JP2021104955A - Agent of improving muscle mass reduction - Google Patents

Abstract

To provide an agent that is based on herbal medicine and can improve muscle mass reduction for women during and after the menopause.SOLUTION: An agent of improving muscle mass reduction in women during and after the menopause contains Angelica acutiloba, Paeonia lactiflora, and Cnidium rhizome. The agent can suppress muscle mass reduction in the women during and after the menopause, and/or can increase reduced muscle mass in the women during and after the menopause.SELECTED DRAWING: None

Description

The present invention relates to an agent for improving muscle mass loss. More specifically, the present invention relates to a composition that improves muscle mass loss that occurs after menopause.

Muscle function declines with age. Although muscle dysfunction is not immediate and life-threatening, it is observed very frequently, resulting in poor quality of life and a significant impact on life prognosis. Therefore, efforts to prevent or improve muscle dysfunction are important in extending healthy life expectancy.

Muscle mass has steadily decreased since the 20s, and many people are aware of muscle loss by the time women are approaching menopause. Then, muscle loss becomes remarkable after the menopause (Non-Patent Document 1). In addition, as a characteristic of each muscle part, the muscle mass of the lower limbs sharply decreases (Non-Patent Document 1). Age-related muscle loss and rapid decrease in lower limb muscle mass are observed not only in women but also in men, and significantly more in men (Non-Patent Document 1).

As the administration composition for muscle mass loss, one selected from the group consisting of anabolic catechins, a muscle aging inhibitor containing leucine as an active ingredient (Patent Document 1), free lysine, a dipeptide containing lysine, and lysine salts. A composition for suppressing an increase in muscle mass and / or a decrease in muscle mass (Patent Document 2) containing the above and n-3 fatty acids in predetermined amounts, and a muscle-building agent containing a plant of the genus Salasia or an extract thereof (Patent Document 2). Patent Document 3), a food composition for increasing muscle mass (Patent Document 4) and the like, which are characterized by containing a substance derived from Euglena as an active ingredient, have been reported.

Characteristics of Japanese muscle mass due to aging, Geriatrics Journal, 2010, Vol. 47, p. 52-57

Japanese Unexamined Patent Publication No. 2008-063321 International Publication No. 2012/141316 Japanese Unexamined Patent Publication No. 2010-235542 Japanese Unexamined Patent Publication No. 2019-24481

Herbal medicine-based drugs such as Chinese herbal medicine have been confirmed to be effective through many years of treatment experience, and prescriptions with few side effects have been inherited, and there are many that have been recognized as effective in Western medicine. ing.

However, until now, no herbal medicine-based drug has been known to be effective against muscle mass loss.

Therefore, an object of the present invention is to provide a crude drug-based agent capable of improving muscle mass loss for women after menopause.

As a result of diligent studies, the present inventors have found that the combination of herbal medicines of Angelica acutiloba, Peony, and Senkyu increases muscle mass in model mice after menopause. The present invention has been completed by further studies based on this finding.

That is, the present invention provides the inventions of the following aspects.
Item 1. Post-menopausal muscle loss improving agent containing Angelica acutiloba, Peony, and Senkyu.
Item 2. Item 2. The muscle mass loss improving agent according to Item 1, wherein the period after the menopause is old age.
Item 3. Item 2. The muscle mass loss improving agent according to Item 1 or 2, which is an atrodin gene expression inhibitor and / or a myogenin gene expression promoter.
Item 4. Item 3. The muscle mass loss improving agent according to any one of Items 1 to 3, which improves the decrease in lower limb muscle mass.
Item 5. Item 4. The muscle mass loss improving agent according to any one of Items 1 to 4, further comprising a crude drug selected from the group consisting of buttonpi, goshitsu, carrot, licorice, cinnamon, byakujutsu, and bukuryo.

According to the present invention, a new agent capable of increasing muscle mass loss is provided for women after menopause.

A mouse sham group (reference example 1) that underwent simulated surgery, a sham + high dose group (reference example 2) that was further administered with a muscle loss improving agent, and a mouse OVX group (comparative example 1) that underwent ovarian removal surgery. It is a graph comparing the weight of soleus muscle with respect to the OVX + low dose group (Example 1) and the OVX + high dose group (Example 2) to which the muscle mass loss improving agent was further administered. The soleus muscle of the mouse OVX group (Comparative Example 1) that underwent ovariectomy, the OVX + low-dose group (Example 1), and the OVX + high-dose group (Example 2) that were further administered with a muscle loss improving agent. It is a graph which compared the expression level of the atrodine gene and the myogenin gene.

