JP2021512871A - Adeno-associated virus compositions for restoring PAH gene function and how to use them - Google Patents

Abstract

Provided herein are adeno-associated virus (AAV) compositions capable of restoring cellular phenylalanine hydroxylase (PAH) gene function. A method of using the AAV composition and a packaging system for producing the AAV composition are also provided.

Description

Related Applications This application claims the priority of U.S. Patent Provisional Application No. 62 / 625,149 filed on February 1, 2018, and U.S. Patent Provisional Application No. 62 / 672,377 filed on May 16, 2018. As a matter of fact, the entire contents of these US patent provisional applications are incorporated herein by reference.

Reference to the sequence listing submitted electronically
The entire contents of the sequence listing submitted electronically via an ASCII text file (name: HMT-024PC_SeqList_ST25.txt; size: 367,287 bytes; and date of creation: January 30, 2019) are incorporated herein by reference in their entirety. It has been.

Phenylketonuria (PKU) is an autosomal recessive disorder, mostly due to mutations in the phenylalanine hydroxylase (PAH) gene. The PAH gene encodes a hepatic enzyme that catalyzes the hydroxylation of L-phenylalanine (Phe) to L-tyrosine (Tyr) during multimerization. Decreased or lost PAH activity leads to phenylalanine accumulation and its conversion to phenylpyruvic acid (also known as phenylketon). This abnormality in phenylalanine metabolism impairs neuronal mutations and myelin synthesis, resulting in mental retardation, seizures and other serious medical problems.

Currently, there is no cure for PKU. Standard care is dietary management by minimizing foods that contain large amounts of phenylalanine. Dietary management with low phenylalanine infant formula from birth prevents the development of neurological effects of this disorder. However, even on a low-protein diet, children still suffer from developmental retardation, and adults often suffer from osteoporosis and vitamin deficiency. Moreover, lifelong dietary adherence is difficult, especially beyond school age.

New treatment strategies have recently emerged, including large neutral amino acid (LNAA) supplementation, cofactor tetrahydrobiopterin therapy, enzyme replacement therapy and transgenic probiotic therapy. However, these strategies have drawbacks. LNAA supplementation is only suitable for adults who do not adhere to a low Phe diet. The cofactor tetrahydrobiopterin can only be used in some mild forms of PKU. Enzyme replacement by administration of a PAH substitute, such as phenylalanine ammonia-lyase (PAL), can result in an immune response that reduces efficacy and / or causes side effects. Regarding recombinant probiotic therapy, there is concern about the pathogenicity of PAL-expressing E. coli.

Gene therapy offers a unique opportunity to treat PKU. Retroviral vectors, such as the lentiviral vector, can integrate nucleic acids into the host cell genome. However, these vectors raise safety concerns due to their non-targeted insertion into the genome. For example, the vector has a risk of causing a malignant disease by disrupting a tumor suppressor gene or activating an oncogene. In fact, in a clinical trial treating X-linked severe combined immunodeficiency (SCID) by transducing ^{CD34 +} bone marrow progenitor cells with a gamma retroviral vector, 4 out of 10 patients developed leukemia (Hacein- Bey-Abina et al., J Clin Invest. (2008) 118 (9): pp. 3132-42).

Nuclease-based gene editing techniques such as meganucleases, zinc finger nucleases (ZFNs), transcriptional activator-like effector nucleases (TALENs), and clustered, regularly spaced short palindromic repetition (CRISPR) techniques. It has also been speculated that palindromes in PKU patients could be used to correct deficiencies in the PAH gene. However, each of these techniques raises safety concerns due to the potential for off-target mutations to sites within the human genome that are sequence-similar to the intended target site.

U.S. Pat. No. 7,790,154 U.S. Pat. No. 9,783,824 U.S. Pat. No. 9,623,120

Hacein-Bey-Abina et al., J Clin Invest. (2008) 118 (9): pp. 3132-42 Mauro and Chappell (2014) Trends Mol Med. 20 (11): pp. 604-13 Sibley et al., (2016) Nature Reviews Genetics, 17, 407-21 Zhang (1998) Human Molecular Genetics, 7 (5): pp. 919-32 Lu et al. (2013) Molecular Therapy 21 (5): pp. 954-63 Lu et al. (2017) Hum. Gene Ther. 28 (1): pp. 125-34 Sherry et al., Nucleic Acids Res. 2001; 29 (1): pp. 308-11 Nucleic Acids Res. 2014; 42 (Database Special Issue): D986-92 Nucleic Acids Res. 2014; 42 (Database Special Issue): D980-D985 Nucleic Acids Res. 2016; 44 (Database Special Issue): D67-D72 genome.ucsc.edu/encode/terms.html Nucleic Acids Res. 2018; 46 (D1): D260-D266 Messeguer et al., Bioinformatics 2002; 18 (2): pp. 333-334 Farre et al., Nucleic Acids Res. 2003; 31 (13): 3651-3653 Savy et al., Human Gene Therapy Methods (2017) 28 (5): pp. 277-289 Remington's Pharmaceutical Sciences, Current Edition, Mack Publishing, Easton Pa. 18042, USA A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th Edition, Lippincott, Williams, & Wilkins Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Ansel et al., 7th Edition, Lippincott, Williams, & Wilkins Handbook of Pharmaceutical Excipients (2000) A. H. Kibbe et al., 3rd Edition, Amer. Pharmaceutical Assoc.

Therefore, there is a need in the art for improved gene therapy compositions and methods that can efficiently and safely restore PAH gene function in PKU patients.

Adeno-associated virus (AAV) compositions capable of restoring cellular PAH gene function, and methods of using the compositions to treat diseases associated with decreased PAH gene function (eg, PKU), are described in this article. Provided in the specification. A packaging system for making adeno-associated virus compositions is also provided.

Thus, in one aspect, the disclosure is a method of modifying an intracellular mutation in the phenylalanine hydroxylase (PAH) gene, comprising transducing the cell with a replication-deficient adeno-associated virus (AAV). AAV,
(a) AAV capsid and
(b) Including modified genome
The modified genome has (i) an editing element for editing the target locus in the PAH gene and (ii) an editing element having homology to the first genomic region on the 5'side of the target locus. 5'side 5'homologous arm nucleotide sequence and (iii) 3'side 3'homologous arm nucleotide sequence of the editing element having homology to the 2nd genomic region on the 3'side of the target locus. Including and
The cells provide a method of transducing an exogenous nuclease, or a nucleotide sequence encoding an exogenous nuclease, without co-transduction or co-administration.

In certain embodiments, the cells are hepatocytes, renal cells, or cells in the brain, pituitary gland, adrenal gland, pancreas, bladder, gallbladder, colon, small intestine or breast. In certain embodiments, the cells are cells of a mammalian subject and AAV is administered to the subject in an amount effective for transduction into the subject's cells.

In another aspect, the disclosure is a method of treating a subject suffering from a disease or disorder associated with a PAH gene mutation.
(a) AAV capsid and
(b) Including the step of administering to the subject an effective amount of replication-deficient adeno-associated virus, including the modified genome.
The modified genome has (i) an editing element for editing the target locus in the PAH gene and (ii) an editing element having homology to the first genomic region on the 5'side of the target locus. 5'side 5'homologous arm nucleotide sequence and (iii) 3'side 3'homologous arm nucleotide sequence of the editing element having homology to the 2nd genomic region on the 3'side of the target locus. Including and
Provided is a method in which an exogenous nuclease, or a nucleotide sequence encoding an exogenous nuclease, is not co-administered to said subject.

In certain embodiments, the disease or disorder is phenylketonuria. In certain embodiments, the subject is a human subject.

In another aspect, the disclosure is a replication-deficient adeno-associated virus (AAV), wherein the AAV.
(a) AAV capsid and
(b) Including modified genome
The modified genome has (i) an editing element for editing the target locus in the PAH gene and (ii) an editing element having homology to the first genomic region on the 5'side of the target locus. 5'side 5'homologous arm nucleotide sequence and (iii) 3'side 3'homologous arm nucleotide sequence of the editing element having homology to the 2nd genomic region on the 3'side of the target locus. Provides AAV, including and.

The following embodiments apply to each of the above embodiments.

In certain embodiments, the editing element comprises at least a portion of the PAH coding sequence. In certain embodiments, the editing element comprises a PAH code sequence. In certain embodiments, the PAH coding sequence encodes the amino acid sequence set forth in SEQ ID NO: 23. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24. In certain embodiments, the PAH coding sequence has a silent change. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143.

In certain embodiments, the editing element comprises a PAH intron insertion code sequence, and optionally the PAH intron insertion code sequence comprises an unnatural intron inserted into the PAH code sequence. In certain embodiments, the unnatural intron is selected from the group consisting of the first intron of the hemoglobin beta gene and the mouse microvirus (MVM) intron. In certain embodiments, the unnatural intron consists of a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 28-30, and 120-130. In certain embodiments, the unnatural intron consists of the nucleotide sequence set forth in any one of SEQ ID NOs: 28-30 and 120-130.

In certain embodiments, the PAH intron insertion coding sequence encodes the amino acid sequence set forth in SEQ ID NO: 23. In certain embodiments, the PAH intron insertion coding sequence comprises a first portion of the PAH coding sequence, an intron, and a second portion of the PAH coding sequence from 5'to 3', said first. The first part and the second part together form a complete PAH coding sequence when spliced together. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 24. In certain embodiments, the PAH coding sequence has a silent change. In certain embodiments, the PAH coding sequence comprises the sequence set forth in SEQ ID NO: 25 or 116. In certain embodiments, the first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65, and / or the second portion of the PAH coding sequence is set forth in SEQ ID NO: 66 or 67. Contains the amino acid sequence of. In certain embodiments, the first part of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 64 or 65 and the second part of the PAH coding sequence is the amino acid sequence set forth in SEQ ID NO: 66 or 67. Consists of.

In certain embodiments, the editing element comprises a ribosome skipping element and a PAH coding sequence or a PAH intron insertion coding sequence from 5'to 3'. In certain embodiments, the editing element further comprises a polyadenylation sequence on the 3'side of the PAH coding sequence or PAH intron insertion coding sequence. In certain embodiments, the polyadenylation sequence is an exogenous polyadenylation sequence and, optionally, the exogenous polyadenylation sequence is an SV40 polyadenylation sequence. In certain embodiments, the SV40 polyadenylation sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34, and a sequence complementary thereto.

In certain embodiments, the nucleotide on the 5'side of the target locus is within the exon of the PAH gene. In certain embodiments, the nucleotide on the 5'side of the target locus is within exon 1 of the PAH gene.

In certain embodiments, the editing element further comprises a splice acceptor on the 5'side of the ribosome skipping element. In certain embodiments, the nucleotide on the 5'side of the target locus is within the intron of the PAH gene. In certain embodiments, the nucleotide on the 5'side of the target locus is within intron 1 of the PAH gene. In certain embodiments, the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 35.

In certain embodiments, the 5'homologous arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the first genomic region. In certain embodiments, the 3'homologous arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the second genomic region.

In certain embodiments, the first genomic region is located within the first edit window and the second genomic region is located within the second edit window. In certain embodiments, the first edit window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45. In certain embodiments, the second edit window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45. In certain embodiments, the first edit window comprises the nucleotide sequence set forth in SEQ ID NO: 36 and the second edit window comprises the nucleotide sequence set forth in SEQ ID NO: 45.

In certain embodiments, the first genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 36. In certain embodiments, the second genomic region consists of the nucleotide sequence set forth in SEQ ID NO: 45.

In certain embodiments, each of the 5'and 3'homologous arm nucleotide sequences independently has a length of about 100 to about 2000 nucleotides.

In certain embodiments, the 5'homologous arm is assigned to C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, and nucleotide 7 of the PAH gene. Corresponding G, G corresponding to nucleotide 9 of PAH gene, A corresponding to nucleotide -467 of PAH gene, A corresponding to nucleotide -465 of PAH gene, A corresponding to nucleotide -181 of PAH gene, PAH gene G corresponding to nucleotide-214, C corresponding to nucleotide -212 of PAH gene, A corresponding to nucleotide-211 of PAH gene, G corresponding to nucleotide 194 of PAH gene, C corresponding to nucleotide -433 of PAH gene , C corresponding to nucleotide -432 of PAH gene, ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of PAH gene, A corresponding to nucleotide -341 of PAH gene, nucleotide -339 of PAH gene A, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and / or A corresponding to nucleotide -203 of the PAH gene. In certain embodiments, the 5'homologous arm
(a) C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and nucleotide 9 of the PAH gene. Corresponding to G;
(b) A corresponding to nucleotide-467 of the PAH gene and A corresponding to nucleotide -465 of the PAH gene,
(c) A corresponding to nucleotide -181 of the PAH gene;
(d) G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene;
(e) G corresponding to nucleotide 194 of the PAH gene;
(f) C corresponding to nucleotide -433 of the PAH gene and C corresponding to nucleotide -432 of the PAH gene;
(g) ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and / or
(h) A corresponding to nucleotide-341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide-211 of the PAH gene, and PAH gene. A corresponding to nucleotide-203 of
including. In certain embodiments, the 5'homologous arm comprises modifications of (c) and (d), (f) and (g), and / or (b) and (h).

In certain embodiments, the 5'homologous arm comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 36-44, 111, 115, and 142. In certain embodiments, the 3'homologous arm consists of the nucleotide sequences set forth in SEQ ID NOs: 45, 112, 117, 144.

In certain embodiments, the modified genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, 113, 118, 134, 136, and 145.

In certain embodiments, the modified genome has a 5'reverse end repeat (5'ITR) nucleotide sequence on the 5'side of the 5'homologous arm nucleotide sequence and 3'on the 3'side of the 3'homologous arm nucleotide sequence. Includes an additional'reverse end repeat (3'ITR) nucleotide sequence. In certain embodiments, the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 18, and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 19. Has sex. In certain embodiments, the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 20, and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 21. Has sex. In certain embodiments, the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 26 and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 27. Has sex.

In certain embodiments, the modified genome comprises the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146. In certain embodiments, the modified genome consists of the nucleotide sequence set forth in any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146.

In certain embodiments, the AAV capsid comprises an AAV clade F capsid protein.

In certain embodiments, the AAV clade F capsid protein is at least with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. Contains an amino acid sequence with 95% sequence identity. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H and the sequence. The amino acid in the capsid protein corresponding to amino acid 312 of No. 2 is Q, and the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, which corresponds to amino acid 464 of SEQ ID NO: 2. The amino acid in the capsid protein is N, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is. The amino acid in the capsid protein which is I and corresponds to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R and of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to amino acid 626 is G or Y, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, which corresponds to amino acid 687 of SEQ ID NO: 2. The amino acid in the capsid protein is R, the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. Or, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments,
(a) The amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(b) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 The amino acid in the capsid protein corresponding to 505 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(c) The amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(d) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(e) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to amino acid 706 is C.

In certain embodiments, the capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17.

In certain embodiments, the AAV clade F capsid protein comprises amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. Includes an amino acid sequence that has at least 95% sequence identity with the amino acid sequence. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D and the sequence. The amino acid in the capsid protein corresponding to amino acid 206 of No. 2 is C, and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, which corresponds to amino acid 312 of SEQ ID NO: 2. The amino acid in the capsid protein is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is. The amino acid in the capsid protein which is N and corresponds to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I and of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to amino acid 505 is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is the capsid protein. The amino acid in the capsid protein is G or Y, the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R. The amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C or SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 718 is G. In certain embodiments,
(a) The amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(b) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 The amino acid in the capsid protein corresponding to 505 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(c) The amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(d) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(e) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to amino acid 706 is C.

In certain embodiments, the capsid protein has the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. Including.

In certain embodiments, the AAV clade F capsid protein comprises amino acids 1 to 12, 13, 15, 16, or 17 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. Includes an amino acid sequence that has at least 95% sequence identity with the 736 amino acid sequence. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T and the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I and sequence. The amino acid in the capsid protein corresponding to amino acid 68 of No. 2 is V, the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R, and corresponds to amino acid 119 of SEQ ID NO: 2. The amino acid in the capsid protein is L, the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is. The amino acid in the capsid protein that is D and corresponds to amino acid 206 of SEQ ID NO: 2 is C, and the amino acid in the capsid protein that corresponds to amino acid 296 of SEQ ID NO: 2 is H and is of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to amino acid 312 is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponds to amino acid 464 of SEQ ID NO: 2. The amino acid in is N, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I. , The amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R, to amino acid 626 of SEQ ID NO: 2. The amino acid in the corresponding capsid protein is G or Y, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2. The amino acid of is R, the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. Alternatively, the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments,
(a) The amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T, and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q.
(b) The amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y.
(c) The amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K.
(d) The amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L, and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S.
(e) The amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G, and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(f) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 The amino acid in the capsid protein corresponding to 505 is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(g) The amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(h) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(i) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid of SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 706 is C.

In certain embodiments, the capsid protein is an amino acid of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. Contains an array.

In certain embodiments, the efficiency of integration of editing elements into target loci when AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of exogenous nucleases. Is at least 1%. In certain embodiments, when AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of an exogenous nuclease, integration of the editing element into the target locus is incorporated. Allele frequency is at least 0.5%.

In another aspect, the disclosure provides a pharmaceutical composition comprising AAV disclosed herein.

In another aspect, the disclosure is a packaging system for recombinant preparation of AAV.
(a) Rep nucleotide sequences encoding one or more AAV Rep proteins,
(b) Cap nucleotide sequences encoding one or more AAV clade F capsid proteins disclosed herein.
(c) A packaging system that includes the modified or transferred genome disclosed herein and is effective in encapsulating the modified or transferred genome in the capsid to form the AAV in the cell. provide.

In certain embodiments, the packaging system comprises a first vector containing the Rep nucleotide sequence and the Cap nucleotide sequence and a second vector containing the modified genome. In certain embodiments, the Rep nucleotide sequence encodes the AAV2 Rep protein. In certain embodiments, the AAV2 Rep protein is 78/68 or Rep 68/52. In certain embodiments, the AAV2 Rep protein comprises an amino acid sequence having the least sequence identity percent with respect to the AAV2 Rep amino acid sequence of SEQ ID NO: 22, the minimum sequence identity percent comprises said AAV2 Rep protein. At least 70% over the length of the encoding amino acid sequence.

In certain embodiments, the packaging system further comprises a third vector, said third vector being a helper viral vector. In certain embodiments, the helper viral vector is an independent third vector. In certain embodiments, the helper viral vector is integrated with the first vector. In certain embodiments, the helper viral vector is integrated with a second vector. In certain embodiments, the third vector comprises a gene encoding a helper virus protein.

In certain embodiments, the helper virus is selected from the group consisting of adenovirus, herpesvirus, vaccinia virus, and cytomegalovirus (CMV). In certain embodiments, the helper virus is an adenovirus. In certain embodiments, the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4 and VA. In certain embodiments, the helper virus is herpes simplex virus (HSV). In certain embodiments, the HSV genome comprises one or more of the HSV genes selected from the group consisting of UL5 / 8/52, ICPO, ICP4, ICP22 and UL30 / UL42.

In certain embodiments, the first vector and the third vector are contained in the first transfect plasmid. In certain embodiments, the nucleotides of the second vector and the third vector are contained in the second transfect plasmid. In certain embodiments, the nucleotides of the first and third vectors are cloned into a recombinant helper virus. In certain embodiments, the nucleotides of the second and third vectors are cloned into a recombinant helper virus.

In another aspect, the disclosure is described herein under conditions effective for encapsulating a modified or translocated genome in a capsid to form an AAV, a method for recombinant preparation of AAV. The method is provided, which comprises the step of introducing the packaging system of the above into cells.

