia viridis. Add 140 kg of water to 10 kg of forsythia leaf chopped containing 8.77% alktiyne and 1.54% alktigenin, heat to 35 ± 5 ° C, heat for 60 minutes, add 60 kg of ethanol, heat for 2 hours, and filter for 80 mesh. Forsythia leaf extract was obtained by filtering with. About 20% of dextrin was added to the solid content of the extract of this solution, concentrated under reduced pressure, and spray-dried. 3.63 kg of Forsythia viridis leaf extract powder having an arctigenin content of 7.73% was obtained.

(Example 9 Production of Forsythia viridis leaf extract 4)
As an example of the Akkermansia genus bacterial growth promoter of the present invention, an extract (extract) was extracted from the leaves of Forsythia viridis. 2000 kg of hydrous ethanol was added to 95 kg of forsythia leaves, heated to 50 ± 5 ° C., stirred for 2 hours, and filtered through an 80 mesh filter to obtain a forsythia leaf extract. Gum arabic and dextrin were added in an amount of 10% each to the extract solid content of this solution, concentrated under reduced pressure, and spray-dried. 32.6 kg of Forsythia viridis leaf extract powder having an arctigenin content of 8.60% was obtained.

(Example 10 burdock extract powder-blended granules)
As an example of the Akkermansia bacterium growth promoter of the present invention, granules were produced using burdock extract. Granules were manufactured according to the "Japan Bureau" general rules for formulations and the section on granules. That is, the following components (1) to (3) were taken and made into granules. 1.5 g of this was filled in an aluminum laminated film to obtain granules containing 0.5 g of burdock extract powder per packet.

(1) Burdock extract powder of Example 2 33.3%
(2) Lactose 65.2%
(3) Hydroxypropyl cellulose 1.5%
100% in total

(Example 11 burdock extract powder-blended granules)
As an example of the Akkermansia bacterium growth promoter of the present invention, granules were produced using burdock extract. Granules were manufactured according to the "Japan Bureau" general rules for formulations and the section on granules. That is, the following components (1) to (3) were taken and made into granules. 3.0 g of this was filled in an aluminum laminated film to obtain granules containing 2 g of burdock extract powder per packet.

(1) Burdock extract powder of Example 2 66.7%
(2) Lactose 30.3%
(3) Hydroxypropyl cellulose 3.0%
100% in total

(Example 12 burdock extract powder-blended tablet)
As an example of the Akkermansia bacterium growth promoter of the present invention, tablets were produced using burdock extract. Tablets were prepared according to the "Japan Bureau" general rules for formulations and the section on tablets. That is, the following components (1) to (6) were taken to obtain tablets.

(1) Burdock extract powder of Example 2 37.0%
(2) Crystalline cellulose 45.1%
(3) Carmellose calcium 10.0%
(4) Cross popidone 3.5%
(5) Hydrous silicon dioxide 3.4%
(6) Magnesium stearate 1.0%
100% in total

(Example 13 Effect of arctigenin on the growth of Akkermansia bacterium)
[Experimental animals]
In the following examples, 20-week-old male C57BL / 6J-DIO mice (purchased from Charles River Co., Ltd., Japan) were used. Animals were bred in a 12-hour light-dark cycle environment with a temperature of 23.0 ± 5 ° C and a humidity of 50.0 ± 10%.

[experimental method]
20-week-old male C57BL / 6 DIO mice were fed a high-fat diet (Research Diets D12492, hereinafter referred to as HFD) for an additional 9 weeks, and obese model mice whose weight gain was slowed down were shown in the following eight groups. The test substance was orally administered by gavage over 4 weeks: Normal group (normal diet), Control group (HFD), Arctigenin low dose group (AG Low group; HFD + Arctigenin 20 mg / kg), Arctigenin high dose group (AG High). Group; HFD + arctigenin 60 mg / kg), Gobous sprout extract low dose group (GSE Low group; HFD + Gobous sprout extract 144 mg / kg), Gobous sprout extract high dose group (GSE High group; HFD + Gobous sprout extract 432 mg / kg), Renkyo Low-dose leaf extract group (RLE Low group; HFD + Lengyo leaf extract 260 mg / kg) and Lengyo leaf extract high-dose group (RLE High group; HFD + Lengyo leaf extract 780 mg / kg) (n = 6 in each group).

For arctigenin, a refined arctigenin product (> 95.0%) purified by Kracie Holdings, Ltd. from burdock sprout extract was used. As the burdock sprout extract, the burdock sprout extract of Example 5 was used. As the forsythia leaf extract, the forsythia leaf extract of Example 8 was used. The amounts of burdock sprout extract and forsythia leaf extract were adjusted so that the low dose group was equivalent to 20 mg / kg of arctigenin and the high dose group was equivalent to 60 mg / kg of arctigenin.