The muscle mass loss improving agent of the present invention contains Angelica acutiloba, Peony, and Senkyu, and is characterized in that it is used for women after menopause. Hereinafter, the muscle mass loss improving agent of the present invention will be described in detail.

Active Ingredient The muscle mass loss improving agent of the present invention contains Angelica acutiloba, Peony, and Senkyu. In the present invention, the touki, sakuyaku, and senkyu may be crude drug powders (touki powder, sakuyaku powder, and senkyu powder) or simple extracts (touki extract, sakuyaku extract, and senkyu extract). Good, Chinese herbal extract (extract of mixed crude drug containing two or more kinds selected from the group consisting of Touki, Shakuyaku, and Senkyu, or one or more kinds selected from the group consisting of Touki, Shakuyaku, and Senkyu, and Touki. , Shakuyaku, and an extract of a mixed crude drug with one or more selected from crude drugs other than Senkyu).

Specific embodiments of Angelica acutiloba, Shakyaku, and Senkyu include a combination of Angelica acutiloba powder and / or Angelica acutiloba extract, Angelica acutiloba powder and / or Shakuyaku extract, and Angelica acutiloba powder and / or Senkyu extract; Angelica powder and / or Examples thereof include a combination mode of Angelica acutiloba extract, shakuyaku powder and / or shakuyaku extract, and / or senkyu powder and / or senkyu extract, and a Chinese herbal extract; or a Chinese herbal extract alone mode.

Angelica acutiloba (Angelica acutiloba) is the root of Angelica acutiloba Kitagawa or other related plants of the Umbelliferae family, and is usually boiled in hot water. It is used in combination with prescriptions for tonics, neuropsychiatric drugs and urinary tract diseases. Angelica acutiloba powder is commercially available from Maruzen Pharmaceuticals Co., Ltd., Sangoku Co., Ltd., Ichimaru Falcos Co., Ltd., etc.

The single taste extract of Angelica acutiloba is known as Angelica acutiloba extract, which is shown in the Japanese Pharmacopoeia Non-Pharmaceutical Standards, Quasi-drug Raw Material Standards, and the like. Specifically, the single taste extract of Angelica acutiloba can be obtained by extracting the roots of Angelica acutiloba or other closely related plants with an extraction solvent. The extraction solvent used in the extraction treatment of Angelica acutiloba is, for example, water and / or alcohol. Angelica acutiloba extract is commercially available from, for example, Maruzen Pharmaceuticals Co., Ltd., Alps Pharmaceutical Industry Co., Ltd., and the like.

Peony (peony) is the root of peony Paeonia lactiflora Pallas or other related plants of the Peony family (Peonyaceae), and is mainly used as a crude drug (Japanese Pharmacopoeia) for analgesic and antispasmodic (gastrointestinal), women's medicine, and cold medicine. Used for applications such as peony. Peony is both a crude drug name (Japanese Pharmacopoeia) and a plant name. Peony powder is commercially available from Maruzen Pharmaceuticals Co., Ltd., Sangoku Co., Ltd., Ichimaru Falcos Co., Ltd., etc.

The peony simple extract is described as a peony extract in the quasi-drug raw material standard and is known. Specifically, the peony simple extract can be obtained by extracting the roots of peony or other closely related plants with an extraction solvent. The extraction solvent used in the extraction treatment of peony is, for example, water and / or alcohol. The peony extract is commercially available from, for example, Maruzen Pharmaceuticals Co., Ltd., Ichimaru Falcos Co., Ltd., Alps Pharmaceutical Industry Co., Ltd., and the like.

Senkyu is usually blanched rhizomes of Cnidium office Makino of the Umbelliferae family, and is mainly used as a crude drug (Japanese Pharmacopoeia) for vascular reinforcements, women's medicines, and the like. Senkyu is both a crude drug name (Japanese Pharmacopoeia) and a plant name. Senkyu powder is commercially available from Nippon Powder Chemicals Co., Ltd., Tochimoto Tenkaido Co., Ltd., etc.

