JP2021119750A - Proliferation method for swine delta coronavirus - Google Patents

Abstract

To provide a production method for swine delta coronavirus, and the like.SOLUTION: A method for producing swine delta coronavirus includes the steps of inoculating swine delta coronavirus into an embryonated egg within 8 days from incubation, culturing the embryonated egg to proliferate the virus, and recovering, from the embryonated egg, egg contents containing the virus.SELECTED DRAWING: None

Description

The present invention relates to a method for propagating porcine delta coronavirus, and more particularly to a method for producing the virus, a method for producing a vaccine containing the virus, and a method for testing the virus using the method.

Porcine epidemic diarrhea virus (PDCoV) attracted attention because it was newly isolated from individuals with diarrhea not caused by PEDV during the outbreak of Porcine Epidemic Diarrhea Virus (PEDV) in North America that began in 2014. rice field. Since then, reports of diarrhea epidemics due to porcine delta coronavirus have been reported one after another in many countries including Japan, and vaccine development against porcine delta coronavirus is being sought after worldwide.

The porcine delta coronavirus has only been studied for about 6 years since it was started as a virus that is pathogenic to pigs. Therefore, there is almost no technology that can handle the virus. At present, the method of propagating the virus without infecting pigs with swine delta coronavirus is the LLC-Pocine Kideney (PK) cell, which is a swine kidney-derived cell line, or the swing testicular cell, which is a swine testis-derived cell line. (Non-Patent Document 1) has been reported.

However, culturing such cells requires highly specialized techniques (skilled aseptic technique, etc.). Furthermore, the production of a vaccine by such a method requires a large-scale facility because a large amount of cells need to be cultured. In addition, in the process of carrying out mass culture, in order to proliferate the established cells, it is necessary to carry out a treatment for cell dispersion represented by trypsin treatment. However, since the medium for culturing the cells contains serum derived from bovine fetal inactivating trypsin, the work of washing it is required. Furthermore, fetal bovine serum that can be used for culturing may contain unknown pathogens and toxic chemical substances, which poses a safety problem.

Therefore, there is a demand for the development of a method for efficiently propagating porcine delta coronavirus without using cultured cells, but there is no such method yet.

International Publication No. 2009/050390

Hu H, et al. , J Clin Microbiol, 53, 1537-1548. (2015)

The present invention has been made in view of the above-mentioned problems of the prior art, and an object of the present invention is to provide a method for multiplying a porcine delta coronavirus.

The present inventors have conducted intensive studies to achieve the above object, and have focused on a method using a developing chicken egg (for example, Patent Document 1), which is used for propagating an influenza virus. Such a method is a method of infecting a developing chicken egg with an influenza virus, culturing the virus, and then recovering the virus that has propagated from the urinary tract fluid (serum). Infectivity to chickens, etc.) has not been shown. Therefore, it was not clear whether the virus could infect the developing chicken eggs and propagate.

Therefore, the present inventors investigated the proliferation of porcine delta coronavirus in embryonated chicken eggs. As a result, the growth of porcine delta coronavirus could not be detected in the embryonated chicken eggs used for the growth of influenza virus on the 10th to 12th days of incubation. On the other hand, it was found that porcine delta coronavirus can be propagated if the eggs are developed within the 8th day of incubation.

Furthermore, it was clarified that the virus can also be propagated by inoculating a developing chicken egg with a fecal sample. Since feces contain a large amount of protein that inactivates trypsin, it is extremely difficult to proliferate the porcine delta coronavirus in the fecal sample by the method using cultured cells, and thus to test it. On the other hand, since it is possible to propagate the virus by inoculating a stool sample into a developing chicken egg, it is also possible to test the porcine delta coronavirus on the sample, and to complete the present invention. I arrived.

