JP2021061785A - VARIANT CeR-2a RNA HOMOLOG AND USE OF THE RNA HOMOLOG - Google Patents

Abstract

To provide a nucleic acid molecule that can have a beneficial physiological action on an organism such as a nematode that has a harmful effect on plants and a method for producing the same, and a composition and an agrochemical containing the nucleic acid molecule as an active ingredient.SOLUTION: A variant CeR-2a RNA homolog, which is a wild-type CeR-2a RNA homolog of a nematode, comprising a mutation modified to form a base pair highly complementary to a base sequence on a 5' terminal side of a base sequence of 26Sr RNA.SELECTED DRAWING: Figure 2

Description

The present invention relates to a composition and pesticide containing a mutant CeR-2a RNA homolog, which is a mutant nucleolar RNA, as an active ingredient, and a mutant nucleolar RNA. Regarding the manufacturing method.

Conventional biocidal pesticides include chemical pesticides, antibiotics, biopesticides and the like. Of these, low molecular weight compounds are used as chemical pesticides and antibiotics. As for drugs applied to the human body, nucleic acid drugs using nucleic acids such as oligo DNA, antisense RNA, siRNA, and miRNA have been developed, but little is known about pesticides using nucleic acids.

Nematodes are a type of pest that infects plants and causes great agricultural damage. Among nematodes, mutants with reduced amounts of cellular CeR-2 RNA in Caenorhabditis elegans have been reported to alter the processing pattern of rRNA precursors compared to wild-type N2 strains. (See Non-Patent Document 1).

Yusuke Hokii et al., Nucleic Acids Research, Volume 38, Issue 17, 1 September 2010, Pages 5909-5918

However, Non-Patent Document 1 does not describe substances such as nucleic acid molecules that can exert some physiological action on wild-type nematodes expressing CeR-2 RNA.

Therefore, the present invention provides a nucleic acid molecule capable of exerting a beneficial physiological action on an organism such as a nematode that causes an adverse event on a plant, a method for producing the same, and a composition and a pesticide containing the nucleic acid molecule as an active ingredient. That is the problem that the invention is trying to solve.

The present inventors have made extensive studies to solve the above problems, and based on the literature of Peculis (BRENDA A. PECULIS, MOLECULAR AND CELLULAR BIOLOGY, July 1997, p. 3702-3713), U8 snoRNA in African Tsumegael. Pattern changes occur in the processing of rRNA when the 5'end sequence of U8 snoRNA is modified, and the 5'end sequence of U8 snoRNA is incompletely base paired with the 5'end of 28S rRNA (including mismatches and gaps). It was found that it may form a base pair). Therefore, I thought that this incomplete base pairing could occur even in C. elegans.

And, on the contrary, C.I. It was considered that the processing of 26S rRNA could be inhibited by modifying the 5'end of CeR-2a RNA of elegans so as to form a more highly complementary base pair with the 5'end of 26S rRNA. In addition, since the target rRNA precursor is localized in the nucleolus, it is possible to more effectively suppress the processing of 26S rRNA by maintaining a structure capable of localizing in the nucleolus. Thought.

Based on the above idea, the present inventors modified the mutation so that the 5'end portion is a base sequence consisting of a base having high complementarity with the 5'end of 26S rRNA as compared with the wild-type CeR-2a RNA. Type CeR-2a RNA was prepared. And, surprisingly, this mutant CeR-2a RNA is found in C.I. It could reduce the synthesis of ribosomes in C. elegans, suppress the growth of C and C. elegans, and delay the start of spawning. In particular, with or without CeR-2a RNA, C.I. The mutant CeR-2a RNA has little effect on the elegans phenotype, whereas the mutant CeR-2a RNA has C.I. Derivation of the above phenotype for elegans is a surprising finding first discovered by the present inventors.

Based on these findings, the present inventors modified the base sequence on the 5'end side of wild-type CeR-2a RNA to be highly complementary to the base sequence on the 5'end side of 26S rRNA. We have succeeded in creating a mutant CeR-2a RNA and a composition and a pesticide containing the mutant CeR-2a RNA as an active ingredient. The present invention is an invention completed based on such findings and successful examples.

