JP2021182940A - METHODS FOR QUANTITATIVE GENETIC ANALYSIS OF CELL FREE DNA (cfDNA) - Google Patents

Abstract

To provide methods for quantitative genetic analysis of cell free DNA (cfDNA).SOLUTION: The invention provides a method for genetic analysis in individuals that reveals both the genetic sequences and chromosomal copy number of targeted specific genomic loci in a single assay. The present invention further provides methods for sensitive specific detection of target gene sequences and gene expression profiles. In various embodiments, methods for genetic analysis of cell-free DNA (cfDNA) comprise treating cfDNA with one or more end-repair enzymes to generate end-repaired cfDNA.SELECTED DRAWING: None

Description

Description of Sequence Listing The sequence listings relevant to this application are provided in text form instead of paper copies and are incorporated herein by reference. The name of the text file including the sequence listing is CLFK_002_00US_ST25. It is txt. This text file is 117KB, created on August 22, 2014, and is submitted electronically via EFS-Web.

Background The present invention generally relates to compositions and methods for quantitative gene analysis of cell-free DNA (cfDNA). In particular, the invention relates to improved targeted sequence capture compositions and methods for gene characterization and analysis of cfDNA.

Description of Related Techniques It is becoming increasingly clear that most, if not all, of the most common human cancers are diseases of the human genome. The fact that somatic mutations accumulate during the life of an individual, some of which increase the probability that cells carrying them can develop into tumors (Vogelstein et al., Science 339 (6127)) is becoming apparent. ): Pages 1546 to 1558 (20)
13 years)). Those in a precancerous state with a very bad combination of accumulated mutational events lose the constraint of suppressing unlimited growth and the resulting cell mass becomes cancerous. The various mutations that are necessary and sufficient to cause cancer are often collectively referred to as "driver mutations." One of the themes that has emerged from recent thorough molecular analysis is that cancer, once thought to be a single tissue-specific disease, is actually a group of related diseases, each with its own unique molecular pathology. It means that there is. The Human Genome Project laid the foundation for genome-wide analysis of cancer.

For example, the introduction of next-generation sequencing technology (as of 2004) has accelerated the rate of discovery of causative genomic factors that underlie the diagnosis of NSCLC, resulting in NSCLC being actually a different targeted therapy. It has become clear that it is a family of related diseases that can respond.

There is no reliable and robust molecular analysis method in the art for the analysis of genetic disorders. Traditionally, molecular diagnostics consist of antibody-based tests (immunohistochemistry), in situ hybridization using DNA probes (fluorescent in situ hybridization), and hybridization or PCR-based tests that query specific nucleotide sequences. Until recently, DNA sequencing as a molecular diagnostic tool was generally limited to coding exons of one or two genes. DNA sequencing has been used in the diagnosis and treatment of solid tumors, but one of the most significant drawbacks of these methods is that they require direct access to tumor tissue. Such materials are often difficult to obtain from the initial biopsy used to diagnose the disease, and it is virtually impossible to obtain them over and over again over time. Similarly, biopsy is not possible in patients with inaccessible tumors and is not feasible for individuals suffering from metastatic disease.

Therefore, a huge amount of molecular diagnostics for genetic disorders, fetal testing, paternity testing, prediction of response to drug treatment, diagnosis or monitoring of pathological conditions, Mendel-type genetic disorders, genetic mosaics, pathogen screening, microbiome profiling and organ transplant monitoring. The possibilities have not yet been realized. To date, existing molecular diagnostic approaches do not have an efficient solution for cloning and amplification of individual DNA molecules, sufficient to distinguish between false positive signals and true positive test results that occur during sample processing. There is also no solution for efficient targeting of sequencing to specific genomic loci with sensitivity.

Vogelstein et al., Science 339 (6127): 1546-1558 (2013)

The present invention generally relates to compositions and methods for improved compositions and methods for genetic analysis of cfDNA.

In various embodiments, a method for gene analysis of cell-free DNA (cfDNA), the step of treating cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA, each of terminal repair cfDNA. The step of ligating one or more adapters to the ends to generate a cfDNA library, the step of amplifying the cfDNA library to generate a cfDNA library clone, and the step of determining the number of genomic equivalents in the cfDNA clone library. , And a method comprising performing a quantitative gene analysis of one or more target gene loci in the cfDNA library clone.

In certain embodiments, the method further comprises the step of isolating cfDNA from the biological sample of interest.

In additional embodiments, the cfDNA is from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, ophthalmic fluid, urine, saliva, feces, mucous and sweat. Be isolated.

In certain embodiments, the one or more adapters comprises a plurality of adapter types.

In certain embodiments, each of the adapters or adapters comprises a primer binding site for amplification of the cfDNA library.

In a further embodiment, each of the one or more adapters comprises one or more unique read cords.

In additional embodiments, each of the adapters or adapters comprises one or more sample codes for sample multiplexing.

In another embodiment, each of the adapters or adapters comprises one or more sequences for DNA sequencing.

In certain embodiments, qPCR is performed on the cfDNA clone library and the qPCR measurements are compared to a standard of known genomic equivalents to determine the genomic equivalent of the cfDNA clone library.

In another particular embodiment, qPCR is performed with a primer that binds to the Alu sequence and a primer that binds to the sequence in the adapter.

In certain embodiments, quantitative gene analysis is performed on multiple gene loci in the cfDNA library clone.

In a further embodiment, quantitative gene analysis is performed on multiple gene loci in multiple cfDNA clone libraries.

In additional embodiments, quantitative gene analysis involves hybridizing one or more capture probes to the target gene locus to form a capture probe-cfDNA clone complex.

In certain embodiments, quantitative genetic analysis comprises isolating a capture probe-cfDNA clone complex.

In certain embodiments, quantitative genetic analysis involves amplification of the cfDNA clone sequence in an isolated hybridized capture probe-cfDNA clone complex.

In a further embodiment, the quantitative gene analysis comprises DNA sequencing to generate multiple sequencing reads.

In another embodiment, the quantitative genetic analysis comprises a bioinformatic analysis of multiple sequencing leads.

In certain embodiments, bioinformatics analysis is used to quantify the number of genomic equivalents analyzed in a cfDNA clone library, to detect gene variants at a target gene locus, to detect mutations within a target gene locus. , Used to detect gene fusions within the target gene locus, and to measure the increase or decrease in the number of copies within the target gene locus.

In additional embodiments, the subject does not have a genetic disorder.

In certain embodiments, the subject has not been diagnosed with a genetic disorder.

In another particular embodiment, the subject has been diagnosed with a genetic disorder.

In another embodiment, quantitative genetic analysis is used to identify or detect one or more genetic lesions that cause or are associated with a genetic disorder.

In certain embodiments, genetic lesions include nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy count changes, or gene fusions.

In certain embodiments, the genetic lesion comprises a genomic rearrangement that fuses the 3'coding region of the ALK gene to another gene.

In certain embodiments, the 3'coding region of the ALK gene is fused to the EML4 gene.

In another embodiment, the genetic disorder is cancer.

In a further embodiment, the subject is pregnant.

In additional embodiments, quantitative genetic analysis is used to identify or detect one or more genetic variants or lesions of one or more target gene loci in fetal cfDNA.

In certain embodiments, the subject is a transplant recipient.

In additional embodiments, quantitative genetic analysis is used to identify or detect donor cfDNA in the subject.

In various embodiments, a method of predicting, diagnosing or monitoring a genetic disorder in a subject, the step of isolating or obtaining cfDNA from a biological sample of subject, treating cfDNA with one or more terminal repair enzymes. Step to generate terminal repair cfDNA, step to ligate one or more adapters to each end of terminal repair cfDNA to generate cfDNA library, step to amplify cfDNA library to generate cfDNA clone library, cfDNA One or more, including the step of determining the number of genomic equivalents in the clone library and the step of performing quantitative genetic analysis of one or more target gene loci associated with the genetic disorder in the cfDNA clone library. Identification or detection of one or more genetic lesions at a target gene locus provides a method of predicting the prognosis of a genetic disorder, diagnosing it, or monitoring its progression.

In additional embodiments, cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, ophthalmic fluid, urine, saliva, feces, mucus and sweat. ..

In certain embodiments, genetic lesions include nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy count changes, or gene fusions.

In certain embodiments, the genetic lesion comprises a genomic rearrangement that fuses the 3'coding region of the ALK gene to another gene.

In a further embodiment, the 3'coding region of the ALK gene is fused to the EML4 gene.

In certain embodiments, the genetic disorder is cancer.

In various embodiments, a companion diagnostic of a genetic disorder, the step of isolating or obtaining cfDNA from a biological sample of interest, the step of treating cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA. , A step of ligating one or more adapters to each end of the terminal repair cfDNA to generate a cfDNA library, a step of amplifying the cfDNA library to generate a cfDNA clone library, a genomic equivalent in the cfDNA clone library. Detection of at least one of the biomarkers, including the step of determining the number of biomarkers and the step of performing quantitative genetic analysis of one or more biomarkers associated with the genetic disorder in the cfDNA clone library. Or undetectable provides a companion diagnostic that indicates whether the subject should be treated for a genetic disorder.

In certain embodiments, cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, ophthalmic fluid, urine, saliva, feces, mucus and sweat. ..

In additional embodiments, the biomarker is a genetic lesion.

In certain embodiments, genetic lesions include nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy count changes, or gene fusions.

In additional embodiments, the genetic lesion comprises a genomic rearrangement that fuses the 3'coding region of the ALK gene to another gene.

In a further embodiment, the 3'coding region of the ALK gene is fused to the EML4 gene.

In certain embodiments, the genetic disorder is cancer.

FIG. 1 shows the expected vs. observed variant frequency as a function of mixed dilution in the absence of unique read filtering. Random base changes at these four selected positions occurred at measurable non-zero frequencies in the absence of unique read filtering. This proves the lack of sensitivity to detect a particular single nucleotide variant (SNV).

FIG. 2 is a diagram showing filtering of unique reads performed on the data generated in FIG. 1. The left-hand panel shows the data from FIG. 1 for BRAF I326T SNV without filtering of unique reads. The right-hand panel shows that the use of unique read filtering of the same data increased assay sensitivity and made it possible to distinguish between true signals and error-causing noise.

FIG. 3 is a diagram showing capture probe performance as a function of length and wash temperature. The y-axis shows the total number of reads associated with each capture probe. The bars in the bar graph are divided into two categories, the white bars correspond to the on-target reads aligned to the intended capture probe target, and the black bars correspond to the unintended regions of the genome associated with the capture probe. Indicates the off-target read to be mapped. Overall, the 40mer and 60mer capture probes function substantially the same in washes at 44 ° C and 47 ° C. For washing at 50 ° C., the 40mer capture probe functions irregularly. These data justify the use of the 40mer capture probe at wash temperatures ranging from about 44 ° C to about 47 ° C.

FIG. 4 is a schematic diagram of targeted and oriented sequencing of the 19th intron of the ALK gene. A) In the "wild-type" reference sequence, an antisense-oriented ALK capture probe identifies the sequence from the 19th intron. B) For pathogenic fusion genes, some ALK capture probes will identify junction sequences associated with the gene fusion event.

FIG. 5 is a schematic diagram of a high density capture probe arrangement for complete sequencing of target regions. Each capture probe captures a set of sequences that provide cumulative coverage at each base position. Here, coverage is represented by a line, the amplitude of which line indicates the depth of coverage from a particular capture probe. Overlapping coverage from adjacent capture probes provides complete sequencing of target areas in both possible directions. In addition, the head-to-head arrangement of the capture probes on the opposing chains ensures that all capture probe binding sites are sequenced.

FIG. 6 is a diagram showing a representative example of the size distribution of the fragmented DNA used for constructing the library.

FIG. 7 is a diagram showing the performance of a high-density 40mer capture probe in a representative experiment. The y-axis shows the total number of leads, which are divided into on-target leads, off-target leads and unmapping leads. The x-axis enumerates each of the 105 capture probes used in this experiment for sequence capture.

FIG. 8 is a diagram showing a representative example of cumulative coverage of a target region using a high-density 40mer capture probe. Shown here is the cumulative coverage of TP53 coding exons.

FIG. 9A is a diagram showing a representative example of the size distribution of a cell-free DNA (cfDNA) library. The major band coincides with a group of 170 ± 10 bp fragments ligated to a 90 bp adapter. FIG. 9B shows a published gel image of cfDNA and a representative cfDNA library generated using the methods disclosed and / or contemplated herein. The appearance of the qualitative "ladder" is stored in the library, but the library is shifted to a higher mass by the addition of a 90bp adapter sequence. FIG. 9C is a diagram showing representative examples of genomic and plasma-derived cfDNA libraries from ovarian cancer patients (OvC) and "healthy donors" (HD).

FIG. 10 shows the number of unique reads across eight cfDNA libraries from four plasma samples. Fragmentation prior to library construction using this sample 23407 increased library yield more than 2-fold.

FIG. 11 is a diagram showing representative read coverage of cfDNA over the entire region of the TP53 gene. "TP53_NM_000546_chr17: 7579351: region_3: 280nt: 41: 80: r" Twenty-four 131bp reads captured by the capture probe (SEQ ID NO: 201) were randomly selected and aligned using the BLAT algorithm within the UCSC Genome Browser. .. Twenty-one reads are mapped to the target area and so in a pattern of overlapping coverage. Arrows are attached to the probes used to capture these leads.

FIG. 12 is a diagram illustrating the outline of targeted DNA sequencing of the coding region of the TP53 gene from the cfDNA genomic library. Coverage (horizontal axis) extends across all 10 coding regions and contains intron regions involved in mRNA splicing. Sequencing depth (vertical axis) reaches up to 4851 and is uniform across all coding exons.

FIG. 13 shows a plot of unique read numbers for qPCR estimated genomic equivalents in an ACA2-based assay. The qPCR measurement value is shown on the X-axis with respect to the number of reads on the Y-axis. The perfect match between these measurements is shown diagonally. Correlation between measurements was very poor, if any, especially at lower genomic inputs. These data indicate that the ACA2-based qPCR assay chronically underestimates library complexity and is unsuitable for measuring genomic equivalents.

FIG. 14 is a schematic diagram of the core elements of a qPCR genome equivalence assay paired with a genomic repeat-specific primer (eg, Alu) and a long adapter-specific primer. (A) Standard library amplification using a single 25nt primer (primer 1) named ACA2. The 58nt version of the ACA2 primer (primer 2), which is longer than (B), does not amplify the genomic library due to stem-loop inhibition. (C) Consensus Forward and reverse primers (primers 3 and 4) directed to the human Alu repeat element recognize thousands of loci and easily amplify genomic DNA. (D) A single single Alu primer (primer 3 or primer 4) paired with a long ACA2 primer (primer 2), either forward or reverse, does not amplify genomic DNA. (E) The same primer pair as in (D) facilitates amplification of genomic cfDNA library clones containing the Alu sequence.

FIG. 15 is a diagram showing proof-of-concept data for a genomic equivalent Alu Plus adapter-based qPCR assay. (A) Amplification of a 10 pg standard genomic library with various PCR primers. The x-axis identifies the PCR primers used for amplification and the Y-axis (log scale) indicates the measured PCR signal in units of fg / μL. The standard ACA2 primer, as expected, produced a strong signal. The ACA2 long primer was unable to generate a signal due to PCR suppression. Both of the two Alu primer pairs generated a signal at 1% of the ACA2 amount. This suggests that 1% of the clones have an amplifyable Alu sequence. The combination of the long ACA2 primer and any Alu primer also produced a signal in about 1% of the clones. (B) Verification of 10 pg genomic DNA (4 samples on the left side) or 10 pg library DNA (4 clones on the right side). The Alu primer pair amplifies the equivalent signal from genomic DNA or genomic library. In contrast, a primer pair consisting of an Alu primer and a long ACA2 primer does not amplify genomic DNA very much (L + A1F) or does not amplify it at all (L + A1R). These same pairs show library amplification that slightly exceeds the signal from the Alu primer pair.

FIG. 16 is a diagram showing a direct comparison between the ACA2 primer qPCR assay and the Alu-ACA2 long-primer qPCR assay. The Alu ACA2 long-primer qPCR assay shows an 8-fold increase in detectable genomic equivalents that is more consistent with the number of unique reads derived from the sequencing data.

FIG. 17 is a diagram showing representative examples of the adapter structure and function of a highly sensitive, quantitative gene assay that accurately determines the genomic equivalent to be analyzed. (A) Detailed structure of the adapter ligation chain. Details of each numbered element are provided in Example 4. (B) The double strand formed by the 45 nt ligation strand and the 12 nt partner oligo strand produces a blunt-ended ligation substrate compatible with the terminal-repaired cfDNA fragment (black bar). (C) After ligation, a complement of the ligation strand is produced by a DNA polymerase-mediated fill-in reaction.

FIG. 18 is a diagram showing a representative example of the size distribution of two DNA samples (NA06994 and NCI-H2228) treated to mimic cfDNA.

FIG. 19 is a diagram showing a representative example of the detection sensitivity ^{of the TP53 point mutation Q331 *} in the tumor sample DNA (H2228) mixed with the normal genomic DNA (N). The most sensitive detection corresponds to about 1 mutant copy of TP53 out of 1000 normal copies of the gene.