That is, the present invention specifically provides the following with respect to a method for producing a porcine delta coronavirus using a developed chicken egg, a vaccine containing the virus, and a method for testing the virus.
<1> A method for producing porcine delta coronavirus.
The process of inoculating porcine delta coronavirus into embryonated chicken eggs within 8 days of incubation,
A method comprising a step of culturing the developed chicken egg to propagate the virus and a step of recovering the egg contents containing the virus from the developed chicken egg.
<2> A method for producing a vaccine containing porcine delta coronavirus.
The process of inoculating porcine delta coronavirus into embryonated chicken eggs within 8 days of incubation,
A step of culturing the developed chicken egg to propagate the virus,
A step of recovering the egg contents containing the virus from the growing chicken egg,
A method comprising the step of isolating the virus from the egg contents and mixing it with a pharmacologically acceptable carrier or vehicle.
<3> This is a test method for porcine delta coronavirus.
The process of inoculating a test sample into a developing chicken egg within 8 days of incubation,
The step of culturing the developed chicken egg,
A step of detecting the porcine delta coronavirus in the developed chicken egg, and a step of determining that the test sample contains the virus when the growth of the porcine delta coronavirus is detected in the step. Including, method.
<4> The method according to any one of <1> to <3>, wherein the inoculation site of the porcine delta coronavirus or the test sample is in the allantois cavity of the developing chicken egg.
<5> The method according to any one of <1> to <4>, wherein the growing chicken egg inoculated with the porcine delta coronavirus or the test sample is a growing chicken egg 5 to 7 days after incubation.

According to the present invention, it is possible to provide a method for producing a porcine delta coronavirus. As shown in Examples described later, in order to obtain the amount of virus contained in 10 ml of allantois cavity fluid recovered from one developing chicken egg by cell culture, ^{2.37 1700 cm 2} cell culture roller bottles are also required. It becomes. As described above, according to the present invention, it is possible to produce a large amount of porcine delta coronavirus without requiring large-scale equipment or the like.

Further, in the virus propagation method using cultured cells such as LLC-PK cells, complicated work such as trypsin treatment and associated washing treatment is required. Furthermore, advanced cell culture technology is also required. On the other hand, in the present invention, the virus can be propagated only by directly inoculating a developing chicken egg with a sample containing the porcine delta coronavirus. In addition, the virus propagation method using embryonated chicken eggs makes it possible to propagate a large amount of virus in a short time by automation. As described above, according to the present invention, porcine delta coronavirus can be efficiently produced.

In addition, since feces that can contain porcine delta coronavirus contain a large amount of protein that inactivates trypsin, it is extremely difficult to propagate the virus in feces by the method using cultured cells. Become. On the other hand, according to the present invention, it is possible to propagate the virus by inoculating the developing chicken egg with feces. Therefore, it is possible to test the porcine delta coronavirus on the sample.

It is a graph which shows the difference in the susceptibility of a developing chicken egg to the pig delta coronavirus (PDCoV) by the difference in the number of incubation days. The virus solution was inoculated into the developing chicken eggs during the incubation period of 3 to 12 days, and the allantois cavity fluid was collected after 48 hours of incubation. Then, the amount of virus-derived gene contained in the recovered solution was detected by real-time RT-PCR. It is a graph which shows the difference in the susceptibility of a developing chicken egg to the pig delta coronavirus (PDCoV) by the difference in the number of incubation days. The virus was inoculated into the developing chicken eggs during the incubation period of 0 to 2 days, and the allantois cavity fluid was collected after 48 hours or 120 hours of incubation. It is a graph which shows the relationship between the passage number of the porcine delta coronavirus (PDCoV) using the developed chicken egg, and the growth efficiency of the virus. The embryonated chicken eggs were continuously passaged by inoculating 2,000 copies / 0.1 ml of virus, and the amount of virus gene contained in 10 ml of allantois cavity fluid was calculated by real-time RT-PCR.

(Manufacturing method of porcine delta coronavirus)
As shown in Examples described later, as a result of examining the proliferative potential of porcine delta coronavirus in embryonated chicken eggs, the pig delta coronavirus was used in the embryonic chicken eggs on the 10th to 12th days of hatching, which is used for the growth of influenza virus. The virus growth could not be detected. On the other hand, it was clarified that the porcine delta coronavirus can be propagated when the embryonated chicken eggs within the 8th day of incubation are used. Therefore, the present invention
The process of inoculating porcine delta coronavirus into embryonated chicken eggs within 8 days of incubation,
Provided is a method for producing a porcine delta coronavirus, which comprises a step of culturing the developed chicken egg to propagate the virus and a step of recovering the egg contents containing the virus from the grown chicken egg.