It is a map of the pHMI-hPAH-hAC-008 vector. It is a map of the pHMI-hPAH-h1C-007 vector. It is a map of the pHMIA-hPAH-hI1C-032.1 vector. Western blots showing the expression of human PAHs from pCOH-WT-PAH (“WT PAH”), pCOH-CO-PAH (“CO PAH pCOH”) and pHMI-CO-PAH (“CO PAH pHMI”) vectors. It is an image. 5 × 10 ⁵ HEK293 cells were transduced with a 1 μg vector. Cellular lysates were collected 48 hours after transfection. Expression of human PAH was detected by Western blotting with an anti-PAH antibody (HPA031642 manufactured by Sigma). The amount of GAPDH protein detected by an anti-GAPDH antibody (MAB 374 manufactured by Millipore) is shown as a load target. It is a graph which shows the quantification of the PAH cDNA cassette (“LAM-concentration”) after linear amplification of an edit target site, or the PAH cDNA cassette (“amplicon”) after PCR amplification. It is a graph which shows the quantitative analysis of the incorporation of the pHMI-hPAH-hA-002 vector by the droplet digital PCR (ddPCR). The design of the pHMI-hPAH-mAC-006 vector and its expected integration into the mouse genome are shown. It is a schematic diagram which illustrates the method of detecting the allele edited by the pHMI-hPAH-mAC-006 vector by PCR. Two pairs of primers were designed: the first pair was capable of amplifying 867 bp DNA from the unedited allele (“control PCR”) and the second pair was capable of amplifying 2459 bp DNA from the edited allele. It was able to be specifically amplified (“edited allele PCR”). It is an image of DNA electrophoresis showing the PCR product from the control PCR as illustrated in FIG. 4A (“control PCR”) and the PCR product from the edited aller PCR as illustrated in FIG. 4A (“edited PCR”). .. The pHMI-hPAH-mAC-006 vector packaged in AAVHSC capsid was ^{intravenously injected into two wild-type neonatal mice at a dose of 2 × 10 13} vector genomes per kg body weight via the tail vein. Liver samples were taken 2 weeks later. Liver samples from saline-treated mice and cell samples of 3T3 mouse fibroblasts were used as negative controls for editorial allele PCR. It is a schematic diagram which illustrates the method of quantifying the edited allele by ddPCR. The first pair of primers is designed to amplify the first sequence in the pHMI-hPAH-mAC-006 vector, and the first probe (“vector probe”) hybridizes to the first sequence. Designed to do. The second pair of primers was designed to amplify the second sequence on the mouse genome near the vector so that the second probe (“locus probe”) hybridizes to the second sequence. Designed. The DNA sample was dispensed into oil droplets. The DNA concentration was optimized to 600 pg per 20 μL to significantly reduce the probability that one drop of oil would randomly contain vector particles and genomic DNA particles (p <0.001). When the vector is integrated into the genome, the double positive rate of the vector probe and locus probe in the same droplet increases. FIG. 5 is a schematic illustration illustrating expected results using the method described in FIG. 5A. Each dot in this schematic represents a single oil droplet. A dot that is negative for the vector probe signal but positive for the locus probe signal represents an unedited allele, whereas a dot that is positive for the vector probe signal but positive for the locus probe signal is Represents an edited allele. FIG. 5 is a graph showing data generated from mouse liver using the method described in FIG. 5A. The pHMI-hPAH-mAC-006 vector packaged in AAVHSC capsid was ^{intravenously injected into two wild-type neonatal mice at a dose of 2 × 10 13} vector genomes per kg body weight via the tail vein. Liver samples were taken 2 weeks later. One sample was analyzed using the method described in Figure 5A. Double positive dots of the vector probe and locus probe were detected. FIG. 5 is a graph showing data generated from a sample containing liver from saline-treated mice and the pHMI-hPAH-mAC-006 plasmid. Almost no probe and locus probe double-positive droplets were detected. This suggests that this sample is significantly diluted and therefore the probability that a drop of oil will contain vector and genomic DNA particles is extremely low. It is a graph which shows the quantification about the graph of FIG. 5D and the graph generated from other samples. Two control mice were edited with 0% and 0.0395% of alleles in the liver, respectively, and two mice treated with the pHMI-hPAH-mAC-006 vector were edited with 2.504% and 2.783% of alleles in the liver, respectively. Was done. It is a graph which shows the mRNA expression of human PAH in the liver after administration of pHMI-hPAH-mAC-006 vector. RNA was extracted and reverse transcribed. Primer pairs and probes were designed to specifically detect PAH expression from edited alleles. Each PAH expression level is normalized to the expression level of endogenous Hprt. Transduction of pHMI-hPAH-mAC-006 vector packaged in AAVHSC capsid in mouse blood samples, measured by ddPCR using a set of primers and probes to determine vector and mouse PAH genomic locus copy numbers. It is a graph which shows efficiency. The number of vector genomes per cell (“VG / cell”) is calculated from a measurement of the ratio of the number of vectors to the number of copies of the mouse PAH genomic locus. In mouse blood samples, the frequency of DNA integrated by integration of AAV vectors (“paidgoes”) into mouse PAH and human PAH loci was measured by multiplexing ddPCR using a primer probe set. It is a graph which shows the edit efficiency percentage. Editing frequency is calculated based on detections of payload and target DNA co-partitioning within a single droplet that exceed the expected probability of payload and target DNA co-partitioning within separate nucleic acid molecules. did. FIG. 5 is a graph showing the percentage level of serum phenylalanine relative to baseline in mice after administration of the pHMI-hPAH-mAC-006 vector packaged in AAVHSC capsid. Mean levels in treated and control animals (mice not treated with AAV) are plotted. FIG. 5 is a graph showing the percentage level of serum phenylalanine relative to baseline in each individual mouse injected with the pHMI-hPAH-mAC-006 vector packaged in AAVHSC capsid or in each control mouse not treated with AAV. The p value was calculated by ANOVA with respect to the control distribution. It is a graph which shows the correlation between the percentage level of serum phenylalanine with respect to the baseline, and the editing efficiency percentage. Pah mRNA and optionally virus containing PAH sequences in mouse liver samples injected with the hPAH-mAC-006 vector (center panel), non-integrated Pah transgene vector (right panel), or saline control (left panel). It is a series of images showing in situ hybridization of DNA. The transduction efficiency of the hPAH-hAC-008 vector and the hPAH-hAC-008-HBB vector into human and mouse hepatocytes in mice administered with the vector packaged in AAVHSC15 capsid, which is specific to the vector. It is a graph which shows the transduction efficiency when it measured by ddPCR using the set of the primer and the probe. The y-axis represents the number of vectors measured relative to the mouse or human cell genome. 5 is a series of photographs showing in situ hybridization of human Pah mRNA and optionally viral DNA containing PAH sequences with silent codon changes in liver samples from mice administered unmodified or modified hPAH-hAC-008 vector. The probe detected only mRNA transcribed from loci edited with the unmodified or modified hPAH-hAC-008 vector. It is a graph which shows the editing efficiency percentage of the hPAH-hAC-008 vector in a mouse and a human hepatocyte from a mouse transplanted with a human hepatocyte as measured by a multiplexed ddPCR. The left half of the figure refers to the editing efficiency of animals treated with the hPAH-hAC-008-HBB vector, and the right side refers to the editing efficiency of animals treated with the hPAH-hAC-008 vector. The p value was calculated by ANOVA. A schematic diagram of the assay used to determine the editing efficiency of PAH genes in mice is shown. FIG. 5 is a graph showing the efficiency of PAH gene editing in cells from mice treated with either the pHMI-hPAH-mAC-006 vector or solvent control. FIG. 6 is a graph showing the average percentage level of serum phenylalanine levels relative to baseline in mice after administration of either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsid or solvent control. FIG. 6 is a graph showing the average percentage level of serum tyrosine levels relative to baseline in mice after administration of either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsid or solvent control. FIG. 5 is a graph showing the ratio of serum phenylalanine levels to serum tyrosine levels in mice treated with either the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsid or solvent control. FIG. 5 is a graph showing average PAH gene editing efficiency and transduction efficiency in cells obtained from mice administered with either the pHMI-hPAH-mAC-006 vector or solvent control. Relative amount of PAH mRNA expressed in cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) and / or solvent control, normalized to the expression level of mouse GAPDH. The graph which shows the said relative quantity is shown. It is a schematic diagram which shows the HuLiv humanized liver mouse model. The mean PAH gene editing efficiency in cells obtained from mice 1 week and 6 weeks after administration of the pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15 capsid is shown. Mean PAH gene editing efficiency in cells obtained from HuLiv mice dosed with the pHMIK-hPAH-hI1C-032 vector packaged in the AAVHSC15 capsid, said editing as measured by ddPCR and next generation sequencing (NGS). It is a graph which shows efficiency. PAH knockout mouse model (PAH ENU2) mice intravenously administered with either the pHMIK-hPAH-hI1C-032 vector (hPAH-032) or the pHMI-hPAH-mAC-006 vector (mPAH-006) ^{packaged in AAVHSC15} It is a graph which shows the average serum phenylalanine level of the mouse compared with the control mouse. It is a graph which shows the relationship between the human PAH expression level and the serum Phe level. It is a plot showing the expression of human PAH to human GAPDH in two different HuLiv mice treated with the pHMIK-hPAH-hI1C-032 vector packaged in AAVHSC15. It is a plot which shows the human PAH gene expression (left side) in the HuLiv mouse treated with the pHMI-hPAH-mAC-006 vector ^{packaged in AAVHSC15 and} the mouse PAH gene expression (right side) in the PAH ENU2 mouse treated with the vector. The vector map of pKITR-hPAH-mAC-006-HCR is shown. The vector map of pKITR-hPAH-hI1C-032-HCR is shown. The vector map of pKITR-hPAH-mAC-006-SD.3 is shown. The vector map of pHMIA2-hPAH-hI1C-032-SD.3 is shown. The vector map of pHMIA2-hPAH-mAC-006-HBB1 is shown.

The present disclosure provides an adeno-associated virus (AAV) composition capable of restoring PAH gene function in cells. A packaging system for making adeno-associated virus compositions is also provided.

I. Definition As used herein, the term "replication-deficient adeno-associated virus" refers to an AAV containing a genome lacking the Rep and Cap genes.

As used herein, the term "PAH gene" includes, but is not limited to, the coding region of the PAH gene, exons, introns, 5'UTR, 3'UTR, and transcriptional regulatory regions. PAH) refers to the gene. The human PAH gene is identified by Entrez Gene ID 5053. An exemplary nucleotide sequence of PAH mRNA is provided as SEQ ID NO: 24. An exemplary amino acid sequence of a PAH polypeptide is provided as SEQ ID NO: 23.

As used herein, the term "correcting a mutation in a PAH gene" is a target gene for a mutant PAH gene to create a PAH gene capable of expressing a wild-type PAH polypeptide. Refers to the insertion, deletion or substitution of one or more nucleotides in a locus. In certain embodiments, "correcting a mutation in a PAH gene" translates a nucleotide sequence encoding at least a portion of a wild-type PAH polypeptide or functional equivalent thereof into a mutant PAH gene, said wild-type. It involves insertion such that the type PAH polypeptide or functional equivalent thereof is expressed from the mutant PAH locus (eg, under the control of an exogenous PAH gene promoter).

As used herein, the term "modified genome" incorporates an editing element (eg, one or more nucleotides or inter-nucleotide linkages) into a target locus by homologous recombination to detect a genetic defect in the PAH gene. Refers to a recombinant AAV genome that can be modified. In certain embodiments, the target locus is within the human PAH gene. A portion of the modified genome containing the 5'homologous arm, the editing element, and the 3'homologous arm may or may be present in the sense orientation with respect to the target locus (eg, the human PAH gene). It will be understood by those skilled in the art that it may occur.

As used herein, the term "editing element" refers to a portion of the modified genome that modifies the target locus when integrated into the target locus. Editing elements can mediate the insertion, deletion or substitution of one or more nucleotides at the target locus.

As used herein, the term "target locus" refers to a region or internucleotide binding of a chromosome (eg, a region or internucleotide binding of a human PAH gene) that is modified by an editorial element.

As used herein, the term "homologous arm" refers to a portion of the modified genome located on the 5'or 3'side of an editing element that is substantially identical to the genome adjacent to the target locus. In certain embodiments, the target locus is within the human PAH gene and the homologous arm comprises a sequence that is substantially identical to the genome flanking the locus.

As used herein, the term "clade F capsid protein" refers to the VP1, VP2, or VP3 amino acids set forth in amino acids 1-736, 138-736, and 203-736 of SEQ ID NO: 1 herein, respectively. Refers to an AAV VP1, VP2, or VP3 capsid protein that contains an amino acid sequence that has at least 90% identity with the sequence.

As used herein, identity between two nucleotide sequences or between two amino acid sequences is determined by dividing the number of identical nucleotides or amino acids aligned by the full length of the longer nucleotide or amino acid sequence. ..

As used herein, the term "disease or disorder associated with a PAH gene mutation" is caused by a mutation in the PAH gene, is exacerbated by a mutation in the PAH gene, or is genetically associated with a mutation in the PAH gene. Refers to any associated disease or disorder. In certain embodiments, the disease or disorder associated with the PAH gene mutation is phenylketonuria (PKU).

As used herein, the term "silently altered" is a change in the coding sequence or stuffer insertion coding sequence of a gene and is a poly encoded by said coding sequence or stuffer insertion coding sequence. Refers to changes that do not involve changes in the amino acid sequence of a peptide (eg, due to nucleotide substitutions). Codon changes can be made by any method known in the art (eg, in Mauro and Chappell (2014) Trends Mol Med. 20 (11): 604-13, which is incorporated herein by reference in its entirety. It can be done by the method described). Such silent changes are advantageous in reducing the likelihood of integration of the modified genome into the locus of other genes or to the locus of paralogous pseudoinheritance to the target gene. Such silent changes also reduce unwanted integration mediated by the editing element rather than the homologous arm by reducing the homology between the editing element and the target gene.

As used herein, the term "coding sequence" refers to the portion of complementary DNA (cDNA) that encodes a polypeptide that begins at the start codon and ends at the stop codon. Genes may have one or more coding sequences due to alternative splicing and / or selective translation initiation. The coding sequence can be wild-type or have silent changes. An exemplary wild-type coding sequence is that set forth in SEQ ID NO: 24.

As used herein, the term "intron insertion coding sequence" of a gene refers to a nucleotide sequence containing one or more introns inserted into the coding sequence of a gene. In certain embodiments, at least one of the introns has an unnatural intron, i.e., a sequence different from the natural intron of the gene. In certain embodiments, all introns within the intron insertion coding sequence are unnatural introns. Unnatural introns may have sequences of introns from different species, or may have sequences of introns within different genes from the same species. Alternatively or additionally, at least a portion of the unnatural intron sequence may be synthetic. It will be appreciated by those skilled in the art that unnatural intron sequences can be designed to mediate RNA splicing by introducing any consensus splicing motif known in the art. Illustrative consensus splicing motifs are provided in Sibley et al., (2016) Nature Reviews Genetics, 17, pp. 407-21, which are incorporated herein by reference in their entirety. Insertion of non-natural introns can increase the efficiency and robustness of vector packaging, as the stuffer sequence can adjust the vector to the optimum size (eg, 4.5-4.8 kb). In certain embodiments, at least one of the introns is the natural intron of the gene. In certain embodiments, all of the introns within the intron insertion coding sequence are the native introns of the gene. Non-natural or natural introns can be inserted into any internucleotide linkage within the coding sequence. In certain embodiments, one or more unnatural or natural introns are inserted into internucleotide bonds that are expected to promote efficient splicing (eg, the whole of which is incorporated herein by reference). See Zhang (1998) Human Molecular Genetics, 7 (5): pp. 919-32). In certain embodiments, one or more unnatural or natural introns are inserted into the internucleotide bonds that link the two exogenous exons.

As used herein, the term "ribosome skipping element" refers to a nucleotide sequence that encodes a short peptide sequence that can trigger the production of two peptide chains from the translation of one mRNA molecule. In certain embodiments, the ribosome skipping element is X ₁ X ₂ EX ₃ NPGP (in the formula, X ₁ is D or G, X ₂ is V or I, and X ₃ is any amino acid. Encodes a peptide containing the consensus motif of (SEQ ID NO: 75). In certain embodiments, the ribosome skipping elements are thosea-asigna virus 2A peptide (T2A), porcine virus-1 2A peptide (P2A), foot and foot epidemic virus 2A peptide (F2A), horse rhinitis A. It encodes a viral 2A peptide (E2A), a cytonal nucleus polymorphic disease viral 2A peptide (BmCPV 2A), or a silkworm (B.mori) softening disease viral 2A peptide (BmIFV 2A). Exemplary amino acid sequences of T2A and P2A peptides are those set forth in SEQ ID NOs: 76 and 77, respectively. Exemplary nucleotide sequences of T2A and P2A elements are those set forth in SEQ ID NOs: 78 and 79, respectively. In certain embodiments, the ribosome skipping element encodes a peptide further comprising a Gly-Ser-Gly sequence at the N-terminus, and optionally the Gly-Ser-Gly sequence is by the nucleotide sequence of GGCAGCGGA. It is coded. Although not desired to be constrained by theory, the ribosome skipping element is due to termination of translation of the first peptide chain and resumption of translation of the second peptide chain, or by the intrinsic protease activity of the encoded peptide. Alternatively, it is assumed that it functions by cleavage of a peptide bond in the peptide sequence encoded by the ribosome skipping element by another protease in the environment (eg, cytosol).

As used herein, the term "ribosome skipping peptide" refers to a peptide encoded by a ribosome skipping element.

As used herein, the term "polyadenylation sequence" refers to a DNA sequence that constitutes a polyadenylation signal sequence when transcribed into RNA. Polyadenylation sequences can be natural (eg, from the PAH gene) or exogenous. The exogenous polyadenylation sequence can be a mammalian polyadenylation sequence or a viral polyadenylation sequence (eg, an SV40 polyadenylation sequence).

In the present disclosure, nucleotide positions within the PAH gene are designated relative to the first nucleotide of the start codon. The first nucleotide of the start codon is at the 1-position, the nucleotide on the 5'side of the first nucleotide of the start codon has a negative number, and the nucleotide on the 3'side of the first nucleotide of the start codon has a negative number. Has a positive number. As used herein, nucleotide 1 of the human PAH gene is nucleotide 5,473 of NCBI reference sequence NG_008690.1 and nucleotide-1 of the human PAH gene is nucleotide 5,472 of NCBI reference sequence NG_008690.1.

In the present disclosure, exons and introns within the PAH gene are designated relative to exons containing the first nucleotide of the start codon, which is nucleotide 5473 of NCBI reference sequence NG_008690.1. The exon containing the first nucleotide of the start codon is exon 1. Exons on the 3'side of exon 1 become exon 2, exon 3, etc. from 5'to 3'. The intron on the 3'side of exon 1 becomes intron 1, intron 2, etc. from 5'to 3'. Therefore, the PAH gene contains exons 1, introns 1, exons 2, introns 2, exons 3, etc. from 5'to 3'. As used herein, exons 1 of the human PAH gene are nucleotides 5001-5532 of NCBI reference sequence NG_008690.1, and intron 1 of the human PAH gene is nucleotides 5533-9704 of NCBI reference sequence NG_008690.1. Is.

As used herein, the term "integration" refers to the introduction of an editing element into a target locus (eg, that of the PAH gene) by homologous recombination between the modified genome and said target locus. .. Integration of editing elements can result in substitutions, insertions and / or deletions of one or more nucleotides at the target locus (eg, that of the PAH gene).

As used herein, the term "efficiency of integration of editorial elements into a target locus" refers to the percentage of cells in a transduced population in which integration of an editorial element into a target locus has occurred.

As used herein, the term "allele frequency of integration of an editing element into a target locus" refers to the percentage of alleles in a population of transduced cells in which integration of an editing element into a target locus has occurred. ..

As used herein, the "standard AAV dosing condition" is transduction into human stem cells implanted in mice after hepatocyte ablation, where AAV is performed by the method in Section b of Example 5. Refers to transduction, administered intravenously at a dose of ^{1 × 10 13} vector genomes per kilogram of body weight, as given.

As used herein, the term "effective amount" in the context of administration of AAV to a subject refers to the amount of AAV that achieves the desired prophylactic or therapeutic effect.

II. Adeno-associated virus compositions In one aspect, novel replication-deficient AAV compositions useful for restoring PAH expression in cells with reduced PAH gene function or other defects are provided herein. Such AAV compositions are highly efficient at correcting mutations in the PAH gene or restoring PAH expression, and exogenous nucleases (eg, meganucleases, zinc finger nucleases, transcriptions) to facilitate such corrections. It does not require genome cleavage at the target locus by the action of activator-like nucleases (TALENs) or RNA-induced nucleases, such as Cas9). Thus, in certain embodiments, the AAV compositions disclosed herein do not contain exogenous nucleases or nucleotide sequences encoding exogenous nucleases.

In certain embodiments, the AAV disclosed herein comprises an AAV capsid and a modified genome for editing a target locus within the PAH gene. The AAV capsid proteins that can be used in the AAV compositions disclosed herein are, but are not limited to, Clade A AAV, Clade B AAV, Clade CA AV, Clade D AAV, Clade E AAV and Clade F AAV. AAV capsid proteins and derivatives thereof. In certain embodiments, the AAV capsid protein is the AAV capsid protein of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 or AAVrh10 or a derivative thereof. In certain embodiments, the AAV capsid comprises an AAV clade F capsid protein.

Any AAV clade F capsid protein or derivative thereof can be used in the AAV compositions disclosed herein. For example, in certain embodiments, the AAV clade F capsid protein is amino acid 203 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16 or 17. ~ 736 amino acid sequence and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 Includes amino acid sequences with%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the AAV clade F capsid protein is such that the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2. Is H, the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q, and the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A and SEQ ID NO: The amino acid in the capsid protein corresponding to amino acid 464 of 2 is N, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid corresponding to amino acid 501 of SEQ ID NO: 2 is said. The amino acid in the capsid protein is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R. The amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: R is R, and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid corresponding to amino acid 706 of SEQ ID NO: 2 is the capsid. The amino acid in the protein is C, or the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G, SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9 , 10, 11, 12, 13, 15, 16, or 17 amino acids 203-736 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, Includes amino acid sequences with 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 505 of is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 in SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 706 in is C. In certain embodiments, the AAV clade F capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. ..

For example, in certain embodiments, the AAV clade F capsid protein is amino acid 138 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16 or 17. ~ 736 amino acid sequence and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 Includes amino acid sequences with%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the AAV clade F capsid protein is such that the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2. Is D, the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C, and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and SEQ ID NO: The amino acid in the capsid protein corresponding to amino acid 312 of 2 is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid corresponding to amino acid 464 of SEQ ID NO: 2 is said. The amino acid in the capsid protein is N, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I. The amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R and the amino acid of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to 626 is G or Y, the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponds to amino acid 687 of SEQ ID NO: 2. The amino acid in the protein is R, the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C. Yes, or the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G, SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 15, 16, or 17 amino acids 138-736 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% contains an amino acid sequence having sequence identity. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 505 of is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 in SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 706 in is C. In certain embodiments, the AAV clade F capsid protein comprises amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. Contains the amino acid sequence.