FIG. 20 shows the exact determination of junction sequences for the EML4-ALK fusion gene within cell line NCI-H2228 using the compositions and methods contemplated herein.

FIG. 21 is a diagram showing the detection of EML4-ALK fusion gene tumor sample DNA (H2228) mixed with normal genomic DNA (N). Since this fusion is present as a heterozygot in the NCI-H2228 cell line, the most sensitive detection corresponds to one gene fusion out of about 100 normal chromosome copies of the ALK gene (50 genomic equivalents). ..

FIG. 22 shows the detection of MYCN gene amplification in a mixture of cell lines NCI-H69 (H69) diluted to normal human DNA (N). The thresholds for the two normal diploid copies are shown as dashed red lines.

FIG. 23 is a diagram showing DNA mutations detected in the TP53 gene of three different cancer patients. The normative genetic model is shown at the top of the figure. Peaks represent DNA sequence coverage (X-axis) and depth (Y-axis). Sequencing depth was> 4000 genomic equivalents for all samples analyzed. The magnified view of the 7th exon below the genetic model shows the location where all the detected mutations are localized. The frequency of mutation detection in cfDNA (plasma), tumor tissue and normal adjacent tissues, if available, is shown (NA-not available). OVA1 and OVA2 are patients with ovarian cancer, and CRC406 and CRC407 are patients with colorectal cancer. No mutations in TP53 were found in any of the OVA1 samples.

FIG. 24 is a diagram showing DNA sequencing of a larger 13 gene panel (enclosed in a square). This sequencing identified KRAS mutations in cfDNA and tumors from ovarian cancer patient OVA1.

FIG. 25 is a diagram showing DNA sequencing of a larger 12 gene panel. This sequencing identified ERBB2 gene amplification in the plasma of colorectal cancer patient CRC407.

A. The present invention, in part, contemplates compositions and methods for quantitative genetic analysis of the genetic status of individuals using cell-free DNA (cfDNA). As used herein, the term "genetic state" refers to one or more target genomic sequences in a genome that are related to or are related to a normal sequence that is not causative for a hereditary state or genetic disorder. Refers to an array. In one embodiment, analysis of genetic status refers to the identification, quantification or monitoring of a gene variant at a target gene locus, where the variant differs relative to a reference sequence (eg, normal or mutated sequence). We relate to the lack of sensitivity to distinguish true positives from false positives, inefficient cloning and amplification of individual DNA molecules, and inefficient targeting of sequencing to specific genomic loci. Provided a solution to molecular diagnostic problems of hereditary status or genetic disorders. The solution contemplated herein is a composition for reliable and robust quantitative gene analysis that is sensitive enough to distinguish between false positive signals and true positive test results that occur during sample processing. And methods included.

Next-generation sequencing technology offers the opportunity to add extensive genomic research to molecular diagnostics in a variety of scenarios, including cancer, fetal diagnosis, paternity testing, pathogen screening and organ transplant monitoring. In the context of genetic disease, next-generation sequencing information is used to identify mutations in genes that are likely to alter gene function, to identify increases or decreases in intracellular genetic material, and to identify normal. It is used clinically to identify genomic rearrangements not found in healthy cells. The results of these extensive diagnostic studies are often used to derive patient treatment.

However, the need to reach the affected tissue directly to obtain a sample outweighs the potential benefits of DNA sequencing in the diagnosis and treatment of an individual's genetic or hereditary status or genetic disease. Such materials are often difficult to obtain from the initial biopsy used to diagnose the disease, and it is virtually impossible to obtain them over and over again over time. Similarly, in the case of cancer patients, biopsy is not possible in patients with inaccessible tumors and is not feasible for individuals suffering from metastatic disease. In contrast, our approach derives from the fact that all tissues require access to vasculature for survival, and as a result these clumps deposit DNA in body fluids. One major reservoir of body fluid in which the DNA of affected cells can be found is the plasma of human blood.

In contrast to test methods that rely on shallow genome-wide sequence coverage, individual genetic status, genetic disorders, Mendel-type genetic disorders, genetic mosaics, fetal studies, parent-child identification, prediction of response to drug treatment, diagnosis or monitoring of pathology. The molecular diagnostics contemplated herein for pathogen screening, microbiome profiling, and organ transplant monitoring leverage the availability of cfDNA to provide deep sequence coverage of selected target genes. In addition, cfDNA-based cancer diagnostics contemplated herein include somatic cell sequence changes that alter protein function, large-scale chromosomal reorganizations that result in chimeric gene fusions, and copy reductions or increases in gene copy. It has the ability to detect various genetic changes, including number fluctuations. With the intended compositions and methods, these are despite a significant dilution of normal sequences in cfDNA or a mixture of such normal sequences, which is contributed by the normal turnover process that occurs in healthy tissue. Changes can be detected and quantified. The compositions and methods contemplated herein are the major challenges associated with the detection of low frequency genetic changes responsible for disease: highly fragmented cfDNA, between individuals with different cfDNA levels. It also copes well with the fact that it is substantially different and that the mix of diseased sequences with respect to normal sequences is highly variable between patients, even among individuals suffering from the same molecular disease and stage. ..

In various embodiments, compositions and methods for genetic analysis include examining DNA fractions in biofluid and stool samples. The methods contemplated herein provide a novel comprehensive framework for addressing molecular genetic analysis using cfDNA available from a variety of biological sources. Cloning of purified cfDNA introduces a tagged cfDNA sequence that provides information for downstream analysis and allows amplification of the resulting clone library. Hybrid capture with target-specific oligonucleotides is used to search for specific sequences for subsequent analysis. Independent measurements of the number of genomes present in the library are applied to each sample, and these assays provide a means for estimating the sensitivity of that assay. Assays contemplated herein provide a reliable, reproducible, robust method for analyzing, detecting, diagnosing or monitoring a genetic state, hereditary state or genetic disorder.

Implementation of a particular embodiment of the invention is within the scope of the art of the art, chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, unless otherwise contradictory. Traditional methods of chemistry, immunology and cell biology will be utilized, many of which are described below for illustration. Such techniques are well described in the literature. For example, Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition, 2001); Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd edition, 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982). ); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, revised July 2008); Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub.Associates and Wiley-Interscience; Glover , DNA Cloning: A Practical Approach, Volumes I and II (IRL Press, Oxford, 1985); Anand, Techniques for the Analysis of Complex Genomes (Academic Press, New York, 1992); Transcription and Translation (B. Hames and S. Higgins, 1984); Perbal, A Practical Guide to Molecular Cloning (1984); and Harlow and Lane, Antibodies
(Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998
Year).

B. Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Any method and material similar to or equivalent to that described herein may be used in the practice or testing of the invention, but preferred embodiments of the composition, method and material are described herein. For the present invention, the following terms are defined below.

The articles "a," "an," and "the" are used herein to refer to one or more (ie, at least one) of the grammatical objects of the article. As an example, "an element" means one element or more than one element.

It should be understood that the use of choices (eg, "or") means either, both, or any combination of choices.

It should be understood that the term "and / or" means one or both of the choices.

As used herein, the term "about" or "approximate" refers to 15%, 10%, weight or length to a reference quantity, level, value, number, frequency, percentage, dimension, size, quantity, weight or length. 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% variable quantity, level, value, number, frequency, percentage, dimension, size, quantity, weight or length Point to. In one embodiment, the term "about" or "approximate" is ± 15%, ± 10%, ± 9 for reference quantity, level, value, number, frequency, percentage, dimension, size, quantity, weight or length. %, ± 8%, ± 7%, ± 6%, ± 5%, ± 4%, ± 3%, ± 2% or ± 1% quantity, level, value, number, frequency, percentage, dimension, size, Refers to a range of quantity, weight or length.

Throughout this specification, the terms "comprise", "comprises" and "comprising" are stated, except where the context requires other meanings. It will be understood to imply the inclusion of a step or element or step or group of elements, but not the exclusion of any other step or element or step or group of elements. In certain embodiments, the terms "include", "has", "constains" and "comprise" are used interchangeably.

"Consists of" is intended to include and be limited to whatever follows the phrase "consisting of". Therefore, the phrase "consisting of" indicates that the listed element is required or required, and that no other element can exist.

"Being essential from" is listed after this phrase and is limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure of the listed element. Intended to include all elements. Therefore, the phrase "becomes essential from" is required or required for the listed elements, while the other elements are not optional, but rather for the activity or action of the listed elements. Indicates that may or may not be present, depending on whether or not it affects.

Throughout the present specification, "one embodiment", "an embodiment", "a specific embodiment", "a related embodiment", "a specific embodiment", "an additional embodiment" or "a further embodiment" or References to these combinations mean that the particular features, structures or properties described in connection with that embodiment are included in at least one embodiment of the invention. Therefore, the appearance of the above clauses at various points throughout the specification does not necessarily refer to the same embodiment. In addition, specific features, structures or properties may be combined in any suitable manner in one or more embodiments.

As used herein, the term "isolated" means a substance in its native state that is normally or essentially free of associated components. In certain embodiments, the term "obtained" or "derived from" is used synonymously with isolated.

As used herein, the term "DNA" refers to deoxyribonucleic acid. In various embodiments, the term DNA refers to genomic DNA, recombinant DNA, synthetic DNA or cDNA. In one embodiment, DNA refers to genomic DNA or cDNA. In certain embodiments, the DNA comprises a "target region". The DNA libraries contemplated herein include genomic DNA libraries and cDNA libraries constructed from RNA (eg, RNA expression libraries). In various embodiments, the DNA library comprises one or more additional DNA sequences and / or tags.

The "target gene locus" or "DNA target region" refers to a region of interest within a DNA sequence. In various embodiments, the targeted gene analysis is performed on the target gene locus. In certain embodiments, the DNA target region is a particular genetic state, hereditary state, genetic disorder, fetal test, genetic mosaic, parent-child identification, prediction of response to drug treatment, diagnosis or monitoring of pathology, microbiome profiling, pathogens. A region of genes related to screening or organ transplant monitoring.

As used herein, the terms "circulating DNA," "circulating cell-free DNA," and "cell-free DNA" are often used interchangeably and are extracellular DNA, DNA, extruded from cells. DNA, or DNA released from necrotic or apoptotic cells.

As used herein, "subject," "individual," or "patient" includes any animal that exhibits symptoms of a condition that can be detected or identified in the compositions herein. Suitable subjects include laboratory animals (eg mice, rats, rabbits or guinea pigs), livestock (eg horses, cows, sheep, pigs), and domestic animals or pets (eg cats or dogs). In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a non-human primate, and in a preferred embodiment, the subject is a human.

C. Methods for Gene Analysis of Cell-Free DNA In various embodiments, methods for gene analysis of cfDNA are provided.

In certain embodiments, methods for gene analysis of cfDNA include the steps of generating and amplifying a cfDNA library, determining the number of genomic equivalents in the cfDNA library, and one or more genomic target loci. Includes steps to perform quantitative genetic analysis of.

The method for gene analysis of cfDNA is to treat cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA and ligate one or more adapters to each end of the terminal repair cfDNA to ligate the cfDNA live. A step to generate a rally, a step to amplify the cfDNA library to generate a cfDNA library clone, a step to determine the number of genomic equivalents of the cfDNA library clone, and one or more target genes in the cfDNA library clone. Includes steps to perform quantitative genetic analysis of the sitting position.

1. 1. Generation of cfDNA Library In certain embodiments, the methods of genetic analysis contemplated herein are the steps of treating cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA, and terminal repair cfDNA. Includes a step to generate a cfDNA library, comprising ligating one or more adapters to each end of the to generate a cfDNA library.

(A) Cell-free DNA (cfDNA)
The methods and compositions contemplated herein use acellular DNA (cfDNA) as an analyte for genetic status, hereditary status, genetic disease, genetic mosaic, fetal diagnosis, paternity testing, microbiome profiling, pathogens. Designed to efficiently analyze, detect, diagnose and / or monitor screening and organ transplant monitoring. The size distribution of cfDNA ranges from about 150 bp to about 180 bp fragments. Fragmentation can be the result of endonuclease cleavage activity and / or exonuclease cleavage activity, presenting a daunting task for accurate, reliable and robust analysis of cfDNA. Another challenge in the analysis of cfDNA is its short half-life in the bloodstream of about 15 minutes. Although not bound by any particular theory, the present invention, in part, is such that the analysis of cfDNA is like "liquid biopsy" and is part of the current biological process. Intended to be a real-time snapshot.

In addition, cfDNA is not found intracellularly and can be obtained from several suitable sources, including but not limited to biofluids and fecal samples, for next-generation sequencing analysis such as direct access to the tissue to be analyzed. Not subject to the existing restrictions that bother you.

Examples of biofluids that are suitable sources for isolating cfDNA in certain embodiments include amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, ophthalmic fluid, urine, saliva, mucus and Sweat is mentioned, but not limited to these.

In certain embodiments, the biological fluid is blood or plasma.

In certain embodiments, commercially available kits and other methods known to those of skill in the art are used to obtain, for example, freeze and / or EDTA, EGTA, or divalent cations from the patient's biofluid or previously. CfDNA can be isolated directly from biological samples that are optionally stabilized by the addition of enzyme chelating agents that include, but are not limited to, other chelating agents that are specific to.

(B) Generation of end-repaired cfDNA In certain embodiments, generation of the cfDNA library comprises end-repair of isolated cfDNA. Fragmented cfDNA is treated with a terminal repair enzyme to produce terminal repair cfDNA with a blunt end, 5'-overhang or 3'-overhang. In some embodiments, the terminal repair enzyme can be produced, for example. In some embodiments, the terminal repair cfDNA contains a blunt end. In some embodiments, the terminal repair cfDNA is processed to contain a blunt end. In some embodiments, the blunt ends of the terminal repair cfDNA are further modified to contain a single base pair overhang. In some embodiments, terminal repair cfDNA containing blunt ends can be further treated to contain an adenine (A) / thymine (T) overhang. In some embodiments, the blunt-ended terminal repair cfDNA can be further treated to contain an adenine (A) / thymine (T) overhang as a single base pair overhang. In some embodiments, the terminal repair cfDNA has an untemplated 3'overhang. In some embodiments, the terminal repair cfDNA is processed to contain a 3'overhang. In some embodiments, the terminal repair cfDNA is treated with terminal transferase (TdT) to contain a 3'overhang. In some embodiments, the G-tail can be added by TdT. In some embodiments, the terminal repair cfDNA is treated to contain an overhang terminal using partial digestion with any known restriction enzyme (eg, with the enzyme Sau3A, etc.).

(C) Ligation of adapter molecule to terminal repair cfDNA In certain embodiments, generation of the cfDNA library comprises ligation of one or more adapters to each terminal of the terminal repair cfDNA. The present invention, in part, contemplates an adapter module designed to accommodate a large number of genomic equivalents in a cfDNA library. The adapter module is configured to measure the sensitivity of the sequencing assay used to identify sequence mutations by the number of genomic equivalents present in the cfDNA library, and its extension.

As used herein, the term "adapter module" refers to at least five elements: (i) a first element containing a PCR primer binding site for amplification of a single primer library, (ii) uniquely identified. A second element containing a 5-nucleotide read code acting on each sequenced read, (iii) a third element containing a 3-nucleotide sample code to identify different samples and allow sample multiplexing during the sequencing run. Element 3, (iv) a fourth element containing a 12 nucleotide anchor sequence, which allows calibration of the proper base call in the sequencing read and acts as an anchor for hybridization to the partner oligonucleotide, and (V) Refers to a polynucleotide comprising a fifth element (FIGS. 17 and Tables 12-16) comprising two 3'terminal nucleotides of element 4. The adapter module is hybridized to a partner oligonucleotide that is complementary to element 4 to form an adapter suitable for ligation to the ends of cfDNA, optionally repaired and blunt-ended cfDNA.

In certain embodiments, the adapter module is one or more PCR primer sequences, one or more read codes, one or more sample codes, one or more anchor sequences, and an efficient ligation substrate. Contains 2 or more 3'nucleotides. In additional embodiments, the adapter module further comprises one or more sequencing primer binding sites.

In certain embodiments, the adapter module comprises a first element containing one or more PCR primer binding sequences for single primer amplification of the cfDNA library. In one embodiment, the PCR primer binding sequence is about 12 to about 40 nucleotides, about 18 to about 40 nucleotides, about 20 to about 35 nucleotides, or about 20 to about 30 nucleotides. In another embodiment, the PCR primer binding sequence is about 12 nucleotides, about 13 nucleotides, about 14 nucleotides, about 15 nucleotides, about 16 nucleotides, about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, about 20 nucleotides, about 21. Nucleotides, about 22 nucleotides, about 23 nucleotides, about 24 nucleotides, about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, About 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, or about 40 nucleotides or more.

In one embodiment, the PCR primer binding sequence is about 25 nucleotides.