"Pig Deltacoronavirus (Porcine Deltacoronavirus) is also called PDCoV, PDCV, Wine Deltacoronavirus (SDCoV), and is a single-stranded (+) RNA virus of the order Nidovirales, Coronaviridae, Deltacoronavirus. It is a virus derived from pigs belonging to.

The porcine delta coronavirus to be inoculated into a developing chicken egg in the present invention is as described above, but it may be a sample containing not only the isolated virus itself but also the virus. Such "samples" include pig excrement / secretions (feces, urine, oral fluid, semen, etc.), pig-derived tissues, pig-derived cells, their cultures, lavage fluids or extracts, or pig breeding. Examples include cleaning solutions for the environment (breeding facilities, etc.) or cultures thereof. Further, as shown in Examples described later, such a sample may contain a substance showing toxicity to a growing chicken egg, and the sample may be appropriately diluted and filtered. For dilution, for example, water, physiological saline, buffer (phosphate buffer, phosphate buffered saline (PBS), Tris buffer, etc.), medium (Eagle's medium, DMEM medium, RPMI1640 medium, αMEM medium, etc.) ) Is used as appropriate. Further, the medium may contain a medium additive such as an antibiotic or serum. Dilution ratio is not particularly limited, those skilled in the art can appropriately adjusted according to the type of the sample. For example 10 to 10 ⁴ times, preferably ¹⁰ 2 to 10 ^3. Further, from the viewpoint of neutralizing and reducing the toxicity, a substance capable of neutralizing or reducing the toxic substance (for example, a chelating agent such as an EDTA compound, particles having a carbon structure (beads)) may be added to the sample. good.

The "developed chicken egg" inoculated with the above-mentioned pig delta coronavirus means a chicken egg obtained by mating and inoculated within 8 days. The type of chicken is not particularly limited, and examples thereof include white Leghorn, brown Leghorn, Bird Rock, Sussex, New Hampshire, Road Island, Australorp, Cornwall, Minorca, Amrox, California Gray, and Italian Partridge Color. Then, such chickens are bred, and the eggs obtained from the female chickens are usually stored at 10 to 20 ° C. As shown in Examples described later, the egg may not be confirmed to be a fertilized egg.

The "incubation" is then initiated by transferring to a temperature of 36-38 ° C. In the present invention, the incubation period under this temperature condition may be 8 days or less, preferably 0 to 7 days, more preferably 3 to 7 days, still more preferably 5 to 5 days, as shown in Examples described later. It's 7 days. As other conditions, the humidity is usually 60 to 80%, and it is preferable that the humidity is dark.

Next, pig delta coronavirus is inoculated into the embryonated chicken eggs that have passed the incubation period. The inoculation site is not particularly limited as long as the porcine delta coronavirus can proliferate in the developing chicken egg after the culture described later. Intravascular and fetal. From the viewpoint that a mechanical (automatic inoculation machine) inoculation method has been established at these sites, it is preferable to inoculate into the allantois cavity.

The inoculation amount of porcine delta coronavirus is not particularly limited, but is 1 to 10 ⁴ EID ₅₀ , preferably 10 to 10 ³ EID ₅₀ , and more preferably 5 × 10 5 × 10 ² EID ₅₀ .

_{The EID 50} of the porcine delta coronavirus can be calculated as follows, for example. First, PBS is used to prepare a 10-fold dilution series of the porcine delta coronavirus of interest. Next, 0.1 ml of each diluted sample is inoculated into the allantois cavity of the developing chicken egg on the 6th day of incubation controlled under the above conditions, inoculating 6 or more for each dilution series. The amount of virus contained in the allantois cavity fluid collected after 48 hours is measured by real-time PCR. More specifically, a virus-derived RNA contained in the recovery solution is extracted using a nucleic acid extraction kit or the like. At this time, the same 0.1 ml virus solution as inoculated into the allantois cavity of the developing chicken egg is prepared, and RNA is extracted in the same manner. Since the amount of liquid recovered from the urinary membrane cavity of a growing chicken egg is approximately 10 ml, the amount of virus contained in 0.1 ml of the growing chicken egg measured by real-time PCR multiplied by 100 is used as the viral load before incubation. Assume. Then, the amount of virus infecting 50% of the eggs is calculated by determining that the virus detected by real-time PCR is larger than the amount of virus before hatching as a developing chicken egg infected with porcine delta coronavirus. Alternatively, it can be calculated using the above-mentioned LLC-PK cells or testicle cells (see TCID assay in Non-Patent Document 1).