For example, in certain embodiments, the AAV clade F capsid protein is amino acid 1 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16 or 17. ~ 736 amino acid sequence and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 Includes amino acid sequences with%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the AAV clade F capsid protein is such that the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T and the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2. Is I, the amino acid in the capsid protein corresponding to amino acid 68 of SEQ ID NO: 2 is V, and the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R and SEQ ID NO: The amino acid in the capsid protein corresponding to amino acid 119 of 2 is L, the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R, and the amino acid corresponding to amino acid 160 of SEQ ID NO: 2 is said. The amino acid in the capsid protein is D, the amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C, and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H. The amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q, and the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A and the amino acid of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to 464 is N and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S and in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2. The amino acid of is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R. The amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or Y, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, amino acid 687 of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to is R and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K and corresponds to amino acid 706 of SEQ ID NO: 2 in the capsid protein. The amino acid is C, or the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G, SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17 Amino acid sequences of amino acids 1 to 736 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, Includes amino acid sequences with 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 505 of is R, and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 in SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R. In certain embodiments, the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 706 in is C. In certain embodiments, the AAV clade F capsid protein comprises amino acids 1 to 12, 13, 15, 16, or 17 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. Contains 736 amino acid sequences.

In certain embodiments, the AAV capsid comprises (a) the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. Clade F Capsid protein, (b) Clade F containing the amino acid sequences of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. A clade containing the capsid protein and (c) the amino acid sequences of amino acids 1-736 of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17 Contains two or more of the F capsid proteins. In certain embodiments, the AAV capsid has (a) an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. Clade F capsid protein, (b) has an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17 Clade F capsid protein and (c) Amino acid sequence consisting of amino acids 1 to 736 of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16 or 17 Includes Clade F capsid protein with.

In certain embodiments, the AAV capsid is (a) the sequence of amino acids 203-736 of SEQ ID NO: 8 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, Clade F capsid protein containing an amino acid sequence with 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. , (B) Sequence of amino acids 138-736 of SEQ ID NO: 8 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 Clade F capsid protein containing an amino acid sequence having a%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, and (c) the amino acid of SEQ ID NO: 8. Sequences from 1 to 736 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 Includes one or more of the Clade F capsid proteins containing an amino acid sequence having a%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 8, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 8. Includes one or more of the capsid proteins and (c) Clade F capsid proteins comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 8. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 8, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 8. Includes two or more of the capsid proteins and (c) Clade F capsid proteins comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 8. In certain embodiments, the AAV capsid has (a) a clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 8, and (b) an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 8. It contains a clade F capsid protein and (c) a clade F capsid protein having an amino acid sequence consisting of amino acids 1 to 736 of SEQ ID NO: 8.

In certain embodiments, the AAV capsid is (a) the sequence of amino acids 203-736 of SEQ ID NO: 11 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, Clade F capsid protein containing an amino acid sequence having 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. , (B) Sequence of amino acids 138-736 of SEQ ID NO: 11 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 Clade F capsid protein containing an amino acid sequence having a%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, and (c) the amino acid of SEQ ID NO: 11. Sequences from 1 to 736 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 Includes one or more of the Clade F capsid proteins containing an amino acid sequence having a%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 11, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 11. Includes one or more of the capsid proteins and (c) Clade F capsid proteins comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 11. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 11, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 11. Includes two or more of a capsid protein and (c) a clade F capsid protein comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 11. In certain embodiments, the AAV capsid has (a) a clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 11 and (b) an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 11. It contains a clade F capsid protein and (c) a clade F capsid protein having an amino acid sequence consisting of amino acids 1 to 736 of SEQ ID NO: 11.

In certain embodiments, the AAV capsid is (a) the sequence of amino acids 203-736 of SEQ ID NO: 13 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, Clade F capsid protein containing an amino acid sequence having 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. , (B) Sequence of amino acids 138-736 of SEQ ID NO: 13 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 Clade F capsid protein containing an amino acid sequence having a%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, and (c) the amino acid of SEQ ID NO: 13. Sequences from 1 to 736 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 Includes one or more of the Clade F capsid proteins containing an amino acid sequence having a%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 13, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 13. Includes one or more of the capsid proteins and (c) Clade F capsid proteins comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 13. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 13, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 13. Includes two or more of a capsid protein and (c) a clade F capsid protein comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 13. In certain embodiments, the AAV capsid has (a) a clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 13, and (b) an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 13. It contains a clade F capsid protein and (c) a clade F capsid protein having an amino acid sequence consisting of amino acids 1 to 736 of SEQ ID NO: 13.

In certain embodiments, the AAV capsid is (a) the sequence of amino acids 203-736 of SEQ ID NO: 16 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, Clade F capsid protein containing an amino acid sequence having 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity. , (B) Sequence of amino acids 138-736 of SEQ ID NO: 16 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 Clade F capsid protein containing an amino acid sequence having a%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity, and (c) the amino acid of SEQ ID NO: 16. Sequences from 1 to 736 and at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 Includes one or more of the Clade F capsid proteins containing an amino acid sequence having a%, 95%, 96%, 97%, 98%, or 99% sequence identity. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 16, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 16. Includes one or more of the capsid proteins and (c) Clade F capsid proteins comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 16. In certain embodiments, the AAV capsid is (a) a clade F capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 16, and (b) a clade F comprising the amino acid sequences of amino acids 138-736 of SEQ ID NO: 16. Includes two or more of a capsid protein and (c) a clade F capsid protein comprising the amino acid sequences of amino acids 1-736 of SEQ ID NO: 16. In certain embodiments, the AAV capsid has (a) a clade F capsid protein having an amino acid sequence consisting of amino acids 203-736 of SEQ ID NO: 16 and (b) an amino acid sequence consisting of amino acids 138-736 of SEQ ID NO: 16. It contains a clade F capsid protein and (c) a clade F capsid protein having an amino acid sequence consisting of amino acids 1 to 736 of SEQ ID NO: 16.

Modified genomes useful in the AAV compositions disclosed herein generally include (i) editing elements for editing the target locus within the PAH gene and (ii) the 5'side of the target locus. Homology to the 5'homologous arm nucleotide sequence on the 5'side of the editing element having homology to the first genomic region and (iii) to the second genomic region on the 3'side of the target locus. The portion of the modified genome containing the 3'homologous arm nucleotide sequence on the 3'side of the editing element having the 5'homologous arm and the editing element and the 3'homologous arm is in the sense direction with respect to the PAH locus. It may be present in, or it may be present in the antisense direction. In certain embodiments, the modified genome has a 5'reverse end repeat (5'ITR) nucleotide sequence on the 5'side of the 5'homologous arm nucleotide sequence and 3'on the 3'side of the 3'homologous arm nucleotide sequence. Includes a'reverse end repeat (3'ITR) nucleotide sequence.

The editing elements used in the modified genome disclosed herein can mediate the insertion, deletion or substitution of one or more nucleotides at the target locus.

In certain embodiments, when correctly integrated into the target locus by homologous recombination, the editing element transfers a nucleotide sequence containing at least a portion of the PAH coding sequence to the mutant PAH gene, a wild-type PAH polypeptide or The functional equivalent is inserted so that it is expressed from the mutant PAH locus. In certain embodiments, the editing element comprises a complete PAH coding sequence (eg, a wild-type PAH coding sequence or a PAH coding sequence with a silent variation). In certain embodiments, the editing element comprises nucleotides 4-1359 of the PAH coding sequence. In certain embodiments, the editing element comprises a PAH intron insertion coding sequence, such as one containing an intron inserted into a PAH coding sequence having a wild-type or silent variation.

In certain embodiments, the PAH coding sequence encodes a wild-type PAH polypeptide (eg, one having the amino acid sequence set forth in SEQ ID NO: 23). In certain embodiments, the PAH coding sequence is wild-type (eg, including the nucleotide sequence set forth in SEQ ID NO: 24). In certain embodiments, the PAH coding sequence is less than 100% with the corresponding exons of the wild-type PAH gene (eg, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%). , 55% or less than 50%) Have silent changes to be identical. In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 25. In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 116.

In certain embodiments, the PAH intron insertion coding sequence encodes a wild-type PAH polypeptide, eg, one having the amino acid sequence set forth in SEQ ID NO: 23. In certain embodiments, the PAH intron insertion coding sequence is at least one inserted into the PAH coding sequence (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or, or 12) Intron is included. Introns may include native intron sequences of the PAH gene, intron sequences from different species or intron sequences from different genes from the same species, and / or synthetic intron sequences. In certain embodiments, the unnatural intron is up to 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1,500, or 2,000 nucleotides in length. Although not desired to be constrained by theory, it is hypothesized that introns can increase transgene expression, for example by reducing transcriptional silencing and enhancing mRNA nuclear export from the nucleus to the cytoplasm. To do. Synthetic intron sequences can be incorporated into any splicing motif known in the art (eg, in Sibley et al., (2016) Nature Reviews Genetics, 17, 407-21, which is incorporated herein by reference in its entirety). It will be appreciated by those skilled in the art that by introducing the above, it can be designed to mediate RNA splicing. Illustrative intron sequences are incorporated herein by reference in their entirety, Lu et al. (2013) Molecular Therapy 21 (5): pp. 954-63, and Lu et al. (2017) Hum. Gene Ther. 28. (1): Provided on pages 125-34. In certain embodiments, the editing element comprises a first intron of the hemoglobin beta gene in any species (eg, human, mouse, or rabbit). In certain embodiments, the editing element is the first intron of the human HBB gene (eg, SEQ ID NO: 28 and at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%). , 98%, or 99% containing the same nucleotide sequence). In certain embodiments, the editing element is the first intron of the mouse HBB gene (eg, SEQ ID NO: 29 and at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%). , 98%, or 99% containing the same nucleotide sequence). In certain embodiments, the editing element is a mouse microvirus (MVM) intron (eg, SEQ ID NO: 30 and at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, Contains 98% or 99% of identical nucleotide sequences).

In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 120. Includes a chimeric MVM intron (also referred to herein as ChiMVM) that comprises or consists of a nucleotide sequence. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 121. Includes an SV40 intron containing or consisting of a nucleotide sequence. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 122. Includes an adenovirus tripartite leader intron (also referred to herein as AdTPL) that comprises or consists of a nucleotide sequence. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 123. Includes a mini β-globin intron (also referred to herein as MiniB Globin) that comprises or consists of a nucleotide sequence. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 124. Includes AdV / Ig chimeric introns (also referred to herein as AdVIgG) that contain or consist of nucleotide sequences. In certain embodiments, the editing element is a β-globin Ig heavy chain intron (also referred to herein as Bglobin Ig), which is a chimeric intron comprising a β-globin splice donor region and an IgG heavy chain splice acceptor region. For example, it contains or does not contain at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical nucleotide sequences to SEQ ID NO: 125. Includes the β-globin Ig heavy chain intron consisting of various nucleotide sequences. In certain embodiments, the editing element is a variant of the wild-type MVM intron, the Wu MVM intron (also referred to herein as Wu MVM), eg, SEQ ID NO: 126 and at least 90%, 91%, 92. %, 93%, 94%, 95%, 96%, 97%, 98%, or 99% Includes said Wu MVM intron containing or consisting of the same nucleotide sequence. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 127. Includes an HCR1 element (also referred to herein as OptHCR) that comprises or consists of a nucleotide sequence. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 128. Includes β-globin introns (also referred to herein as B Globin) that contain or consist of nucleotide sequences. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 129. Includes Factor IX introns (also referred to herein as tFIX or FIX introns) that contain or consist of nucleotide sequences. In certain embodiments, the editing element is, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 130. Includes a ch2BLood intron (also referred to herein as Blood Enh) that comprises or consists of a nucleotide sequence. In certain embodiments, the PAH intron insertion coding sequence encodes a wild-type PAH polypeptide, eg, one having the amino acid sequence set forth in SEQ ID NO: 23. In certain embodiments, the PAH intron insertion coding sequence comprises a portion of the PAH coding sequence that, when spliced together, forms a complete PAH coding sequence. In certain embodiments, the PAH coding sequence is wild-type (eg, including the nucleotide sequence set forth in SEQ ID NO: 24). In certain embodiments, the PAH coding sequence is less than 100% with the corresponding exons of the wild-type PAH gene (eg, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%). , 55% or less than 50%) have silent changes that are identical. In certain embodiments, the PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 25. In certain embodiments, the PAH coding sequence comprises or consists of the nucleotide sequences set forth in SEQ ID NO: 116. In certain embodiments, the intron-inserted PAH coding sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 116. Contains the nucleotide sequence of. In certain embodiments, the PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 116. In certain embodiments, the intron-inserted PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 80, 81, 82, 131, 132, or 143. In certain embodiments, the intron-inserted PAH coding sequences are at least 90%, 91%, 92%, 93%, 94%, 95%, 96% with SEQ ID NOs: 80, 81, 82, 131, 132, or 143. , 97%, 98%, or 99% contain the same nucleotide sequence. In certain embodiments, the intron-inserted PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 80, 81, 82, 131, 132, or 143.

The intron can be inserted at any position in the PAH coding sequence. In certain embodiments, the intron is inserted at the position corresponding to the internucleotide bond connecting the two natural exons. In certain embodiments, the intron is inserted at a position corresponding to the internucleotide bond that connects the natural exon 8 and exon 9. In certain embodiments, the PAH intron insertion coding sequence comprises a first portion of the PAH coding sequence, an intron, and a second portion of the PAH coding sequence from 5'to 3'. The first part and the second part together form a complete PAH coding sequence (eg, a wild PAH coding sequence, or a PAH coding sequence with silent variation) when spliced together. In certain embodiments, the first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65, and / or the second portion of the PAH coding sequence is set forth in SEQ ID NO: 66 or 67. Contains the amino acid sequence of. In certain embodiments, the first part of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 64 or 65 and the second part of the PAH coding sequence is the amino acid sequence set forth in SEQ ID NO: 66 or 67. Consists of. In certain embodiments, the first portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 65 and the second portion of the PAH coding sequence consists of the amino acid sequence set forth in SEQ ID NO: 67. In certain embodiments, the editing element is the first portion of the PAH coding sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 64, from 3'to 5', or a variant having a silent variation thereof (eg, sequence). A PAH coding sequence consisting of the nucleotide sequence set forth in No. 65), an intron (eg, consisting of the nucleotide sequence set forth in SEQ ID NO: 28, 29, or 30) and the nucleotide sequence set forth in SEQ ID NO: 66. Includes a second portion, or a variant thereof having a silent variation (eg, consisting of the nucleotide sequence set forth in SEQ ID NO: 66).

In certain embodiments, the PAH coding sequence comprises a modified splice donor site. In certain embodiments, the splice donor site-modified PAH coding sequence comprises the nucleotide sequence set forth in SEQ ID NO: 138 or 139. In certain embodiments, the splice donor site-modified PAH coding sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, with SEQ ID NO: 138 or 139. Or contains 99% identical nucleotide sequences. In certain embodiments, the splice donor site-modified PAH coding sequence consists of the nucleotide sequence set forth in SEQ ID NO: 138 or 139.

In certain embodiments, the editing element further comprises a transcription terminator on the 3'side of the PAH coding sequence or PAH intron insertion coding sequence. In certain embodiments, the transcription terminator comprises a polyadenylation sequence (eg, an exogenous polyadenylation sequence). In certain embodiments, the exogenous polyadenylation sequence comprises an SV40 polyadenylation sequence, including, for example, a nucleotide sequence selected from the group of SEQ ID NOs: 31-34, or a sequence complementary thereto. In certain embodiments, the SV40 polyadenylation sequence comprises the nucleotide sequence set forth in SEQ ID NO: 31. In certain embodiments, the editing element is directed from 5'to 3'to the PAH coding sequence (eg, including the nucleotide sequence set forth in SEQ ID NO: 25) or the PAH intron insertion coding sequence (eg, SEQ ID NO: 80). (Contains the nucleotide sequence set forth in SEQ ID NO: 31) and an SV40 polyadenylated sequence (for example, those containing the nucleotide sequence set forth in SEQ ID NO: 31).

In certain embodiments, the editing element may further include an ID cassette on the 5'side of the SV40 polyadenylation sequence (eg, one containing the nucleotide sequence set forth in SEQ ID NO: 31). ID cassettes provide sequences that can be used for identification when performing next-generation sequencing experiments. In certain embodiments, the ID cassette comprises the nucleotide sequence set forth in SEQ ID NO: 33. In certain embodiments, the ID cassette is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical nucleotide sequence to SEQ ID NO: 33. including. In certain embodiments, the ID cassette consists of the nucleotide sequence set forth in SEQ ID NO: 33. In certain embodiments, the editing element comprises a PAH code sequence or PAH intron insertion code sequence, an ID cassette, and an SV40 polyadenylation sequence from 5'to 3'.

In certain embodiments, the editing element further comprises a ribosome skipping element on the 5'side of the PAH coding sequence or PAH intron insertion coding sequence. In certain embodiments, the editing elements are from 5'to 3'with a ribosome skipping element, a PAH coding sequence or a PAH intron insertion coding sequence, and optionally a transcription terminator (eg, a polyadenylation sequence). including. In certain embodiments, the above-mentioned editing elements are homologously recombinantly incorporated into the exon of the PAH gene (eg, the 5'side nucleotide of the target gene enters the exon of the PAH gene), resulting in a result from 5'. A pair comprising a portion of the PAH gene on the 5'side of the target locus towards 3', a ribosome skipping element, a PAH coding sequence or PAH intron insertion coding sequence, and a transcription terminator (eg, a polyadenylated sequence). To generate the recombinant sequence which is a translocation sequence and in which the ribosome skipping element is in an in-frame position with the portion of the PAH gene on the 5'side of the target locus and the complete PAH coding sequence. Can be done. The first, which comprises the amino acid sequence encoded by the PAH gene portion on the 5'side of the target locus, fused to the 5'portion of the encoded ribosome skipping peptide by transcription and translation of this recombinant sequence. And a second polypeptide containing the 3'portion of the encoded ribosome skipping peptide fused to the complete amino acid sequence of the PAH polypeptide are produced.

In certain embodiments, the 5'side nucleotide of the target locus is an exon of the PAH gene (eg, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 8). It is in 9, exon 10, exon 11, exon 12, or exon 13). In certain embodiments, the target locus is an exon of the PAH gene (eg, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 10. An internucleotide bond within 11, exon 12, or exon 13). In certain embodiments, the target locus is a sequence within the PAH gene, and the 5'end of this sequence is the exon of the PAH gene (eg, exon 1, exon 2, exon 3, exon 4, exon 5, Exon 6, Exon 7, Exon 8, Exon 9, Exon 10, Exon 11, Exon 12 or Exon 13) or in the intergenic region between Achaete-scute homolog 1 (ASCL1) and PAH , The 3'end of this sequence can be any nucleotide within the PAH gene or within the intergenic region between PAH and insulin-like growth factor 1 (IGF1). In certain embodiments, the nucleotide on the 5'side of the target locus is within exon 1, exon 2, or exon 3 of the PAH gene. In certain embodiments, the target locus is an internucleotide linkage within exon 1, exon 2, or exon 3 of the PAH gene. In certain embodiments, the target locus is a sequence within the PAH gene, and the 5'end of this sequence is within exon 1, exon 2, or exon 3 of the PAH gene, and the 3'end of this sequence. Can be any nucleotide within the PAH gene or within the intergenic region between PAH and IGF1.

In certain embodiments, the editing element comprises a splice acceptor on the 5'side of the ribosome skipping element. In certain embodiments, the editing elements go from 5'to 3'towards a splice acceptor, a ribosome skipping element, a PAH coding sequence or a PAH intron insertion coding sequence, and a transcription terminator as needed (eg, a transcription terminator). Polyadenylation sequence) and. In certain embodiments, the editing elements described above are integrated into the intron of the PAH gene by homologous recombination (eg, the 5'side nucleotide of the target gene enters the intron of the PAH gene), resulting in a result from 5'. Towards 3', the portion of the PAH gene on the 5'side of the target locus, including the intrinsic splice donor site of the intron but not the exogenous splice acceptor, the splice acceptor, the ribosome skipping element, and the PAH. A recombinant sequence comprising a coding sequence or PAH intron insertion coding sequence and a transcription terminator (eg, a polyadenylated sequence), wherein the ribosome skipping element is the PAH coding sequence or PAH intron insertion coding sequence, and a transcription terminator. (For example, a polyadenylated sequence) and the portion of the PAH gene on the 5'side of the target loci by splicing the splice acceptor to the endogenous splice donor of the intron of PAH, which appears to be in-frame. The recombinant sequence can be generated in a position that is framed. Expression of this recombinant sequence comprises a first poly comprising an amino acid sequence encoded by the portion of the PAH gene on the 5'side of the target locus, fused to the 5'part of the encoded ribosome skipping peptide. A second polypeptide containing the complete amino acid sequence of the PAH polypeptide, fused to the 3'part of the encoded ribosome skipping peptide, is produced.

In certain embodiments, the 5'-side nucleotide of the target locus is an intron of the PAH gene (eg, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 8). 9, Intron 10, Intron 11, or Intron 12). In certain embodiments, the target locus is the intron of the PAH gene (eg, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 10). 11 or an internucleotide bond within an intron 12). In certain embodiments, the target locus is a sequence within the PAH gene, and the 5'end of this sequence is the intron of the PAH gene (eg, intron 1, intron 2, intron 3, intron 4, intron 5, intron 5, Within intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, or intron 12), the 3'end of this sequence is within the PAH gene or within the intergenic region between PAH and IGF1. Can be any nucleotide. In certain embodiments, the nucleotide on the 5'side of the target locus is within the intron 1, intron 2, or intron 3 of the PAH gene. In certain embodiments, the target locus is an internucleotide linkage within an intron 1, intron 2, or intron 3 of the PAH gene. In certain embodiments, the target locus is a sequence within the PAH gene, and the 5'end of this sequence is within the intron 1, intron 2, or intron 3 of the PAH gene, and the 3'end of this sequence. Can be any nucleotide within the PAH gene or within the intergenic region between PAH and IGF1. In certain embodiments, the nucleotide on the 5'side of the target locus is within intron 1 of the PAH gene. In certain embodiments, the target locus is a sequence within the PAH gene, the 5'end of this sequence is within the intron 1 of the PAH gene, and the 3'end of this sequence is within the PAH gene. Or it can be any nucleotide in the intergenic region between PAH and IGF1.