In certain embodiments, the adapter module comprises a second element that includes one or more readcode sequences. As used herein, the term "read code" refers to a polynucleotide used to identify a unique sequencing read. In one embodiment, the read code is a random sequence of nucleotides. In one embodiment, the readcode is about 1 nucleotide, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides, about 5 nucleotides, about 6 nucleotides, about 7 nucleotides, about 8 nucleotides, about 9 nucleotides, about 10 nucleotides or the like. It's super.

As a non-limiting example, the 5 nucleotide code consists of 256 possible unique sequences, and each code selected here is 2 nucleotides different from all other codes in the set. This feature makes it possible to distinguish between unique and distinct reads and reads that appear unique due to sequencing errors in the code area. In certain embodiments, due to a particular sequence combination, codes that are experimentally determined to interfere with adapter function may be excluded from use, for example, 7 of 256 codes have an excess of G nucleotides. I excluded it because it was presented.

In other embodiments, each read code of 5, 6, 7, 8, 9, 10 or more nucleotides may differ from all other read codes by 2, 3, 4 or 5 nucleotides.

In one embodiment, the read code is about 5 nucleotides, which is 2 nucleotides different from all other read codes.

In certain embodiments, the adapter module comprises a third element containing one or more sample coding sequences. As used herein, the term "sample code" refers to a polynucleotide used to identify a sample. The sample code is also useful for establishing multiple sequencing reactions. This is because each sample code is unique to the sample and therefore each sample code can be used to identify leads from a particular sample in a multisequencing reactant.

In one embodiment, the sample code comprises a sequence that is about 1, about 2 nucleotides, about 3 nucleotides, about 4 nucleotides or about 5 nucleotides or more. In another embodiment, each sample code of 2, 3, 4, 5 or more nucleotides may differ from all other sample codes by 2, 3, 4 or 5 nucleotides.

In one embodiment, the sample code is about 3 nucleotides, which is 2 nucleotides different from all other sample codes used for other samples.

In certain embodiments, the adapter module comprises a fourth element that includes one or more anchor arrays. As used herein, an "anchor sequence" is a nucleotide sequence of at least 8 nucleotides, at least 10 nucleotides, at least 12 nucleotides, at least 14 nucleotides, or at least 16 nucleotides, hybridizing to a partner oligonucleotide and below. Refers to a nucleotide sequence containing the three properties of: (1) Each anchor sequence is part of a family of four anchor sequences that collectively represent each of the four potential DNA bases at each site within the extension. (This feature, balanced base presentation, is useful for calibrating proper base calling in sequencing reads in certain embodiments), (2) Each anchor sequence has four possible bases. It consists of only two of them and is specifically selected so that they are either the same number of A + C or the same number of G + T (anchor sequences formed from only two bases are proper adapter functions. (3) Since each anchor sequence consists of the same number of A + C or G + T, each anchor sequence is four 1 It shares approximately the same melting temperature and double-stranded stability as all other anchor sequences in the set.

In certain embodiments, the adapter molecule comprises a fifth element consisting of two 3'terminal nucleotides of element 4. These two bases at the 3'end of each anchor are selected based on experimental determination that these two nucleotides are efficient substrates for ligation to cfDNA. In certain embodiments, element 5 comprises a sequence selected from the group consisting of AA, CC, TT and GG. In certain embodiments, element 5 does not include a combination of dinucleotides CG or TG. This is because the present inventors have determined that these combinations are not efficient ligation substrates.

In certain embodiments, the ligation step comprises ligating an adapter module to terminal repair cfDNA to generate a "tagged" cfDNA library. In some embodiments, a single adapter module is utilized. In some embodiments, 2, 3, 4 or 5 adapter modules are utilized. In some embodiments, an adapter module of the same sequence is ligated to each end of the fragmented end repair DNA.

In one embodiment, multiple adapter species are ligated to a terminal repair cfDNA library. Each of the adapters has one or more primer binding sites for amplification of the cfDNA library, one or more read-coding sequences, one or more sequences for sample multiplexing, and DNA sequencing. May contain one or more sequences for.

Ligation of one or more adapters contemplated herein can be performed by methods known to those of skill in the art. In certain embodiments, one or more adapters contemplated herein are ligated to a terminal repair cfDNA containing a blunt end. In certain embodiments, one or more adapters contemplated herein are ligated to a terminal repair cfDNA containing complementary ends suitable for the ligation method used. In certain embodiments, one or more adapters contemplated herein are ligated to a terminal repair cfDNA containing a 3'overhang.

2. 2. cfDNA Library Amplification In certain embodiments, the methods of gene analysis contemplated herein include amplification of a cfDNA clone library or a cfDNA library to generate a library of cfDNA clones. Each molecule of the cfDNA library contains an adapter ligated to each end of the terminal repair cfDNA, and each adapter contains one or more PCR primer binding sites. In one embodiment, different adapters are ligated to different ends of the terminal repair cfDNA.

In a preferred embodiment, the same adapter is ligated to both ends of cfDNA. Ligation of the same adapter to both ends of the terminal repair cfDNA allows PCR amplification with a single primer sequence. In certain embodiments, a portion of the adapter-ligated cfDNA library will be amplified by single primer sequence driven amplification using standard PCR techniques. In one embodiment, the single primer sequence is about 25 nucleotides and optionally has an estimated Tm of 55 ° C. or higher under standard ionic strength conditions.

In certain embodiments, a few picograms of the initial cfDNA library are amplified to a few micrograms of cfDNA clones, which implies a 10,000-fold amplification. The amount of amplification product can be measured using methods known in the art, such as quantification with a Qubit 2.0 or Nanodrop device.

3. 3. Determining the number of genomic equivalents In various embodiments, the method for genetic analysis of cfDNA comprises determining the number of genomic equivalents in the cfDNA clone library. As used herein, the term "genome equivalent" refers to the number of genomic copies in each library. An important challenge addressed by the compositions and methods contemplated herein is to obtain sufficient assay sensitivity for the detection and analysis of infrequent gene mutations or differences in gene sequences. To determine the assay sensitivity value for each sample, the number of different distinct sequences present in each sample is measured by measuring the number of genomic equivalents present in the sequencing library. To establish sensitivity, the number of genomic equivalents must be measured for each sample library.

The number of genomic equivalents can be determined by the qPCR assay or by using bioinformatics-based counting after sequencing. In the clinical sample process flow, genomic equivalent qPCR measurements are used as the QC step in the cfDNA library. The qPCR measurement establishes the expected value of assay sensitivity prior to sequence analysis and the sample can be excluded from the analysis if its corresponding cfDNA clone library lacks the required depth of genomic equivalents. Finally, bioinformatics-based counting of genomic equivalents is also used to identify genomic equivalents for each given cfDNA clone library, and thus assay sensitivity and false negative estimates.

The experimental qPCR assay and the statistical counting assay should correlate well. If sequencing cannot reveal the sequence depth of the cfDNA clone library, reprocessing and / or additional sequencing of the cfDNA clone library may be required.

In one embodiment, genomic equivalents in the cfDNA clone library are determined using a quantitative PCR (qPCR) assay. In certain embodiments, a standard library of known concentrations is used to construct a standard curve, the resulting standard curve is fitted with measurements from the qPCR assay, and genomic equivalent values are derived from the fit. Surprisingly, we have qPCRs that include one primer that specifically hybridizes to a common sequence in the genome, eg, a repeat sequence, and another primer that binds to a primer binding site in the adapter. Repeated sequence-based "assays have been found to measure an 8-fold increase in genomic equivalent compared to methods using only adapter-specific primers (present at both ends of the cfDNA clone). The number of genomic equivalents measured by the repeat sequence-based assay is better with more consistent performance across the libraries and better qPCR estimates of genomic equivalents and tag equivalents counted by bioinformatics in the sequencing run. Bring alignment.

Examples of repetitive sequences suitable for use in the repetitive sequence-based genomic equivalence assay contemplated herein are short interspersed repeats (SINE), such as Alu repetitive sequences; long interspersed repetitive sequences (LINE). Examples include, but are not limited to, LINE1, LINE2, LINE3; microsatellite repetitive sequence elements such as short tandem repeats (STR); simple sequence repeats (SSR); and mammalian wide interspersed repeats (MIR).

In one embodiment, the repetitive sequence is an Alu repetitive sequence.

4. Quantitative Gene Analysis In various embodiments, methods for gene analysis of cfDNA include quantitative gene analysis of one or more target gene loci of the cfDNA library clone. Quantitative gene analysis involves one or more or all of the following steps: capturing a cfDNA clone containing a target gene locus, amplifying a captured target gene locus, capturing and amplifying targeting. Steps for sequencing gene loci and bioinformatic analysis steps for the resulting sequence reads.

(A) Capturing target gene loci The invention is partly designed to maintain the efficiency and reliability of larger probes, but to minimize informative sequence generation in cfDNA clone libraries. The capture probe module is intended. "Capture probe module" refers to a polynucleotide comprising a capture probe sequence and a tail sequence. In certain embodiments, the capture probe module sequence or portion thereof serves as a primer binding site for one or more sequencing primers.

In certain embodiments, the capture probe module comprises a capture probe. As used herein, "capture probe" refers to a region that can hybridize to a specific DNA target region. Since the average size of cfDNA is from about 150 to about 170 bp and is highly fragmented, the compositions and methods contemplated herein are relatively dense and relatively for investigating DNA target regions of interest. Includes the use of short capture probes.

One particular concern with the use of high density capture probes is that capture probes are generally designed using specific "sequence rules". For example, regions of redundant sequences, or regions that exhibit extreme base composition bias, are generally excluded in the design of capture probes. However, we have found that the inflexibility of the capture probe design rules does not substantially affect probe performance. In contrast, capture probes strictly selected by position constraints provide on-target sequence information, show little off-target unmapable read capture, and with only a few exceptions, uniform and useful on-target. Bring the lead. In addition, the high redundancy at close probe spacings more than compensates for capture probes that may not work very well.

In certain embodiments, the target region is targeted by multiple capture probes, wherein any two or more capture probes are within 10 nucleotides of each other, within 15 nucleotides of each other, within 20 nucleotides of each other, and 25 of each other. Designed to bind to target regions within nucleotides, within 30 nucleotides of each other, within 35 nucleotides of each other, within 40 nucleotides of each other, within 45 nucleotides of each other, or within 50 or more nucleotides of each other, and with all intervening nucleotide lengths. ing.

In one embodiment, the capture probe is about 25 nucleotides, about 26 nucleotides, about 27 nucleotides, about 28 nucleotides, about 29 nucleotides, about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about. 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, about 40 nucleotides, about 41 nucleotides, about 42 nucleotides, about 43 nucleotides, about 44 nucleotides, or about 45 nucleotides.

In one embodiment, the capture probe is about 100 nucleotides, about 200 nucleotides, about 300 nucleotides, about 400 nucleotides, or about 100 nucleotides. In another embodiment, the capture probe is from about 100 nucleotides to about 500 nucleotides, from about 200 nucleotides to about 500 nucleotides, from about 300 nucleotides to about 500 nucleotides, or from about 400 nucleotides to about 500 nucleotides, or any intervening thereof. It is a range.

In certain embodiments, the capture probe is not 60 nucleotides.

In another embodiment, the capture probe is substantially smaller than 60 nucleotides, but hybridizes as well as, or better than, to the same extent as a 60 nucleotide capture probe that targets the same DNA target region.

In certain embodiments, the capture probe is 40 nucleotides.

In certain embodiments, the capture probe module comprises a tail sequence. As used herein, the term "tail sequence" refers to a polynucleotide at the 5'end of a capture probe module that can serve as a primer binding site in certain embodiments. In certain embodiments, the sequencing primer binds to a primer binding site within the tail region.

In certain embodiments, the tail sequence is about 5 to about 100 nucleotides, about 10 to about 100 nucleotides, about 5 to about 75 nucleotides, about 5 to about 50 nucleotides, about 5 to about 25 nucleotides, or about 5 to about. It is 20 nucleotides. In certain embodiments, the third region is about 10 to about 50 nucleotides, about 15 to about 40 nucleotides, about 20 to about 30 nucleotides or about 20 nucleotides, or any number of intervening nucleotides.

In certain embodiments, the tail sequence is about 30 nucleotides, about 31 nucleotides, about 32 nucleotides, about 33 nucleotides, about 34 nucleotides, about 35 nucleotides, about 36 nucleotides, about 37 nucleotides, about 38 nucleotides, about 39 nucleotides, Or about 40 nucleotides.

In various embodiments, the capture probe module is a binding pair to allow isolation and / or purification of one or more capture fragments of a tagged and / or amplified cfDNA library that hybridizes to the capture probe. Includes specific members of. In certain embodiments, the capture probe module is attached to biotin or another suitable hapten, such as dinitrophenol, digoxigenin.

In various embodiments, the capture probe module is hybridized to an optionally amplified tagged cfDNA library to form a complex. In some embodiments, the polyfunctional capture probe module substantially hybridizes to a specific genomic target region of the cfDNA library.

Hybridization or hybridization conditions indicate that the two nucleotide sequences form a stable complex, eg, a tagged cfDNA library and a capture probe module form a stable tagged cfDNA library-capture probe module complex. Any reaction conditions can be included. Such reaction conditions are well known in the art and such conditions can be modified as appropriate, eg, the annealing temperature can be lowered using shorter length capture probes, and so on. It will be appreciated by those skilled in the art that such conditions may be within the scope of the present invention. Substantial hybridization is such that the second region of the capture probe complex is 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92 with the region of the tagged cfDNA library. It can occur when%, 91%, 90%, 89%, 88%, 85%, 80%, 75% or 70% show sequence identity, homology or complementarity.

In certain embodiments, the capture probe is about 40 nucleotides and has an optimal annealing temperature of about 44 ° C to about 47 ° C.

In certain embodiments, the method contemplated herein comprises the step of isolating a tagged cfDNA library-capture probe module complex. In certain embodiments, methods of isolating DNA complexes are well known to those of skill in the art and any method deemed appropriate by one of ordinary skill in the art can be used with the methods of the invention (Ausubel et al., Current Protocols in Molecular). Biology, 2007-2012). In certain embodiments, the complex is isolated using biotin-streptavidin isolation techniques.

In certain embodiments, removal of the single-stranded 3'end from the isolated tagged cfDNA library-capture probe module complex is contemplated. In certain embodiments, the method is a 3'-5'exonuclease enzymatic of an isolated tagged DNA library-polyfunctional capture probe module complex for removing single-stranded 3'ends. Including processing.

In certain other embodiments, the method comprises the step of using the isolated tagged DNA library fragment as a template to perform 5'-3'DNA polymerase extension of the polyfunctional capture probe.

In certain other embodiments, the method produces a hybrid target molecule of capture probe and isolated tagged cfDNA by the concerted action of 5'FLAP endonuclease, DNA polymerization, and nick closure with DNA ligase. including.

Various enzymes can be utilized for the 3'-5'exonuclease enzymatic treatment of the isolated tagged cfDNA library-polyfunctional capture probe module complex. Examples of suitable enzymes exhibiting 3'-5'exonuclease enzyme activity that can be utilized in certain embodiments include, but are not limited to, T4 or exonucleases I, III, V. IV, Hubscher U., "The 3'5'exonucleases"
, Nat Rev Mol Cell Biol., Vol. 3, (No. 5): pp. 364-76 (2002)). In certain embodiments, the enzyme containing 3'-5'exonuclease activity is a T4 polymerase. In certain embodiments, enzymes exhibiting 3'-5'exonuclease enzyme activity and capable of extending the primer template can be utilized, such as T4 or exonucleases I, III, V. Can be mentioned. The same book.

In some embodiments, the method contemplated herein is a sequence for a complex enzymatically treated with a 3'-5'exonuclease discussed above and elsewhere herein. Includes steps to perform singing and / or PCR. In certain embodiments, the tail portion of the capture probe molecule is copied to produce a hybrid nucleic acid molecule. In one embodiment, the hybrid nucleic acid molecule produced comprises a target region that can hybridize to a capture probe module and a complement of the capture probe module tail sequence.

In certain embodiments, the genetic analysis a) hybridizes one or more capture probe modules to one or more target gene loci in multiple cfDNA library clones and one or more capture probes. Module-CfDNA Library Clone Complex Forming Step, b) One or More Capture Probes from a) Module-cfDNA Library Clone Complex Isolation Step, c) One or More From Step b) A step of enzymatically treating a plurality of isolated capture probe modules-cfDNA library clone complexes, a step of performing PCR on the enzymatically treated complex from d) c), the capture probe molecule. Copies the tail portion of the gene to generate an amplified hybrid nucleic acid molecule, and the amplified hybrid nucleic acid molecule can hybridize to a complement of the capture probe and capture probe module tail sequence to a target sequence at the target genome locus. Including steps, as well as performing quantitative genetic analysis on the amplified hybrid nucleic acid molecule from e) d).