The culture temperature after inoculation is not particularly limited as long as the porcine delta coronavirus can grow, and is, for example, 28 to 40 ° C, preferably 30 to 39 ° C, and more preferably 36 to 38 ° C. .. The culture period after inoculation is, for example, 24-240 hours, preferably 48-120 hours.

Then, in the present invention, the propagated porcine delta coronavirus can be obtained by recovering the egg contents from the developed chicken eggs after such culturing. The egg contents to be recovered are not particularly limited as long as they contain the propagated porcine delta coronavirus, and may be all or a part of the egg contents. Examples of a part of the egg contents include allantois cavity fluid (serous fluid), egg yolk, and fetus, but from the viewpoint that a collection method by a machine (automatic fluid collector) has been established, the allantois membrane. It is preferable to collect the cavity fluid.

(Manufacturing method of vaccine containing porcine delta coronavirus)
As shown in Examples described later, according to the present invention, it is possible to efficiently propagate a large amount of porcine delta coronavirus in a developing chicken egg. The porcine delta coronavirus propagated in this way is useful as a vaccine material. Therefore, the present invention
The process of inoculating porcine delta coronavirus into embryonated chicken eggs within 8 days of incubation,
A step of culturing the developed chicken egg to propagate the virus,
A step of recovering the egg contents containing the virus from the growing chicken egg,
Provided is a method for producing a vaccine containing porcine delta coronavirus, which comprises the step of isolating the virus from the egg contents and mixing it with a pharmacologically acceptable carrier or vehicle.

The steps up to the propagation of porcine delta coronavirus in a developing chicken egg are as described in (Method for producing porcine delta coronavirus) described above. "Isolation" of the propagated porcine delta coronavirus means isolation, purification and / or concentration from the egg contents. Examples of the virus isolation method include filtration of egg contents, centrifugation (ultracentrifugation, density gradient centrifugation, etc.), and chromatography (eg, size exclusion chromatography, ion exchange chromatography, affinity chromatography, etc.). ), Concentration (ammonium sulfate, resin column, polyethylene glycol salting out, etc.).

The porcine delta coronavirus isolated in this way may be used as it is as a vaccine (so-called live vaccine), may be used in an attenuated live form (so-called live attenuated virus), and may be used in an inactivated form. May be used as a vaccine. Furthermore, some of these isolated porcine delta coronaviruses (proteins, polypeptides, sugars, glycoproteins, lipids, nucleic acids, etc.) may be used as vaccines as long as they are immunogenic.

Live attenuated virus means a virus with a reduced level of virulence compared to a virus isolated from the field. Attenuated viruses are produced by known methods, such as growth in the presence of mutagens, acclimation to cultured cells by continuous (long-term) passage in vitro, and conditions deviating from the natural growth environment (eg,). It can be obtained by subjecting porcine delta coronavirus to growth under high temperature conditions). A live attenuated virus can also be obtained by deleting or recombining a specific gene of a virus by using genome editing, gene modification technology, or the like.

Virus inactivation can also be performed by a known method by those skilled in the art. Examples of such inactivation methods include formaldehyde treatment, UV irradiation, X-ray irradiation, electron beam irradiation, gamma ray irradiation, and alkylation. Treatments include treatment, ethylene-imine treatment, timerosal treatment, β-propiolactone treatment, and glutaraldehyde treatment.

Examples of "pharmaceutically acceptable carriers" to be mixed with the isolated porcine delta coronavirus in vaccine production include stabilizers, excipients, preservatives, surfactants, chelators and binders. .. Examples of the "pharmacologically acceptable medium" include water, physiological saline, and a buffer solution (phosphate buffer solution, phosphate buffered saline solution (PBS), Tris buffer solution, etc.). Those skilled in the art can select and use these carriers and vehicles as appropriate or in combination with known substances used in the art, depending on the dosage form and method of use of the vaccine. The form of the vaccine is not particularly limited, and may be, for example, a suspension form or a freeze-dried form.