The simple taste extract of Senkyu is described as a Senkyu extract in the quasi-drug raw material standard and is known. Specifically, the simple taste extract of Senkyu can be obtained by extracting the rhizome of Senkyu with an extraction solvent. The extraction solvent used in the extraction treatment of Senkyu is, for example, water and / or alcohol. Senkyu extract is commercially available from, for example, Maruzen Pharmaceuticals Co., Ltd., Alps Pharmaceutical Industry Co., Ltd., and the like.

Examples of Chinese herbal extracts of mixed crude drugs containing Angelica acutiloba, Peony and Senkyu include Tokishakuyakusan extract and the like.

In the present invention, as a preferred embodiment of Angelica acutiloba, peony, and peony, from the viewpoint of further improving the effect of improving muscle mass loss according to the present invention, angelica acutiloba powder and / or angelica acutiloba extract, peony powder and / or peony extract, and peony extract. A combination mode of powder and / or senkyu extract can be mentioned, and from the viewpoint of particularly remarkably improving the effect of improving muscle mass loss according to the present invention, a combination mode of angelica acutiloba powder, peony powder, and senkyu powder can be mentioned more preferably.

The content of Angelica acutiloba, Peony, and Senkyu in the muscle mass loss improving agent of the present invention is not particularly limited, but for example, the total amount as a crude drug equivalent is 10 to 98% by weight, preferably 13 to 95% by weight. More preferably, 16 to 85% by weight is mentioned. The ratio of the contents of Angelica acutiloba, Shakyaku, and Senkyu to 100 parts by weight of the total crude drug component contained in the muscle mass loss improving agent of the present invention is preferably, for example, 20 to 98 parts by weight in total as a crude drug equivalent amount. 28 to 95 parts by weight, more preferably 34 to 85 parts by weight.

The ratios of Angelica acutiloba, Peony, and Senkyu are not particularly limited, but in terms of crude drug equivalent, Angelica acutiloba: Peony: Senkyu = 1: 0.5 to 1.7: 0.4 to 1, preferably 1: 0. 8 to 1.2: 0.6 to 0.8, and particularly preferably 1: 1: 2/3.

Other crude drug components The muscle mass loss improving agent of the present invention is selected from the group consisting of buttonpi, goshitsu, carrot, licorice, cinnamon, byakujutsu, and bukuryo as other crude drugs from the viewpoint of further enhancing the muscle mass loss improving effect. It is preferable to further contain one or more crude drugs to be used.

In the present invention, the crude drug selected from the group consisting of buttonpi, goshitsu, carrot, kanzo, keihi, byakujutsu, and bukuryo is the crude drug powder (buttonpi powder, goshitsu powder, carrot powder, kanzo powder, keihi powder, biakujutsu powder, and It may be a crude drug powder selected from the group consisting of bukuro powder, or it may be selected from the group consisting of simple extract (button pi extract, goshitsu extract, carrot extract, kanzo extract, keihi extract, biakujutsu extract, and bukuro extract). It may be a crude drug extract), a mixed crude drug extract containing two or more selected from the group consisting of Chinese herbal extracts (button pi, goshitsu, carrot, kanzo, keihi, byakujutsu, and bukuryo), or button pi. One or more selected from the group consisting of, goshitsu, carrot, kanzo, keihi, byakujutsu, and bukuryo, and one or more selected from crude drugs other than buttonpi, goshitsu, carrot, kanzo, keihi, byakujutsu, and bukuro. It may be an extract of a mixed crude drug).

Specific embodiments of buttonpi, goshitsu, carrot, kanzo, keihi, byakujutsu, and bukuryo include buttonpi powder and / or buttonpi extract, goshitsu powder and / or goshitsu extract, carrot powder and / or carrot extract, kanzo powder and / Or combination of Kanzo extract, Keihi powder and / or Keihi extract, Byakujutsu powder and / or Byakujutsu extract, and Bukuryo powder and / or Bukuryo extract; Buttonpi powder and / or Buttonpi extract, Gositsu powder and / or Gositsu extract, carrot Powder and / or carrot extract, kanzo powder and / or kanzo extract, keihi powder and / or keihi extract, biakujutsu powder and / or biakujutsu extract, and / or bukuryo powder and / or bukuryo extract in combination with Chinese herbal extract ; Or, the Chinese herbal extract alone mode can be mentioned.