In certain embodiments, it is a method of determining the number of copies of a specific target gene locus a) one or more capture probe modules in one or more target gene loci in multiple cfDNA library clones. Hybridize to form one or more capture probe module-cfDNA library clone complexes, b) Isolate one or more capture probe module-cfDNA library clone complexes from a) Step, c) Enzymatically treating one or more isolated capture probe module-cfDNA library clone complexes from step b), d) Enzymatically treated complex from c) In the step of performing PCR with respect to, the tail portion of the capture probe molecule is copied to generate an amplified hybrid nucleic acid molecule, and the amplified hybrid nucleic acid molecule becomes a complement to the capture probe and the capture probe module tail sequence. A step including a target sequence at a target gene locus that can be hybridized, a step of performing PCR amplification of the amplified hybrid nucleic acid molecule in e) d), and a step of quantifying the PCR reaction in f) e). A method is contemplated in which quantification involves a step that allows determination of the number of copies of a specific target region.

In one embodiment, the enzymatic treatment of step c) is 3'-5 for one or more capture probe modules-cfDNA library clone complex from b) using 3'-5'exonuclease activity. 'Exonuclease Enzymatic treatment to remove single-stranded 3'ends; capture probe module and cfDNA library clone 1 by synergistic action of 5'FLAP end nuclease, DNA polymerization, and nick closure with DNA ligase Generating one or more hybrid molecules; or using an isolated cfDNA clone in the complex as a template to perform 5'-3'DNA polymerase extension of the capture probe.

In one embodiment, the enzymatic treatment of step c) comprises using the isolated cfDNA clone in the complex as a template to perform 5'-3'DNA polymerase extension of the capture probe.

In certain embodiments, PCR can be performed using any standard PCR reaction conditions well known to those of skill in the art. In certain embodiments, the PCR reaction in e) utilizes two PCR primers. In one embodiment, the PCR reaction in e) utilizes a first PCR primer that hybridizes to a repetitive sequence within the target gene locus. In certain embodiments, the PCR reaction in e) utilizes a second PCR primer that hybridizes to the target gene locus / tail junction of the hybrid nucleic acid molecule. In certain embodiments, the PCR reaction in e) is a first PCR primer that hybridizes to the target gene locus and a second PCR primer that hybridizes to the target gene locus / tail junction of the amplified hybrid nucleic acid molecule. And use. In certain embodiments, the second primer hybridizes to the target gene locus / tail junction with at least one or more nucleotides of the primer hybridizing to the target gene locus and at least one or more nucleotides of the primer having a tail sequence. Hybridize as it hybridizes to.

In certain embodiments, the amplified hybrid nucleic acid molecules obtained from step e) are sequenced and their sequences are horizontally aligned, i.e. aligned with each other, but not with reference sequences. In certain embodiments, steps a) to e) are repeated once or multiple times with one or more capture probe modules. The capture probe modules may be the same or different and can be designed to target either cfDNA strand at the target gene locus. In some embodiments, if the capture probes are different, they hybridize to duplicate or flanking target sequences within the target gene loci in the tagged cfDNA clone library. In one embodiment, a plurality of capture probes hybridize to a target gene locus, and each of the capture probes hybridizes to a target gene locus in a tagged cfDNA clone library of about 5 of any other capture probe. Use a high density capture probe strategy that hybridizes to target gene loci within 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200 bp (including all intervening distances).

In some embodiments, the method hybridizes to the "Watson" strand (non-coding strand or template strand) upstream of the target region and one to the "click" strand (coding strand or non-coding strand) downstream of the target region. Two capture probe modules that hybridize to the template strand) can be used for each target gene locus.

In certain embodiments, the methods contemplated herein are any number of capture probe modules per target gene locus, eg, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or It can be done many more times with any combination of capture probe modules that are more than that and any number of them hybridize to Watson or Crick chains. In some embodiments, the resulting sequences can be aligned with each other to identify any of several differences.

In certain embodiments, one or more capture probe modules are used to multiple target gene loci in a single reaction, eg, 100, 200, 300, 400, 500, 600, 700, 800, 900, Target gene loci of 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 10000, 50000, 100,000, 500,000 or more are examined.

(B) Sequencing In certain embodiments, quantitative genetic analysis yields multiple unique sequencing reads of multiple hybrid nucleic acid molecules, as discussed elsewhere herein above. Includes the steps of sequencing to produce sufficient sequencing depth. A unique read is defined as a single consensus read from a "family" of reads that all share the same read code and sequence origin in the cfDNA. Each capture probe yields a set of unique reads that are computationally extracted from all reads by classifying them into families. Unique reads for a given sample are then calculated as the average of all unique reads observed per probe. Cases with obvious copy count changes are excluded from the dataset used to calculate the mean. Unique reads are important because each unique read must be derived from a unique cfDNA clone. Each unique read represents a haploid equivalent of genomic DNA input and analysis. The sum of unique reads is the sum of the analyzed haploid genomes. And again, the number of genomes analyzed defines the sensitivity of the sequencing assay. As a non-limiting example, when the average unique read count is 100 genomic equivalents, the particular assay has the sensitivity to detect 1 in 100, i.e., 1% of mutant reads. Any observation below this is not justified.

In certain embodiments, quantitative genetic analysis involves multiple sequencing of hybrid nucleic acid molecules from multiple samples.

In various embodiments, quantitative gene analysis is the step of obtaining one or more or more tagged DNA library clones, each clone comprising a first DNA sequence and a second DNA sequence. , A step in which the first DNA sequence contains the sequence of the target gene locus and the second DNA sequence contains the capture probe sequence, and one or more end sequencing reactions are performed on one or more clones. A step of obtaining a sequencing read, or a step of performing a sequencing reaction on one or more clones to obtain a single long sequencing read larger than about 100, 200, 300, 400, 500 or more nucleotides. Steps are sufficient for the read to identify both the first and second DNA sequences, as well as ordering or clustering the sequencing reads of one or more clones according to the sequencing read probe sequence. Includes steps to do.

(C) Bioinformatics Analysis In various embodiments, the quantitative gene analysis further comprises a bioinformatics analysis of the sequencing read. Bioinformatics analysis excludes any pure psychoanalysis performed in the absence of compositions or methods for sequencing. In certain embodiments, bioinformatics analysis includes, but is not limited to, sequence alignment, genomic equivalence analysis, single nucleotide variant (SNV) analysis, gene copy number variation (CNV) analysis, and detection of gene lesions. In certain embodiments, bioinformatics analysis is used to quantify the number of genomic equivalents analyzed in the cfDNA clone library, to detect the genetic status of the target gene locus, to detect gene lesions within the target gene locus, and It is useful for measuring the increase or decrease in the number of copies in the target gene locus.

Sequence alignment may be performed between the sequence read and one or more human reference DNA sequences. In certain embodiments, sequencing alignments include, but are not limited to, detection of nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy count changes or gene fusions, but are not limited to genes at target gene loci. It can be used to detect lesions. Detection of genetic lesions, which are causes or prognostic indicators, may be useful in diagnosing, prognostic, treating and / or monitoring a particular hereditary condition or disease.

Also herein is a method of sequence alignment analysis, called horizontal sequence analysis, which can be performed without the need for alignment to a reference sequence. Such analysis can be performed on any sequence generated by the method contemplated herein or by any other method. In certain embodiments, sequence analysis comprises performing sequence alignments for reads obtained by the methods contemplated herein.

In one embodiment, genomic equivalents in the cfDNA clone library are determined using bioinformatics-based counting after sequencing. Each sequencing read is associated with a particular capture probe, and the set of reads assigned to each capture probe is grouped. Individual sets of reads within a group share the same read code and the same DNA sequence starting position within the genomic sequence. These individual leads are classified as "family" and a single consensus representative of this family is carried forward as a "unique lead". All of the individual leads that make up the family are derived from a single ligation event, and thus they are "brothers" of amplification origin from each other. Each unique read is considered a unique ligation event, and the sum of the unique reads is considered equal to the number of genomic equivalents analyzed.

When the number of unique clones approaches the total number of possible sequence combinations, the probability is that the same code and origin combination will result from independent events, and these independent events are improperly grouped within a single family. It is decided that it will be transformed. The end result is an underestimation of the genomic equivalents analyzed, and infrequent mutant reads overlap with wild-type reads with the same identifier and may be disposed of as a sequencing error.

In certain embodiments, the number of genomic equivalents analyzed is about 1/10, about 1/12, about 1/1 of the number of possible unique clones to result in accurate analysis of the cfDNA clone library. 14, about 1/16, about 1/18, about 1/20, about 1/25 or less. It should be understood that the procedure outlined above is only informative and not limiting.

In some embodiments, it may be necessary to increase the number of genomic equivalents analyzed. At least two solutions are planned to increase the depth of genomic equivalents. The first solution is to use more than one adapter set per sample. By combining adapters, it is possible to multiply the total number of possible clones in a multiplicative manner, thus expanding the satisfactory limits of genomic input. The second solution is to expand the read code by 1, 2, 3, 4, or 5 or more bases. The number of possible read codes that differ from all other read codes by at least 2 bases is 4 ^(n-1) , where n is the number of bases in the read code. Therefore, in a non-limiting example, if the read code is 5 nucleotides, 4 ^(5-1) = 256. Therefore, by including additional bases, the available repertoire is expanded by a factor of 4 for each additional base.

In one embodiment, quantitative genetic analysis comprises bioinformatic analysis of sequencing reads to identify infrequent single nucleotide variants (SNVs).

Next-generation sequencing has an inherent error rate of approximately 0.02-0.02%, which means that 1/200 to 1/500 base calls are inaccurate. Molecular annotation strategies need to be exercised to detect variants and other mutations that occur at a lower frequency, eg, 1 in 1000 sequences. As a non-limiting example, analysis of 5000 unique molecules using targeted sequence capture techniques shows that each unique read has 50 unique reads, a group of 5000 unique reads that belong to a "family" of reads, all having the same read code. Generate with sufficient sequencing depth to exceed 000 leads. SNVs that occur within the family are candidates for low frequency variants. If this same variant is observed in more than one family, it is a very strong candidate for a low frequency variant present in the starting sample. In contrast, variants that occur sporadically within a family are more likely to have sequencing errors, and variants that occur within one and only one family are infrequent or occur in Exvivo. It is the result of base changes (eg, DNA base oxidation or PCR introduction errors).

In one embodiment, the method of detecting SNV comprises introducing more than 10-fold genomic input (genome or genomic equivalent) depending on the desired target sensitivity of the assay. In one non-limiting example, if the desired sensitivity is 2% (2 out of 100), the experimental target is an input of 2000 genomes.

In certain embodiments, bioinformatics analysis of sequencing data includes genetic status, hereditary status or genetic disease, genetic mosaic, fetal testing, paternity testing, prediction of response to drug treatment, diagnosis or monitoring of pathology, microbiome profiling. , Used to detect or identify SNVs associated with pathogen screening and monitoring of organ transplantation.

In various embodiments, it is a method for copy number determination analysis, comprising the step of obtaining one or more or more clones, each clone comprising a first DNA sequence and a second DNA sequence. , A method is provided in which the first DNA sequence comprises the sequence of the target gene locus and the second DNA sequence comprises the capture probe sequence. In a related embodiment, a pair of terminal sequencing reactions for one or more clones is performed to obtain one or more sequencing reads. In another embodiment, a sequencing reaction for one or more clones results in a single long sequencing read of about 100 or more nucleotides, with the reads being the first DNA sequence and the second DNA sequence. Perform a sequencing reaction, which is sufficient to identify both. Sequencing reads of one or more clones can be ordered or clustered according to the probe sequence of the sequencing reads.

Copy count analysis is an analysis that examines the number of copies of a particular gene or mutation that occurs in a given genomic DNA sample, quantitatively the number of copies or sequence differences of a given gene in a given sample. Includes, but is not limited to, analyzes that can further include verdicts. In certain embodiments, copy count analysis includes genetic status, hereditary status or disease, fetal testing, genetic mosaic, paternity testing, prediction of response to drug treatment, diagnosis or monitoring of pathology, microbiome profiling, pathogen screening and Used to detect or identify gene amplification associated with organ transplant monitoring.

In certain embodiments, bioinformatics analysis of sequencing data includes, but is not limited to, detection of nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy count changes or gene fusions. Used for the detection or identification of one or more sequences or genetic lesions in the sitting position. Detection of genetic lesions, which are causes or prognostic indicators, may be useful in diagnosing, prognostic, treating and / or monitoring a particular hereditary condition or disorder. In one embodiment, the genetic lesion is genetic status, hereditary or genetic disease, fetal testing, genetic mosaic, paternity testing, prediction of response to drug treatment, diagnosis or monitoring of pathology, microbiome profiling, pathogen screening and organ transplantation. Related to monitoring.

D. Clinical Applications of Quantitative Genetic Analysis In various embodiments, the present invention contemplates methods of detecting, identifying, predicting, diagnosing or monitoring a condition or disease in a subject.

In certain embodiments, methods for detecting, identifying, predicting, diagnosing or monitoring genetic status, hereditary status or genetic disease in a subject include quantitative genetic analysis of one or more target gene loci in a cfDNA clone library. To detect or identify sequence changes at one or more target gene loci.

In one embodiment, a method of detecting, identifying, predicting, diagnosing or monitoring a genetic state, hereditary state or genetic disorder is a step of isolating or obtaining cfDNA from a biological sample of interest, one or more ends of cfDNA. The step of treating with a repair enzyme to generate terminal repair cfDNA, the step of ligating one or more adapters to each end of the terminal repair cfDNA to generate a cfDNA library, and the step of amplifying the cfDNA library to generate a cfDNA clone library. To generate one or more targets, to determine the number of genomic equivalents in the cfDNA clone library, and to perform quantitative gene analysis of one or more target gene loci in the cfDNA clone library to perform one or more targets. Includes steps to detect or identify sequence changes at loci.

In certain embodiments, a genetic disorder, a genetic state selected from the group consisting of a genetic mosaic, or a hereditary state or genetic disorder detection, identification, prediction, diagnosis or monitoring, fetal testing, parent-child identification, parent-child identification, drug treatment. Methods of predicting response to, diagnosing or monitoring pathology, microbiome profiling, pathogen screening and organ transplant monitoring, the step of isolating or obtaining cfDNA from a biological sample of interest, repairing one or more ends of cfDNA. The step of treating with an enzyme to generate a terminal repair cfDNA, the step of ligating one or more adapters to each end of the terminal repair cfDNA to generate a cfDNA library, and the step of amplifying the cfDNA library to obtain a cfDNA clone library. One or more target genes are generated, the step of determining the number of genomic equivalents in the cfDNA clone library, and the quantitative gene analysis of one or more target gene loci in the cfDNA clone library. A method comprising detecting or identifying a nucleotide transition or transversion, a nucleotide insertion or deletion, a genome rearrangement, a change in copy count or a gene fusion in a locus sequence.

Examples of genetic disorders that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include cancer, Alzheimer's disease (APOE1), Sharko Marie Tooth's disease, and the like. Lever hereditary optic nerve atrophy (LHON), Angelman syndrome (UBE3A, ubiquitin-protein ligase E3A), Prader Willy syndrome (region within chromosome 15), β-salasemia (HBB, β-globin), Gauche disease (HBB, β-globin) Type I) (GBA, glucocerebrosidase), cystic fibromatosis (CFTR epithelial chloride channel), sickle erythema (HBB, β-globin), Teisax disease (HEXA, hexosaminidase A), phenylketone Urology (PAH, phenylalanine hydrolyase), familial hypercholesterolemia (LDLR, low density lipoprotein receptor), adult cystic kidney (PKD1, polycystin), Huntington's disease (HDD, huntingtin), neurofibromatosis Type I (NF1, NF1 tumor suppressor gene), muscle tonic dystrophy (DM, myotonin), nodular sclerosis (TSC1, tuberin), chondrosis aplasia (FGFR3, neurofibromatosis factor receptor), fragile X syndrome (FMR1, RNA-binding protein), Duchenne-type muscle dystrophy (DMD, dystrophin), hemophilia A (F8C, blood coagulation factor VIII), Resh-Naihan syndrome (HPRT1, hypoxanthing anninribosyltransferase 1), and adrenal white dystrophy (ABCD1), but is not limited to these.

Examples of cancers that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include B-cell cancers such as multiple myeloma, melanoma, breast cancer. Lung cancer (eg, non-small cell lung cancer or NSCLC), bronchial cancer, colorectal cancer, prostate cancer, pancreatic cancer, stomach cancer, ovarian cancer, bladder cancer, brain or central nervous system Cancer of the peripheral nervous system, esophageal cancer, cervical cancer, uterine or endometrial cancer, oral or pharyngeal cancer, liver cancer, kidney cancer, testis cancer, biliary tract cancer, small intestine Or worm drop cancer, salivary adenocarcinoma, thyroid cancer, adrenal cancer, osteosarcoma, chondrosarcoma, blood tissue cancer, adenocarcinoma, inflammatory myofibroblastic tumor, gastrointestinal stromal tumor (GIST), Colon cancer, multiple myeloma (MM), myelodystrophy syndrome (MDS), myeloproliferative disease (MPD), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia ( CML), Chronic lymphocytic leukemia (CLL), True erythrocytosis, Hodgkin lymphoma, Non-Hodgkin lymphoma (NHL), Soft tissue sarcoma, Fibrosarcoma, Mucinosarcoma, Fat sarcoma, Osteogenic sarcoma, Spinal sarcoma, Angiosarcoma , Endocardial sarcoma, Lymphatic sarcoma, Lymphatic endothelial sarcoma, Luminous tumor, Medium dermatoma, Ewing tumor, Smooth muscle tumor, Lacterial myoma, Squamous epithelial cancer, Basal cell cancer, Adenocarcinoma, Sweat adenocarcinoma, Sebaceous adenocarcinoma, Papillary cancer, papillary adenocarcinoma, medullary cancer, bronchial lung cancer, renal cell cancer, hepatoma, bile duct cancer, chorionic villus cancer, sperm epithelioma, fetal cancer, Wilms tumor, bladder cancer, epithelial cancer, glioma, Astral cell tumor, myelblastoma, cranial pharyngeal tumor, ventricular lining tumor, pine fruit tumor, hemangioblastoma, acoustic nerve tumor, oligodendroglioloma, meningitis, neuroblastoma, retinal blastoma, Follicular lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, hepatocellular carcinoma, thyroid cancer, gastric cancer, head and neck cancer, small cell cancer, essential thrombocytosis, unknown cause Myelination, eosinophilia syndrome, systemic obesity cytosis, familial hypereocytosis, chronic eosinophilia, neuroendocrine cancer, cartinoid tumors, etc., but are not limited to these. ..