Any or all of the editing elements disclosed herein can further include restriction endonuclease sites that are not present in the wild-type PAH gene. Cells with editing elements integrated at the target locus by such restriction endonuclease sites, based on restriction enzyme fragment length polymorphism analysis, or for nucleic acids amplified from the target locus and its flanking regions or from them. Can be identified by nuclear sequencing analysis of.

Any or all of the editing elements disclosed herein may contain one or more nucleotide changes that cause one or more amino acid mutations in the PAH polypeptide when integrated at the target locus. it can. In certain embodiments, the mutant PAH polypeptide is a functional equivalent of a wild-type PAH polypeptide, i.e., it can function like a wild-type PAH polypeptide. In certain embodiments, the functionally equivalent PAH polypeptide has the ability to stabilize at least one property not found in wild PAH polypeptides, such as PAH proteins (eg, dimers or tetramers). , Or have the ability to resist proteolysis.

In certain embodiments, the editing elements described herein include at least 0, 1, 2, 10, 100, 200, 500, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides. In certain embodiments, the editing elements are 1 to 5000, 1 to 4500, 1 to 4000, 1 to 3000, 1 to 2000, 1 to 1000, 1 to 500, 1 to 200, 1 to 100, 1 to 50. , Or contains 1 to 10 nucleotides, or consists of such a number of nucleotides.

In certain embodiments, the editing elements described herein are PAH coding sequences or parts thereof (eg, fully human PAH coding sequences, or nucleotides 4 to 1359 of human PAH coding sequences), 5'untranslated regions (eg, human PAH coding sequences), 5'untranslated regions ( It contains, or consists of, a sequence encoding a UTR), 3'UTR, promoter, splice donor, splice acceptor, untranslated RNA, an insulator, a gene, or a combination thereof.

In certain embodiments, the editing element is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94 with the sequence set forth in SEQ ID NO: 35, 83, or 84. %, 95%, 96%, 97%, 98%, 99%, or 99.5% contain identical nucleotide sequences. In certain embodiments, the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 35, 83, or 84. In certain embodiments, the editing element consists of the nucleotide sequence set forth in SEQ ID NO: 35, 83 or 84. In certain embodiments, the editing element is at least 70%, 75%, 80%, 85%, 90%, 91% with the sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153. , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% Containing the same nucleotide sequence. In certain embodiments, the editing element comprises the nucleotide sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153. In certain embodiments, the editing element consists of the nucleotide sequence set forth in SEQ ID NO: 147, 148, 149, 150, 151, 152, or 153.

The homologous arm used for the modified genome disclosed herein can be directed to any region of the PAH gene or adjacent gene on the genome. The exact identity and positioning of the homologous arm is determined by the identity of the editing element and / or the target locus.

The homologous arm utilized in the modified genome disclosed herein is substantially identical to the genome flanking the target locus (eg, the target locus within the PAH gene). In certain embodiments, the 5'homologous arm is at least about 90% (eg, at least about 91%, 92%, 93%, 94%, etc.) of the first genomic region on the 5'side of the target locus. 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity. In certain embodiments, the 5'homologous arm has 100% nucleotide sequence identity to the first genomic region. In certain embodiments, the 3'homologous arm is at least about 90% (eg, at least about 91%, 92%, 93%, 94%, etc.) of the second genomic region on the 3'side of the target locus. 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity. In certain embodiments, the 3'homologous arm has 100% nucleotide sequence identity to the second genomic region. In certain embodiments, the 5'and 3'homologous arms are at least about 90% (eg,) of the first and second genomic regions adjacent to the target locus (eg, the target locus within the PAH gene), respectively. For example, at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) are identical. In certain embodiments, the 5'and 3'homologous arms are 100% identical to the first and second genomic regions, respectively, adjacent to the target locus (eg, the target locus within the PAH gene), respectively. .. In certain embodiments, the difference between the nucleotides of the 5'homologous arm and / or the 3'homologous arm and the nucleotides of the corresponding region in the genome adjacent to the target locus is the difference in the untranslated region of the nucleotide sequence. Including, essentially from such differences, or consisting of such differences.

It will be appreciated by those skilled in the art that a homologous arm can mediate the integration of an editing element into that target locus by homologous recombination, even if it is not 100% identical to the genomic sequence flanking the target locus. Will. For example, the homologous arm is one or more genetic variations within the human population and / or one or more modifications designed to improve expression levels or specificities (eg, nucleotide substitutions, insertions or Deletion) can be included. Human genetic mutations include both hereditary mutations and de novo mutations that are unique to the target genome, including simple nucleotide polymorphisms, insertions, deletions, rearrangements, inversions, duplications, and microrepetitions (micro). -repeat) and combinations thereof. Such variants are known in the art, eg, dnSNP (Sherry et al., Nucleic Acids Res. 2001; 29 (1): 308-11, each incorporated herein by reference. (See), Database of Genomic Variants (Nucleic Acids Res. 2014; 42 (Database Special Issue): D986-92), ClinVar (Nucleic Acids Res. 2014; 42 (Database Special Issue): D980-D985 (See), Genbank (Nucleic Acids Res. 2016; 44 (Database Special Issue): See D67-D72), ENCODE (genome.ucsc.edu/encode/terms.html), JASPAR (Nucleic Acids Res) 2018; 46 (D1): see D260-D266), and PROMO (Messeguer et al., Bioinformatics 2002; 18 (2): 333-334; Farre et al., Nucleic Acids Res. 2003; 31 (13): You can find it in the database (see pages 3651 to 3653). In situations where the homologous arm is not 100% identical to the genomic sequence flanking the target locus, homologous recombination between the homologous arm and the genome will bring the genomic sequence flanking the target locus to the homologous arm used. It will be further understood by those skilled in the art that the sequence and the sequence of its genome can be altered to be identical.

In certain embodiments, the first genomic region on the 5'side of the target locus is located within the first edit window, which consists of the nucleotide sequence set forth in SEQ ID NO: 36. .. In certain embodiments, the second genomic region on the 3'side of the target locus is located within a second edit window, which consists of the nucleotide sequence set forth in SEQ ID NO: 45. .. In certain embodiments, the first genomic region on the 5'side of the target locus is located within the first edit window, which consists of the nucleotide sequence set forth in SEQ ID NO: 36. , The second genomic region on the 3'side of the target locus is located within the second edit window, which consists of the nucleotide sequence set forth in SEQ ID NO: 45.

In certain embodiments, the first edit window and the second edit window are different. In certain embodiments, the first edit window is located on the 5'side of the second edit window. In certain embodiments, the first genomic region consists of a sequence shorter than the sequence in the first edit window in which the first genomic region is located. In certain embodiments, the first genomic region consists of a sequence in a first edit window in which the first genomic region is located. In certain embodiments, the second genomic region consists of a sequence shorter than the sequence in the second edit window in which the second genomic region is located. In certain embodiments, the second genomic region consists of a sequence in a second edit window in which the second genomic region is located. In certain embodiments, the first genomic region on the 5'side of the target locus has the sequence set forth in SEQ ID NO: 36. In certain embodiments, the second genomic region on the 3'side of the target locus has the sequence set forth in SEQ ID NO: 45. In certain embodiments, the first genomic region on the 5'side of the target locus and the second genomic region on the 3'side of the target locus are the sequences set forth in SEQ ID NO: 36 and SEQ ID NO: 45, respectively. Has the sequence described in.

In certain embodiments, the first edit window and the second edit window are the same. In certain embodiments, the target locus is an internucleotide linkage or nucleotide sequence within the edit window, and the first genomic region consists of the first part of the edit window on the 5'side of the target locus. The second genomic region consists of the second part of the edit window on the 3'side of the target locus. In certain embodiments, the first portion of the edit window consists of a sequence from the 5'end of the edit window to the nucleotide adjacent to the 5'side of the target locus. In certain embodiments, the second portion of the edit window consists of a sequence from the nucleotide adjacent to the 3'side of the target locus to the 3'end of the edit window. In certain embodiments, the first part of the edit window consists of the sequence from the 5'end of the edit window to the nucleotide adjacent to the 5'side of the target locus, and the second part of the edit window is the target. It consists of a sequence from the nucleotide adjacent to the 3'side of the locus to the 3'end of the edit window. In certain embodiments, the edit window consists of the nucleotide sequence set forth in SEQ ID NO: 36 or 45. In certain embodiments, the first and second parts of the edit window have substantially equal lengths (eg, the ratio of the length of the shorter part to the length of the longer part is: Greater than 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, 0.96, 0.97, 0.98, or 0.99).

In certain embodiments, the 5'homologous arm has a length of about 50 to about 4000 nucleotides (eg, about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 5'homologous arm has a length of approximately 800 nucleotides. In certain embodiments, the 5'homologous arm has a length of approximately 100 nucleotides. In certain embodiments, the 3'homologous arm has a length of about 50 to about 4000 nucleotides (eg, about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). In certain embodiments, the 3'homologous arm has a length of approximately 800 nucleotides. In certain embodiments, the 3'homologous arm has a length of approximately 100 nucleotides. In certain embodiments, each of the 5'and 3'homologous arms independently has about 50 to about 4000 nucleotides (eg, about 100 to about 3000, about 200 to about 2000, about 500 to about 1000 nucleotides). Has a length. In certain embodiments, the 5'and 3'homologous arms have a length of approximately 800 nucleotides.

In certain embodiments, the 5'and 3'homologous arms have substantially equal nucleotide lengths. In certain embodiments, the 5'and 3'homologous arms have an asymmetric nucleotide length. In certain embodiments, the nucleotide length asymmetry is a length difference of up to 90% between the 5'homologous arm and the 3'homologous arm, eg, up to 80%, 70%, 60%, 50%, 40. Defined by a%, 30%, 20%, or 10% length difference.

In certain embodiments, the 5'homologous arm is assigned to C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, and nucleotide 7 of the PAH gene. Corresponding G, G corresponding to nucleotide 9 of PAH gene, A corresponding to nucleotide -467 of PAH gene, A corresponding to nucleotide -465 of PAH gene, A corresponding to nucleotide -181 of PAH gene, PAH gene G corresponding to nucleotide-214, C corresponding to nucleotide -212 of PAH gene, A corresponding to nucleotide-211 of PAH gene, G corresponding to nucleotide 194 of PAH gene, C corresponding to nucleotide -433 of PAH gene , C corresponding to nucleotide -432 of PAH gene, ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of PAH gene, A corresponding to nucleotide -341 of PAH gene, nucleotide -339 of PAH gene A, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and / or A corresponding to nucleotide -203 of the PAH gene.

In certain embodiments, the 5'homologous arm
(a) C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and nucleotide 9 of the PAH gene. Corresponding to G;
(b) A corresponding to nucleotide-467 of the PAH gene and A corresponding to nucleotide -465 of the PAH gene;
(c) A corresponding to nucleotide -181 of the PAH gene;
(d) G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene;
(e) G corresponding to nucleotide 194 of the PAH gene;
(f) C corresponding to nucleotide -433 of the PAH gene and C corresponding to nucleotide -432 of the PAH gene;
(g) ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and / or
(h) A corresponding to nucleotide-341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide-211 of the PAH gene, and PAH gene. A corresponding to nucleotide-203 of
including.

In certain embodiments, the 5'homologous arm
(a) C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and nucleotide 9 of the PAH gene. Corresponding to G;
(b) A corresponding to nucleotide-467 of the PAH gene and A corresponding to nucleotide -465 of the PAH gene;
(c) A corresponding to nucleotide -181 of the PAH gene;
(d) A corresponding to nucleotide -181 of the PAH gene, G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene;
(e) G corresponding to nucleotide 194 of the PAH gene;
(f) C corresponding to nucleotide -433 of the PAH gene and C corresponding to nucleotide -432 of the PAH gene;
(g) C corresponding to nucleotide-433 of the PAH gene, C corresponding to nucleotide -432 of the PAH gene, and ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and / or
(h) A corresponding to nucleotide-467 of PAH gene, A corresponding to nucleotide -465 of PAH gene, A corresponding to nucleotide -341 of PAH gene, A corresponding to nucleotide -339 of PAH gene, PAH gene A corresponding to nucleotide-225, A corresponding to nucleotide-211 of the PAH gene, and A corresponding to nucleotide -203 of the PAH gene
including.

In certain embodiments, the 5'homologous arm is at least about 90% (eg, at least about 91%, 92%, 93%, 94%, 95%, 96%) of the nucleotide sequence set forth in SEQ ID NO: 36. , 97%, 98%, 99%, or 99.5%) nucleotide sequence identity, thus including one or more of the nucleotides at the above positions as needed. In certain embodiments, the 5'homologous arm further comprises one or more genetic variations within the human population. In certain embodiments, the 5'homologous arm comprises the nucleotide sequence set forth in SEQ ID NO: 36, 37, 38, 39, 40, 41, 42, 43, or 44. In certain embodiments, the 5'homologous arm comprises the nucleotide sequence set forth in SEQ ID NO: 36, 37, 38, 39, 40, 41, 42, 43, or 44.

In certain embodiments, the 3'homologous arm is at least about 90% (eg, at least about 91%, 92%, 93%, 94%, 95%, 96%) of the nucleotide sequence set forth in SEQ ID NO: 45. , 97%, 98%, 99%, or 99.5%) have nucleotide sequence identity. In certain embodiments, the 3'homologous arm further comprises one or more genetic variations within the human population. In certain embodiments, the 3'homologous arm comprises the nucleotide sequence set forth in SEQ ID NO: 45. In certain embodiments, the 3'homologous arm consists of the nucleotide sequence set forth in SEQ ID NO: 45.

In certain embodiments, the 5'homologous arm and the 3'homologous arm are at least about 90% (eg, at least about 91%, 92%, 93), respectively, of the nucleotide sequences set forth in SEQ ID NOs: 36 and 45, respectively. %, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) nucleotide sequence identity, and if necessary, the 5'homologous arm may be a nucleotide at the position above. Includes one or more of. In certain embodiments, the 5'homologous arm and the 3'homologous arm are SEQ ID NOs: 36 and 45, 37 and 45, 38 and 45, 39 and 45, 40 and 45, 41 and 45, 42 and 45, 43 and 45, or contains the nucleotide sequences described in 44 and 45, respectively. In certain embodiments, the 5'homologous arm and the 3'homologous arm are SEQ ID NOs: 36 and 45, 37 and 45, 38 and 45, 39 and 45, 40 and 45, 41 and 45, 42 and 45, 43 and It consists of 45, or the nucleotide sequences described in 44 and 45, respectively.

In certain embodiments, the 5'homologous arm comprises the nucleotide sequence set forth in SEQ ID NO: 69 or 72. In certain embodiments, the 5'homologous arm consists of the nucleotide sequence set forth in SEQ ID NO: 69 or 72. In certain embodiments, the 3'homologous arm comprises the nucleotide sequence set forth in SEQ ID NO: 70 or 73. In certain embodiments, the 3'homologous arm consists of the nucleotide sequence set forth in SEQ ID NO: 70 or 73. In certain embodiments, the 5'homologous arm and the 3'homologous arm comprise the nucleotide sequences set forth in SEQ ID NOs: 69 and 70, or 72 and 73, respectively. In certain embodiments, the 5'homologous arm and the 3'homologous arm consist of the nucleotide sequences set forth in SEQ ID NOs: 69 and 70, or 72 and 73, respectively.

In certain embodiments, the 5'homologous arm comprises the nucleotide sequence set forth in SEQ ID NO: 111, 115 or 142. In certain embodiments, the 5'homologous arm consists of the nucleotide sequence set forth in SEQ ID NO: 111, 115 or 142. In certain embodiments, the 3'homologous arm comprises the nucleotide sequence set forth in SEQ ID NO: 112, 117 or 144. In certain embodiments, the 3'homologous arm consists of the nucleotide sequence set forth in SEQ ID NO: 112, 117 or 144. In certain embodiments, the 5'homologous arm and the 3'homologous arm comprise the nucleotide sequences set forth in SEQ ID NOs: 111 and 112, 115 and 117, or 142 and 144, respectively. In certain embodiments, the 5'homologous arm and the 3'homologous arm consist of the nucleotide sequences set forth in SEQ ID NOs: 111 and 112, 115 and 117, or 142 and 144, respectively.

In certain embodiments, the modified genome is at least 90% with SEQ ID NOs: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145 ( For example, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) contain the same nucleotide sequence. In certain embodiments, the modified genome is the nucleotide sequence set forth in SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145. including. In certain embodiments, the modified genome is the nucleotide sequence set forth in SEQ ID NO: 46, 47, 48, 49, 50, 51, 52, 53, 54, 85, 86, 113, 118, 134, 136, or 145. Consists of.

In certain embodiments, the modified genome disclosed herein has a 5'reverse end repeat (5'ITR) nucleotide sequence on the 5'side of the 5'homologous arm nucleotide sequence, and a 3'homologous arm nucleotide. The 3'side of the sequence further comprises a 3'reverse end repeat (3'ITR) nucleotide sequence. ITR sequences from any AAV serotype or variant thereof can be used for the modified genome disclosed herein. The 5'and 3'ITRs may be from the same serotype of AAV, or may be from different serotypes of AAV. Exemplary ITRs for use in the modified genome disclosed herein are those set forth in SEQ ID NOs: 18-21 herein. In certain embodiments, the 5'ITR nucleotide sequence and the 3'ITR nucleotide sequence are substantially complementary to each other (eg, at 1, 2, 3, 4 or 5 locations within the 5'or 3'ITR. They are complementary to each other, except for mismatches in nucleotide positions).

In certain embodiments, the 5'ITR or 3'ITR is from AAV2. In certain embodiments, both 5'ITR and 3'ITR are from AAV2. In certain embodiments, the 5'ITR nucleotide sequence has at least 95% (eg, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO: 18. Or the 3'ITR nucleotide sequence has at least 95% (eg, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO: 19. .. In certain embodiments, the 5'ITR nucleotide sequence has at least 95% (eg, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO: 18. And the 3'ITR nucleotide sequence has at least 95% (eg, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO: 19. .. In certain embodiments, the modified genome comprises an editing element having the nucleotide sequence set forth in SEQ ID NO: 35, a 5'ITR nucleotide sequence having the sequence of SEQ ID NO: 18, and a 3'ITR nucleotide having the sequence of SEQ ID NO: 19. Includes arrays. In certain embodiments, the modified genome has the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, the 5'ITR nucleotide sequence having the sequence of SEQ ID NO: 18, and the sequence of SEQ ID NO: 193. 'Includes the ITR nucleotide sequence. In certain embodiments, the modified genome comprises the 5'ITR nucleotide sequence having the sequence of SEQ ID NO: 18 and the nucleotide sequence of any one of SEQ ID NOs: 46-54 from 5'to 3'. , Consists of a 3'ITR nucleotide sequence having the sequence of SEQ ID NO: 19.

In certain embodiments, the 5'ITR or 3'ITR is from AAV5. In certain embodiments, both the 5'ITR and the 3'ITR are from AAV5. In certain embodiments, the 5'ITR nucleotide sequence has at least 95% (eg, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO: 20. Or the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 21. In certain embodiments, the 5'ITR nucleotide sequence has at least 95% (eg, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO: 20. And the 3'ITR nucleotide sequence has at least 95% (eg, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to SEQ ID NO: 21. .. In certain embodiments, the modified genome comprises an editing element having the nucleotide sequence set forth in SEQ ID NO: 35, a 5'ITR nucleotide sequence having the sequence of SEQ ID NO: 20, and a 3'ITR nucleotide having the sequence of SEQ ID NO: 21. Includes arrays. In certain embodiments, the modified genome has the nucleotide sequence set forth in any one of SEQ ID NOs: 46-54, the 5'ITR nucleotide sequence having the sequence of SEQ ID NO: 20, and the sequence of SEQ ID NO: 21 3 'Includes the ITR nucleotide sequence. In certain embodiments, the modified genome comprises the 5'ITR nucleotide sequence having the sequence of SEQ ID NO: 20 and the nucleotide sequence of any one of SEQ ID NOs: 46-54 from 5'to 3'. , Consists of a 3'ITR nucleotide sequence having the sequence of SEQ ID NO: 21.

In certain embodiments, the 5'ITR nucleotide sequence and the 3'ITR nucleotide sequence are substantially complementary to each other (eg, at 1, 2, 3, 4 or 5 locations within the 5'or 3'ITR. They are complementary to each other, except for mismatches in nucleotide positions).

In certain embodiments, the 5'ITR or 3'ITR is modified to reduce or eliminate degradation by the Rep protein (“non-resolvable ITR”). In certain embodiments, the non-degradable ITR comprises an insertion, deletion or substitution in the nucleotide sequence of the terminal degradation site. Such modifications allow the formation of a self-complementary double-stranded DNA genome of AAV after the transferred genome has been replicated in infected cells. Illustrative non-degradable ITR sequences are known in the art (eg, those provided in US Pat. Nos. 7,790,154 and 9,783,824, which are incorporated herein by reference in their entirety. See). In certain embodiments, the 5'ITR comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26. In certain embodiments, the 5'ITR consists of a nucleotide sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26. In certain embodiments, the 5'ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26. In certain embodiments, the 3'ITR comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 27. In certain embodiments, the 5'ITR consists of a nucleotide sequence that is at least 95%, 96%, 97%, 98%, 3 or 99% identical to SEQ ID NO: 27. In certain embodiments, the 3'ITR consists of the nucleotide sequence set forth in SEQ ID NO: 27. In certain embodiments, the 5'ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26 and the 3'ITR consists of the nucleotide sequence set forth in SEQ ID NO: 27. In certain embodiments, the 5'ITR consists of the nucleotide sequence set forth in SEQ ID NO: 26 and the 3'ITR consists of the nucleotide sequence set forth in SEQ ID NO: 19.