Peony bark is the root bark of Peonya sufruticosa Andrews (Paeonia moustan Sims) of the Peony family, and is mainly used as a crude drug (Japanese Pharmacopoeia) for women's medicines and the like. Buttonpi powder is commercially available from Tochimoto Tenkaido Co., Ltd., Takasago Pharmaceutical Co., Ltd., etc.

The simple extract of buttonpi can be obtained by extracting the root bark of buttonpi with an extraction solvent. The extraction solvent used in the extraction process of buttonpi is, for example, water and / or alcohol. The simple extract of buttonpi is commercially available from, for example, Alps Pharmaceutical Industry Co., Ltd.

Gositsu (cow knee) is the root of Achyranthes bidentata Blume of Amaranthaceae, Achyranthes bidentata Blume, or Achyranthes bidentata Blume, and is mainly used as a herbal medicine (Japanese pharmacy). .. Gositsu powder is commercially available from Nippon Powder Chemicals Co., Ltd., Mikuni Co., Ltd., Maechu Co., Ltd., etc.

The simple taste extract of Gositsu can be obtained by extracting the roots of Gositsu with an extraction solvent. The extraction solvent used in the extraction treatment of gositsu is, for example, water and / or alcohol. Gositsu extract is commercially available from, for example, Nippon Powder Chemicals Co., Ltd., Maechu Co., Ltd., etc.

Ginseng is a ginseng of the Araliaceae family, Panax ginseng C.I. A. Meyer (Panax schinseng Needs) roots excluding fine roots or lightly boiled ones, mainly as tonic tonics, digestive promoters, antidiarrhea, tranquilizers, hypoglycemic agents as crude drugs (Japanese Pharmacopoeia) It is used for medicines, cardiotonics, antidiarrheals, anti-fatigue drugs, etc. Carrot is both a crude drug name (Japanese Pharmacopoeia) and a plant name. Carrot powder is commercially available from Nippon Powder Chemicals Co., Ltd., Tochimoto Tenkaido Co., Ltd., etc.

A carrot simple extract is described as a carrot extract in the quasi-drug raw material standard and is known. Specifically, the simple taste extract of carrot can be obtained by extracting the fine roots of carrot with an extraction solvent. The extraction solvent used in the carrot extraction treatment is, for example, water and / or alcohol. The carrot extract is commercially available from, for example, Matsuura Pharmaceutical Co., Ltd., Alps Pharmaceutical Industry Co., Ltd., and the like.

Licorice (licorice) is the root and stron of Glycyrrhiza uralensis Fisher or Glycyrrhiza grabra line of the legume family (Leguminosae), sometimes excluding the peripheral skin (peeling licorice). It is used for medicine, gastric ulcer medicine, etc. Licorice powder is commercially available from Nippon Powder Chemicals Co., Ltd., Takasago Pharmaceutical Co., Ltd., Tochimoto Tenkaido Co., Ltd., etc.

The licorice simple extract is described as a licorice extract in the quasi-drug raw material standard and is known. Specifically, the licorice extract simple extract can be obtained by extracting the roots or strons of Glycyrrhiza uralensis Fisher or Glycyrrhiza grabra Line with an extraction solvent. The extraction solvent used in the licorice extraction treatment is, for example, water and / or alcohol. The licorice extract is commercially available from, for example, Maruzen Pharmaceuticals Co., Ltd., Nippon Powder Pharmaceutical Co., Ltd., Alps Pharmaceutical Industry Co., Ltd., and the like.

Cinnamon cinnamon cassia Blum of the Lauraceae family or other plants of the same genus is peeled from the bark of the thick trunk of cinnamon, and is mainly used as a crude drug (Japanese Pharmacy) for aromatic stomachic medicine. Will be done. Cinnamon powder is commercially available from Nippon Powder Chemicals Co., Ltd., Tochimoto Tenkaido Co., Ltd., etc.

The cinnamon simple extract is known as a cinnamon extract, which is shown in quasi-drug raw material standards and the like. Specifically, the cinnamon simple extract can be obtained by extracting the bark of cinnamon or other plants of the same genus with an extraction solvent. The extraction solvent used in the extraction treatment of cinnamon is, for example, water and / or alcohol. The cinnamic acid extract is commercially available from, for example, Maruzen Pharmaceuticals Co., Ltd., Nippon Powder Pharmaceutical Co., Ltd., and the like.