In one embodiment, the genetic lesion is a lesion annotated in a Cosmic database (lesion and sequence data can be downloaded from cancer.sanger.ac.uk/cosmic/census), or Cancer Genome Atlas (lesion and sequence). The lesion is annotated with data (which can be downloaded from tcga-data.nci.nih.gov/tcga/tcgaDownload.jsp).

Examples of genes with one or more genetic lesions associated with cancer that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein are ABCB1, ABCC2. ABCC4, ABCG2, ABL1, ABL2, AKT1, AKT2, AKT3, ALDH4A1, ALK, APC, AR, ARAF, ARFRP1, ARID1A, ATM, ATR, AURKA, AURKB, BCL2, BCL2A1, BCL2 , BRCA2, Clorf144, CARD11, CBL, CCND1, CCND2, CCND3, CCNE1, CDH1, CDH2, CDH20, CDH5, CDK4, CDK6, CDK8, CDKN2A, CDKN2B, CDKN2C, CEBPA, CHEK2, CDKN2B, CDKN2C, CEBPA, CHEK1 , CYP2C19, CYP2C8, CYP2D6, CYP3A4, CYP3A5, DNMT3A, DOT1L, DPYD, EGFR, EPHA3, EPHA5, EPHA6, EPHA7, EPHB1, EPHB4, EPHB6, EPHX1, ERBBER2 , ETV4, ETV5, ETV6, EWSR1, EZH2, FANCA, FBXW7, FCGR3A, FGFR1, FGFR2, FGFR3, FGFR4, FLT1, FLT3, FLT4, FOXP4, GATA1, GNA11, GNAQ, GNAQ, GNAQ, GNAQ , HSP90AA1, IDH1, IDH2, IGF1R, IGF2R, IKBKE, IKZF1, INHBA, IRS2, ITPA, JAK1, JAK2, JAK3, JUN, KDR, KIT, KRAS, LRP1B, LRP2, LTK, MAN1B , MDM2, MDM4, MEN1, MET, MITF, MLH1, MLL, MPL, MRE11A, MSH2, MSH6, MTHFR, MTOR, MUTYH, MYC, MYCL1, MYCN, NF1, NF2, NKX2-1, NOTCH1, NPM1 , NRP2, NTRK1, NTRK3, PAK3, PAX5, PDGFRA, PDGFRB, PIK3CA, PIK3R1, PKHD 1, PLCG1, PRKDC, PTCH1, PTEN, PTPN11, PTPRD, RAF1, RARA, RB1, RET, RICTOR, RPTOR, RUNX1, SLC19A1, SLC22A2, SLCO1B3, SMAD2, SMAD3, SMAD4, SMARCA4, SMARCB1 SOX2, SRC, STK11, SULT1A1, TBX22, TET2, TGFBR2, TMPRSS2, TNFRSF14, TOP1, TP53, TPMT, TSC1, TSC2, TYMS, UGT1A1, UMPS, USP9X, VHL and WT1.

In certain embodiments, genetic lesions include nucleotide transitions or transversions, nucleotide insertions or deletions, genomic rearrangements, copy count changes, or gene fusions.

In one embodiment, the gene lesion is a gene fusion that fuses the 3'coding region of the ALK gene to another gene.

In one embodiment, the gene lesion is a gene fusion that fuses the 3'coding region of the ALK gene to the EML4 gene.

Examples of conditions suitable for fetal testing that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include Down Syndrome (Trisomy 21), Edwards Syndrome (Trisomy 18). ), Pateau Syndrome (Trisomy 13), Klinefelter Syndrome (XXY), Trisomy X Syndrome, XYY Syndrome, Trisomy 8, Trisomy 16, Turner Syndrome (XO), Robertson's Translocation, Di George Syndrome and Wolf Hirschorn Syndrome However, it is not limited to these.

Examples of alleles suitable for paternity testing that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein are D20S1082, D6S474, D12ATA63, D22S1045, D10S1248, D1S1677, etc. D11S4463, D4S2364, D9S1122, D2S1776, D10S1425, D3S3053, D5S2500, D1S1627, D3S4529, D2S441, D17S974, D6S1017, D4S2408, D9S2157, D4S2408, D9S2157, D4S2408, D9S2157, Amelogenin, D17S3147 Not limited to these.

Examples of genes suitable for predicting response to drug treatment that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include one or more of the following genes: Including, but not limited to: ABCB1 (ATP binding cassette, subfamily B (MDR / TAP), member 1), ACE (angiotensin I converting enzyme), ADH1A (alcohol dehydrogenase 1A (class I), alpha polypeptide), ADH1B (alcohol dehydrogenase IB (class I), beta polypeptide), ADH1C (alcohol dehydrogenase 1C (class I), gamma polypeptide), ADRB1 (adrenaline action, beta-1-, receptor), ADRB2 (adrenaline action) , Beta-2-, receptor, surface), AHR (aryl hydrocarbon receptor), ALDH1A1 (aldehyde dehydrogenase 1 family, member A1), ALOX5 (arachidonic acid 5-lipoxygenase), BRCA1 (breast cancer 1, early-onset type) , COMT (Catecol-O-Methyltransferase), CYP2A6 (Cytochrome P450, Family 2, Subfamily A, Polypeptide 6), CYP2B6 (Cytochrome P450, Family 2, Subfamily B, Polypeptide 6), CYP2C9 (Cytochrome P450, Family 2, subfamily C, polypeptide 9), CYP2C19 (cytochrome P450, family 2, subfamily C, polypeptide 19), CYP2D6 (cytochrome P450, family 2, subfamily D, polypeptide 6), CYP2J2 (cytochrome P450) , Family 2, Subfamily J, Polypeptide 2), CYP3A4 (Cytochrome P450, Family 3, Subfamily A, Polypeptide 4), CYP3A5 (Cytochrome P450, Family 3, Subfamily A, Polypeptide 5), DPYD (Dihydro) Pyrimidine dehydrogenase), DRD2 (dopamine receptor D2), F5 (coagulation factor V), GSTP1 (glutathione S-transferase pie), HMGCR (3-hydroxy-3-methylglutaryl coenzyme A reductase), KCNH2 (potassium potential) Dependent channel, subfamily H (eg-related), member 2), KCNJ11 (inwardly rectifying potassium channel, subfamily J, member 11), M THFR (5,10-methylenetetrahydrofolate reductase (NADPH)), NQO1 (NAD (P) H dehydrogenase, quinone 1), P2RY1 (purinergic receptor P2Y, G protein-bound type, 1), P2RY12 (purinergic receptor P2Y, G protein bound type, 12), PTGIS (prostaglandin I2 (prostacycline) synthase), SCN5A (sodium channel, voltage dependent, V type, alpha (QT prolongation syndrome 3)), SLC19A1 (solute transporter family 19 (solute transporter family 19) Folic acid transporter), member 1), SLCO1B1 (solute transporter organic anion transporter family, member 1B1), SULT1A1 (sulfotransferase family, cytosolic, 1A, phenol selectivity, member 1), TPMT (thiopurin S-methyl) Transtransferase), TYMS (thymidylate synthase), UGT1A1 (UDP glucuronosyl transferase 1 family, polypeptide A1), VDC (vitamin D (1,25-dihydroxyvitamin D3) receptor), VKORC1 (vitamin K epoxy drductase complex) , Subunit 1).

Examples of medical conditions that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein include stroke, transient ischemic attacks, traumatic brain injury, heart disease, and the like. Examples include, but are not limited to, heart attack, angina, atherosclerosis and hypertension.

Examples of pathogens that can be screened using the compositions and methods contemplated herein include, but are not limited to, bacteria, fungi and viruses.

Examples of bacterial species that can be screened using the compositions and methods contemplated herein are Mycobacterium spp. , Pneumococcus spp. , Escherichia spp. , Campylobacter spp. , Corynebacterium spp. , Clostridium spp. , Streptococcus spp. , Staphylococcus spp. , Pseudomonas spp. , Shigella spp. , Treponema spp. , Or Salmonella spp. However, it is not limited to these.

Examples of fungal species that can be screened using the compositions and methods contemplated herein include Aspergillis spp. , Blastomyces
spp. , Candida spp. , Coccioides spp. , Cryptococcus spp. , Dermatophytes, Tinea spp. , Trichophyton spp. , Microsporum spp. , Fusarium spp. , Histoplasma spp. , Mucoromycotina spp. , Pneumocystis spp. , Sporothlix spp. , Excellophylum spp. Or Cladosporium spp. However, it is not limited to these.

Examples of viruses that can be screened using the compositions and methods contemplated herein include virus A, eg, H1N1, H1N2, H3N2 and H5N1 (bird flu), influenza B, influenza C virus. , Hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, hepatitis E virus, rotavirus, all viruses of the no-walk virus group, intestinal adenovirus, parvovirus, dengue fever virus, salpox, Mononegavirus, Lassavirus, eg mad dog disease virus, Lagos bat virus, mocolavirus, Dubenhage virus, European bat virus 1 and 2, and Australian bat virus, ephemerovirus, becyclovirus, bullous stomatitis virus (VSV), Herpesviruses such as simple herpesvirus types 1 and 2, varicella herpes, cytomegalovirus, Epstein barvirus (EBV), human herpesvirus (HHV), human herpesviruses 6 and 8, Moloney mouse leukemia virus (M-). MuLV), Moloney mouse sarcoma virus (MoMSV), Harvey mouse sarcoma virus (HaMuSV), mouse breast cancer virus (MuMTV), tenagazal leukemia virus (GaLV), cat leukemia virus (FLV), spumavirus, friend mouse leukemia virus, mouse stem cells. Virus (MSCV) and Raus sarcoma virus (RSV), HIV (human immunodeficiency virus; including HIV1 and HIV2 types), Bisna maedivirus (VMV) virus, goat arthritis encephalitis virus (CAEV), horse-borne anemia Virus (EIAV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV) and monkey immunodeficiency virus (SIV), papillomavirus, mouse gamma herpesvirus, arenavirus, such as Argentine hemorrhagic fever virus, Bolivian hemorrhagic fever virus , Savior-related hemorrhagic fever virus, Venezuelan hemorrhagic fever virus, Lassa fever virus, Machupo virus, lymphocytic choriomenelitis virus (LCMV), Bunyaviridiae, eg Crimea Congo hemorrhagic fever virus, Hunter virus, Nephropathy hemorrhagic fever Cause virus, Lift Valley fever virus, Filoviridae (Ebola hemorrhagic fever and Malburg hemorrhagic fever), Flaviviridae (including Kasanul forest disease virus, Omsk hemorrhagic fever virus, tick-borne encephalitis-causing virus), and Paramyxoviridae, such as Hendra virus and nipavirus, large and small pox (natural pox), alpha virus. Examples include, but are not limited to, Venezuelan encephalitis encephalitis virus, eastern horse encephalitis virus, western horse encephalitis virus, SARS-related coronavirus (SARS-CoV), western Nile virus and any encephalitis-causing virus.

Examples of genes suitable for monitoring organ transplantation in transplant recipients that can be detected, identified, predicted, diagnosed or monitored using the compositions and methods contemplated herein are one of the following genes or Including, but not limited to, HLA-A, HLA-B, HLA-C, HLA-DR, HLA-DP and HLA-DQ.

In certain embodiments, bioinformatic analysis involves mutations within the target gene locus to detect gene variants at the target gene locus to quantify the number of genomic equivalents analyzed in the cfDNA clone library. It is used to detect, to detect gene fusions within the target gene locus, or to measure the increase or decrease in the number of copies within the target gene locus.

E. Companion diagnostics In various embodiments, a companion diagnostic of a genetic disorder, the step of isolating or obtaining cfDNA from a biological sample of interest, treating cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA. Steps to generate a cfDNA library by ligating one or more adapters to each end of the terminal repair cfDNA, a step to amplify the cfDNA library to generate a cfDNA clone library, in the cfDNA clone library At least one of one or more biomarkers, including the step of determining the number of genomic equivalents and the step of performing quantitative genetic analysis of one or more biomarkers associated with the genetic disorder in the cfDNA clone library. Companion diagnostics are provided that indicate whether a subject should be treated for a genetic disorder if detected or undetectable.

As used herein, the term "companion diagnostic" refers to a diagnostic test associated with a particular anti-cancer therapy. In certain embodiments, these diagnostic methods include the detection of genetic lesions associated with relevant biomarkers in biological samples, thereby allowing rapid identification of patients who should or should not be treated with anticancer therapy. Become.

Anti-cancer therapies include, but are not limited to, surgery, radiation, chemotherapeutic agents, anti-cancer agents and immunomodulators.

Examples of anti-cancer drugs include alkylating agents such as thiotepa and cyclophosphamide (CYTOXAN ™); alkyl sulfonic acids such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carbocon, methuredopa. And uredopa; ethyleneimine and methylamelamines (including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylolomelamine resume); nitrogenmastered, eg, chlorambucil, chlorna Fazin, clophosphamide, estramstin, iposfamide, chlormethine, chlormethine oxide hydrochloride, melphalan, novemubitin, phenesterin, predonimustine, trophosphamide, urasylmasterd; Antibiotics such as aclacinomysins, actinomycin, authramycin
, Azaseline, bleomycin, cactinomycin, calikeamycin, carabicin, carminomycin, cardinophylline, chromomycin, dactinomycin, daunorbisin, detorbisin, 6-diazo-5-oxo-L-norroicin, doxorubicin and its PEGylation Formulations, epirubicin, esorbicin, idarubicin, marcelomycin, mitomycin, mycophenolic acid, nogalamycin, olivomycin, pepromycin, potophilomycin, puromycin, queramicin, rodorbisin, streptnigrin, streptosocin, tubersidine, ubenimex, dinostatin; Metabolic antagonists such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludalabine, 6-mercaptopurine, thiamipulin, thioguanine; Pyrimidin analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxiflulysine, enocitabine, floxuridine, 5-FU; androgen such as carsterone, dromostanolone propionate, epithiostanol, mepitiostane, test. Lactone; anti-adrenals, eg, aminoglutetimid, mitotan, trilostane; folic acid replacement agents, eg, frolinic acid; acegraton; aldphosphamide glycoside; aminolevulinic acid; amsacrine; best love Syl; bisanthren; edatraxate; defofamine; demecorcin; diadicon; elformitin; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidamine; mitogazone; mitoxanthron; mopidamole; nitraclin; pentostatin; phenamet; Pirarubicin; podophylphosphate; 2-ethylhydrazide; procarbazine; PSK®; razoxane; cyzophyllane; spirogermanium; tenazonoic acid; triazicon; 2,2', 2 "-trichlorotriethylamine;urethane;bindesin;dacarbazine;mannomustin; mitobronitol Methotrexate; Pipobroman; Gasitocin; Arabinoside ("Ara-C");Cyclophosphamide;thiotepa; taxoids, such as paclitaxel (TAXOL®, Bristol-Myers Squibb Oncology, Princeton, N. et al. J. ) And docetaxel (TAXOTIRE®, Rhne-Poulenc Ro)
rer, Antony, France); chlorambusyl; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinbrostin; platinum; etoposide (VP-16); ifofamide; mitomycin C; mitoxanthrone; Vinorelbine; Vinorelbine; Navelbine; Novantron; Teniposide; Aminopterin; Xeloda; Ivandronate; CPT-11; Topoisomerase inhibitor RFS 2000; Difluoromethylomithine (DMFO); Retinoic acid derivatives such as Targretin ™ (trademark). Bexarotene), Panretin ™ (Alitretinoin); ONTAK ™ (Deniroykin diftytox); Esperamicin; Capecitabine; and any of the above pharmaceutically acceptable salts, acids or derivatives. Not limited to these. Anti-hormonal agents that act to regulate or inhibit hormonal effects on cancer, such as anti-estrogen agents, such as tamoxifen, raloxifene, 4 (5) -imidazole-inhibiting aromatase, 4-hydroxytamoxifen, trioxyfen, Chemoxifen, LY117018, onapristone, and toremifene (fairstone), etc .; and antiandrogen agents such as flutamide, niltamide, bicalutamide, leuprolide and goseleline; and also pharmaceutically acceptable salts, acids or derivatives of any of the above. Included in this definition.