In certain embodiments, the 3'ITR is flanked by additional nucleotide sequences derived from the wild-type AAV2 genomic sequence. In certain embodiments, the 3'ITR is flanked by an additional 37 bp sequence derived from the wild-type AAV2 genomic sequence flanking the wild-type AAV2 ITR. See, for example, Savy et al., Human Gene Therapy Methods (2017) 28 (5): 277-289 (this reference is thereby incorporated herein by reference in its entirety). In certain embodiments, an additional 37 bp sequence is inside the 3'ITR. In certain embodiments, the 37 bp sequence consists of the sequence set forth in SEQ ID NO: 140. In certain embodiments, the 3'ITR comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 141. In certain embodiments, the 3'ITR comprises the nucleotide sequence set forth in SEQ ID NO: 141. In certain embodiments, the nucleotide sequence of 3'ITR consists of a nucleotide sequence that is at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 141. In certain embodiments, the nucleotide sequence of 3'ITR consists of the nucleotide sequence set forth in SEQ ID NO: 141.

In certain embodiments, the modified genome disclosed herein is about 0.5 to about 8 kb (eg, about 1 to about 5, about 2 to about 5, about 3 to about 5, about 4 to about 5, It has a length of about 4.5 to about 4.8, or about 4.7 kb).

In certain embodiments, the modified genome is at least 90% with SEQ ID NOs: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146 ( For example, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5%) contain the same nucleotide sequence. In certain embodiments, the modified genome is the nucleotide sequence set forth in SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146. including. In certain embodiments, the modified genome is the nucleotide sequence set forth in SEQ ID NO: 55, 56, 57, 58, 59, 60, 61, 62, 63, 87, 88, 114, 119, 135, 137, or 146. Consists of.

In certain embodiments, the replication-deficient AAV is (a) an AAV capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 16 and the next genetic element from 5'to 3': 5'ITR element. (For example, 5'ITR of SEQ ID NO: 18), 5'homologous arm (eg, 5'homologous arm of SEQ ID NO: 115), splice acceptor (eg, splice acceptor of SEQ ID NO: 14), 2A element (eg, sequence Number 74 2A element), human PAH coding sequence with silent variation (eg PAH coding sequence of SEQ ID NO: 116), SV40 polyadenylation sequence (eg SV40 polyadenylation sequence of SEQ ID NO: 31), 3'homologous arm (eg) , 3'homologous arm of SEQ ID NO: 117), and an imported genome containing a 3'ITR element (eg, 3'ITR of SEQ ID NO: 19); (b) Amino acid sequence of amino acids 138-736 of SEQ ID NO: 16. With the AAV capsid protein containing, the next genetic element from 5'to 3': 5'ITR element (eg, 5'ITR of SEQ ID NO: 18), 5'homologous arm (eg, 5'homologous of SEQ ID NO: 115). Arm), splice acceptor (eg, splice acceptor of SEQ ID NO: 14), 2A element (eg, 2A element of SEQ ID NO: 74), human PAH coding sequence with silent variation (eg, PAH coding sequence of SEQ ID NO: 116). , SV40 polyadenylated sequence (eg, SV40 polyadenylated sequence of SEQ ID NO: 31), 3'homologous arm (eg, 3'homologous arm of SEQ ID NO: 117), and 3'ITR element (eg, 3'ITR of SEQ ID NO: 19). ), And / or (c) an AAV capsid protein containing the amino acid sequence of SEQ ID NO: 16 and the next genetic element from 5'to 3': 5'ITR element (eg, sequence). Number 18 5'ITR), 5'homologous arm (eg, SEQ ID NO: 115 5'homologous arm), splice acceptor (eg, SEQ ID NO: 14 splice acceptor), 2A element (eg, SEQ ID NO: 74 2A) Element), human PAH coding sequence with silent variation (eg, PAH coding sequence of SEQ ID NO: 116), SV40 polyadenylation sequence (eg, SV40 polyadenylation sequence of SEQ ID NO: 31), 3'homologous arm (eg, SEQ ID NO: 117). 3'homologous arm), and an imported genome containing a 3'ITR element (eg, 3'ITR of SEQ ID NO: 19).

In certain embodiments, replication-deficient AAV comprises (a) an AAV capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 16 and SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119. , 134-137, 145, and a modified genome comprising the nucleotide sequence of any one of 146; (b) an AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16. Includes a modified genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146; and / or ( c) AAV capsid protein comprising the amino acid sequence of SEQ ID NO: 16 and one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146. Includes a modified genome containing the nucleotide sequence of.

The AAV compositions disclosed herein are particularly advantageous in that they can modify intracellular PAH genes with high efficiency both in vivo and in vitro. In certain embodiments, the efficiency of integration of editing elements into target loci when AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of exogenous nucleases. Is at least 1% (eg at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35% , 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%). In certain embodiments, when AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of an exogenous nuclease, integration of the editing element into the target locus is incorporated. Allele efficiency is at least 0.5% (eg at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%).

Any method of determining the editing efficiency of PAH genes can be used. In certain embodiments, individual cells are isolated from a population of transduced cells and single-cell PCR using PCR primers that can identify the presence of editing elements correctly integrated into the locus of the PAH gene. Attached to. Such methods can further include single-cell PCR of the same cells using PCR primers that selectively amplify unmodified target loci. In this way, the genotype of cells can be determined. For example, if single-cell PCR shows that a cell has both an edited target locus and an unmodified target locus, then the edited PAH gene for this cell is considered heterozygous. Will be.

In addition or alternatively, in certain embodiments, linear amplification-mediated PCR (LAM-PCR), quantitative PCR (qPCR) or digital solution is used with primers and probes that detect only edited PAH alleles. Drop PCR (ddPCR) can be performed on DNA extracted from a population of transduced cells. Such methods further include (either in the same reaction or another reaction) additional qPCR or ddPCR to determine the number of whole genomes and the number of unedited PAH alleles in the sample. These numbers can be used to determine the allelic frequency of integration of the editing element into the target locus.

In addition or alternatively, in certain embodiments, PCR using primers that bind the PAH locus from DNA extracted from a population of transduced cells to a region of the PAH gene flanking the target locus. It can be amplified either by LAM-PCR or by LAM-PCR using a primer that binds to a region within the modified genome (eg, a region containing an exogenous sequence that does not originally exist at the locus). The resulting PCR amplicon was individually sequenced using single molecule next-generation sequencing (NGS) techniques to produce edited and unedited PAH alleles present in a population of transduced cells. The relative number of alleles can be determined. These numbers can be used to determine the allelic frequency of integration of the editing element into the target locus.

In another aspect, the disclosure provides a pharmaceutical composition comprising the AAV disclosed herein with a pharmaceutically acceptable excipient, adjuvant, diluent, solvent or carrier, or a combination thereof. A "pharmaceutically acceptable carrier", when combined with the active ingredient of the composition, allows the ingredient to retain biological activity and does not cause problematic physiological reactions such as unintended immune reactions. , Including any material. Pharmaceutically acceptable carriers include water, phosphate buffered saline, emulsions such as oil / water emulsions, and wetting agents. Compositions containing such carriers are described in Remington's Pharmaceutical Sciences, Current Edition, Mack Publishing, Easton Pa. 18042, USA; A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th Edition, Lippincott. , Williams, &Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) HC Ansel et al., 7th Edition, Lippincott, Williams, &Wilkins; and Handbook of Pharmaceutical Excipients (2000) AH Kibbe et al., 3rd Edition, Amer Formulated by well-known conventional methods, such as those described in Pharmaceutical Assoc.

III. Usage In another aspect, the disclosure provides methods for correcting mutations in the PAH gene and for expressing PAH polypeptides in cells. These methods generally include transducing cells with replication-deficient AAV disclosed herein. Such methods are highly efficient in correcting mutations in the PAH gene or restoring PAH expression, and exogenous nucleases (eg, meganucleases, zinc finger nucleases, transcriptional activators) to facilitate such corrections. It does not require genome cleavage at the target locus by the action of like nucleases (TALENs) or RNA-induced nucleases, such as Cas9). Thus, in certain embodiments, the methods disclosed herein replicate the disclosures herein without co-transduction or co-administration of an exogenous nuclease, or a nucleotide sequence encoding an exogenous nuclease. It involves the step of transducing cells with defective AAV.

The methods disclosed herein can be applied to any cell that has an endogenous mutation in the PAH gene. Those skilled in the art will appreciate that cells that actively express PAHs are of particular interest. Thus, in certain embodiments, the method applies to cells in the liver, kidney, brain, pituitary gland, adrenal gland, pancreas, bladder, gallbladder, colon, small intestine or breast. In certain embodiments, the method applies to hepatocytes and / or kidney cells.

The methods disclosed herein can be performed in vitro for study or ex vivo or in vivo for treatment.

In certain embodiments, the cells to be transduced are cells of a mammalian subject, and AAV is administered to the subject in an amount effective for transduction into the cells of the subject. Thus, in certain embodiments, the disclosure is a method of treating a subject suffering from a disease or disorder associated with a PAH gene mutation, the effective amount of replication-deficient AAV disclosed herein. Provided is the method, which generally comprises the step of administering to the subject. The subject may be a human subject or a rodent subject having human liver cells (eg, a mouse). Suitable mouse subjects include, but are not limited to, mice engrafted with human liver cells (eg, human hepatocytes). Any disease or disorder associated with a PAH gene mutation can be treated using the methods disclosed herein. Suitable diseases or disorders include, but are not limited to, phenylketonuria. In certain embodiments, cells are transduced without co-transduction or co-administration of an exogenous nuclease, or a nucleotide sequence encoding an exogenous nuclease.

The methods disclosed herein are particularly advantageous in that they can modify intracellular PAH genes with high efficiency both in vivo and in vitro. In certain embodiments, the efficiency of integration of editing elements into target loci when AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of exogenous nucleases. Is at least 1% (eg at least 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35% , 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%). In certain embodiments, when AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of an exogenous nuclease, integration of the editing element into the target locus is incorporated. Allele efficiency is at least 0.5% (eg at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%).

In certain embodiments, transduction of cells with the AAV compositions disclosed herein can be performed as provided herein, or any transduction method known to those of skill in the art. Can be done by In certain embodiments, cells and AAV are optimally transduced into cells with multiplicity of infection (MOI) of 50,000, 100,000, 150,000, 200,000, 250,000, 300,000, 350,000, 400,000, 450,000, or 500,000. It can be contacted with any MOI that it brings.

In certain embodiments, the method described above is: (a) an AAV capsid protein comprising the amino acid sequences of amino acids 203-736 of SEQ ID NO: 16 and the next genetic element from 5'to 3': 5'ITR element. (For example, 5'ITR of SEQ ID NO: 18), 5'homologous arm (eg, 5'homologous arm of SEQ ID NO: 115), splice acceptor (eg, splice acceptor of SEQ ID NO: 14), 2A element (eg, sequence 2A element of number 74), human PAH coding sequence with silent variation (eg, PAH coding sequence of SEQ ID NO: 116), SV40 polyadenylation sequence (eg, SV40 polyadenylation sequence of SEQ ID NO: 31), 3'homologous arm (eg) , 3'homologous arm of SEQ ID NO: 117), and an imported genome comprising a 3'ITR element (eg, 3'ITR of SEQ ID NO: 19), (b) amino acid sequence of amino acids 138-736 of SEQ ID NO: 16. With the AAV capsid protein containing, the next genetic element from 5'to 3': 5'ITR element (eg, 5'ITR of SEQ ID NO: 18), 5'homologous arm (eg, 5'homologous of SEQ ID NO: 115). Arm), splice acceptor (eg, splice acceptor of SEQ ID NO: 14), 2A element (eg, 2A element of SEQ ID NO: 74), human PAH coding sequence with silent variation (eg, PAH coding sequence of SEQ ID NO: 116). , SV40 polyadenylated sequence (eg, SV40 polyadenylated sequence of SEQ ID NO: 31), 3'homologous arm (eg, 3'homologous arm of SEQ ID NO: 117), and 3'ITR element (eg, 3'ITR of SEQ ID NO: 19). ), And / or (c) an AAV capsid protein containing the amino acid sequence of SEQ ID NO: 16 and the next genetic element from 5'to 3': 5'ITR element (eg, sequence). Number 18 5'ITR), 5'homologous arm (eg, SEQ ID NO: 115 5'homologous arm), splice acceptor (eg, SEQ ID NO: 14 splice acceptor), 2A element (eg, SEQ ID NO: 74 2A) Element), human PAH coding sequence with silent variation (eg, PAH coding sequence of SEQ ID NO: 116), SV40 polyadenylation sequence (eg, SV40 polyadenylation sequence of SEQ ID NO: 31), 3'homologous arm (eg, SEQ ID NO: 117). 3' A replication-deficient AAV containing a homologous arm) and an imported genome containing a 3'ITR element (eg, 3'ITR of SEQ ID NO: 19) is utilized.

In certain embodiments, the methods described above are: (a) an AAV capsid protein comprising the amino acid sequence of amino acids 203-736 of SEQ ID NO: 16 and SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119. , 134-137, 145, and 146, including a modified genome comprising the nucleotide sequence according to any one of (b) AAV capsid protein comprising the amino acid sequence of amino acids 138-736 of SEQ ID NO: 16. Containing and / or a modified genome comprising the nucleotide sequence set forth in any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146, and / or ( c) AAV capsid protein containing the amino acid sequence of the amino acid of SEQ ID NO: 16 and any one of SEQ ID NOs: 25, 46-63, 113, 114, 116, 118, 119, 134-137, 145, and 146. A replication-deficient AAV containing a modified genome containing the nucleotide sequence described in 1 is utilized.

The AAV compositions disclosed herein are administered to a subject by any suitable route, including but not limited to intravenous, intraperitoneal, subcutaneous, intramuscular, intranasal, topical or intradermal routes. Can be done. In certain embodiments, the composition is formulated for administration by intravenous or subcutaneous injection.

IV. AAV Packaging System In another aspect, the present disclosure provides a packaging system for the recombinant preparation of replication-deficient AAV. Such packaging systems include a Rep nucleotide sequence encoding one or more AAV Rep proteins and a Cap nucleotide sequence encoding one or more AAV clade F capsid proteins disclosed herein. Generally comprising a modified genome for modification of the PAH gene or an imported genome for expression of the PAH gene disclosed in the document, this packaging system encapsulates the modified genome in the capsid in a cell and the AAV. It is effective in forming.

In certain embodiments, the packaging system comprises a first vector containing a Rep nucleotide sequence and a Cap nucleotide sequence and a second vector containing a modified or transferred genome. As used in the context of the packaging systems described herein, a "vector" is a nucleic acid molecule that is a medium for introducing a nucleic acid into a cell (eg, a plasmid, virus, cosmid, artificial chromosome, etc.). Point to.

Any AAV Rep protein can be utilized in the packaging systems disclosed herein. In certain embodiments of the packaging system, the Rep nucleotide sequence encodes the AAV2 Rep protein. Suitable AAV2 Rep proteins include, but are not limited to, Rep 78/68 or Rep 68/52. In certain embodiments of the packaging system, the nucleotide sequence encoding the AAV2 Rep protein is the nucleotide sequence encoding the protein having the lowest percent sequence identity to the AAV2 Rep amino acid sequence of SEQ ID NO: 22. The minimum sequence identity percent is at least 70% (eg, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, over the length of the amino acid sequence of the AAV2 Rep protein. Contains a nucleotide sequence that is at least 99%, or 100%). In certain embodiments of the packaging system, the AAV2 Rep protein has the amino acid sequence set forth in SEQ ID NO: 22.

In certain embodiments of the packaging system, the packaging system further comprises a third vector, eg, a helper viral vector. The third vector may be an independent third vector, may be integrated with the first vector, or may be integrated with the second vector. In certain embodiments, the third vector comprises a gene encoding a helper virus protein.

In certain embodiments of the packaging system, helper viruses include adenovirus, herpesvirus (including herpes simplex virus (HSV)), poxvirus (eg, vaccinia virus), cytomegalovirus (CMV), and baculovirus. Selected from the group consisting of. In certain embodiments of the packaging system, where the herpesvirus is an adenovirus, the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4 and VA. In certain embodiments of the packaging system where the helper virus is HSV, the HSV genome is one of the HSV genes selected from the group consisting of UL5 / 8/52, ICPO, ICP4, ICP22 and UL30 / UL42. Includes one or more.

In certain embodiments of the packaging system, the first, second, and / or third vectors are contained in one or more transfection plasmids. In certain embodiments, the first vector and the third vector are contained in the first transfect plasmid. In certain embodiments, the second vector and the third vector are contained in a second transfect plasmid.

In certain embodiments of the packaging system, the first, second, and / or third vectors are contained in one or more recombinant helper viruses. In certain embodiments, the first vector and the third vector are contained in a recombinant helper virus. In certain embodiments, the second and third vectors are contained in the recombinant helper virus.

In a further aspect, the disclosure is a method for recombinant preparation of AAV as described herein, a condition effective for encapsulating a modified genome in a capsid to form the AAV described herein. Below, the method is provided, comprising transfecting or transducing cells with the packaging system described. Illustrative methods for recombinant preparation of AAV include transient transfection (eg, a first vector and a second vector described herein, and optionally a third vector. , With one or more transfection plasmids, viral infection (eg, containing one or two vectors described herein, a second vector and optionally a third vector, one or more. Multiple recombinant helper viruses, such as adenovirus, poxvirus (eg, vaccinia virus), herpesvirus (including HSV), cytomegalovirus, or baculovirus), and stable production cell line transfection or infection. (For example, a mammal or insect containing a Rep nucleotide sequence encoding one or more AAV Rep proteins described herein and / or a Cap nucleotide sequence encoding one or more AAV clade F plasmid proteins. Examples include (in stable producing cells, such as cells, and in the modified genomes described herein) delivered in the form of transfected plasmids or recombinant helper viruses.

V. Examples The recombinant AAV vectors disclosed herein mediate highly efficient gene editing in vitro and in vivo. The following examples may be packaged with AAV Clade F Capsid (eg, AAVHSC7, AAVHSC15 or AAVHSC17, as disclosed in US Pat. No. 9,623,120, which is incorporated herein by reference in its entirety). We provide a modified vector that can be used to demonstrate the efficient recovery of expression of the PAH gene that mutates during certain human diseases such as phenylketonuria. These examples are provided as examples, not as limitations.

(Example 1)
PAH correction vector pHMI-h PAH-hAC-008
a) PAH modification vector pHMI-h PAH-hAC-008
The PAH modified vector pHMI-h PAH-hAC-008 contains the following genetic elements from 5'to 3'as shown in Figure 1A: 5'ITR elements, 5'homologous arms, silent changes. Has human PAH coding sequences, SV40 polyadenylation sequences, target integration restriction cassettes (“TI RE”), 3'homologous arms, and 3'ITR elements. The array of these elements is shown in Table 1. The 5'homologous arm contains a wild-type genomic sequence 800 nucleotides upstream from the human PAH start codon and thus affects the start codon and / or 5'untranslated as observed in some PKU patients. Has the ability to correct region (UTR) mutations. The 3'homologous arm contains a wild-type genomic sequence 800 nucleotides downstream from the start codon. Integration of the PAH modification vector pHMI-hPAH-hAC-008 into the human genome inserts a human PAH coding sequence with silent changes, an SV40 polyadenylation sequence, and a target integration restriction cassette at the PAH initiation codon locus (ie, the PAH gene). (Replace nucleotides 1-3), thereby restoring expression of wild PAH proteins impaired by mutations in the 5'UTR, coding sequence or 3'UTR of the PAH gene.

b) PAH modification vector pHMI-h PAH-h1C-007
The PAH modified vector pHMI-h PAH-h1C-007 contains the following genetic elements from 5'to 3'as shown in Figure 1B: 5'ITR elements, 5'homologous arms, splice acceptors. , 2A elements, human PAH coding sequences with silent changes, SV40 polyadenylation sequences, target integration restriction cassettes (“TI RE”), 3'homologous arms, and 3'ITR elements. The array of these elements is shown in Table 2. The 5'homologous arm contains a wild-type genomic sequence located within intron 1 and upstream of nucleotides 2128 to 800 nucleotides of human PAH. The 3'homologous arm contains a wild-type genomic sequence downstream of nucleotides 2127 to 800 nucleotides of human PAH. Integration of the PAH modification vector pHMI-hPAH-h1C-007 into the human genome allows transcription of the PAH locus into pre-mRNA, which pre-mRNA contains the following elements from 5'to 3': exogenous. Exons 1 of sex PAH, its 5'splice donor to nucleotide 2127 portion of intron 1, splice acceptor in vector pHMI-hPAH-h1C-007, 2A element, PAH coding sequence with silent changes, and SV40 polyadenylation. Array. This pre-mRNA splicing produces mRNAs containing the following elements from 5'to 3': exogenous PAH exons 1, 2A elements (PAH exons 1 and inframe), human PAH codes with silent changes. Sequences (2A elements and inframes), and SV40 polyadenylated sequences. The 2A element results in the production of two polypeptides, the truncated PAH peptide ending at the exon 1 terminus, fused to the N-terminus of the 2A peptide, and the proline from the 2A peptide fused to the full-length PAH polypeptide. .. Therefore, integration of the vector pHMI-hPAH-h1C-007 can restore expression of wild-type PAH proteins impaired by mutations in the coding sequence of the PAH gene or 3'UTRs.