Byakujutsu (Atractylodes japonicum) is used as a rootstock of Atractylodes japonicum ex Kitamura of Atractylodes japonicum of the Asteraceae family or Atractylodes japonicum ex Kitamura or Bai zhu. .. Byakujutsu powder is commercially available from Tochimoto Tenkaido Co., Ltd., Konishi Pharmaceutical Co., Ltd., etc.

The simple extract of Bai zhu can be obtained by extracting the rhizome of Mole cricket or Bai zhu with an extraction solvent. The extraction solvent used in the extraction treatment of Byakujutsu is, for example, water and / or alcohol. The single taste extract of Byakujutsu is commercially available from, for example, Alps Pharmaceutical Industry Co., Ltd.

Bukuryo (Polyporaceae) is a sclerotium of the Chinese root Wolfiporia cocos Ryvarden et Gilbertson (Polia cocos Wolf) of the Polyporaceae family. , Used for diuretics, etc. Bukuryo powder is commercially available from Takasago Yakuhin Co., Ltd., Tochimoto Tenkaido Co., Ltd., etc.

The simple extract of Bukuryo is described as a Bukuryo extract in the quasi-drug raw material standard and is known. Specifically, the simple taste extract of Bukuryo can be obtained by extracting the sclerotium of China root with an extraction solvent. The extraction solvent used in the extraction treatment of Bukuryo is, for example, water and / or alcohol. Bukuryo extract is commercially available from, for example, Maruzen Pharmaceuticals Co., Ltd., Alps Pharmaceutical Co., Ltd., and the like.

Further, in the present invention, as a preferred embodiment of the crude drug selected from the group consisting of buttonpi, goshitsu, carrot, citrus, cinnamon, biakjutsu, and bukuryo, from the viewpoint of further improving the effect of improving muscle mass loss according to the present invention, Buttonpi powder and / or buttonpi extract, goshitsu powder and / or goshitsu extract, carrot powder and / or carrot extract, kanzo powder and / or kanzo extract, cinnamon powder and / or cinnamon extract, cinnamon powder and / or cinnamon extract, and bukuryo A crude drug selected from the group consisting of powder and / or bukuryo extract can be mentioned, and from the viewpoint of particularly remarkably improving the effect of improving muscle mass loss according to the present invention, more preferably, buttonpi powder, goshitsu powder, carrot powder, cinnamon powder. , Cinnamon powder, Byakujutsu powder, and Bukuryo powder.

In a preferred example of the muscle loss improving agent of the present invention, among the above other crude drugs, at least one of carrot, licorice, cinnamon, and biakjutsu from the viewpoint of further improving the muscle loss improving effect of the present invention. It is preferable to contain at least licorice and carrot, at least containing cinnamon, or at least containing byakujutsu.

In another preferable example of the muscle mass loss improving agent of the present invention, among the above other crude drugs, it is preferable to contain at least gossitsu from the viewpoint of further remarkably improving the muscle mass loss improving effect according to the present invention. , It is more preferable to include crude drug powder.

In the muscle mass loss improving agent of the present invention, among the other crude drugs described above, from the viewpoint of significantly improving the muscle mass loss improving effect of the present invention, buttonpi, goshitsu, carrot, licorice, cinnamon, biakjutsu, and bukuryo It is most preferable to include all of the above.

The content of the crude drug (other crude drug) selected from the group consisting of buttonpi, goshitsu, carrot, licorice, cinnamon, biakjutsu, and bukuryo in the muscle mass loss improving agent of the present invention is not particularly limited, but for example, The total amount of crude drug equivalent is 2 to 70% by weight.

The ratio of the total amount of other crude drugs to the total amount of Angelica acutiloba, Peony and Senkyu is not particularly limited, but from the viewpoint of further enhancing the effect of improving muscle mass loss, the total amount of Angelica acutiloba, Peony and Senkyu is 100. 9 to 250 parts by weight, preferably 150 to 200 parts by weight, are mentioned with respect to parts by weight.