Examples of immunomodulators include, but are not limited to, cyclosporine, tacrolimus, tresperimus, pimecrolimus, sirolimus, verolimus, raflunimus, lacinimod and imiquimod, as well as analogs, derivatives, salts, ions and complexes thereof.

Whether all publications, patent applications and issuance patents cited herein are specifically and individually indicated that each individual publication, patent application or issuance patent is incorporated by reference. As such, it is incorporated herein by reference.

The invention described above has been described in some detail as description and examples for the purpose of clarifying understanding, but in view of the teachings of the present invention, without departing from the spirit or scope of the appended claims. It will be readily apparent to those skilled in the art that certain changes and modifications can be made therein. The following examples are given merely as an explanation and not as a limitation. One of skill in the art will readily notice a variety of less important parameters that can be modified or modified to achieve essentially similar results.

(Example 1)
Accurate detection of low-frequency mutations using targeted sequence capture technology The purpose of this experiment was to directly demonstrate the principle of low-frequency variant detection using targeted sequence capture technology.

Background Target sequence capture technology results in quantitative sequence-based gene analysis of nucleic acids, which can be utilized to perform combined analysis of mutations and copies of drug-metabolizing genes. We used targeted sequence capture techniques and subsequent genetic analysis to detect low frequency sequence variants.

Genomic DNA inputs play a central role in the detection of infrequent variants, but quantitative analysis and control of genomic inputs puts limits on the estimated sensitivity of infrequent variant analysis. We used the genomic qPCR assay to estimate genomic input.

One experimental goal of infrequent variant analysis is the introduction of genomic inputs that are 10-fold greater than the target sensitivity of the assay. In other words, in order to measure the variant with a sensitivity of 1% (1 in 100), the experimental target is the input of 1000 genomes. Downstream of sequencing, bioinformatics analysis reveals unique read numbers, which have the desired quality of being both orthogonal and more direct measurements of genomic input.

Summary Cell lines with known SNV (ZR75-30) and germline DNA samples (NA12878) were mixed in a dilution range ranging from 1: 1 to 1: 1000. Target regions corresponding to known sequence differences were searched and sequenced using targeted sequence capture techniques. Sequence variants that occur less than 1 per 1000 sequences were detected.

Methods Capturing probes The following table shows a group of 62 capturing probes used in this experiment.

The capture probe module was pooled from the stock plate and combined with partner oligo # 138 (SEQ ID NO: 63) (GTGAAAACCAGGTCAACTCCCGTGCCAGTCACAT / 3BioTEG /) and diluted to a final working concentration of 1 nM.

Genome Samples Commercially purchased genomic DNA from germline sample NA12878 and cell line ZR75-30 was fragmented with a Covaris sonicator to a target fragment size of 500 bp at a concentration of 10-20 ng / μl. The DNA was purified with 1: 1 concentration of purified DNA beads and terminally repaired at a final concentration of 15-30 ng / μL using the New England Biolabs (NEB) Quick bluet kit. Germline DNA and cell line DNA were blended in ratios of 1: 1, 10: 1, 100: 1 and 1000: 1, respectively. A library was constructed, purified and quantified. Table 2 shows the sample code, library quantification and inputs used to build the library.

Genomic libraries were pooled, denatured, combined with probes, hybridized and washed. The washed capture probe-tagged genomic library complex was amplified with forward and reverse full-length primers, purified, and size-selected for 225-600 bp fragments with a Pippin-prep device. Finally, the 150-V3 Illumina sequencing kit was used to sequence the captured material.

Results A pair of capture probes targeting BRAF (in two loci), MYCN and CDH1 were used to analyze SNV in these loci. The results are shown in Table 3.

Column 3 shows the total number of unique reads, which also provides a limit on the sensitivity of the assay. Estimated and measured genomic inputs were well within range of each other. The lightly shaded box highlights the SNV whose cell line sequence was different from the germline sequence. In the absence of unique read filtering shown in the right part of the table, measurable, non-zero frequency, random base changes occurred at these four selection positions. FIG. 1. By requiring the change to occur within the unique read family, it was possible to sort out the true signal from the noise that caused the error. FIG. 2.

(Example 2)
New probe design effective for comprehensive sequencing of target regions in highly fragmented gDNA Objective The purpose of these experiments is to develop an assay system for reliable and reproducible examination of circulating DNA. ..

Analysis of circulating DNA from background fluid represents a thrilling, but not yet realized opportunity for molecular diagnostics. Genomic DNA is very intact. The literature suggests that the average size of circulating DNA is about 150 bp, which correlates well with the size of DNA wrapped around a single nucleosome histone complex.

Summary The technical parameters of the targeted sequence capture technique contemplated herein are designed to accommodate highly fragmented DNA and retain the ability to generate extensive sequence coverage of the targeted DNA. bottom. The capture probe density was increased and the length of the capture probe sequence was shortened from 60 nucleotides to 40 nucleotides to minimize the generation of non-informational sequences in the clone library. Due to the large number of repetitive sequences and extreme changes in base composition in the human genome, the suitability of implementing higher capture probe densities and shorter capture probes has not been found to be appropriate and is based on experiments with this novel assay. Verification required.

Conditions have been established for shorter 40mer capture probe sequences to exhibit reliable and robust assay performance. In the first set of experiments, the assay was used to use two large regions-the coding region of the tumor suppressor gene TP53 and the long, contiguous 19th intron of the ALK oncogene, both of which form the core of cancer diagnosis. )-Inquired. In the second set of experiments, several dense paired capture probes with shorter 40 nucleotide capture probe sequences were used to examine known SNVs present in the NCI-H69 cell line.

This novel high-density, shorter capture probe was successfully queried for short fragmented DNA, and the results show that this assay design is well suited for sequencing circulating DNA found in blood plasma fractions. showed that.

Method-Modified 40mer capture probe Table 4 shows the capture probe sequences used to experimentally verify the performance of the 40mer capture probe.

The performance of the 40mer capture probe was compared with that of the 60mer capture probe. By removing 20 nucleotides from the 5'end of 60 mer, 60 mer to 40 mer was designed. The 3'ends of both capture probe sets are identical for the sequences copied from the captured genomic clones, but the probe sequence signature (lead 2 of the paired terminal read) is between the 60mer and 40mer probe sets. different. This design is useful because it allows the capture probes to be multiplexed during sequencing and then their performance analyzed during downstream bioinformatics deconvolution.

Genomic Samples A pool of 12 genomic DNA samples (selected from the Coriell human panel of 112 human genomic DNAs) was used as the target DNA. The 12 samples were divided into 4 sets of 4 samples each, as detailed in Table 5.

Hybridization, Washing and Sequencing Six different hybridization conditions were used to hybridize 60mer and 40mer probes to genomic target DNA:
1) Cleaning the 60mer probe at 50 ° C 2) Cleaning the 40mer probe at 50 ° C 3) Cleaning the 60mer probe at 47 ° C 4) Cleaning the 40mer probe at 47 ° C 5) Cleaning the 60mer probe at 44 ° C 6) Cleaning the 40mer probe at 44 ° C Washed at 44 ° C.

For each experiment, capture probe oligos were combined with partner oligos. The final concentration of double-stranded capture probes was 1 nM for each capture probe.

Each hybridization reaction had an approximately 2.5 μg genomic library in a total volume of 40 μl. Each sample was heated to 98 ° C. for 2 minutes and then cooled with ice. 20 μl of capture probe and 90 μl of hybridization buffer were added and the hybridization mixture was subjected to a 24-hour incubation starting at 80 ° C. and lowered once every 48 minutes to 50 ° C. The complex was bound to 20 ul of streptavidin beads in 1 mL of TEzero buffer + 0.05% Tween 20 (TT) in total volume. The beads were washed 3 times with 200 ul TT for 5 minutes each and washed once in wash buffer at 45 ° C. for 5 minutes. The beads were then washed with TEzero and 20 μl per reaction.
It was resuspended in Tezero. The complex is then subjected to full-length forward (ACA2_FLFP; SEQ ID NO: 152; AATTGATACGGGCACCGAGAATTACACCGTCATGCAGGAGACGAGAATTCCGAATACA) and full-length reverse (CAC3_FLRP; SEQ ID NO: 153; CAAGCAGAAGGCGGCATGAGTGAGTGAGTGAGTGATCGGGTgACTGACTGACT.

After amplification and purification, the masses of the resulting products were measured and equal masses were pooled for sequencing.

Results-The capture probe performance as a function of modified 40mer primer length and wash temperature is illustrated in FIG. Overall, the 40 mer capture probe worked as well as the 60 mer capture probe with 44 ° C and 47 ° C washes. At 50 ° C. washing, the 40mer capture probe behaves sporadically. These data experimentally validate the use of 40mer capture probes and wash temperatures in the 44 ° C. to 47 ° C. range when using these reagents.

Method-High Density 40mer
In general, sequence capture probes are designed using specific "rules". For example, regions of redundant sequences, or regions that exhibit extreme base composition bias, are generally avoided. One important implication of the requirement for high probe density and close probe spacing along the target area is that there is little or no tolerance for moving the probe to accommodate any such probe design rules. In this study, the probes were designed based only on their position relative to each other, without any consideration of probe binding sequences, so the use of this high density approach is such a group of probes with hybridization and processing methods. It is necessary to verify by experiment that it corresponds to.

The human ALK gene encodes a protein kinase that is important for early development, but normal ALK gene expression is essentially undetectable in normal adults. A carcinogenic ALK fusion is produced when the 19th intron of ALK undergoes an unorthodox recombination that fuses the kinase coding portion of ALK to the 5'end of another gene. Such gene fusions often cause ectopic expression of ALK kinase, and this ectopic expression is also important in driving the inappropriate cell proliferation observed in lung tumors. In the case of lung cancer, this "other gene" is often EML4, but other fusion partners have also been detected. To create an assay capable of detecting any possible ALK gene fusion event, a 40 nucleotide probe was designed placed at 80 nucleotide intervals in the 19th intron of ALK. These probes were oriented antisense to the gene (Fig. 4). This means that their 3'ends are elongated and copy the gene region at 5'to their hybridization site. If a fusion gene is present, probe extension from a probe located near the fusion junction copies the junction sequence. The DNA sequences obtained from these junction clones have a fusion partner sequence at their 5'end, a fusion junction sequence, and an ALK 19th intron sequence at their 3'end (FIG. 4B).

Another important diagnostic target in cancer is the TP53 gene. This gene encodes a tumor suppressor and is often inactivated by mutations in cancer. Since mutations capable of inactivating gene function are scattered throughout this gene, a sequence-based comprehensive assay for TP53 inactivating mutations addresses the entire coding region and untranslated region (UTR) of this gene. Must. Since the circulating DNA fragment is short, a high density probe was used to examine all target regions of the TP53 gene. Unlike ALK, the probe for TP53 is placed in both possible orientations (Fig. 5). At high probe densities, cumulative coverage from multiple probes results in uniform, deep sequencing coverage of the target area.

The series of 105 probes used in this study is shown in Table 6. In addition to probes targeting the Flux-friendly region of ALK and the coding region of TP53, we also included probes that include known SNVs in cell line DNA.

Genome Samples Three samples of genomic DNA were analyzed:
1) Germline sample NA 06994-Normal human sample obtained from Coriell repository,
2) There is a mutation in the cancer cell line NCI-H69-TP53, amplification of the MYCN locus, and SNV in ALDH4A1, BRCA1, BRCA2, CDKN2A, DPYD, EPHX1, MYC, RB1 and TNFRSF14 included in the target probe set. Cell lines known to exist,
3) Cancer cell line ZR-75-1, which is reported to have the EML4-ALK fusion gene (Lin et al., Mol. Cancer Res., Vol. 7 (9): 1466, 2009).
Year).

DNA sequencing libraries are generally constructed from shared DNA fragments. Acoustic decomposition was used to generate DNA fragments ranging in size from 200 to> 500 bp. Enzymatic fragmentation of acoustically fragmented DNA was performed to mimic circulating DNA believed to be composed of approximately 150 bp fragments of nucleosomes. Briefly, 20-40 ng / μl of DNA was sonicated at a setting of 200 bp to give broad smear fragments ranging in size from 150 bp to 400 bp. 0.01 and 0.02 μl of DNAse enzyme (New England Biolabs recombinant bovine DNAse) is added to a 50 μl aliquot of DNA in a _{DNAse buffer (10 mM Tris pH 8.0, 2.5 mM MnCl 2} , 0.5 mM CaCl _2). This further fragmented the DNA. The DNAse reaction was incubated at 37 ° C. for 10 minutes and the reaction was stopped by adding 0.5 M EDTA to a final concentration of 25 mM. DNA with an average size of 150 bp was purified by "bilateral" bead selection by first adding 0.9 volumes of beads to 1 volume of DNA. Since the beads bind to larger pieces that are not desirable, discard the beads and add an additional 1.6 volumes of beads to the supernatant. The binding agent is then purified and quantified. The resulting highly fragmented short DNA agarose gel used to build the library is shown in FIG.

Fragmented DNA was terminally repaired using the Quick Blunt kit from NEB and blended in the ratios shown in Table 7. Then, 10 nanograms of blended DNA was ligated to an adapter having the sequences shown in Table 7. Mixtures 9 and 15 were subjected to two ligation reactions using 10 ng each and then pooled. The mixture 16 was reacted four times. Estimates of genomic input to each library using the qPCR assay are also shown in Table 7.

Targeted Sequencing 1 microgram of each of the 16 DNA libraries shown in Table 7 was pooled and adjusted to a final volume of 160 μL. Eight identical 20 μL aliquots were denatured at 98 ° C., cooled on ice, 20 μL probe at 1 nM / probe (Table 6) and 50 μL CF.
With hyb buffer was added. The sample was annealed at 80 ° C. to 50 ° C. for 24 hours, washed and amplified. After amplification of the resulting captured and processed fragments, the final sequencing library was sized using a Pippin Prep ™ device with a size selection of 175-400 bp. Libraries were sequenced on Illumina MiSeq using a 150-lead V3 kit.

The capture probe performance for the target sequence of the high density capture probe selected based on the result position was monitored. A graph showing the performance of each capture probe is shown in FIG. These data are
1) On-target sequence information was obtained by all capture probes strictly selected by position constraint.
2) Prove that most capture probes show little off-target unmappable read capture, and 3) yields of useful on-target reads were substantially uniform.

Further analysis was performed on capture probes that captured unmapping leads with a large percentage of off-targets. These capture probes were generally located in areas of low complexity / high sequence redundancy. However, here, such a capture probe did not have a significant detrimental effect on the sequencing depth. This is because a high level of probe redundancy (high density probe) means that all regions are covered by reads from several probes. The net effect was excellent uniformity of coverage. See, for example, Figure 8, probe coverage of the TP53 gene using a 40 mer capture probe.

Conclusion Taken together, these data demonstrate that the capture probe length can be reduced from 60 nucleotides to 40 nucleotides with little or no discernible loss of probe performance (adjusting the capture wash temperature). These data also indicate that the probe design can be constrained and that sequence relationships and composition can generally be ignored. Even if this methodology results in probes that may not work very well, the high redundancy at close probe intervals more than compensates for the lack of individual probes.

(Example 3)
Objectives of Gene Analysis of Circulating DNA The purpose of this example was to evaluate genetic analysis of cfDNA using an efficient cloning procedure for cfDNA and a target search system.

Background The enthusiasm of scientific and medical organizations for "liquid biopsy" -analysis of circulating DNA (cfDNA) for markers associated with potential disease states-is enormous, but the actual information about this potential analysis is significantly scarce.

Summary Genetic analysis of circulating DNA was performed using plasma samples taken from healthy donors and individuals suffering from either ovarian cancer or colon cancer. The amount and general characteristics of circulating cfDNA can vary widely from individual to individual. Surprisingly, we can easily clone cfDNA with an efficiency indistinguishable from highly purified fragmented genomic DNA, with an average fragment size of 170 ± 10 bp (in 7/8 sample). We found that there was a marked match in clone insert size, and that the genomic presentation from such samples was uniform, comparable to experiments performed using purified gDNA. Counting unique reads further confirmed that the depth of presentation in each library yielded small allele frequency estimates for tumor markers present in the cfDNA of affected patients. This study confirmed that the compositions and target search systems contemplated herein are effectively applied for quantitative genetic analysis of cfDNA.

Method DNA purification Eight sets of plasma samples were prepared from Proteinex, Inc. , Culver City, purchased from CA (Table 8). Circulating DNA was extracted from the sample (twice separately) using the Circulating Nucleic Acid Purification Kit from Qiagen. The sample was passed through a DNA mini column using centrifugation. Table 8 shows the sample ID and the yield of DNA.