The administration method was daily forced oral administration. As for the feeding method, pair feeding of powdered feed was performed in the HFD feeding group other than the Normal group, and the feeding amount was unified.

After administration of the test substance for 4 weeks, the test substance was fasted for 18 hours, blood was collected from the abdominal vena cava under anesthesia, sacrificed by cervical dislocation, and then the contents of the liver and cecum were collected.

[Weight change]
Table 1 shows the changes in body weight (g) of each group. Normal group, Control group, Arctigenin high-dose group (indicated by "AG" in the figure), Burdock sprout extract high-dose group (indicated by "GSE" in the figure) and Forsythia leaf extract high-dose group (indicated by "RLE" in the figure). The change in body weight (g) is shown in Fig. 1. As shown in Table 1 and FIG. 1, a tendency toward weight loss was observed in the burdock sprout extract high-dose group and the forsythia leaf extract high-dose group.

[Expression level of inflammation-related factors]
After total RNA extraction and cDNA synthesis from the obtained liver for the Normal group, Control group and high-dose administration group of each test substance, the inflammation-related factors CD11c, PAI-1 and TNFα are encoded by qPCR. The expression levels of the genes were compared. 18S rRNA was used to control the gene expression level. Primers for qPCR are 18S (F: TTCTGGCCAACGGTCTAGACAAC, R: CCAGTGGTCTTGGTGTGCTGA), CD11c (F: ACACAGTGTGCTCCAGTATGA, R: GCCCAGGGATATGTTCACAGC), PAI-1 (F: CCGTGGAACAAGAATGAGATCAG) TGGTGGTTTGCTACGACGT) was used.

Tables 2 and 2 show the Normal group, Control group, Arctigenin high-dose group (indicated by "AG" in the figure), Gobous sprout extract high-dose group (indicated by "GSE" in the figure), and Lengyo leaf extract high-dose group. The expression levels of CD11c, PAI-1 and TNFα in the group (indicated by "RLE" in the figure) are shown. The values in FIG. 3 represent the mean ± standard error (Mean ± S.E.M) of 3 to 6 animals. As a result of Dunnett's t-test, "*" was added when the p-value was smaller than 0.05 compared to the Control group. The expression levels of CD11c, PAI-1 and TNFα were lower in the arctigenin high-dose group, the burdock sprout extract high-dose group, and the forsythia leaf extract high-dose group than in the control group.

From these results, it was shown that arctigenin, burdock sprout extract and forsythia leaf extract have an action of suppressing the expression of genes encoding CD11c, PAI-1 and TNFα.

[Analysis of the flora of the contents of the cecum]
For each group, DNA was extracted from the collected cecal contents and amplicon sequence analysis was performed. Table 3 and FIG. 3 show the genus-level composition ratios (%) of the 11 species and other bacteria that had the highest composition ratios in the cecal contents for all groups.

Table 4 and FIG. 4 show the composition ratio (%) of Akkermansia bacteria contained in the cecal contents for each group. The values in FIG. 4 represent the mean ± standard error (Mean ± S.E.M) of 3 to 6 animals. As a result of Dunnett test, if the p-value is less than 0.01, "**" is added.

As shown in FIGS. 3 and 4, a dose-dependent increase in the composition ratio of Akkermansia spp. Was observed in the group treated with arctigenin, burdock sprout extract and forsythia leaf extract as compared with the control group. A significant increase in the composition of Akkermansia bacterium was observed in the high dose group of arctigenin, burdock sprout extract and forsythia leaf extract.

(Example 14 Effect of arctigenin on the growth of Akkermansia bacterium)
[Experimental animals]
In the following examples, 5-week-old male C57BL / 6J mice (purchased from Nippon SLC Co., Ltd.) were used. Animals were bred in a 12-hour light-dark cycle environment with a temperature of 23.0 ± 5 ° C and a humidity of 50.0 ± 10%.

[experimental method]
6-week-old male C57BL / 6J mice were divided into the following 6 groups and fed with the test substance for 8 weeks: Normal group (normal diet), Control group (high-fat, high-sucrose diet: HFHS), arctigenin group. (AG group; HFHS containing 0.5% arctigenin), metformin group (MF group; HFHS containing 0.5% metformin), gobous sprout extract group (GSE group; HFHS containing 5% gobous sprout extract) and lotus leaf extract group (RLE group; lotus HFHS containing 5% leaf extract) (n = 6 in each group).

For arctigenin, a refined arctigenin product (> 95.0%) purified by Kracie Holdings, Ltd. from burdock sprout extract was used. Metformin (M2009) purchased from Tokyo Chemical Industry Co., Ltd. was used. As the burdock sprout extract, the burdock sprout extract of Example 5 was used. As the forsythia leaf extract, the forsythia leaf extract of Example 9 was used.