Specifically, the content of each of the other crude drugs with respect to the total amount of Touki, Shakyaku and Senkyu is not particularly limited, but from the viewpoint of further enhancing the effect of improving muscle mass loss, the crude drug equivalent amounts of Touki, Shakyaku and Senkyu are used. For a total amount of 100 parts by weight, 15 to 40 parts by weight, preferably 30 to 38 parts by weight for button pi; 30 to 40 parts by weight for herbal medicine; 2 to 50 parts by weight for carrots. By weight, preferably 20 to 30 parts by weight; for kanzo, 3 to 40 parts by weight, preferably 30 to 38 parts by weight; for Keihi, 15 to 40 parts by weight, preferably 20 to 26 parts by weight. In the case of Byakujutsu, 3 to 40 parts by weight, preferably 10 to 15 parts by weight; in the case of Bukuryo, 1 to 40% by weight, preferably 10 to 13 parts by weight.

Other Ingredients In addition to the above-mentioned crude drug ingredients, the muscle mass loss improving agent of the present invention may further contain additives and bases according to the formulation form. Additives and bases are not particularly limited as long as they are pharmaceutically acceptable, but excipients, binders, disintegrants, lubricants, tonicity agents, plasticizers, dispersants, emulsifiers, etc. Dissolving aids, wetting agents, stabilizers, suspending agents, pressure-sensitive adhesives, coating agents, brighteners, water, fats and oils, waxes, hydrocarbons, fatty acids, higher alcohols, esters, water-soluble High polymers, surfactants, metal soaps, lower alcohols, polyhydric alcohols, pH adjusters, buffers, antioxidants, UV inhibitors, preservatives, flavoring agents, fragrances, powders, thickeners, pigments , Chelating agent and the like. These additives may be used alone or in combination of two or more. The contents of these additives and bases are appropriately set according to the types of additives and bases to be used, the formulation form of the muscle mass loss improving agent of the present invention, and the like.

Specific examples of the additives and bases include starch, lactose, carmellose calcium, light anhydrous silicic acid, magnesium stearate, synthetic aluminum silicate, magnesium aluminometasilicate, calcium silicate, magnesium silicate, and synthetic. Examples thereof include hydrotalcite, anhydrous calcium hydrogen phosphate, carmellose, sodium croscarmellose, sodium starch glycolate, and crospopidone. The contents of these additives and bases are appropriately set according to the types of additives and bases used.

When the muscle mass loss improving agent of the present invention further contains additives and bases in addition to the above-mentioned crude drug components, the total amount of the additives and bases in the entire pharmaceutical composition is 2 to 2. 70% by weight, preferably 5 to 60% by weight.

In addition, the muscle mass loss improving agent of the present invention may further contain other nutritional components and pharmacological components, if necessary. Such nutritional components and pharmacological components are not particularly limited as long as they are pharmaceutically acceptable, but for example, antacids, stomachic agents, digestive agents, intestinal regulators, antispasmodics, mucosal repair agents, anti-inflammatory agents, and antiemetics. Agents, antitussives, sputum, anti-inflammatory enzyme agents, sedative hypnotics, antihistamines, caffeines, cardiotonic diuretics, antibacterial agents, vasoconstrictors, vasodilators, local anesthetics, crude drugs and / or crude drug extracts, vitamins And so on. These nutritional components and pharmacological components may be used alone or in combination of two or more. Further, the content of these components is appropriately set according to the type of the component to be used and the like.

Formulation form The formulation form of the muscle mass loss improving agent of the present invention is not particularly limited as long as it can be orally administered, and for example, a powder, a fine granule, a granule, a tablet, a troche, a chewable agent, etc. Examples include solid preparations such as capsules (soft capsules and hard capsules) and rounds; semi-solid preparations such as jelly; liquid preparations such as liquids, suspensions and syrups.

Production method The method for producing the muscle mass loss improving agent of the present invention may be formulated by using the above-mentioned crude drug components according to a usual formulation method adopted in the pharmaceutical field.

Uses The muscle mass loss improving agent of the present invention is used for the purpose of improving muscle mass loss in women after menopause. Specifically, the muscle mass loss improving agent of the present invention is used for the purpose of suppressing the loss of muscle mass in women after menopause and / or for the purpose of increasing the loss of muscle mass in women after menopause. ..