Library construction 4 mL of purified DNA from plasma was collected in 100 μl of elution buffer. For four samples taken from a colon cancer patient (CRC), the DNA was split in half and one 50 μl aliquot from each patient was sonicated to 200 bp. One 50 μl aliquot of untreated cfDNA and one 50 μl fragmented cfDNA from each patient (all samples from each patient).
6 μl of 10X quick blunt buffer (New England Biolabs (NEB))
-0.6 μl of 10 mM dNTP
-2.4 μl quick brant enzyme mix-End repair by adding 1.2 μl PreCR enzyme mix (per sample).
Samples were incubated at 20 ° C for 30 minutes and at 70 ° C for 10 minutes.
60 μl end-repaired cfDNA
・ 12 μl adapter double chain (10 μM)
10 μl 10X ligase buffer (NEB)
15 μl 50% PEG ₈₀₀₀
-Ligation with the adapter (Table 2) was performed by combining 3 μl HC T4 DNA ligase.

The reaction was incubated at 22 ° C. for 1 hour and 65 ° C. for 10 minutes. The ligation product was purified by addition of 100 μl beads, washing and elution with 40 μl TEzero. All 40 μl of ligation products were amplified by PCR with primer ACA2 (SEQ ID NO: 283) and combined at the same mass for targeted capture.

Targeted sequence capture and sequencing Four unfragmented and four fragmented colonic plasma samples (FIG. 9C) were hybridized with our high-density, 40-nucleotide probe set specifically targeting TP53, ALK. .. The capture complex was treated as described in Example 2 above.

Results Library Appearance A colored photograph of a 2% agarose gel loaded with 50 ng of each library is shown in FIG. 9A. The average fragment size was in the narrow range of 260 ± 20 bp. These data showed that the cloneable fraction of cfDNA was predominantly present as a nucleosome fragment. In addition, the size of the cfDNA library is cfDNA of renal dialysis patients (Atamaniuk et al., Clinical Chemistry Vol. 52 (3): 523-, except that the cfDNA library was shifted to a higher mass by the addition of the adapter sequence. It had the same basic surface appearance as on page 26 (2006) (Fig. 9B). In contrast, the cfDNA library was dramatically different from the sonicated gDNA library, which appeared as a broad smear.

An additional four sets of the cfDNA library were constructed from two plasma samples from ovarian cancer patients and two plasma samples from healthy volunteers. 38 μl of cfDNA aliquot was terminally repaired in a total volume of 50 μl. The ligation contained 40 μl of terminal repair fragments, 16 μl of adapter (10 μM), 8 ul of 10X ligase buffer, 16 μl of 50% PEG and 4 μl of HC T4 DNA ligase in a total volume of 80 μl. The ligation reaction was incubated at 20 ° C. for 1 hour and at 65 ° C. for 10 minutes. For purification, 20 μl TEzero and 150 μl beads were added. The purified ligation product was resuspended in 40 μl, all of which was used for subsequent 200 μl library amplification by PCR. The obtained amplification library is shown in FIG. 9C.

Sequencing Data Analysis The average number of unique reads observed in each of the eight libraries ranges from about 700 unique reads to> 3000 unique reads, which is about 0.15% to about 0.03% sensitive. Specify the range of. FIG. 10. Infrequent mutant reads are more likely to be observed more than once, which means that the lowest sensitivity is lower than that calculated above. In a preferred embodiment, the unique read provides a statistically valid lower bound for observation frequency.

cfDNA cloning efficiency Sample 23407 was used as a reference. 10 ng / mL cfDNA was recovered from plasma samples and 20 ng of isolated cfDNA was used for each of the two library building efforts. The number of unique reads indicates that we recovered an average of 700 unique reads (genome equivalents) from unfragmented DNA (“23407” in FIG. 10). Given that each genome contains 0.003 ng of gDNA, 2.1 ng of input DNA (10% cloning efficiency) in this library was recovered.

Fragmentation prior to library construction in this sample increased library yield by more than 2-fold (“23407 frag” in FIG. 10). This indicates that much of the DNA present in the 23407 sample was high molecular weight DNA that required fragmentation because it was cloneable. Therefore, library cloning efficiency was likely to be much higher than 10% and likely to be in the 20% range of input cfDNA. This cloning efficiency was comparable to highly purified genomic DNA, indicating that cfDNA was unlikely to be modified in any way that was detrimental to downstream cloning efforts.

Library coverage The cfDNA library resembled a set of individual bands with random target region coverage. FIG. 11 shows random sampling of sequence data. Random sets of reads from sample 23407 that were not fragmented prior to cloning (see FIG. 10) and were captured by the TP53 probe "chr17: 7579351: region_3: 280nt: 41: 80: r" (SEQ ID NO: 201). Aligned using BLAT. Given the method by which the samples were prepared, these are generally likely to be reflections of the cfDNA fragment. This is because the left part of these leads (lead start site) is randomly distributed over the entire target region. This random distribution indicates random disruption of genomic DNA, demonstrating that the sequencing output was random target region coverage despite the band-like appearance of the cfDNA library. This random distribution is important for effective genetic analysis using the techniques contemplated herein.

FIG. 12 provides an overview of the higher resolution of TP53 coding region sequencing for a typical pfDNA library. The elements of target sequencing-coverage across all target areas and uniform depth at each sequenced base-are obvious. Mutation detection sensitivity for this particular library is approximately in 2000 sequences, at this depth of more than 4000 unique reads per base, and with the precondition that orthodox candidate base changes must be encountered at least twice. It is possible to estimate that it was one mutation, ie 0.05%. This sensitivity level represents amazing, unexpected, and exceptional technological achievements.

Conclusion CfDNA was isolated and cloned from plasma clones with the same efficiency as highly purified gDNA (criteria) isolated from cell lines. The cfDNA library resembled a circulating nucleosome-sized DNA fragment + adapter, with sufficiently random features at the ends that allowed efficient gene analysis. In addition, the highly uniform size inherent in the plasma cfDNA library provides a capture strategy and underlying probe to maximize reliable coverage of targets as far as 120 bp (= 160-40) from the probe end. Allows array design.

(Example 4)
Measurement of Genome Equivalents in Circulating DNA Libraries Objective and Background One of the major challenges in the analysis of circulating and cell-free DNA is the achievement of sufficient assay sensitivity. If sufficient sensitivity is not achieved, analysis of the cfDNA library is confounded. If the sample is sequenced and no mutational events are detected, the result may be interpreted to mean that no mutations are present or that significant events were missed because the sample extraction depth was too small. Assay sensitivity is defined in statistical terms as a false negative rate. A significant impairment associated with circulating, cell-free DNA sequencing is the detection of infrequent sequences mixed in with a large excess of reference sequences.

One method of determining assay sensitivity is to measure the incidence of mutant sequences in a set of samples that gradually dilute the mutant sequences into non-mutant reference sequences. Assay sensitivity is defined by the dilution at which the mutant sequence is no longer detected. This method is suitable when both the identity and dilution of the mutant sequence are known. Unfortunately, clinical samples generally do not provide either parameter. In many cases, the identity of the mutant sequence is unknown and the dilution will vary from sample to sample. In this regard, assay sensitivity is established on a sample-by-sample basis.

To assign sensitivity values to each sample, measure the number of different distinct sequences present in each sample by measuring the number of genomic equivalents present in the sequencing library. As a non-limiting example, a DNA sequencing library is known to contain 3 ng (3000 pg) of human genomic DNA, and if each human genome has a mass of 3 pg, the library is 3000 of DNA. ÷ 3 = 1000 genome equivalents. If the mutant DNA sequence must be detected twice for statistical significance, the highest possible detection sensitivity for this particular library is 2 mutant sequences ÷ 1000 full sequences = 0.002 = 0. .2%. To establish sensitivity, the number of genomic equivalents must be measured for each sample library.

Summary Genome equivalents were measured using two methods. The first method is based on quantitative PCR (qPCR). A genomic library using a ligation of the adapter to the genomic fragment and a pair of PCR primers, one specific for a common genomic sequence (eg, Alu I repeats) and one specific for the adapter. Was built. The abundance of ligated adapter: fragment sequences in these cfDNA libraries was measured. A standard curve was constructed using a standard library of known concentrations, measurements were fitted to the resulting standard curve, and genomic equivalent values were derived from the fit.

A second method for measuring genomic equivalents used bioinformatics counting after sequencing. Each unique sequence in the library was identified by its random sequence label and the starting molecule of the genomic sequence. In addition, each unique sequence must be derived from an independent genome. Therefore, the sum of the unique sequences present in the sequence data established an accurate quantitative measure of the number of genomic equivalents present in the sample.

Methods and Results qPCR Assay Development The first version of the qPCR-based genomic equivalent assay used ACA2 primers (Table 10), which chronically underestimated the number of genomic equivalents present in the cfDNA library. Report (Fig. 13).

An improved version of the assay was based on endogenous repetitive sequences (eg, Alu repetitive sequences) found very frequently throughout the human genome. By pairing the Alu-specific primer with the adapter-specific primer, the frequency with which the adapter was ligated to the genomic fragment was reliably measured. A standard curve was created using a library of known genomic equivalents, and the number of genomic equivalents in the cloned library was measured by fitting to that curve.

Table 10 shows the PCR primers used to develop the Alu + adapter-based qPCR assay. PCR primers for Alu amplification are consensus human Alu sequences (Batzer and Deininger, Nat Rev Genet., Volume 3 (No. 5) 370-) using Primers 3 (Alu_F1 and Alu_R1, SEQ ID NOs: 285 and 286, respectively).
Designed from page 9 (2002). The remaining two Alu primers (Alu_F2 and Alu_R2, SEQ ID NOs: 287 and 288, respectively) are described in the literature (Marullo et al., Genome).
Biology Vol. 11: R9 (2010)).

A schematic diagram of the assay design is shown in FIG. Since a single PCR primer can be used to amplify the genomic DNA library (FIG. 14A), a primer that recognizes the adapter sequence but cannot amplify the genomic clone was used. The 58 nucleotide ACA2-FLFP primer (hereinafter abbreviated as AF, SEQ ID NO: 284) meets these criteria as its length induces strong stem-loop PCR inhibition (FIG. 14B). In addition, a functional Alu primer pair was used (FIG. 14C). In addition, a primer pair consisting of one Alu primer and a long ACA2 primer that does not amplify genomic DNA was used (FIG. 14D). These same primers also amplified the genomic library clone (Fig. 14E).

All of the required elements of the functional Alu-based assay have been validated. FIG. 15. Specifically, long primers alone are inactive, both sets of Alu primer pairs recognize human genomic DNA, and any combination of one Alu primer and long ACA2 primer amplifies the genomic library clone. (Fig. 15A). Finally, FIG. 15B shows the ability of the Alu primer + long ACA2 primer pair to distinguish between genomic DNA and genomic library clones. The combination of Alu_R1 and AF primers was used to measure genomic equivalents in the newly constructed library.

A direct comparison between the ACA2-based qPCR assay and the Alu-based qPCR assay is shown in FIG. An eight-fold difference in genomic equivalent was found. In addition, the Alu-based assay resulted in more consistent performance between libraries and a better alignment of qPCR-derived equivalents with tag equivalents counted by bioinformatics in the sequencing run (Table 11).

Sensitive Library Adapters for Sequence-Based Counting of Genome Equivalents As discussed above, mutant sequences are a low frequency component in other large excesses of "normal" (germline) DNA sequences. It is the reality of disease monitoring using cfDNA. Therefore, there is a need for highly sensitive and quantifiable sequencing assays. Assay sensitivity could be generated by counting the number of unique sequences present in the sequencing library. However, such counting would lead to false underestimation of sensitivity. This is because the cfDNA fragment is fairly short (about 165 bp) and can actually result in the same read from an independent cloning event. One solution to this problem is to mark each independent sequencing clone during library construction, for example, by including a set of DNA tags in the adapter used to build the library. ..

Such a library construction adapter set, specifically the number of genomic equivalents present in the cfDNA library, and its extension, measures the sensitivity of the sequencing assay used to monitor the mutant sequence. Designed to be.

FIG. 17 shows the structure of a sensitive library adapter configured to accommodate a large number of genomic equivalents in the cfDNA library. Within the 45 nucleotide ligation strand, which is the strand bound to the terminally repaired cfDNA fragment, there is a significant amount of engineered molecules. The adapter contains at least 5 elements.

Element 1 is the PCR primer binding site for the single primer library amplification primer ACA2 (Table 12).

Element 2 is a 5 nucleotide read code. The combination of this code and the genomic DNA sequence constitutes the DNA tag used to uniquely identify each read. The 5-nucleotide code consists of 256 possible unique sequences selected to differ by 2 bases from all other codes in this set. This feature makes it possible to distinguish between unique and distinct reads and reads that appear unique due to sequencing errors in the code area. By removing the seven codes that were over-presented with G residues and that were experimentally proven to interfere with adapter function, 249 random codes remained. Table 13.

Element 3 is a 3-nucleotide sample code that differs by at least 2 bases. This element was used to identify different samples and allowed sample multiplexing during sequencing runs. Table 14.

Element 4 is a 12 nucleotide anchor sequence with three important properties for library construction and downstream sequencing. Table 15. These properties are as follows: A) Part of a family of four 12-base extensions, where each of the 12-base extensions collectively represents each of the four possible DNA bases at each site within the extension. Is. This feature, balanced base presentation, is required by Illumina sequencing equipment to calibrate proper base calling in sequencing reads. B) Each extension consists of only two of the four possible bases, which are specifically selected to be either six A + six C or six G + six T. This extension, formed from only two bases, greatly reduces the likelihood that the extension sequence will be involved in secondary structure formation, which would make proper adapter function impossible. C) Since each extension consists of the same number of A + C or G + T, each extension shares approximately the same melting temperature and double-stranded stability as all other extensions in a set of four.

Element 5 is a two-base sequence found at the 3'end of element 4. Specific 2-base extensions were selected based on experimental data showing that these 2-base sequences are efficient substrates for ligation. Table 15.
4.

Hybridize the adapter module to the partner oligonucleotide. Table 16. Hybridization of the sequence in element 4 with the partner oligonucleotide is performed. The double-stranded adapter was ligated to end-repaired cfDNA.

Convert a set of 256 independently synthesized and pooled ligation strands, each of which shares a common sample code and thus constitutes a single sample adapter set, into a double strand suitable for ligation. The 45 nucleotide ligation strand was combined with the appropriate complementary 12 nucleotide partner strand, heated to 95 ° C., cooled to 65 ° C. for 5 minutes, and then cooled to room temperature. The double strand formed a blunt-ended ligation substrate as shown in FIG. 17B. After ligation and DNA purification, the partner strand was replaced by a DNA polymerase-mediated step performed prior to PCR amplification and the ligation strand was copied to form a double-stranded adapter suitable for exponential amplification by single primer PCR.

Next, a quantitative analysis of genomic equivalents derived from targeted sequencing data was performed. Each unique read was considered a unique ligation event and the sum of the unique reads was considered equal to the number of genomic equivalents analyzed.

Rough, "easy-to-calculate" and "rough" calculations were performed to determine the number of genomic equivalents that could be analyzed. Each cfDNA clone had approximately 150 base pairs, of which 50 base pairs were required for binding to the capture probe. This left approximately 100 possible sequence initiation sites in any captured cfDNA clone. By binding 249 random codes to each of the 100 potential initiation sites, a complete repertoire of approximately 249,000 potential unique clones was generated. When the number of unique clones approaches the total number of possible sequence combinations, the probability is that the same code and origin combination will result from independent events, and these independent events are improperly grouped within a single family. It is decided that it will be transformed. The end result is an underestimation of the genomic equivalents analyzed, and infrequent mutant reads overlap with wild-type reads with the same identifier and may be disposed of as a sequencing error. To avoid this, efforts were made to limit genomic input to one-tenth or less of the number of possible unique clones using the qPCR assay. For example, a single adapter has 24,900 potential clones and thus has the reliable ability to provide accurate analysis of a library consisting of 2500 or less genomic equivalents.

The schematic procedure is provided by way of example and is not intended to limit the methods contemplated herein by this embodiment. In some cases, the number of genomic equivalents analyzed may well exceed the 2500 limit described in the previous paragraph. Two solutions to this problem can be readily obtained to increase the depth of genomic equivalents. The first solution is to use more than one adapter set per sample. By combining adapters, it is possible to increase the total number of possible clones, and thus to a satisfactory limit of genomic input. As a non-limiting example, a combination of four adapter sets used for one sample has a possible sequence of 24,900x4 = 99,600 for analysis, and a rationally analyzed genomic equivalent of about 10,000. Will be expanded to. The second solution is to extend the code for element 2 in FIG. 17A to 6, 7 or more bases. The number of possible codes that differ from all other codes by at least 2 bases is 4 ^(n-1) , where n is the number of bases in element 2. Therefore, in the non-limiting examples presented here, n = 5 and 4 ^(5-1) = 256. Therefore, by including additional bases, the available repertoire is expanded by a factor of 4 for each additional base.

CONCLUSIONS The results from this example showed that two independent methods for determining genomic equivalents helped the workflow of processing samples. The first method, qPCR, was performed during the library building phase of cfDNA analysis and used as a quality control step to ensure that a reasonable number of genomic equivalents were driven by library amplification, targeted sequence capture and DNA sequencing. Other methods use a clear count of unique reads as a more direct measure of the actual number of genomic equivalents that fall into the informatics considerations.