From the viewpoint of enhancing the vaccine effect, an adjuvant may be further mixed. Examples of the adjuvant include inorganic substances such as aluminum gel adjuvant, microorganisms or substances derived from microorganisms (BCG, muramyl dipeptide, alum, pertussis toxin, choleratoxin, etc.), and surfactant substances (saponin, deoxycol). Acids, etc.), emulsions of oily substances (mineral oil, vegetable oil, animal oil, etc.), alum, etc.

(Inspection method for pig delta coronavirus)
As shown in Examples described later, according to the present invention, it is possible to efficiently propagate a large amount of porcine delta coronavirus in a developing chicken egg. In particular, since feces that can contain porcine delta coronavirus contain a large amount of protein that inactivates trypsin, it is extremely difficult to propagate the virus in feces by the method using cultured cells. Become. On the other hand, according to the present invention, since the virus can be propagated by inoculating the developed chicken egg with feces, it is possible to test the porcine delta coronavirus on such a sample as well. Therefore, the present invention
The process of inoculating a test sample into a developing chicken egg within 8 days of incubation,
The step of culturing the developed chicken egg,
A step of detecting the porcine delta coronavirus in the developed chicken egg, and a step of determining that the test sample contains the virus when the growth of the porcine delta coronavirus is detected in the step. Provided are methods of testing for porcine delta coronavirus, including.

The steps up to the propagation of porcine delta coronavirus in a developing chicken egg are as described in (Method for producing porcine delta coronavirus) described above. The "test sample" is not particularly limited as long as it is a sample in which pig delta coronavirus can be present, and examples thereof include the above-mentioned pig feces.

Similar to the above, the detection target of the porcine delta coronavirus may be all or a part of the egg contents of the developing chicken egg. Examples of a part of the egg contents include allantois cavity fluid (sero-urinary fluid), egg yolk, and fetus. As described above, mechanical recovery of allantois cavity fluid from a developing chicken egg has been established. From this point of view, it is preferable to target the allantois cavity fluid as a detection target.

Detection of porcine delta coronavirus in embryonated chicken eggs can be carried out by a person skilled in the art using a known virus detection method as appropriate. Examples of such a method include a CPE test using the cytopathic effect (CPE) as an index, as shown in Examples described later. In addition, a method for detecting a gene derived from porcine delta coronavirus or its expression can also be used. Here, gene expression may be at the transcriptional level (mRNA level) or the translational level (protein level). Examples of methods for detecting a gene (genomic RNA) or mRNA include PCR (RT-PCR, real-time PCR, quantitative PCR), DNA microarray analysis, Northern blotting or Southern blotting, in situ hybridization, dot blot, and RNase protection. Examples include an assay method and a mass analysis method. In addition, the gene or mRNA level can be quantitatively detected by counting the number of reads in the so-called next-generation sequencing method. Further, as a method for detecting a protein, for example, an antibody such as ELISA method, antibody array, immunoblotting, imaging cytometry, flow cytometry, radioimmunoassay, immunoprecipitation method, immunohistochemical staining method or the like is used for detection. Methods (immunological methods) and mass analysis methods can be mentioned.

If a person skilled in the art is a person skilled in the art, a statistical method is appropriately used according to the type of virus detection method, and a threshold value (cutoff) is set as necessary, and based on the obtained results, the growth of porcine delta coronavirus is carried out. The presence or absence can be determined. Then, when the growth of the virus is observed, it is determined that the test sample contains the virus.

Hereinafter, the present invention will be described in more detail based on Examples, but the present invention is not limited to the following Examples. Moreover, this Example was carried out using the following materials and methods.

(Virus inoculation of growing chicken eggs with different incubation days)
For the porcine delta coronavirus, a YGT strain isolated from pigs in Yamagata Prefecture in 2017 was used. As the developed chicken egg (synonymous with the hatched chicken egg), a conventional grade egg was used, and the egg was stored at 10 ° C. until hatching. For each day until incubation 0-12 days, 0.1ml ⁽¹⁰ 3 50% egg infectious dose _{(Egg Infectious Dose: EID 50)} / ml) virus solution was inoculated into the allantoic cavity of embryonated chicken eggs, 37 After incubating at ° C for 48 hours, the cells were moved to 4 ° C. In addition, for the embryonated chicken eggs 0 to 2 days after incubation, a group was also set in which the eggs were collected after incubation for 120 hours after inoculation with the virus solution. The collected allantois cavity fluid (synonymous with serous fluid) was stored at −80 ° C. until cells were inoculated or nucleic acids were extracted.