The silent changes adopted in the above two vectors significantly improved the expression of PAH proteins, as demonstrated by the comparison of the expression vectors pCOH-WT-PAH, pCOH-CO-PAH and pHMI-CO-PAH. The pCOH-WT-PAH vector contains a CBA promoter operably linked to the wild-type PAH coding sequence set forth in SEQ ID NO: 24. The pCOH-CO-PAH and pHMI-CO-PAH vectors each contain a CBA promoter operably linked to the human PAH coding sequence with the silent change set forth in SEQ ID NO: 25. The pCOH-CO-PAH and pHMI-CO-PAH vectors were very similar. Each vector was transfected into HEK 293 cells that are naturally deficient in PAH. As shown in Figure 2, VG-GT-CO-PAH (“CO-hPAH”) produced significantly higher levels of human PAH expression than VG-GT-PAH (“WT-hPAH”). ..

(Example 2)
PAH modified vector pHMIA-hPAH-hI1C-032.1 and its variants To identify homologous arm sequences that facilitate efficient gene editing, we designed 130 modified vectors, 70 of which were human hepatocellular carcinoma cells. Tested in. The pHMIA-hPAH-hI1C-032.1 vector showed the highest editing efficiency in vitro. This example provides the structure of this vector and its variants.

a) PAH modification vector pHMIA-hPAH-hI1C-032.1
The PAH modified modification vector pHMIA-hPAH-hI1C-032.1 contains the following genetic elements from 5'to 3'as shown in Figure 1C: 5'ITR element, 5'homologous arm, splice ac. Scepters, P2A elements, human PAH coding sequences with silent changes, SV40 polyadenylation sequences, 3'homologous arms, and 3'ITR elements. The array of these elements is shown in Table 3. The 5'homologous arm contains the wild-type genomic sequence of nucleotides -686-274 of human PAH, the 3'end of which is located within intron 1. The 3'homologous arm contains the wild-type genomic sequence of nucleotides 415-1325 of human PAH. Integration of the PAH modification vector pHMIA-hPAH-hI1C-032.1 into the human genome allows transcription of the PAH locus into pre-mRNA, which pre-mRNA contains the following elements from 5'to 3': exogenous. Exons 1 of sex PAH, its 5'splice donor to nucleotide 274 portion of intron 1, splice acceptor in vector pHMIA-hPAH-hI1C-032.1, P2A element, PAH coding sequence with silent changes, and SV40 polyadenylation. Array. This pre-mRNA splicing produces mRNAs containing the following elements from 5'to 3': exogenous PAH exons 1, P2A elements (PAH exons 1 and inframes), human PAH codes with silent changes. Sequences (P2A elements and inframes), and SV40 polyadenylated sequences. The P2A element results in the production of two polypeptides: a truncated PAH peptide ending at the exon 1 terminus, fused to the N-terminus of the P2A peptide, and proline from the P2A peptide fused to a full-length PAH polypeptide. .. Therefore, integration of the vector pHMIA-hPAH-hI1C-032.1 can restore expression of wild-type PAH proteins impaired by mutations in the coding sequence of the PAH gene or in the 3'UTR.

b) Variant of PAH modification vector pHMIA-hPAH-hI1C-032.1
Eight variants of the pHMIA-hPAH-hI1C-032.1 vector were designed to enhance expression at the PAH locus. These variants, named pHMIA-hPAH-hI1C-032.2 to pHMIA-hPAH-hI1C-032.9, differ from pHMIA-hPAH-hI1C-032.1 only in the 5'homologous arm. An array of these different elements is shown in Table 4.

The pHMIA-hPAH-hI1C-032.2 vector was designed to optimize the Kozak sequence for enhanced ribosome recruitment to transcripts. This vector differs from pHMIA-hPAH-hI1C-032.1 in that it has nucleotides C, G, G, G and G at positions -2, 4, 6, 7 and 9 of the PAH gene, respectively.

The pHMIA-hPAH-hI1C-032.3 vector was designed to remove a singlet in the 5'UTR of the PAH gene, which may suppress expression. This vector differs from pHMIA-hPAH-hI1C-032.1 in that it has nucleotides A and A at positions -467 and -465 of the PAH gene, respectively.

The pHMIA-hPAH-hI1C-032.4 vector was designed to optimize cyclic AMP response elements for increased expression. This vector differs from pHMIA-hPAH-hI1C-032.1 in that it has nucleotide A at position -181 of the PAH gene.

The pHMIA-hPAH-hI1C-032.5 vector was designed to optimize two cyclic AMP response elements for increased expression. This vector differs from pHMIA-hPAH-hI1C-032.1 in that it has nucleotides G, C, A and A at positions -214, -212, -211 and -181 of the PAH gene, respectively.

The pHMIA-hPAH-hI1C-032.6 vector was designed to incorporate a minor allele of SNP rs1522295 that correlates with changes in PAH expression in humans. This vector differs from pHMIA-hPAH-hI1C-032.1 in that it has nucleotide G at position 194 of the PAH gene.

The pHMIA-hPAH-hI1C-032.7 vector was designed to optimize the glucocorticoid binding site in the 5'UTR for increased expression. This vector differs from pHMIA-hPAH-hI1C-032.1 in that it has nucleotides C and C at positions -433 and -432 of the PAH gene, respectively.

The pHMIA-hPAH-hI1C-032.8 vector was designed to modify two glucocorticoid binding sites and a single AP2 binding site for enhanced expression. This vector is pHMIA-hPAH in that it has nucleotides C and C at positions -433 and -432 of the PAH gene, respectively, and the nucleotide sequence ACGCTGTTCTTCGCC (SEQ ID NO: 68) at positions -394 to -388 of the PAH gene. -HI1C Different from C-032.1.

The pHMIA-hPAH-hI1C-032.9 vector was designed to disrupt the G-quadret at 5'UTR, which may suppress expression. This vector differs from pHMIA-hPAH-hI1C-032.1 in that it has nucleotide A at each of the nucleotide positions -467, -465, -341, -339, -225, -211 and -203 of the PAH gene.

(Example 3)
In vitro Human PAH Gene Editing This example provides an in vitro method for investigating PAH modified vectors such as those described in the previous examples.

The PAH modification vector pHMI-hPAH-hA-002, which is a variant of pHMI-hPAH-hAC-008 with wild PAH coding sequences (ie, no silent changes), and the wild PAH coding sequences. A variant of pHMI-hPAH-h1C-007 (ie, with no silent changes), the PAH modified vector pHMI-hPAH-h1-001, was investigated for evaluation of target integration. K562 cells were transduced using the pHMI-hPAH-hA-002 vector packaged in AAVHSC17 with a MOI of 150,000. The genomic DNA of the cells was collected after 48 hours. DNA samples were amplified by linear amplification using separately single biotinylated primers with the sequences ccaaatcccaccagctcact (SEQ ID NO: 89) and tcccatgaaactgaggtgtga (SEQ ID NO: 90) located on the outside of the homologous arm. Both edited and unedited alleles were amplified evenly. Amplified DNA samples were pooled and concentrated by streptavidin pull-down. The number of alleles incorporating pHMI-hPAH-hA-002 was measured by ddPCR using the PAH_Genomic Set 1 primer / probe set.

Desired integration is detected in samples from cells transduced with the pHMI-hPAH-hA-002 vector (“R1 ATG”), as shown in Figure 3A, left panel (“LAM-enriched”). However, neither sample from cells transduced with the pHMI-hPAH-h1-001 vector (“R1 Intron”) nor sample from non-transduced cells (“R1 WT”) was detected. In the right panel of Figure 3A (“Amplicon”), vector integration was measured by ddPCR using the SV40_FAM Set 1 primer / probe set. Positive signals observed in samples from both pHMI-hPAH-hA-002 vector transduced cells (“T001 Frag”) and pHMI-hPAH-h1-001 vector transduced cells (“T002 Frag”) This indicates that the vector was integrated into both cells.

To quantify target integration, three sets of primers and probes, as shown in Table 6, were designed for detection of integration by ddPCR. PAH_Genomic Set 1 detected unedited and edited genomes after targeted integration of pHMI-hPAH-hA-002. SV40_FAM Set 1 detected sequences in the SV40 polyadenylation sequence present in the edited and unedited genomes. PAH_HA Set 1 detected regions in the homologous arm that were also present in vectors that were not integrated into both the edited and unedited genomes.

The DNA sample was dispensed into oil droplets. Increase the concentration of DNA to 600 pg per 20 μL so that one drop of oil significantly reduces the probability of randomly containing two DNA molecules (eg, vector and genomic DNA particles) (p <0.001). Optimized. The amount of DNA (Quantity_genome) identified by PAH_Genomic Set 1 represented the total amount of unedited and edited genomes. The amount of DNA (Quantity_payload) identified by SV40_FAM Set 1 represented the total amount of the edited genome and the unintegrated vector. The amount of DNA (Quantity_HA) identified by PAH_HA Set 1 represented the total amount of unedited and edited genomes and unintegrated vectors. Therefore, the amount of edited genome can be calculated by the following formula: Quantity_genome +-Quantity_payload --Quantity_HA. The percentage of properly integrated genomes can be calculated as the amount of edited genomes divided by Quantity_genome.

As shown in FIG. 3B, the percentage of genomes correctly integrated with the pHMI-hPAH-hA-002 vector was 17.86% as measured by the primer / probe set. Integration was not detected in control cells that were not transduced with the pHMI-hPAH-hA-002 vector.

(Example 4)
In vivo PAH Gene Editing in Mouse Liver This example investigates PAH modified vectors capable of editing mouse PAH genes, said PAH modified vectors capable of determining their editing efficiency in mouse liver. Provide an animal model to do.

a) Editing of mouse PAH genes in wild-type mice In a specific example, provided here is in vivo editing of the mouse genome using the pHMI-hPAH-mAC-006 vector. The pHMI-hPAH-mAC-006 vector is similar to the pHMI-hPAH-hAC-008 vector, but the mouse PAH gene can be edited instead of the human PAH gene (Fig. 4A). Specifically, pHMI-hPAH-mAC-006 contained the following genetic elements from 5'to 3': 5'ITR elements, 5'homologous arms, human PAH coding sequences with silent changes, SV40 polyadenylation sequence, target integration restriction cassette (“TI RE”), 3'homologous arm, and 3'ITR element. The array of these elements is shown in Table 6. The 5'homologous arm contains a wild-type genomic sequence upstream of the mouse PAH start codon and containing the mouse PAH start codon, and thus mutations in the start codon and / or 5'untranslated region (UTR) of the mouse PAH gene. Had the ability to correct. The 3'homologous arm contained a wild-type genomic sequence downstream of the start codon of mouse PAHs. Integration of the PAH modification vector pHMI-hPAH-mAC-006 into the mouse genome inserts a human PAH coding sequence with silent alterations, an SV40 polyadenylation sequence, and a target integration restriction cassette into the start codon of the mouse PAH gene (ie). By substituting nucleotides 1-3 of the mouse PAH gene), wild-type human PAH protein could be expressed in mouse cells. The vector alone was free of promoter sequences but was able to drive independent PAH expression without genomic integration.

The pHMI-hPAH-mAC-006 vector was packaged in AAVHSC17 capsid and injected intravenously into two wild-type neonatal mice via the tail vein at a dose of ^{2 × 10 13 vector genomes per kg body weight.} Two control mice were injected with saline via the tail vein. Liver samples were taken 2 weeks later.

We have developed a PCR method to detect the integration of the pHMI-hPAH-mAC-006 vector into the mouse genome. As shown in FIG. 4B, the first pair of primers (SEQ ID NOs: 62 and 63) were designed to amplify 867 bp DNA from the unedited allele (“control PCR”) and the second primer. Pairs (SEQ ID NOs: 64 and 65) were designed to specifically amplify 2459 bp DNA from the edited allele (“Edited Allele PCR”). As shown in Figure 4C, liver samples from saline-treated mice and cell samples of 3T3 mouse fibroblasts did not produce PCR products corresponding to the edited aller, on the other hand. Liver samples from two mice injected with the pHMI-hPAH-mAC-006 vector produced PCR products corresponding to the edited allele. All four samples gave rise to similar levels of PCR products corresponding to unedited alleles, suggesting that these samples were quality equivalent.

We have developed a ddPCR method for quantifying the integration of the pHMI-hPAH-mAC-006 vector into the mouse genome. Two sets of primers and probes, as shown in Table 7, were designed for integration detection by ddPCR. mPAH_ATG_gDNA_FAM Set 1 detected unedited and edited genomes after target integration of pHMI-hPAH-mAC-006. SV40_FAM Set 1 detected sequences in the SV40 polyadenylation sequence present in the edited and unedited genomes (Fig. 5A).

The DNA sample was dispensed into oil droplets. The concentration of DNA was optimized to 600 pg per 20 μL so that the probability that one drop of oil would randomly contain vector particles and genomic DNA particles (p <0.001) was optimized (FIGS. 5C and 5D). When the vector is integrated into the genome, the double positive rate of the vector probe and locus probe in the same droplet increases (Fig. 5B). As shown in FIG. 5E, the two control mice were edited with 0% and 0.0395% of alleles in the liver, respectively, and the two mice treated with the pHMI-hPAH-mAC-006 vector were in the liver. 2.504% and 2.783% of alleles were edited, respectively. Therefore, the overall integration efficiency of the pHMI-hPAH-mAC-006 vector in the liver under given conditions was about 2.6%. The integration efficiency for each individual cell is expected to be higher as not all cells were transduced with this vector.

The relative amount of mRNA expressed from the edited allele was determined by ddPCR. SV40_FAM Set 1 was used to specifically detect human PAH expression from edited alleles. Each PAH expression level was normalized to the expression level of endogenous Hprt. As shown in FIG. 6, control mice showed no expression of human PAHs, suggesting that primers and probes did not cross-react with endogenous mouse PAHs. Percentages of PAH expression for wild-type levels were calculated based on human PAH signals for Hprt, normalized to endogenous mouse PAH signals for Hprt. Two mice treated with the pHMI-hPAH-mAC-006 vector had mRNA levels of 5.378% and 4.846%, respectively, relative to endogenous mouse PAH levels. Therefore, the total mRNA level of the pHMI-hPAH-mAC-006 vector in the liver under given conditions was about 5%. MRNA levels for each individual cell are expected to be higher as not all cells were transduced with this vector.

b) Editing mouse PAH genes in pah knockout mice
In one experiment, the efficiency of the pHMI-hPAH-mAC-006 vector for phenotypic modification was determined using ^{the PAH knockout mouse model (PAH ENU2).} Briefly, the hPAH-mAC-006 vector packaged in AAVHSC15 capsid was ^{intravenously administered to these mice at a dose of 1.16 × 10 14} vector genomes per kilogram of body weight for 5 consecutive days. Serum phenylalanine (Phe) was measured by mass spectrometry once a week for 5 months. Five months later, DNA was extracted from liver samples and the number of vector genomes per cell was analyzed by ddPCR using a set of primers and probes to determine vector and human PAH genome locus copy numbers.

Transduction efficiency (measured by the number of vector genomes per cell (“VG / cell”)) was determined by ddPCR using a set of primers and probes to determine the vector, as well as the mouse and human PAH genomic genes. The locus copy number was measured. Editing frequency was measured by multiplexing ddPCR using a primer probe set to measure the frequency of editing element DNA from AAV vectors (“payloads”) integrated into mouse PAH and human PAH loci. Briefly, a single DNA strand was distributed into oil droplets. Each droplet was tested for the presence or absence of payload and the presence of either human or mouse PAH DNA. The editing frequency was calculated based on the detected value of payload and target DNA codistribution within a single droplet, exceeding the expected probability of payload and target DNA codistribution within separate nucleic acid molecules.

PAH knockout mice had a phenotype with elevated blood phenylalanine (Phe) levels. To investigate phenotypic changes, serum levels of Phe after administration of the AAV vector were measured, percentage levels relative to baseline at 0 were calculated, and percentage levels were compared to control mice not treated with the AAV vector. ..

Mice treated with the hPAH-mAC-006 vector packaged in the AAVHSC15 capsid had a transduction efficiency of approximately 8-18 vector genomes per cell (Fig. 7A) and approximately 4.4% of the number of alleles. The average editing efficiency (Fig. 7B) is shown. This editing efficiency supports PAH expression levels sufficient to reduce Phe levels in mouse serum by about 50% for at least 5 months (Figures 7C and 7D), and phenotypic changes are associated with this editing efficiency. Correlated (Fig. 7E). From the edited genomic locus, the Pah gene was amplified by the length of the PCR product, amplified using a first primer that hybridized to the payload and a second primer that hybridized to the genomic sequence downstream of the right homologous arm. The correct homologous hybridization of the vector at the locus was verified (data not shown).

The DNA sequences within the genomic region corresponding to the homologous arm were further analyzed by deep sequencing (Illumina) to determine if homologous recombination would introduce any genomic alterations into the edited allele. All samples had high quality sequence leads and all positions were sequenced to a depth greater than 20,000 reads. Insertions and deletions (hereinafter "Indel" herein) were identified by the Somatic Variant Caller using an Indel quality filter and a strand bias filter. Specifically, the region within the right homologous arm containing 10 consecutive Gs showed a high indel rate of about 0.02-0.05% in both control and treated animals. Indels at this locus, as well as at some other loci, did not pass the filter for genuine changes and were therefore excluded from further analysis. As shown in Table 8, untreated control animals showed an indel rate of 0.002-0.006%. Treatment animal 1 had an indel rate of 0.031%, treatment animal 2 had no filtered indels, and treatment animal 3 had an indel rate similar to that of control animals. All identified indels were located in the untranslated region.

The above results demonstrate the feasibility of reversing the PAH deficiency phenotype using modified vectors that insert PAH coding sequences into the genome.

To detect expression of human PAH in individual mouse hepatocytes after in vivo hybridization, liver tissue sections were used to probe> 1 kb of human PAH RNA with the above silent codon changes. RNA in situ hybridization (ISH) was performed using (Advanced Cell Diagnostics, Hayward, CA). As shown in FIG. 7F, this probe detected human PAH RNA containing the PAH sequence and optionally viral DNA in mouse hepatocytes transduced with the hPAH-mAC-006 vector, but endogenous mouse Pah RNA. Did not cross-hybridize with. A mouse liver sample transduced with a transgene construct containing a CMV promoter that drives expression of human Pah RNA with the same silent codon changes was used as a positive control.

c) PAH modification vector pHMI-hPAH-mAC-006
The pHMI-hPAH-mAC-006 vector contained the following genetic elements from 5'to 3': 5'ITR elements, 5'homologous arms, human PAH coding sequences with silent changes, SV40 polyadenylation sequences. , 3'homologous arm, and 3'ITR element. The array of these elements is shown in Table 9.

d) PAH gene editing efficiency in mice treated with pHMI-hPAH-mAC-006 Figure 9A is a schematic of the assay used to determine the editing efficiency of PAH genes in mice treated with the pHMI-hPAH-mAC-006 vector. The figure is shown. ddPCR and LAM-NGS (LAM-PCR followed by next-generation sequencing (NGS)) were performed as described herein and as shown in FIG. 9A. FIG. 9B shows a graph of PAH gene editing efficiency as determined in mouse cells treated with either the pHMI-hPAH-mAC-006 vector or solvent control. As shown in FIG. 9B, the PAH gene editing efficiency in mice treated with the HMI-hPAH-mAC-006 vector was determined to be approximately 8% relative to the number of alleles. No errors were detected in the edited area.

e) Persistent phenotypic modification of hyperphenylalanineemia in a mouse model
In one experiment, the efficiency of the pHMI-hPAH-mAC-006 vector for phenotypic modification was determined using ^{the PAH knockout mouse model (PAH ENU2).} The pHMI-hPAH-mAC-006 vector was packaged in AAVHSC15 capsid and mice were intravenously administered at a dose of ^{1 × 10 14 vector genomes per kilogram of body weight.} To investigate phenotypic changes, serum levels of phenylalanine (Phe) and tyrosine (Tyr) after administration of the pHMI-hPAH-mAC-006 vector packaged in AAVHSC15 capsid were measured once weekly for longer than 7 weeks. Measurements were taken, percentage levels relative to baseline at 0 were calculated, and percentage levels were compared to solvent-controlled control mice. A total of 4 mice received the pHMI-hPAH-mAC-006 vector packaged in the AAVHSC15 capsid, and 2 mice received the solvent control. Significant reduction in serum levels of Phe, as shown in FIG. 10 (FIG. 10A; * shows p <0.0001 for the solvent by ANOVA with a dual ANOVA for repeated measures; ANOVA with a dual ANOVA for repeated measures. Significant increase in serum levels of p <0.0001) and Tyr with respect to time (Fig. 10B; * indicates p <0.05 with respect to solvent by ANOVA with two-way ANOVA with repeated measures; two-way ANOVA with repeated measures. With respect to time, p <0.0003) was observed in vector-treated mice. FIG. 10C shows the ratio between serum Phe and serum Tyr in vector or solvent controlled mice (* indicates p <0.002 for solvent by ANOVA with two-way ANOVA for repeated measures; binary for repeated measures. Placement ANOVA with respect to time p <0.0004).

FIG. 11A shows a graph showing PAH gene editing efficiency and transduction efficiency for cells obtained from mice treated with either the pHMI-hPAH-mAC-006 vector or solvent control. The y-axis on the left side of Figure 11A shows the percentage of editing efficiency, with mice receiving the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) having an editing efficiency of approximately 5% relative to the number of alleles. Show that. The y-axis on the right side of FIG. 11A shows the number of vector genomes per cell, and the number of mice administered with the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) is about 140 per cell. It shows that it had transduction efficiency.

FIG. 11B shows the relative amount of PAH mRNA expressed for cells obtained from mice administered either the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) or solvent control, and the expression level of mouse GAPDH The graph which shows the said relative quantity normalized to is shown. As shown, cells obtained from mice treated with the pHMI-hPAH-mAC-006 vector (AAVHSC15-mPAH) had significant human PAH mRNA levels compared to mice treated with solvent control. (* Indicates p <0.005 for solvent by two-sided Mann-Whitney test).