(Example 5)
Quantitative Gene Analysis Objectives The objective of this example is to apply quantitative genetic analysis to cancer genomes mixed with normal DNA and to uncharacterized cfDNA isolated from plasma of cancer patients. Met.

Background Three types of genomic events are common in human cancer. These are somatic mutations that alter the function of the affected gene and its expressed protein products; genomic rearrangements that give rise to chimeric gene fusions with novel biological properties and thus expressed fusion proteins; and gene reduction and underproduction of gene products. Changes in gene copy count leading to expression, or conversely, gene amplification and overpresentation of the corresponding gene product. In the case of circulating DNA in cancer patients, many of these abnormal loci are of great significance in deriving patient care and are mixed (mixed) with the patient's normal germline DNA. ing).

Overview In the previous example, we described techniques configured for the analysis of circulating, cell-free DNA (cfDNA) for the purpose of cancer monitoring. However, this technique is an all-analysis, diagnostic and monitoring paradigm where circulating DNA is a potential analytical material, including but not limited to genetic disorders, fetal testing, Mendel-type genetic disorders, pathogen screening and organ transplant monitoring. It is widely applicable to. In this example, the technical features highlighted in the previous example are applied to the analysis of mixed cancer samples. In the first stage of this verification, cancer-derived cell lines were mixed with normal human DNA at a specified dilution and quantitative genetic analysis was performed. In the second phase of this study, uncharacterized cfDNA was isolated from the plasma of cancer patients and then investigated using quantitative genetic analysis.

Method Mixing cell line genomic DNA with normal human DNA The following DNA samples were used:
NA06994-Normal Human Genome DNA (Coriell Repository),
NCI-H2228-illegal cell lung cancer cell line (ATCC), TP53 mutation (Q331 ^* ) and EML4-ALK gene fusion (cutting point unknown), and NCI-H69-small cell lung cancer cell line (ATCC), Has amplification of the MYCN gene (about 100 copies).

Library preparation: Genomic DNA isolated from cell lines (all three above) is a high molecular weight substance that differs from the small size of cfDNA. In these validation experiments, genomic DNA was first fragmented at a "150 bp" setting using the Coveris Acoustic Sonicator to mimic cfDNA. This sonication generally produced wide smears and further processed the DNA using "bilateral" bead selection. A dilute solution of purified DNA beads was added to the sample and the higher molecular weight fragments adhering to the beads were discarded (the size of the purified DNA is proportional to the amount of beads added). An additional aliquot of the beads is added to the residual supernatant and in this second round it is added to the DNA attached to the beads and purified (in a higher total concentration of binding buffer). This "bilateral" purification results in a narrow size distribution that is a reasonable substitute for cfDNA (FIG. 18).

Fragmented genomic DNA is terminally repaired, quantified, mixed in various ratios shown in Table 17, and described in the Results section below.

The cfDNA library can have limited DNA input. The amount of cfDNA obtained per 1 mL of patient plasma can vary widely, but the lower limit (eg, Example 3) is generally about 10 ng / mL, which is equivalent to the 3300 human genome. To prepare for the limited amount of cfDNA, the mixed experiment was modeled to reflect the lower limit of cfDNA routinely harvested from the patient. This constraint was applied to everything except the most extreme mixes. In a mixture of these latter, the library was made to mimic the input from 4 mL (NA06994: H2228 1000: 1) or 8 mL (NA06994: H69 500: 1) low yield patient cfDNA. The mixed sample was then ligated to the adapter set described in Example 4. Genomic equivalent measurements (Example 4) in each purified library using qPCR are also shown in Table 17. Libraries were amplified and quantified, and the equivalent mass of each library (500 ng each) was pooled. The pooled sample was hybridized with the proof-of-concept, high density 40mer capture probe listed in Table 6 of Example 2. The resulting complex was captured on streptavidin-coated beads, washed, treated, amplified, purified and sized as described in the previous example. The resulting library was analyzed on an Illumina MiSeq device using the Illumina 150bp-V3 Miseq sequencing kit.

For bioinformatics analysis, use in-house analysis to detect mutations using a low-frequency somatic variant caller, detect fusion genes using a split read aligner, and quantify and statistically fit tags. Called copy number variation (CNV).

The detection of a mixed point mutation in the TP53 gene is shown in FIG. Since it is known that TP53 is hemizygous in the NCI-H2228 cell line, the "expected" frequency falls outside the mixing ratio. The automated software was able to call a 50: 1 mixed mutant allele. Manual curation was required to call the 1000: 1 mutation event. Regarding specificity, the tag filtering described in Example 1 was applied to the analysis, and no other mutant calls were detected in TP53 after applying this tag filter.

It is known that the cell line NCI-H2228 has a fusion gene of EML4 and ALK, and this cell line is used as a positive control both in fluorescence in situ hybridization and in the detection of fusion gene transcripts using RT-PCR. Useful. No report has been published on the exact location of the gene fusion junction. Using high-density probe coverage of the 19th intron region of ALK, sequence analysis revealed the exact location and sequence of the junction formed when the two genes fused (FIG. 20). The frequency of normal reads to junction reads in the NCI-H2228 cell line (378 vs. 249, respectively) suggests that the fusion gene is heterozygous with a normal copy of ALK.

The detection of junction reads as a function of mixing is shown in FIG. As with point mutation detection, expectations were adjusted to reflect that mutant alleles are found in one copy per diploid genome. No fusion leads were detected in the 1000: 1 mixed sample.

FIG. 22 shows the results of CNV determination for the MYCN gene as a function of mixing. The NCI-H69 cell line has a highly amplified MYCN gene. Since MYCN is usually found twice per diploid genome as a single copy gene, the expected result for a gradually diluted mixture is that the tag calculation CNV should asymptotically approach 2 copies. (Emphasize the asymptote in the figure). The validation experiments presented herein have shown that the assay system described in the present invention is robust to highly amplified genes.

Finding Variants in cfDNA from Cancer Patients The most rigorous validation of the technique contemplated herein is the application of the technique to cfDNA samples whose mutation spectrum is unknown. The analysis was performed by sequencing matched cfDNA, tumor and normal adjacent tissue (NAT) samples from two ovarian cancer patients. In addition, two cfDNA samples from colorectal cancer (CRC) patients and two cfDNA samples from healthy volunteers were analyzed. In all cases, mutations, fusions and abnormal CNVs were not detected in healthy volunteer samples.

First, a library of cfDNA from 4 cancer patients was screened using the targeted probes listed in Table 6 of Example 2. These probes were primarily configured to detect point mutations in the TP53 gene, gene fusion with ALK, and amplification of MYCN. The result of this initial sequencing screen is shown in FIG. Point mutations occurring at the same base position were found in cfDNA, tumor and NAT in one ovarian patient. No TP53 mutations were found in other sets of matched samples from patients with ovarian cancer. Point mutations were also detected in two CRC cfDNA libraries for which no matching tissue was available. All of these point mutations have been previously identified in tumors and all are known to be causative drivers of tumor development. Mutant sequence detection in the 0.9% cfDNA library CRC406 was well within assay sensitivity. Sensitivity is defined by the presence of multiple families of tagged reads, all with mutant sequences. These data underscore the clinical usefulness of the system contemplated herein.

To further explore the detection of cancer-related changes in the cfDNA library and related tissues, the same library is hybridized to a set of 679 probes directed to a total of 20 different cancer-related genes (Table 18). I let you. The probe set targeted the entire coding region of 14 genes, while the remaining 6 genes targeted the selective loci.

As shown in FIG. 24, the OVA1 sample with no detectable change in TP53 had a mutation in KRAS, which mutation was found in both cfDNA and the corresponding tumor. This observation highlights the significant features of the assay system described herein. Libraries generated from cfDNA can be examined with hundreds and even thousands of targeting probes (as in this example). Sequencing of the resulting targeted library revealed somatic mutations that were present in the tumor and not in the germline of the affected individual. These tumor-related somatic cell markers can also be used to quantify the amount of circulating DNA excreted from a tumor (relative to cfDNA having a germline sequence). Therefore, the discovery of mutations also estimates the tumor content in the mixed cfDNA, regardless of their biological significance.

Many targeted therapies have been most successful in the presence of normal genes (eg, EGFR inhibitors only work in the presence of wild-type KRAS). Quantitative assessment of circulating tumor DNA levels is especially significant in these cases where no gene mutations are found. In other words, the demonstrable presence of circulating tumor DNA, coupled with wild-type sequencing results at specific target genes, suggests that the target genes are normal within the tumor, and such results suggest that the therapy It can have a significant effect on the induction of selection. The above also applies to the OVA1 sample highlighted in FIG. The presence of KRAS mutations in the cfDNA library suggested that the patient's tumor had the wild-type TP53 gene.

Another example of abnormal gene discovery is shown in FIG. A targeted quantitative gene analysis system revealed the presence of significant amplification in the ERBB2 gene, paraphrased as HER-2 / neu. This type of amplification is widely published for breast cancer, but may also be identified for colorectal cancer.

CONCLUSIONS Verification experiments with cell line DNA have revealed thresholds for the detection of three types of genetic variation that are central to driving neoplasmic growth in cancer. Characterization of cfDNA from cancer patients revealed tumor-related gene changes well above the threshold set by reconstitution experiments in all four analyzed samples. These data indicate that the quantitative analysis contemplated herein may have clinical utility, especially in situations where liquid biopsy is most appropriate.

In general, the terms used in the claims below should not be construed as limiting the scope of the claims to the specific embodiments disclosed herein and in the claims, and such claims. It should be interpreted that the scope of is to include all possible embodiments as well as the entire range of equalities to which it is entitled. Therefore, the scope of the claims is not limited by the present disclosure.
For example, the present invention provides the following items.
(Item 1)
A method for gene analysis of cell-free DNA (cfDNA).
(A) A step of treating cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA.
(B) A step of ligating one or more adapters to each end of the terminal repair cfDNA to generate a cfDNA library.
(C) A step of amplifying the cfDNA library to generate a cfDNA library clone,
A method comprising: (d) determining the number of genomic equivalents in the cfDNA clone library and (e) performing quantitative gene analysis of one or more target gene loci in the cfDNA library clone.
(Item 2)
The method of item 1, further comprising the step of isolating cfDNA from a biological sample of interest.
(Item 3)
Item 1 or item, wherein the cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, ophthalmic fluid, urine, saliva, feces, mucus and sweat. The method according to 2.
(Item 4)
The method according to any one of items 1 to 3, wherein the one or more adapters include a plurality of adapter types.
(Item 5)
The method of any one of items 1-4, wherein each of the one or more adapters comprises a primer binding site for amplification of the cfDNA library.
(Item 6)
The method of any one of items 1-5, wherein each of the one or more adapters comprises one or more unique read cords.
(Item 7)
The method of any one of items 1-6, wherein each of the adapters comprises one or more sample codes for sample multiplexing.
(Item 8)
The method of any one of items 1-6, wherein each of the adapters comprises one or more sequences for DNA sequencing.
(Item 9)
The method according to any one of items 1 to 8, wherein qPCR is performed on the cfDNA clone library and the qPCR measurement value is compared with a standard of known genomic equivalents to determine the genomic equivalent of the cfDNA clone library. ..
(Item 10)
9. The method of item 9, wherein the qPCR is performed using a primer that binds to the Alu sequence and a primer that binds to the sequence in the adapter.
(Item 11)
The method according to any one of items 1 to 10, wherein the quantitative gene analysis is performed on a plurality of gene loci in the cfDNA library clone.
(Item 12)
The method according to any one of items 1 to 11, wherein the quantitative gene analysis is performed on a plurality of gene loci in a plurality of cfDNA clone libraries.
(Item 13)
The item according to any one of items 1 to 12, wherein the quantitative gene analysis comprises hybridizing one or more capture probes to a target gene locus to form a capture probe-cfDNA clone complex. Method.
(Item 14)
13. The method of item 13, wherein the quantitative gene analysis comprises isolating the capture probe-cfDNA clone complex.
(Item 15)
14. The method of item 14, wherein the quantitative genetic analysis comprises amplifying the cfDNA clone sequence in the isolated hybridized capture probe-cfDNA clone complex.
(Item 16)
The method according to any one of items 1 to 15, wherein the quantitative gene analysis comprises DNA sequencing for generating a plurality of sequencing reads.
(Item 17)
16. The method of item 16, further comprising bioinformatic analysis of the plurality of sequencing leads.
(Item 18)
Bioinformatics analysis,
(A) To quantify the number of genomic equivalents analyzed in the cfDNA clone library.
(B) To detect gene variants at target gene loci
(C) To detect mutations in target gene loci
The method according to any one of items 1 to 17, which is used for (d) detecting gene fusion within a target gene locus and (e) measuring an increase or decrease in the number of copies within a target gene locus.
(Item 19)
The method according to any one of items 2 to 18, wherein the subject does not have a genetic disorder.
(Item 20)
The method according to any one of items 2 to 18, wherein the subject has not been diagnosed with a genetic disease.
(Item 21)
The method according to any one of items 2 to 18, wherein the subject has been diagnosed with a genetic disease. (Item 22)
21. The method of item 21, wherein the quantitative genetic analysis is used to identify or detect one or more genetic lesions that cause or are associated with the genetic disorder.
(Item 23)
22. The method of item 22, wherein the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in the number of copies, or a gene fusion.
(Item 24)
22. The method of item 22, wherein the gene lesion comprises a genomic rearrangement that fuses the 3'coding region of the ALK gene to another gene.
(Item 25)
24. The method of item 24, wherein the 3'coding region of the ALK gene is fused to the EML4 gene.
(Item 26)
The method according to any one of items 22 to 25, wherein the genetic disease is cancer.
(Item 27)
The method according to any one of items 2 to 18, wherein the subject is pregnant.
(Item 28)
27. The method of item 27, wherein the quantitative gene analysis is used to identify or detect one or more gene variants or genetic lesions at one or more target gene loci in fetal cfDNA.
(Item 29)
The method according to any one of items 2 to 18, wherein the subject is a transplant recipient.
(Item 30)
27. The method of item 27, wherein the quantitative genetic analysis is used to identify or detect donor cfDNA in the subject.
(Item 31)
A method of predicting, diagnosing or monitoring a genetic disorder in a subject.
(A) A step of isolating or obtaining cfDNA from a biological sample of interest,
(B) A step of treating the cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA.
(C) A step of ligating one or more adapters to each end of the terminal repair cfDNA to generate a cfDNA library.
(D) A step of amplifying the cfDNA library to generate a cfDNA clone library.
(E) Steps to determine the number of genomic equivalents in the cfDNA clone library, and (f) Quantitative gene analysis of one or more target gene loci associated with the genetic disorder in the cfDNA clone library. A method of identifying or detecting one or more genetic lesions at said one or more target gene loci, comprising performing steps, predicting the prognosis of said genetic disorder, diagnosing it, or monitoring its progression. ..
(Item 32)
29. Item 29, wherein the cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, ophthalmic fluid, urine, saliva, feces, mucus and sweat. the method of.
(Item 33)
29. The method of item 29, wherein the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in copy count, or a gene fusion.
(Item 34)
31. The method of item 31, wherein the gene lesion comprises a genomic rearrangement that fuses the 3'coding region of the ALK gene to another gene.
(Item 35)
32. The method of item 32, wherein the 3'coding region of the ALK gene is fused to the EML4 gene.
(Item 36)
The method according to any one of items 29 to 32, wherein the genetic disease is cancer.
(Item 37)
Companion diagnostics for genetic disorders
(A) A step of isolating or obtaining cfDNA from a biological sample of interest,
(B) A step of treating the cfDNA with one or more terminal repair enzymes to produce terminal repair cfDNA.
(C) A step of ligating one or more adapters to each end of the terminal repair cfDNA to generate a cfDNA library.
(D) A step of amplifying the cfDNA library to generate a cfDNA clone library.
(E) Determine the number of genomic equivalents in the cfDNA clone library, and (f) perform quantitative genetic analysis of one or more biomarkers associated with the genetic disorder in the cfDNA clone library. Companion diagnostics comprising the step, the detection or failure to detect at least one of the one or more biomarkers indicates whether the subject should be treated for the genetic disorder.
(Item 38)
35. Item 35, wherein the cfDNA is isolated from a biological sample selected from the group consisting of amniotic fluid, blood, plasma, serum, semen, lymph, cerebrospinal fluid, ophthalmic fluid, urine, saliva, feces, mucus and sweat. the method of.
(Item 39)
35. The method of item 35, wherein the biomarker is a genetic lesion.
(Item 40)
37. The method of item 37, wherein the genetic lesion comprises a nucleotide transition or transversion, a nucleotide insertion or deletion, a genomic rearrangement, a change in the number of copies, or a gene fusion.
(Item 41)
37. The method of item 37, wherein the gene lesion comprises a genomic rearrangement that fuses the 3'coding region of the ALK gene to another gene.
(Item 42)
39. The method of item 39, wherein the 3'coding region of the ALK gene is fused to the EML4 gene.
(Item 43)
The method according to any one of items 35 to 40, wherein the genetic disease is cancer.

Claims (1)

The invention described in the specification.

Images