(Continuous passage of porcine delta coronavirus using embryonated chicken eggs)
With 4-6 embryonated chicken eggs incubation day 6, the virus solution of 0.1ml (2 × 10 ³ copies) was inoculated into the allantoic cavity of embryonated chicken eggs, 4 ° C. After 48 hours incubation at 37 ° C. Moved to. The collected allantois cavity fluid was stored at −80 ° C. until cells were inoculated or nucleic acids were extracted. The amount of virus contained in the collected urinary tract fluid was measured using real-time RT-PCR, and the same amount of virus diluted with PBS was continuously inoculated into the developing chicken eggs on the 6th day of incubation until the 6th generation. I went.

(Separation of porcine delta coronavirus from 10% porcine fecal emulsion using grown chicken eggs)
Feces of healthy pigs about 110 days old were mixed with 10 times the amount of the medium. As the medium, a medium prepared by adding penicillin (10,000 units / ml), streptomycin (10,000 μg / ml) and gentamicin (30 μg / ml) to Eagle's medium (manufactured by Sigma) was used. The obtained 10% pig manure-containing medium was subjected to centrifugation (3,000 rpm) for 10 minutes at room temperature, and the supernatant was filtered through a 0.45 μm filter and used as a 10% manure emulsion. Porcine delta coronavirus with 10% fecal emulsion ⁽¹⁰ 4 EID50 / ml) was serially diluted up to 10 to 10 ⁶ times, allantoic cavity of each virus dilution by embryonated eggs six incubation day 6 Was inoculated with 0.1 ml and incubated at 37 ° C. for 48 hours and then moved to 4 ° C. The collected allantois cavity fluid was stored at −20 ° C. until cells were inoculated or nucleic acids were extracted.

(Measurement of virus titer)
The cytopathic effect (CPE) was used as an index to measure the titer of porcine delta coronavirus contained in the developed chicken egg or porcine feces emulsion. Pigney kidney-derived cell line (LLC-PK1 cell (National Institutes of Biomedical Innovation, Health and Nutrition, JCRB Cell Bank Cell Number; JCRB0060) (Hull RN, et al., Thromb Res, 10, 669-677. ( For the culture of 1977)), a medium obtained by adding 8% bovine fetal serum (FBS), penicillin (10,000 unit / mL), and streptomycin (10,000 μg / mL) to an eagle medium (sigma) was used (Hu). H, et al., J Clin Microbiol, 53, 1537-1548. (2015)). For virus inoculation, cells cultured in a single layer were inoculated with urinary cavities recovered from developing chicken eggs or 10% fecal emulsion. After adsorbing the virus at 37 ° C. for 2 hours, the cells were washed with PBS, the culture solution was added, and the cells were allowed to stand for 5 days. For adsorption and culture, trypsin (product name: GIBCO (product name: GIBCO)) was added to the culture solution. Registered trademark) Trypin, Thermo Fisher Scientific Inc., (USA)) 10 μg / ml was added.

(Measurement of porcine delta coronavirus gene amount by real-time RT-PCR)
The amount of virus contained in the serum or the supernatant of the cultured cells collected from the developing chicken eggs was measured by real-time PCR. Virus RNA is extracted from the material using a virus RNA purification kit (product name: QIAamp Viral RNA Mini Kit, manufactured by QIAGEN (Germany)), One Step PrimeScript RT-PCR Kit (Perfect Real Time) (TAKARAB). Real-time RT-PCR was performed using (manufactured by Japan). The method for amplifying the nucleic acid of porcine delta coronavirus is according to the report of Marthaler et al. (Marthaler D. et al., Emerging Infectious, 20 (8): 1347-50. (2014)). Primers were used to amplify some of the genes encoding membrane proteins.
Forward primer: AT C GACCACATAGGCTCCAA (SEQ ID NO: 1)
Reverse primer: CAGCCTTGCCCATGTAGCTT (SEQ ID NO: 2)
Probe: FAM-CACACCAGTCGTTAAGCATGGCAAGCT-BHQ (SEQ ID NO: 3, "FAM" and "BHQ" indicate the labeling substances fluorescein and black hole quencher, respectively).