(Example 5)
In vivo Editing of Human PAH Genes in Mouse Models This example provides an animal model for investigating PAH modified vectors, such as those described in previous examples for editing human PAH genes in mouse models. To do.

a) Editing human PAHs in human blood cells in a mouse model Briefly, NOD.Cg-Prkdc ^scid Il2rg ^tm1Wjl / SzJ (NSG) mice were bone marrow-destroyed by sublethal irradiation and human CD34 ⁺ hematopoiesis in these mice. Stem cells were transplanted. After 12 weeks, engraftment levels were determined by identifying the amount of human and mouse CD45 ⁺ cells in peripheral blood by flow cytometry, and mice with more than 50% ^{circulating human CD45 + cells were selected.} The hPAH-hAC-008 vector packaged with AAVHSC17 capsid was intravenously administered to 12 such mice evenly divided into 4 groups. The first and second groups of mice received ^{a dose of 1.54 x 10 13} vector genomes per kilogram of body weight, and the third and fourth groups received 2.1 x 10 ¹² vector genomes per kilogram of body weight. The dose was given. Mice were euthanized 6 weeks after injection. Blood, bone marrow and spleen tissue samples were taken and genomic DNA was extracted.

Editing frequency in mouse and human cells was measured by multiplexed droplet digital PCR (ddPCR) using a primer probe set and incorporated by integration of the AAV vector (“papment”) into the mouse PAH and human PAH loci. The frequency of DNA was measured. Briefly, a single DNA strand was distributed into oil droplets. Each droplet was tested for the presence or absence of payload and the presence of either human or mouse PAH DNA. The editing frequency was calculated based on the detection value of payload and target DNA codistribution within a single droplet, exceeding the expected probability of payload and target DNA codistribution within separate nucleic acid molecules.

As shown in Table 10, editing of human cells was detected in bone marrow samples in a dose-dependent manner. Notably, the edits were specific to the human genome, as no edits were detected in mouse cells.

FIG. 8A shows the transduction efficiency of the hPAH-hAC-008 vector and the hPAH-hAC-008-HBB vector into human and mouse hepatocytes of mice administered with the vector packaged in AAVHSC15 capsid.

b) Editing of human PAHs in human hepatocytes in a mouse model using vectors containing HBB introns
The hPAH-hAC-008 vector contains a fully human PAH coding sequence without any introns. Transcription of the modified vector hPAH-hAC-008-HBB from which the first intron of the human HBB gene (having the nucleotide sequence of SEQ ID NO: 28) is added between nucleotides 912 and 913 of the human PAH coding sequence. Generated to improve the nuclear export and stability of RNA molecules produced. The internucleotide bond between nucleotides 912 and 913 corresponded to the splicing site between exon 8 and exon 9 of the native PAH gene, which was not disrupted by silent codon changes.

The vector was packaged with AAVHSC15 capsid and mice were intravenously administered at a dose of ^{1 × 10 13 vector genomes per kilogram of body weight.} Six weeks after dosing, liver samples were taken and the localization of human PAH mRNA and optionally viral DNA containing PAH sequences with silent alterations was investigated by in situ hybridization. As shown in Figure 8B, the addition of HBB introns substantially improved the nuclear transport of mRNA. This result demonstrated that the addition of introns to the PAH coding sequence could increase the expression level of the PAH gene, and that this feature could be included in the design of PAH modified vectors.

c) Editing human PAH in human hepatocytes in a mouse model Briefly, C57Bl / 6 background Fah ^-/- Rag2 ^{-/- Il2rg-/-} mice, commonly referred to as FRG® knockout mice. , Used as a model for liver humanization. This mouse was immunodeficient and lacked the tyrosine-degrading enzyme fumalyl acetoacetate hydrase (Fah). Ablation of mouse hepatocytes was induced by withdrawal of the protective drug 2- (2-nitro-4-trifluoromethylbenzoyl) -1,3-cyclohexanedione (NTBC). Then, human hepatocytes were engrafted in mice, and urokinase-expressing adenovirus was administered to promote the regrowth of human hepatocytes. Engraftment was maintained throughout the life of the animal using the appropriate regimen of CuRx ™ nitisinone (20-0026) and prophylactic treatment with SMX / TMP antibiotics (20-0037). These animals weighed an average of 22 grams and had a typical lifespan of 18-24 months.

The hPAH-hAC-008 or hPAH-hAC-008-HBB vector was packaged with AAVHSC15 capsid and mice were intravenously administered at a dose of ^{1 × 10 13 vector genomes per kilogram of body weight.} Six weeks after administration, liver samples were taken, human and mouse hepatocytes were isolated, and after liver perfusion, purified using a Miltenyi autoMACS column. DNA was extracted and the efficiency of gene editing was measured using the same ddPCR method described above.

As shown in Figure 8C, the percentage of editing efficiency in human hepatocytes, measured as the percentage of edited allele of all alleles, was 2.2% in animals treated with the hPAH-hAC-008 vector, and It was 4.3% in animals treated with the hPAH-hAC-008-HBB vector. No edits were detected in mouse hepatocytes from either animal. The lack of edit detection in mouse hepatocytes from either animal is unlikely to be due to inadequate transduction efficiency as it was fully transduced into mouse hepatocytes (Fig. 8A). In another experiment, editing the human genome with the hPAH-hAC-008 vector was detected at a rate of 2.131% of the number of alleles in the human genome, while editing the mouse genome in this liver sample was in mice. It was detected at a rate of 0.05% of the number of alleles in the genome. These results showed human-specific editing of the PAH gene by the hPAH-hAC-008 vector or a modified version thereof, and provided an in vivo model for investigating the editing efficiency in hepatocytes.

d) Editing human PAHs in human hepatocytes in a mouse model
^{In one experiment, C57Bl / 6 background Fah-/-} Rag2 ^-/- Il2rg ^-/- mice, commonly referred to as FRG® knockout mice (also referred to herein as HuLiv mice), are described above. As described above, it was used as a model for liver humanization (see Figure 12A).

The pHMIK-hPAH-hI1C-032 vector contained the following genetic elements from 5'to 3': 5'ITR elements, 5'homologous arms, splicing acceptors, 2A elements, human PAHs with silent changes. Code sequence, SV40 polyadenylation sequence, 3'homologous arm, and 3'ITR element. The array of these elements is shown in Table 11.

The pHMIK-hPAH-hI1C-032 vector was packaged with AAVHSC15 capsid and mice were intravenously administered at a dose of ^{1 × 10 14 vector genomes per kilogram of body weight.} Liver samples were taken from 3 mice treated with pHMIK-hPAH-hI1C-032 packaged with AAVHSC15 capsid, and human and mouse hepatocytes were isolated, purified and DNA extracted. The efficiency of gene editing was measured using the same ddPCR method described above.

Persistence of PAH gene editing in human hepatocytes was measured by determining the percentage of alleles of all alleles in cells obtained from treated mice 1 and 6 weeks after vector administration. As shown in Figure 12B, approximately 4% of PAH gene edits were measured in cells obtained from mice 1 week after vector administration and approximately 7% in cells obtained from mice 6 weeks after vector administration. Gene editing was measured.

Genome editing mediated by the pHMIK-hPAH-hI1C-032 vector was found to be specific for human hepatocytes in HuLiv mice. As shown in FIG. 13, one week after vector administration, PAH gene editing (as determined by ddPCR and NGS) was detected at a rate of approximately 3% to 3.5% of the number of alleles in the human genome. However, on the other hand, the editing of the mouse genome in this liver sample was close to 0% of the number of alleles in the mouse genome. At 6 weeks after vector administration, edits were detected at a rate of approximately 5% to 6.5% of the number of alleles in the human genome. * Indicates p <0.0025 compared to the mouse value.

Furthermore, the pHMIK-hPAH-hI1C-032 vector was found to be ineffective in non-human cells. As shown in FIG. 14, PAH knockout mice (PAH ^ENU2 ) mice were injected with the pHMIK-hPAH-hI1C-032 vector (hPAH-032) packaged with AAVHSC15 capsid, vector genome 1 × per kilogram of body weight. When administered intravenously at 10 ¹⁴ doses, serum phenylalanine levels were similar to those of control-treated mice up to 3 weeks after injection. In contrast, mice treated with the pHMI-hPAH-mAC-006 vector (mPAH-006) showed decreased serum Phe levels as early as 1 week after injection.

FIG. 15A shows the relationship between human PAH expression and serum Phe levels. As shown, the data collected from experiments using pHMI-hPAH-mAC-006 vector in PAH ^ENU2 mice, 10% of the human PAH expression, to modify the phenotype in PAH ^ENU2 mice. Therefore, it was determined that 10% human PAH expression relative to the endogenous level is the level required to correct phenylalanineemia (eg, therapeutic level).

Therapeutic level expression was detected with the pHMIK-hPAH-hI1C-032 vector. Expression of human PAH in human hepatocytes was relative to human GAPDH in HuLiv mice treated with the pHMIK-hPAH-hI1C-032 vector (hPAH-032) at ^{a dose of 1 × 10 14 vector genomes per kilogram of body weight.} Was measured. As shown in FIG. 15B, human PAH expression was measured using two different expression probes in two different HuLiv mice treated with the vector, and human PAH expression was greater than 10% in human hepatocytes. I decided that there were many. The PAH gene editing range in human hepatocytes of vector-treated HuLiv mice was measured to be about 5% to about 11% over 3 different experiments in 13 different mice.

The pHMIK-hPAH-hI1C-032 vector was found to target the human PAH gene, resulting in modified mRNA levels in HuLiv mice. The PAH mRNA levels required for phenotypic modification were first established in a ^{mouse model (using the PAH knockout mouse model (PAH ENU2)).} This was determined to be about 10% PAH expression relative to the endogenous level (Fig. 15A). As shown in FIG. 16, human PAH gene expression was determined to be approximately 44.9% relative to GAPDH expression (left side), and mouse PAH gene expression was approximately 39.7% relative to GAPDH expression. Determined (right side).

(Example 6)
Human PAH Modified Vector This example is a human PAH modified vector pKITR-hPAH-mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, pKITR-hPAH-mAC-006-SD.3, pHMIA2-hPAH-hI1C -032-SD.3 and pHMIA2-hPAH-mAC-006-HBB1 are provided. Schematic diagrams of these vectors are shown in FIGS. 17A, 17B, 17C, 17D, and 17E, respectively.

a) pKITR-hPAH-mAC-006-HCR, pKITR-hPAH-hI1C-032-HCR, and pHMIA2-hPAH-mAC-006-HBB1
The vectors pKITR-hPAH-mAC-006-HCR and pKITR-hPAH-hI1C-032-HCR were generated by inserting HCR introns into the PAH coding sequence. The vector pHMIA2-hPAH-mAC-006-HBB1 was generated by inserting an HBB1 intron into the PAH coding sequence. HCR and HBB1 introns were selected based on their performance in intron screening experiments to determine highly expressed introns in liver and blood cell lines using a luciferase reporter. The introns used for screening are shown in Table 12.

pKITR-hPAH-mAC-006-HCR contained the following genetic elements from 5'to 3': human PAH with silent changes with 5'ITR elements, 5'homologous arms, and HCR introns inserted. Code sequence, SV40 polyadenylation sequence, target integration restriction cassette (“TI RE”), 3'homologous arm, and 3'ITR element. The pKITR-hPAH-hI1C-032-HCR contained the following genetic elements from 5'to 3': 5'ITR element, 5'homologous arm, splice acceptor, 2A element, HCR intron inserted. Human PAH coding sequences with silent changes, SV40 polyadenylation sequences, 3'homologous arms, and 3'ITR elements. pHMIA2-hPAH-mAC-006-HBB1 contained the following genetic elements from 5'to 3': 5'ITR element, 5'homologous arm, human PAH with silent change with HBB intron inserted. Code sequence, SV40 polyadenylation sequence, target integration restriction cassette (“TI RE”), 3'homologous arm, and 3'ITR element. The array of these elements is shown in Table 13.

b) pKITR-hPAH-mAC-006-SD.3 and pHMIA2-hPAH-hI1C-032-SD.3
The vectors pKITR-hPAH-mAC-006-SD.3 and pHMIA2-hPAH-hI1C-032-SD.3 were generated by modifying the splice donor site. Splice donors were modified as shown in FIGS. 17C and 17D, respectively. pKITR-hPAH-mAC-006-SD.3 contained the following genetic elements from 5'to 3': 5'ITR element, 5'homologous arm, splice donor modified silent variation Human PAH coding sequence, SV40 polyadenylation sequence, target integration restriction cassette (“TI RE”), 3'homologous arm, and 3'ITR element. pHMIA2-hPAH-hI1C-032-SD.3 contained the following genetic elements from 5'to 3': 5'ITR elements, 5'homologous arms, splicing acceptors, 2A elements, splice donors. Human PAH coding sequences with modified silent changes, SV40 polyadenylation sequences, 3'homologous arms, and 3'ITR elements. The array of these elements is shown in Table 14.

The present invention is not limited in scope by the particular embodiments described herein. In fact, it is expected that various modifications of the invention in addition to those described will be apparent to those skilled in the art from the above description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

All references cited herein (eg, publications or patents or patent applications) are referenced in their entirety by each individual reference (eg, publication or patent or patent application) for any purpose. They are incorporated herein by reference in their entirety for all purposes, to the same extent as specifically and individually indicated as incorporated by. Other embodiments are within the scope of the claims below.

Claims (154)