After the menopause, it includes menopause (meaning the age at which menopausal symptoms are exhibited, for example, 45 to 55 years old) and old age (meaning the elderly after the age after menopause, for example, 56 years old or older). Considering that the decrease in muscle mass is remarkable in old age, the muscle mass loss improving agent of the present invention is preferably used for the purpose of improving the muscle loss in elderly women. Further, in view of the fact that the decrease in muscle mass is remarkable in the lower limb muscles, the muscle mass loss improving agent of the present invention is preferably used for the purpose of improving the decrease in lower limb muscle mass.

In the mechanism of action of the muscle mass lowering improving agent of the present invention, the expression of the atrodin gene is suppressed to suppress the decomposition of the muscle, and the expression of the myogenin gene is promoted to promote the synthesis of the muscle. Therefore, the muscle mass loss improving agent of the present invention can be used as an atrodin gene expression inhibitor and / or a myogenin gene expression promoter.

The muscle mass loss improving agent of the present invention has a favorable mechanical effect on muscles in postmenopausal women, thereby suppressing the deterioration of quality of life caused by the loss of muscle mass and improving health. It can be expected to extend the life expectancy. Further, according to the muscle mass loss improving agent of the present invention, it is possible to improve the muscle mass loss of the lower limbs in women after the menopause, so that the activity amount is increased mainly by facilitating the activity using the lower limbs. You can also do it. That is, according to the muscle mass lowering improving agent of the present invention, the voluntary activity is increased by mechanically exerting a favorable effect on the lower limb muscle, and the voluntary activity is increased by causing the lower limb muscle. Is incidentally trained, so a positive chain can be expected for the improvement of muscle mass loss.

Dosage and Usage The muscle mass loss improving agent of the present invention is used by oral administration. The dose of the muscle mass loss improving agent of the present invention is appropriately set according to the age, constitution, degree of symptom, etc. of the administration subject. The crude drug equivalent amount is 0.3 to 10 g, preferably 1.8 to 10 g, more preferably 2.2 to 10 g, and the crude drug equivalent amount of Touki, Shakuyaku, and Senkyu is 0.1 to 0.1. Examples thereof include 3.5 g, preferably 0.5 to 3.5 g, and more preferably 0.7 to 3.5 g. In addition, the muscle mass loss improving agent of the present invention can be taken 1 to 3 times a day, preferably 2 or 3 times, more preferably 3 times a day. The timing of administration is not particularly limited and may be before meals, after meals, or between meals, but it is preferably after meals.

Hereinafter, the present invention will be specifically described with reference to Examples, but the present invention is not limited to these Examples.

(1) Preparation of muscle loss improving agent A muscle loss improving agent was prepared at the blending ratio shown in Table 1 (daily human dose).

(2) Animal Experiment A 9-week-old ICR female mouse (manufactured by Nippon SLC Co., Ltd.) was preliminarily bred for 1 week, and an aging model mouse (10-week-old) was prepared. The aging model mice were divided into groups as shown in Table 2 and operated on. Specifically, the group in which the simulated surgery was performed was defined as the Sham group (Reference Example 1) and the Sham + high-dose group (Reference Example 2), and each group was bred for an additional 8 weeks to reduce muscle mass due to aging. A model mouse was produced. On the other hand, the groups that underwent ovariectomy (OVX) were the OVX group (Comparative Example 1), the OVX + low dose group (Example 1), and the OVX + high dose group (Example 2). These were bred for another 8 weeks as menopausal and muscular loss model mice (10 weeks old) to prepare senile and muscular mass loss model mice (18 weeks old) that had passed the climacteric period. To these mice, at the doses shown in Table 2, the Sham group (Reference Example 1) and the OVX group (Comparative Example 1) were fed with a normal diet of 4.0 g / animal per day for 5 weeks. For the Sham + high-dose group (Reference Example 2), OVX + low-dose group (Example 1), and OVX + high-dose group (Example 2), the muscle mass loss improving agent prepared in (1) above was used as a normal diet. A mixed diet containing 1% by weight (low dose) or 2% by weight (high dose) was fed at 4.0 g / animal per day for 5 weeks.

(3) Confirmation of effect of improving muscle mass loss-1
After administration for 5 weeks, the soleus muscle, which is the muscle of the lower limbs of the mouse, was excised and its weight was measured. The weight of soleus muscle in the OVX group (Comparative Example 1), OVX + low dose group (Example 1), and OVX + high dose group (Example 2) was determined by Williams' method using the OVX group (Comparative Example 1) as a control. A multiple comparison test was performed. In each case, the significance level was set to 5%. FIG. 1 shows the measurement result and the test result of the soleus muscle weight.