Since the membrane protein gene of the YGT strain used by the present inventors was found to have a 1-base substitution with the previously reported sequence, a forward primer in which the underlined sequence was changed from C to T was used. For quantitative analysis, double-stranded DNA containing the target gene was artificially synthesized (Thermo Fisher Scientific Inc., USA), and real-time RT-PCR was performed using it as a template, and a calibration curve (standard curve). It was created. A real-time PCR system (product name: Quant Studio 5 Real-Time PCR system, Thermo Fisher Scientific Inc., manufactured by USA) was used for the analysis.

(Statistical analysis)
Student's t-test was used for statistical processing between the two groups, and the statistically significant difference was P <0.05. Further, in FIGS. 1 and 2 (graph), the average value ± standard error is shown. In the analysis of the gene amount by real-time RT-PCR, the virus gene inoculated into the developing chicken egg was detected even if the virus was not propagated, so Cut off line was set. Six developing chicken eggs were inoculated with the virus at the same number of incubation days and doses as in the other test groups, and the chicken embryos were killed at 4 ° C. without returning to the incubator, and the entire amount of allantois cavity fluid was collected. After the urinary pelvic fluid is well mixed, nucleic acid is extracted by the same method as in the test group, the gene amount is measured by real-time RT-PCR, and the measured value is 3 × standard deviation and the maximum error range is positive as Cut off line. Was used as the standard.

(Example 1) Sensitivity of porcine delta coronavirus to embryonated chicken eggs As shown in Table 1 below, porcine delta coronavirus propagated in embryonated chicken eggs with an incubation period of 2 to 8 days. On the other hand, no growth of porcine delta coronavirus was observed in the incubation days of 10 to 12 days, which are usually used for culturing influenza virus. During the incubation period of 2 days and 8 days, only 30.0% and 11.1% of the embryonic eggs showed virus growth, but the number of tested eggs was different between the 3 to 7 days of incubation. However, virus growth was observed in 75.0% or more of the embryonated chicken eggs.

Furthermore, as shown in FIG. 1, when the difference in the amount of recovered virus was compared, a particularly large amount of virus was recovered in the embryonic chicken eggs having incubation days of 5 days and 7 days, but the incubation days were 3 days and 6 days. No significant difference was observed between the viral load and the viral load obtained in the embryonated chicken eggs.

In addition, as shown in FIG. 2, as a result of conducting the same test for embryonated chicken eggs having an incubation period of 0, 1 or 2 days for which it cannot be confirmed that they are fertilized eggs by the time the urinary membrane cavity fluid is collected, the incubation period However, the growth of the virus was confirmed in 3/10 of the eggs grown on the 2nd day, but the growth of the virus was not observed in the eggs grown on the 0th and 1st day of incubation.

However, by extending the culture period after virus inoculation from 48 hours to 120 hours, the developing chicken eggs acquire susceptibility to the porcine delta coronavirus, and the virus remaining in the urinary membrane infects the cells in the developing chicken eggs. When it was confirmed whether or not the virus was propagated even in the embryonated chicken egg whose hatching period was 0 day (see FIG. 2). On the other hand, for the embryonic chicken eggs with incubation periods 9, 10 and 11 days in which virus growth was not confirmed by the judgment of 48 hours, a group was set in which the observation period was extended to 168 hours (n = 6), but virus growth. Was not confirmed (data not posted).

(Example 2) Development of porcine delta coronavirus Changes in proliferation efficiency by continuous passage using chicken eggs Diluted to contain 2,000 copies of porcine delta coronavirus based on the results of real-time RT-PCR. When the developed urinary cavities were continuously passaged by inoculating the developed chicken eggs, as shown in FIG. 3, the amount of virus estimated to be contained in 10 ml of urinary tract fluid by the 6th generation tended to decrease. (R ² = 0.439). However, no significant difference was observed between the 2nd and 4th generations, which had the largest difference in average values, so it was estimated that there was no change in virus growth efficiency in the passages up to the 6th generation. In addition, in order to verify whether the pig delta coronavirus passaged using the embryonated chicken eggs acquires infectivity to the embryonated chicken eggs with advanced incubation days, the incubation period was reduced to 12 embryonic chicken eggs with 9 days. When the 3rd to 6th generation porcine delta coronavirus with a gene amount of 1,000 copies was inoculated, no virus growth was observed (data not shown).