A method of correcting a mutation in the intracellular phenylalanine hydroxylase (PAH) gene, which comprises the step of transducing the cell with a replication-deficient adeno-associated virus (AAV).
(a) AAV capsid and
(b) Including modified genome
The modified genome has (i) an editing element for editing the target locus in the PAH gene and (ii) an editing element having homology to the first genomic region on the 5'side of the target locus. 5'side 5'homologous arm nucleotide sequence and (iii) 3'side 3'homologous arm nucleotide sequence of the editing element having homology to the 2nd genomic region on the 3'side of the target locus. Including and
A method in which the cells are transduced with an exogenous nuclease, or a nucleotide sequence encoding an exogenous nuclease, without co-transduction or co-administration. The method of claim 1, wherein the cells are hepatocytes, renal cells, or cells in the brain, pituitary gland, adrenal gland, pancreas, bladder, gallbladder, colon, small intestine or breast. The method of claim 1 or 2, wherein the cells are cells of a mammalian subject and AAV is administered to the subject in an amount effective for transduction into the cells of the subject. A method of treating a subject suffering from a disease or disorder associated with a PAH gene mutation.
(a) AAV capsid and
(b) Including the step of administering to the subject an effective amount of replication-deficient AAV, including the modified genome.
The modified genome has (i) an editing element for editing the target locus in the PAH gene and (ii) an editing element having homology to the first genomic region on the 5'side of the target locus. 5'side 5'homologous arm nucleotide sequence and (iii) 3'side 3'homologous arm nucleotide sequence of the editing element having homology to the 2nd genomic region on the 3'side of the target locus. Including and
A method in which an exogenous nuclease, or nucleotide sequence encoding an exogenous nuclease, is not co-administered to said subject. The method of claim 4, wherein the disease or disorder is phenylketonuria. The method of claim 4 or 5, wherein the subject is a human subject. The method of any one of claims 1-6, wherein the editing element comprises at least a portion of a PAH coding sequence. The method of claim 7, wherein the editing element comprises a PAH code sequence. The method of claim 7 or 8, wherein the PAH coding sequence encodes the amino acid sequence set forth in SEQ ID NO: 23. The method of any one of claims 7-9, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 24. The method of any one of claims 7-9, wherein the PAH coding sequence has a silent variation. 11. The method of claim 11, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143. The method of claim 7, wherein the editing element comprises a PAH intron insertion code sequence, and optionally the PAH intron insertion code sequence comprises an unnatural intron inserted into the PAH code sequence. 13. The method of claim 13, wherein the unnatural intron is selected from the group consisting of a first intron of the hemoglobin beta gene and a mouse microvirus (MVM) intron. 14. The method of claim 14, wherein the unnatural intron comprises a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 28-30 and 120-130. 15. The method of claim 15, wherein the unnatural intron comprises the nucleotide sequence of any one of SEQ ID NOs: 28-30 and 120-130. The method according to any one of claims 13 to 16, wherein the PAH intron insertion coding sequence encodes the amino acid sequence set forth in SEQ ID NO: 23. The PAH intron insertion coding sequence comprises a first portion of the PAH coding sequence, an intron, and a second portion of the PAH coding sequence from 5'to 3', the first portion and the first portion. The method of any one of claims 13-17, wherein when the two parts are spliced together, they form a complete PAH coding sequence. The method of claim 18, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 24. The method of claim 18, wherein the PAH coding sequence has a silent variation. The method of claim 20, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143. The first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65 and / or the second portion of the PAH coding sequence is the amino acid sequence set forth in SEQ ID NO: 66 or 67. The method according to any one of claims 18 to 21, including. The first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65, and the second portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 66 or 67. The method according to any one of claims 18 to 22. The method according to any one of claims 7 to 23, wherein the editing element comprises a ribosome skipping element and the PAH coding sequence or the PAH intron insertion coding sequence from 5'to 3'. 24. The method of claim 24, wherein the editing element further comprises a polyadenylation sequence on the 3'side of the PAH coding sequence or the PAH intron insertion coding sequence. 25. The method of claim 25, wherein the polyadenylation sequence is an extrinsic polyadenylation sequence and, optionally, the extrinsic polyadenylation sequence is an SV40 polyadenylation sequence. 26. The method of claim 26, wherein the SV40 polyadenylation sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34. The method according to any one of claims 24 to 27, wherein the nucleotide on the 5'side of the target locus is in an exon of the PAH gene. The method according to any one of claims 24 to 28, wherein the nucleotide on the 5'side of the target locus is in exon 1 of the PAH gene. The method of any one of claims 24-27, wherein the editing element further comprises a splice acceptor on the 5'side of the ribosome skipping element. The method of claim 30, wherein the nucleotide on the 5'side of the target locus is in the intron of the PAH gene. The method according to claim 30 or 31, wherein the nucleotide on the 5'side of the target locus is in the intron 1 of the PAH gene. The method of any one of claims 1-32, wherein the editing element comprises the nucleotide sequence of SEQ ID NO: 35. According to any one of claims 1 to 33, the 5'homologous arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the first genomic region. The method described. According to any one of claims 1 to 34, the 3'homologous arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the second genomic region. The method described. The method according to any one of claims 1 to 35, wherein the first genomic region is located in the first edit window and the second genomic region is located in the second edit window. .. 36. The method of claim 36, wherein the first edit window comprises the nucleotide sequence of SEQ ID NO: 36 or 45. The method of claim 36 or 37, wherein the second edit window comprises the nucleotide sequence of SEQ ID NO: 36 or 45. The first edit window comprises the nucleotide sequence set forth in SEQ ID NO: 36, and the second edit window comprises the nucleotide sequence set forth in SEQ ID NO: 45, according to any one of claims 36 to 38. the method of. The method according to any one of claims 1 to 39, wherein the first genomic region comprises the nucleotide sequence of SEQ ID NO: 36. The method according to any one of claims 1 to 40, wherein the second genomic region comprises the nucleotide sequence of SEQ ID NO: 45. The method according to any one of claims 1 to 41, wherein each of the 5'and 3'homologous arm nucleotide sequences independently has a length of about 100 to about 2000 nucleotides. The 5'homologous arm corresponds to C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, and nucleotide 7 of the PAH gene. G, G corresponding to nucleotide 9 of the PAH gene, A corresponding to nucleotide -467 of the PAH gene, A corresponding to nucleotide -465 of the PAH gene, A corresponding to nucleotide -181 of the PAH gene, said G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, A corresponding to nucleotide 211 of the PAH gene, G corresponding to nucleotide 194 of the PAH gene, G of the PAH gene C corresponding to nucleotide -433, C corresponding to nucleotide -432 of the PAH gene, ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene, and nucleotide -341 of the PAH gene. A, A corresponding to nucleotide-339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and / or corresponding to nucleotide -203 of the PAH gene. The method of any one of claims 1-42, comprising A. The 5'homologous arm
(a) C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and the above. G corresponding to nucleotide 9 of the PAH gene;
(b) A corresponding to nucleotide-467 of the PAH gene and A corresponding to nucleotide -465 of the PAH gene;
(c) A; corresponding to nucleotide-181 of the PAH gene;
(d) G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene;
(e) G corresponding to nucleotide 194 of the PAH gene;
(f) C corresponding to nucleotide-433 of the PAH gene and C corresponding to nucleotide -432 of the PAH gene;
(g) ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and / or
(h) A corresponding to nucleotide-341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide-211 of the PAH gene. , And A corresponding to nucleotide-203 of the PAH gene
The method according to any one of claims 1 to 43, including. 44. The method of claim 44, wherein the 5'homologous arm comprises modifications of (c) and (d), (f) and (g), and / or (b) and (h). The method according to any one of claims 1 to 45, wherein the 5'homologous arm comprises the nucleotide sequence according to any one of SEQ ID NOs: 36 to 44, 111, 115, and 142. The method of any one of claims 1 to 46, wherein the 3'homologous arm comprises the nucleotide sequence of SEQ ID NOs: 45, 112, 117, 144. The method of any one of claims 1-47, wherein the modified genome comprises the nucleotide sequence of any one of SEQ ID NOs: 46-54, 113, 118, 134, 136, and 145. .. The modified genome has a 5'reverse end repeat (5'ITR) nucleotide sequence on the 5'side of the 5'homologous arm nucleotide sequence and a 3'reverse end repeat (5' reverse end repeat (5'ITR) on the 3'side of the 3'homologous arm nucleotide sequence. The method according to any one of claims 1 to 48, further comprising a 3'ITR) nucleotide sequence. Claimed that the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 18 and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 19. Item 49. The 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 20, and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 21. Item 49. Claimed that the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 26 and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 27. Item 49. The method of any one of claims 1-52, wherein the modified genome comprises the nucleotide sequence of any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146. .. The method according to any one of claims 1 to 53, wherein the modified genome comprises the nucleotide sequence according to any one of SEQ ID NOs: 55 to 63, 114, 119, 135, 137, and 146. .. The method according to any one of claims 1 to 54, wherein the AAV capsid comprises an AAV clade F capsid protein. The AAV clade F capsid protein has at least 95% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. The method according to any one of claims 1 to 55, which comprises an amino acid sequence comprising. The amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C, and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, which corresponds to amino acid 312 of SEQ ID NO: 2. The amino acid in the capsid protein is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is. , N, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: R is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is the capsid. The amino acid in the protein is G or Y, the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is The amino acid in the capsid protein which is R and corresponds to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C or SEQ ID NO: 2. The method of claim 56, wherein the amino acid in the capsid protein corresponding to amino acid 718 of 2 is G. (a) Whether the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(b) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 Whether the amino acid in the capsid protein corresponding to 505 is R and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(c) Whether the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(d) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(e) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid of SEQ ID NO: 2 The method of claim 57, wherein the amino acid in the capsid protein corresponding to amino acid 706 is C. 58. The method of claim 57, wherein the capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. The AAV clade F capsid protein is at least 95% of the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. The method according to any one of claims 1 to 59, which comprises an amino acid sequence having the sequence identity of. The amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D, which corresponds to amino acid 206 of SEQ ID NO: 2. The amino acid in the capsid protein is C, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is. , Q, and the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: S is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, and the amino acid corresponding to amino acid 505 of SEQ ID NO: 2 is the capsid. The amino acid in the protein is R, the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or The amino acid in the capsid protein which is Y and corresponds to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein is R. The amino acid in the capsid protein corresponding to amino acid 690 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C, or the amino acid corresponding to amino acid 718 of SEQ ID NO: 2 is said. The method of claim 60, wherein the amino acid in the capsid protein is G. (a) Whether the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(b) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 Whether the amino acid in the capsid protein corresponding to 505 is R and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(c) Whether the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(d) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(e) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid of SEQ ID NO: 2 The method of claim 61, wherein the amino acid in the capsid protein corresponding to amino acid 706 is C. 61. The capsid protein comprises the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. The method described. The AAV clade F capsid protein contains at least the amino acid sequence of amino acids 1 to 736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. The method according to any one of claims 1 to 63, comprising an amino acid sequence having 95% sequence identity. The amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T, and the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I, which corresponds to amino acid 68 of SEQ ID NO: 2. The amino acid in the capsid protein is V, the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is. , L, the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D, and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: C is C, and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid corresponding to amino acid 312 of SEQ ID NO: 2 is the capsid. The amino acid in the protein is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N. Yes, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, amino acid 505 of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to is R and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R and corresponds to amino acid 626 of SEQ ID NO: 2 in the capsid protein. The amino acid is G or Y, the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R. , The amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C, or the amino acid of SEQ ID NO: 2. The method of claim 64, wherein the amino acid in the capsid protein corresponding to 718 is G. (a) Whether the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q.
(b) Whether the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y.
(c) Whether the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K.
(d) Whether the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S.
(e) Whether the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(f) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 Whether the amino acid in the capsid protein corresponding to 505 is R and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(g) Whether the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(h) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(i) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid of SEQ ID NO: 2 The method of claim 65, wherein the amino acid in the capsid protein corresponding to amino acid 706 is C. Claim that the capsid protein comprises the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. 65. When the AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of an exogenous nuclease, the efficiency of integration of the editing element into the target locus is at least 1. The method according to any one of claims 1 to 67, which is%. When the AAV was administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of an exogenous nuclease, the allelic frequency of integration of the editing element into the target locus was determined. The method of any one of claims 1-68, which is at least 0.5%. Adeno-associated virus (AAV) with replication deficiency, AAV
(a) AAV capsid and
(b) Including modified genome
The modified genome has (i) an editing element for editing the target locus in the PAH gene and (ii) an editing element having homology to the first genomic region on the 5'side of the target locus. 5'side 5'homologous arm nucleotide sequence and (iii) 3'side 3'homologous arm nucleotide sequence of the editing element having homology to the 2nd genomic region on the 3'side of the target locus. And including AAV. The AAV of claim 70, wherein the editing element comprises at least a portion of the PAH coding sequence. The AAV of claim 70 or 71, wherein the editing element comprises a PAH code sequence. The AAV of claim 71 or 72, wherein the PAH coding sequence encodes the amino acid sequence set forth in SEQ ID NO: 23. The AAV of claim 73, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 24. The AAV of claim 73, wherein the PAH coding sequence has a silent variation. The AAV of claim 75, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143. The AAV of claim 71, wherein the editing element comprises a PAH intron insertion code sequence, and optionally the PAH intron insertion code sequence comprises an unnatural intron inserted into the PAH code sequence. The AAV of claim 77, wherein the unnatural intron is selected from the group consisting of a first intron of the hemoglobin beta gene and a mouse microvirus (MVM) intron. The AAV of claim 78, wherein the unnatural intron comprises a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 28-30 and 120-130. The AAV of claim 79, wherein the unnatural intron comprises the nucleotide sequence of any one of SEQ ID NOs: 28-30 and 120-130. The AAV according to any one of claims 77 to 80, wherein the PAH intron insertion coding sequence encodes the amino acid sequence set forth in SEQ ID NO: 23. The PAH intron insertion coding sequence comprises a first portion of the PAH coding sequence, an intron, and a second portion of the PAH coding sequence from 5'to 3', the first portion and the second portion. The AAV according to any one of claims 77 to 81, wherein the portions of are spliced together to form a complete PAH coding sequence. The AAV of claim 82, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 24. The AAV of claim 82, wherein the PAH coding sequence has a silent variation. The AAV of claim 84, wherein the PAH coding sequence comprises the sequence of SEQ ID NO: 25, 116, 131, 132, 138, 139, or 143. The first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65 and / or the second portion of the PAH coding sequence is the amino acid sequence set forth in SEQ ID NO: 66 or 67. The AAV according to any one of claims 82 to 85, including. The first portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 64 or 65, and the second portion of the PAH coding sequence comprises the amino acid sequence set forth in SEQ ID NO: 66 or 67. The AAV according to any one of claims 82 to 86. The AAV according to any one of claims 71 to 87, wherein the editing element comprises a ribosome skipping element and the PAH coding sequence or the PAH intron insertion coding sequence from 5'to 3'. 28. The AAV of claim 88, wherein the editing element further comprises a polyadenylation sequence on the 3'side of the PAH coding sequence or the PAH intron insertion coding sequence. The AAV of claim 89, wherein the polyadenylation sequence is an extrinsic polyadenylation sequence and, optionally, the extrinsic polyadenylation sequence is an SV40 polyadenylation sequence. The AAV of claim 90, wherein the SV40 polyadenylation sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 31-34. The AAV according to any one of claims 88 to 91, wherein the nucleotide on the 5'side of the target locus is in an exon of the PAH gene. The AAV according to any one of claims 88 to 92, wherein the nucleotide on the 5'side of the target locus is in exon 1 of the PAH gene. The AAV according to any one of claims 88 to 91, wherein the editing element further comprises a splice acceptor on the 5'side of the ribosome skipping element. The AAV according to claim 94, wherein the nucleotide on the 5'side of the target locus is in the intron of the PAH gene. The AAV according to claim 94 or 95, wherein the nucleotide on the 5'side of the target locus is in the intron 1 of the PAH gene. The AAV of any one of claims 70-96, wherein the editing element comprises the nucleotide sequence of SEQ ID NO: 35. According to any one of claims 70 to 97, the 5'homologous arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the first genomic region. The listed AAV. According to any one of claims 70 to 98, the 3'homologous arm nucleotide sequence is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the second genomic region. The listed AAV. The AAV according to any one of claims 70 to 99, wherein the first genomic region is located in the first edit window and the second genomic region is located in the second edit window. .. The AAV of claim 100, wherein the first edit window comprises the nucleotide sequence of SEQ ID NO: 36 or 45. The AAV of claim 100 or 101, wherein the second edit window comprises the nucleotide sequence of SEQ ID NO: 36 or 45. The first edit window comprises the nucleotide sequence set forth in SEQ ID NO: 36, and the second edit window comprises the nucleotide sequence set forth in SEQ ID NO: 45, according to any one of claims 100 to 102. AAV. The AAV according to any one of claims 70 to 103, wherein the first genomic region comprises the nucleotide sequence of SEQ ID NO: 36. The AAV according to any one of claims 70 to 104, wherein the second genomic region comprises the nucleotide sequence of SEQ ID NO: 45. The AAV according to any one of claims 70 to 105, wherein each of the 5'and 3'homologous arm nucleotide sequences independently has a length of about 100 to about 2000 nucleotides. The 5'homologous arm corresponds to C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, and nucleotide 7 of the PAH gene. G, G corresponding to nucleotide 9 of the PAH gene, A corresponding to nucleotide -467 of the PAH gene, A corresponding to nucleotide -465 of the PAH gene, A corresponding to nucleotide -181 of the PAH gene, said G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, A corresponding to nucleotide 211 of the PAH gene, G corresponding to nucleotide 194 of the PAH gene, G of the PAH gene C corresponding to nucleotide -433, C corresponding to nucleotide -432 of the PAH gene, ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene, and nucleotide -341 of the PAH gene. A, A corresponding to nucleotide-339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide -211 of the PAH gene, and / or corresponding to nucleotide -203 of the PAH gene. AAV according to any one of claims 70 to 106, including A. The 5'homologous arm
(a) C corresponding to nucleotide-2 of the PAH gene, G corresponding to nucleotide 4 of the PAH gene, G corresponding to nucleotide 6 of the PAH gene, G corresponding to nucleotide 7 of the PAH gene, and the above. G corresponding to nucleotide 9 of the PAH gene;
(b) A corresponding to nucleotide-467 of the PAH gene and A corresponding to nucleotide -465 of the PAH gene;
(c) A; corresponding to nucleotide-181 of the PAH gene;
(d) G corresponding to nucleotide -214 of the PAH gene, C corresponding to nucleotide -212 of the PAH gene, and A corresponding to nucleotide -211 of the PAH gene;
(e) G corresponding to nucleotide 194 of the PAH gene;
(f) C corresponding to nucleotide-433 of the PAH gene and C corresponding to nucleotide -432 of the PAH gene;
(g) ACGCTGTTCTTCGCC (SEQ ID NO: 68) corresponding to nucleotides -394 to -388 of the PAH gene; and / or
(h) A corresponding to nucleotide-341 of the PAH gene, A corresponding to nucleotide -339 of the PAH gene, A corresponding to nucleotide -225 of the PAH gene, A corresponding to nucleotide-211 of the PAH gene. , And A corresponding to nucleotide-203 of the PAH gene
AAV according to any one of claims 70 to 107, including. The AAV of claim 108, wherein the 5'homologous arm comprises modifications of (c) and (d), (f) and (g), and / or (b) and (h). The AAV of any one of claims 70-109, wherein the 5'homologous arm comprises the nucleotide sequence of any one of SEQ ID NOs: 36-44, 111, 115, and 142. The AAV according to any one of claims 70 to 110, wherein the 3'homologous arm comprises the nucleotide sequence of SEQ ID NOs: 45, 112, 117, 144. AAV according to any one of claims 70 to 111, wherein the modified genome comprises the nucleotide sequence of any one of SEQ ID NOs: 46-54, 113, 118, 134, 136, and 145. .. The modified genome has a 5'reverse end repeat (5'ITR) nucleotide sequence on the 5'side of the 5'homologous arm nucleotide sequence and a 3'reverse end repeat (5' reverse end repeat (5'ITR) on the 3'side of the 3'homologous arm nucleotide sequence. The AAV according to any one of claims 70 to 112, further comprising a 3'ITR) nucleotide sequence. Claimed that the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 18 and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 19. Item 113. AAV. The 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 20, and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 21. Item 113. AAV. Claimed that the 5'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 26 and the 3'ITR nucleotide sequence has at least 95% sequence identity to SEQ ID NO: 27. Item 113. AAV. AAV according to any one of claims 70 to 116, wherein the modified genome comprises the nucleotide sequence of any one of SEQ ID NOs: 55-63, 114, 119, 135, 137, and 146. .. The AAV according to any one of claims 70 to 117, wherein the modified genome comprises the nucleotide sequence according to any one of SEQ ID NOs: 55 to 63, 114, 119, 135, 137, and 146. .. The AAV according to any one of claims 70 to 118, wherein the AAV capsid comprises an AAV clade F capsid protein. The AAV clade F capsid protein has at least 95% sequence identity with the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. The AAV according to any one of claims 70 to 119, which comprises an amino acid sequence comprising. The amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: 2 is C, and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, which corresponds to amino acid 312 of SEQ ID NO: 2. The amino acid in the capsid protein is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is. , N, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: R is R, and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is the capsid. The amino acid in the protein is G or Y, the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is The amino acid in the capsid protein which is R and corresponds to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C or SEQ ID NO: 2. The AAV according to claim 120, wherein the amino acid in the capsid protein corresponding to amino acid 718 of 2 is G. (a) Whether the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(b) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 Whether the amino acid in the capsid protein corresponding to 505 is R and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(c) Whether the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(d) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(e) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid of SEQ ID NO: 2 The AAV according to claim 121, wherein the amino acid in the capsid protein corresponding to amino acid 706 is C. 12. AAV according to claim 121, wherein the capsid protein comprises the amino acid sequence of amino acids 203-736 of SEQ ID NO: 2, 3, 4, 6, 7, 10, 11, 12, 13, 15, 16, or 17. The AAV clade F capsid protein is at least 95% of the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. The AAV according to any one of claims 70 to 123, which comprises an amino acid sequence having the sequence identity of. The amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D, which corresponds to amino acid 206 of SEQ ID NO: 2. The amino acid in the capsid protein is C, the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is. , Q, and the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: S is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, and the amino acid corresponding to amino acid 505 of SEQ ID NO: 2 is the capsid. The amino acid in the protein is R, the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G or The amino acid in the capsid protein which is Y and corresponds to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein is R. The amino acid in the capsid protein corresponding to amino acid 690 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C, or the amino acid corresponding to amino acid 718 of SEQ ID NO: 2 is said. The AAV according to claim 124, wherein the amino acid in the capsid protein is G. (a) Whether the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(b) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 Whether the amino acid in the capsid protein corresponding to 505 is R and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(c) Whether the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(d) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(e) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid of SEQ ID NO: 2 The AAV according to claim 125, wherein the amino acid in the capsid protein corresponding to amino acid 706 is C. 125. The capsid protein comprises the amino acid sequence of amino acids 138-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 15, 16, or 17. Described AAV. The AAV clade F capsid protein contains at least the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. The AAV according to any one of claims 70 to 127, comprising an amino acid sequence having 95% sequence identity. The amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T, and the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I, which corresponds to amino acid 68 of SEQ ID NO: 2. The amino acid in the capsid protein is V, the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is. , L, the amino acid in the capsid protein corresponding to amino acid 151 of SEQ ID NO: 2 is R, and the amino acid in the capsid protein corresponding to amino acid 160 of SEQ ID NO: 2 is D, and SEQ ID NO: 2 The amino acid in the capsid protein corresponding to amino acid 206 of SEQ ID NO: C is C, and the amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid corresponding to amino acid 312 of SEQ ID NO: 2 is the capsid. The amino acid in the protein is Q, the amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N. Yes, the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S, and the amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, amino acid 505 of SEQ ID NO: 2. The amino acid in the capsid protein corresponding to is R and the amino acid in the capsid protein corresponding to amino acid 590 of SEQ ID NO: 2 is R and corresponds to amino acid 626 of SEQ ID NO: 2 in the capsid protein. The amino acid is G or Y, the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M, and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R. , The amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K, and the amino acid in the capsid protein corresponding to amino acid 706 of SEQ ID NO: 2 is C, or the amino acid of SEQ ID NO: 2. The AAV according to claim 128, wherein the amino acid in the capsid protein corresponding to 718 is G. (a) Whether the amino acid in the capsid protein corresponding to amino acid 2 of SEQ ID NO: 2 is T and the amino acid in the capsid protein corresponding to amino acid 312 of SEQ ID NO: 2 is Q.
(b) Whether the amino acid in the capsid protein corresponding to amino acid 65 of SEQ ID NO: 2 is I and the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is Y.
(c) Whether the amino acid in the capsid protein corresponding to amino acid 77 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 690 of SEQ ID NO: 2 is K.
(d) Whether the amino acid in the capsid protein corresponding to amino acid 119 of SEQ ID NO: 2 is L and the amino acid in the capsid protein corresponding to amino acid 468 of SEQ ID NO: 2 is S.
(e) Whether the amino acid in the capsid protein corresponding to amino acid 626 of SEQ ID NO: 2 is G and the amino acid in the capsid protein corresponding to amino acid 718 of SEQ ID NO: 2 is G.
(f) The amino acid in the capsid protein corresponding to amino acid 296 of SEQ ID NO: 2 is H, and the amino acid in the capsid protein corresponding to amino acid 464 of SEQ ID NO: 2 is N, and the amino acid of SEQ ID NO: 2 Whether the amino acid in the capsid protein corresponding to 505 is R and the amino acid in the capsid protein corresponding to amino acid 681 of SEQ ID NO: 2 is M.
(g) Whether the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R and the amino acid in the capsid protein corresponding to amino acid 687 of SEQ ID NO: 2 is R.
(h) The amino acid in the capsid protein corresponding to amino acid 346 of SEQ ID NO: 2 is A, and the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R or
(i) The amino acid in the capsid protein corresponding to amino acid 501 of SEQ ID NO: 2 is I, the amino acid in the capsid protein corresponding to amino acid 505 of SEQ ID NO: 2 is R, and the amino acid of SEQ ID NO: 2 The AAV according to claim 129, wherein the amino acid in the capsid protein corresponding to amino acid 706 is C. Claim that the capsid protein comprises the amino acid sequence of amino acids 1-736 of SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, or 17. AAV described in 129. When the AAV is administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of an exogenous nuclease, the efficiency of integration of the editing element into the target locus is at least 1. The AAV according to any one of claims 70 to 131, which is%. When the AAV was administered to mice implanted with human hepatocytes under standard AAV administration conditions in the absence of an exogenous nuclease, the allelic frequency of integration of the editing element into the target locus was determined. The AAV according to any one of claims 70 to 132, which is at least 0.5%. A pharmaceutical composition comprising the AAV according to any one of claims 70 to 133. A packaging system for recombinant preparation of replication-deficient AAV.
(a) Rep nucleotide sequences encoding one or more AAV Rep proteins,
(b) Cap nucleotide sequence encoding one or more AAV clade F capsid proteins according to any one of claims 119 to 131.
(c) It comprises the modified genome according to any one of claims 70 to 118, 132, and 133, and is effective for encapsulating the modified genome in the capsid in the cell to form the AAV. , Packaging system. The packaging system according to claim 135, which comprises a first vector containing the Rep nucleotide sequence and the Cap nucleotide sequence, and a second vector containing the modified genome. The packaging system according to claim 135 or 136, wherein the Rep nucleotide sequence encodes an AAV2 Rep protein. The packaging system according to claim 137, wherein the AAV2 Rep protein is 78/68 or Rep 68/52. The AAV2 Rep protein comprises an amino acid sequence having the smallest percent sequence identity to the AAV2 Rep amino acid sequence of SEQ ID NO: 22, the smallest percent sequence identity is the length of the amino acid sequence encoding the AAV2 Rep protein. The packaging system according to claim 137 or 138, which is at least 70%. The packaging system according to any one of claims 136 to 139, further comprising a third vector, wherein the third vector is a helper viral vector. The packaging system according to claim 140, wherein the helper virus vector is an independent third vector. The packaging system according to claim 140, wherein the helper virus vector is integrated with the first vector. The packaging system according to claim 140, wherein the helper virus vector is integrated with a second vector. The packaging system according to any one of claims 140 to 143, wherein the third vector contains a gene encoding a helper virus protein. The packaging system according to any one of claims 140 to 144, wherein the helper virus is selected from the group consisting of adenovirus, herpesvirus, vaccinia virus, and cytomegalovirus (CMV). The packaging system according to claim 145, wherein the helper virus is an adenovirus. The packaging system according to claim 146, wherein the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4 and VA. The packaging system according to claim 145, wherein the helper virus is a herpes simplex virus (HSV). The packaging system of claim 148, wherein the HSV genome comprises one or more of the HSV genes selected from the group consisting of UL5 / 8/52, ICPO, ICP4, ICP22 and UL30 / UL42. The packaging system according to any one of claims 140 to 149, wherein the first vector and the third vector are contained in the first transfect plasmid. The packaging system according to any one of claims 140 to 149, wherein the second vector and the nucleotides of the third vector are contained in the second transfect plasmid. The packaging system according to any one of claims 140 to 149, wherein the nucleotides of the first vector and the third vector are cloned into a recombinant helper virus. The packaging system according to any one of claims 140 to 149, wherein the nucleotides of the second vector and the third vector are cloned into a recombinant helper virus. The method for recombinant preparation of replication-deficient AAV, according to any one of claims 135 to 153, under conditions effective for encapsulating the modified genome in the capsid to form the AAV. The method comprising the step of introducing the packaging system of the above into cells.

Images