As shown in FIG. 1, in both Reference Example 1 and Comparative Example 1, muscle mass decreased due to aging, and there was no difference in muscle mass depending on the presence or absence of ovarian removal surgery. (Although not shown, the femur bone fracture strength was significantly and significantly reduced in Comparative Example 1 with respect to Reference Example 1.) On the other hand, Comparative Example 1 and Examples 1 and 2. As shown by the comparison of, the muscle mass loss improving agent of the present invention significantly increased the muscle mass. In addition, the effect of increasing muscle mass was also dose-dependent. Furthermore, even if the muscle mass loss improving agent of the present invention was applied at a high dose to Reference Example 1 in which ovariectomy was not performed, no significant increase in muscle mass was observed as shown in Reference Example 2. It was found that the effect produced by the muscle mass loss improving agent of the present invention is an effect peculiar to an application target (menopause or old age) in which muscle mass is reduced and ovarian function is reduced or stopped.

(4) Confirmation of effect of improving muscle mass loss-2
Isogen (manufactured by Nippon Gene Co., Ltd.) was added to the soleus muscle excised in (3) above, and homogenized with POLYTRONPT1300D (manufactured by Central Scientific Trading Co., Ltd.). Then, chloroform was added and centrifuged, and the supernatant was recovered after precipitation with isopropanol, and total RNA was extracted by washing with ethanol. The extracted RNA is reverse transcribed into cDNA using SUPER SCRIPT VILO cDNA SYNTHESIS KIT (manufactured by Thermo Fisher Scientific Co., Ltd.), and mRNA of Atrogin gene and Myogenin gene by Real-time RT-PCR method. The amount was quantified. The measurement was performed by the TaqMan probe method using a Light Cycler 480 II (manufactured by Roche Diagnostics Co., Ltd.).
The atrodin gene induces muscle breakdown and the myogenin gene induces muscle synthesis. In addition, as an internal standard, the amount of mRNA of the housekeeping gene GAPDH was quantified. The primers used for Real-time RT-PCR used were those synthesized by Thermo Fisher Scientific Co., Ltd. Specifically, it is as follows.
Primer for GAPDH:
agcttgtcatcaacgggaag (Forward primer) (SEQ ID NO: 1)
tttgatgttagtggggtctcg (ReversePrimer) (SEQ ID NO: 2)
Primer for Atrodin gene:
agtgaggaccggctactgtg (Forward primer) (SEQ ID NO: 3)
gatcaaacgcttgcgaatct (ReversePrimer) (SEQ ID NO: 4)
Primer for myogenin gene:
gacttgaccttggaccttgg (Forward primer) (SEQ ID NO: 5)
cgctgtgggagtttgcatt (ReversePrimer) (SEQ ID NO: 6)
The average value of the relative amount of the expression level of each gene with respect to the GAPDH expression level was derived. The results are shown in FIG.

As is clear from the OVX + low dose group (Example 1) and the OVX + high dose group (Example 2) with respect to the OVX group (Comparative Example 1) in FIG. 2, the muscle mass loss improving agent of the present invention expresses the atrodin gene. It was found that the expression of the myogenin gene was promoted and their action was dose-dependent. That is, it was found that the muscle mass lowering improving agent of the present invention exerted the effect of increasing muscle mass observed in (3) above by suppressing the expression of the atrodin gene and promoting the expression of the myogenin gene.

SEQ ID NOs: 1 to 6 are primers.

Claims (5)

Post-menopausal muscle loss improving agent containing Angelica acutiloba, Peony, and Senkyu. The muscle mass loss improving agent according to claim 1, wherein the period after the menopause is old age. The muscle mass loss improving agent according to claim 1 or 2, which is an atrodin gene expression inhibitor and / or a myogenin gene expression promoter. The muscle mass loss improving agent according to any one of claims 1 to 3, which improves the decrease in lower limb muscle mass. The muscle mass loss improving agent according to any one of claims 1 to 4, further comprising a crude drug selected from the group consisting of buttonpi, goshitsu, carrot, licorice, cinnamon, byakujutsu, and bukuryo.

Images