LLC-PK cells were inoculated with porcine delta coronavirus diluted to contain 2,000 copies of porcine delta coronavirus passaged up to the 5th generation using developed chicken eggs, and based on the recovered gene amount. The virus growth efficiency by cell culture was compared with the case of using a developed chicken egg. The culture time after virus inoculation was set to 48 hours in both cases. As a result, in the LLC-PK cells, from one well of 96-well microplates, viral genes mean 1.3 × 10 ⁵ copies / 100 [mu] l were detected. On the other hand, from the embryonated eggs one inoculated with the same amount of virus, viral genes mean 1.7 × 10 ⁹ copies / 10 ml were detected. In order to obtain the amount of virus contained in 10 ml of urinary membrane cavity fluid recovered from one developing chicken egg by cell culture, ^{an area of 1.2 × 10 4} times is required, so a 1700 cm ² cell culture roller. It became clear that 2.37 bottles would be needed.

(Example 3) Virus isolation from pig 10% feces emulsion A 10-fold stepwise diluted solution of pig delta coronavirus prepared using pig 10% feces emulsion was inoculated into a growing chicken egg by real-time RT-PCR. -The virus inoculated into PK cells was determined by the cytopathic effect (CPE).

As a result, as shown in Table 2, in the LLC-PK cells are cultured cells, specimens confirmed the CPE depending on the dilution ratio is reduced from 6/6 and up to 2/6, 10 ⁵ and 10 ⁶ dilutions Can no longer be detected from. On the other hand, in embryonated chicken eggs, but it was similar in that could not be detected from the 10 ⁵ and 10 ⁶ dilutions showed a growth of the virus in 83.3% of chicken embryonic eggs even 10 ⁴ dilution. However, at 10 ² and 10 ³ dilutions inoculated test group the inoculation and the next day to three pieces and one embryo each death, since the proliferation of the virus was not confirmed, died embryos virus It was speculated that it was not due to proliferation but due to the toxicity of the fecal emulsion. For this reason, the virus isolation method for porcine delta coronavirus using developed chicken eggs is more efficient than the method using cultured cells, but depending on the components of the feces, it can be diluted 10 times or more, or it can be used as a fecal emulsion. It has been shown that it is necessary to add components that neutralize or dilute the toxic components contained.

As described above, according to the present invention, the porcine delta coronavirus can be efficiently propagated, and a vaccine against the virus can be produced and developed. It also makes it possible to detect (test, diagnose) porcine delta coronavirus.

Claims (5)

A method for producing porcine delta coronavirus.
The process of inoculating porcine delta coronavirus into embryonated chicken eggs within 8 days of incubation,
A method comprising a step of culturing the developed chicken egg to propagate the virus and a step of recovering the egg contents containing the virus from the developed chicken egg. A method for producing a vaccine containing porcine delta coronavirus.
The process of inoculating porcine delta coronavirus into embryonated chicken eggs within 8 days of incubation,
A step of culturing the developed chicken egg to propagate the virus,
A step of recovering the egg contents containing the virus from the growing chicken egg,
A method comprising the step of isolating the virus from the egg contents and mixing it with a pharmacologically acceptable carrier or vehicle. It is a test method for porcine delta coronavirus.
The process of inoculating a test sample into a developing chicken egg within 8 days of incubation,
The step of culturing the developed chicken egg,
A step of detecting the porcine delta coronavirus in the developed chicken egg, and a step of determining that the test sample contains the virus when the growth of the porcine delta coronavirus is detected in the step. Including, method. The method according to any one of claims 1 to 3, wherein the inoculation site of the porcine delta coronavirus or the test sample is in the allantois cavity of the developing chicken egg. The method according to any one of claims 1 to 4, wherein the growing chicken egg inoculated with the porcine delta coronavirus or the test sample is a growing chicken egg 5 to 7 days after incubation.

Images