After administration of the test substance for 7 weeks, the mice were transferred to a wire mesh cage and fresh feces were collected. Eight weeks after administration, the animals were sacrificed under anesthesia, and visceral fat (epididymis peribody fat and mesenteric fat) and cecal contents were collected.

[Weight change]
Figure 5 shows the changes in body weight (g) of each group. The values in FIG. 5 represent the mean ± standard error (Mean ± SEM) of the 6 animals. A significant difference test was performed by Repeated measures ANOVA, and "*" was added when the p-value was smaller than 0.05 and "**" was added when the p-value was smaller than 0.01. Significant suppression of weight gain was observed in all groups compared to the Control group.

[Visceral fat weight]
Figure 6 shows the visceral fat weight (g) of each group at the time of dissection. The values in FIG. 6 represent the mean ± standard error (Mean ± SEM) of the 6 animals. As a result of Dunnett test, if the p-value is less than 0.01, "**" is added. A significant decrease in visceral fat weight was observed in all groups compared to the Control group.

[Analysis of bacterial flora in feces]
For each group, DNA was extracted from the collected feces and amplicon sequence analysis was performed. FIG. 7 shows the genus-level composition ratios (%) of the 10 species and other bacteria with high composition ratios contained in feces for all groups.

[Quantification of Akkermansia bacteria in feces]
For each group, DNA was extracted from the collected feces, and the number of copies of Akkermansia bacteria contained in the feces was quantified by qPCR. Primers for qPCR used were Akk-F: CAGCACGTGAAGGTGGGGAC and Akk-R: CCTTGCGGTTGGCTTCAGAT. FIG. 8 shows the quantitative results of Akkermansia bacteria contained in feces by qPCR for all groups. The values in FIG. 8 represent the mean ± standard error (Mean ± SEM) of the 6 animals. As a result of Dunnett test, if the p-value is less than 0.01, "**" is added. Compared with the Control group, the Akkermansia genus bacteria in the feces were significantly increased in the arctigenin group, the burdock sprout extract group and the forsythia leaf extract group.

[Amount of short-chain fatty acids in the contents of the cecum]
For each group, the amount of short-chain fatty acids (acetic acid, propionic acid, butyric acid and total short-chain fatty acids) in the collected cecal contents was quantified using an organic acid analysis system (Shimadzu, Japan) by ProminenceTM HPLC. FIG. 9 shows the quantification results of short-chain fatty acids contained in the cecal contents for all groups. The values in FIG. 9 represent the mean ± standard error (Mean ± SEM) of the 6 animals. As a result of Dunnett test, "*" was added when the p-value was less than 0.05, and "**" was added when the p-value was less than 0.01. Compared with the Control group, the amount of acetic acid, propionic acid and total short-chain fatty acids was significantly increased in the arctigenin group and the forsythia leaf extract group, and the total amount of short-chain fatty acids was significantly increased in the Gobous sprout extract group.

From these results, it was shown that arctigenin, burdock sprout extract and forsythia leaf extract have an action of inducing the growth of Akkermansia spp. And increasing the amount of short-chain fatty acids in the cecum.

INDUSTRIAL APPLICABILITY The present invention can be suitably used for medicines and foods for promoting the growth of Akkermansia bacteria in the intestine.

Claims (7)

An Akkermansia bacterium growth promoter containing alktigenin and / or alktiine as an active ingredient. The Akkermansia bacterium growth-promoting agent according to claim 1, wherein the arktigenin and / or arktiin is contained as burdock, burdock, burdock sprout or forsythia or an extract thereof. A food composition for promoting the growth of Akkermansia bacteria, which comprises alktigenin and / or alktiine as an active ingredient. The food composition for promoting the growth of Akkermansia genus according to claim 4, wherein the arktigenin and / or arktiin is contained as burdock, burdock, burdock sprout or forsythia or an extract thereof. Alcoholic hepatitis (ASH), IgE-related atopic dermatitis, inflammatory bowel disease (ulcerative colitis and Crohn's disease) through the growth-promoting action of Ackermancia, which contains arctigenin and / or arctiin as an active ingredient. ), Irritable bowel syndrome, appendicitis, insulin resistance and diabetes due to increased LPS, atherosclerosis and at least one disease selected from the group consisting of autism to treat, improve and / or prevent Pharmaceutical composition for. An intestinal short-chain fatty acid production promoter containing alktigenin and / or alktiin as an active ingredient. The intestinal short-chain fatty acid production promoter according to claim 6, wherein the arktigenin and / or arktiin is contained as burdock, burdock, burdock sprout or forsythia or an extract thereof.

Images