Therefore, according to one aspect of the present invention, the RNA homologs, compositions, pesticides and methods according to [1] to [11] below are provided.
[1] In the wild-type CeR-2a RNA homolog of nematodes, a mutant type having a mutation modified to form a highly complementary base pair with the base sequence on the 5'end side of the base sequence of 26S rRNA. CeR-2a RNA homolog.
[2] The nematodes, mosquito Enola Budhi infantis genus (Caenorhabditis) nematodes are Haemonchus genus (Haemonchus) nematodes or Shifashia genus (Syphacia) nematodes, mutant CER-2a RNA homologs according to [1] ..
[3] In the base sequence of the wild-type CeR-2a RNA homolog, the base sequence consisting of the 1st to 8th positions on the 5'end side is the 21st to 28th positions on the 5'end side in the base sequence of 26S rRNA. The mutant CeR-2a RNA homolog according to any one of [1] to [2], which has a base sequence consisting of a base and a mutation modified to form 6 or more complementary base pairs.
[4] Furthermore, in the base sequence of the wild-type CeR-2a RNA homolog, the base sequence consisting of the 9th to 18th positions on the 5'end side is the 4th to 13th positions on the 5'end side in the base sequence of 26S rRNA. The mutant CeR-2a RNA homolog according to [3], which has a base sequence consisting of the bases of the above and a mutation modified to form 9 or more complementary base pairs.
[5] Furthermore, in the base sequence of the wild-type CeR-2a RNA homolog, between the 8th and 9th bases on the 5'end side, the 14th to 20th positions on the 5'end side in the base sequence of 26S rRNA. The mutant CeR-according to any one of [3] to [4], which has a mutation modified to insert a base sequence complementary to a part or all of the base sequence consisting of the base at the position. 2a RNA homolog.
[6] A mutant CeR-2a RNA homolog consisting essentially of the nucleotide sequence set forth in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 23 in the Sequence Listing.
[7] A nematode growth-suppressing composition or a nematode spawning-suppressing composition containing the mutant CeR-2a RNA homolog according to any one of [1] to [6] as an active ingredient.
[8] A composition for promoting the accumulation of rRNA precursors in C. elegans or inhibition of ribosomal synthesis in C. elegans, which contains the mutant CeR-2a RNA homolog according to any one of [1] to [6] as an active ingredient. Composition for.
[9] A pesticide for nematodes containing the mutant CeR-2a RNA homolog according to any one of [1] to [6] as an active ingredient.
[10] A step of obtaining a small nucleolar RNA that forms a complementary base pair with the base sequence on the 5'end side of the rRNA precursor of an organism and binds to the rRNA precursor.
Mutant nucleolar RNA by modifying the base sequence on the 5'end side of the nucleolar RNA so as to be highly complementary to the base sequence on the 5'end side of the rRNA precursor. A method for producing mutant nucleolar RNA, which comprises a step of obtaining a mutant nucleolar RNA.
[11] The production method according to [10], wherein the organism is a nematode.

According to the mutant CeR-2a RNA homologue, composition and pesticide of one aspect of the present invention, through beneficial physiological actions such as growth inhibitory action, egg laying inhibitory action, rRNA precursor accumulation promoting action and / or ribosomal synthesis inhibitory action. It is expected to protect animals and plants where harmful events are caused by nematodes. In addition, according to the method of one aspect of the present invention, it is possible to produce a mutant nucleolar RNA that is beneficial to an organism including nematodes.

FIG. 1 is a schematic diagram showing the structure of wild-type CeR-2a RNA and the formation mode of complementary base pairs between wild-type CeR-2a RNA and 26S rRNA. FIG. 2 is a schematic diagram showing a mode of formation of complementary base pairs between wild-type CeR-2a RNA or mutant CeR-2a RNA consisting of the base sequence shown in SEQ ID NO: 3 and 26S rRNA. FIG. 3 is a diagram showing a list of nematode strains used as described in Examples. FIG. 4 is a diagram showing the results of length measurement of nematodes incubated at 20 ° C. as described in Examples. FIG. 5 is a diagram showing the results of length measurement of nematodes incubated at 25 ° C. as described in Examples. FIG. 6 is a diagram showing the results of measuring the number of spawning nematodes incubated at 20 ° C. as described in Examples. FIG. 7 is a diagram showing the results of measuring the number of spawning nematodes incubated at 25 ° C. as described in Examples. FIG. 8 is a diagram showing the results of measuring the time to reach 1 mm in body length and the time to start spawning of nematodes incubated at 20 ° C. and 25 ° C. as described in Examples. FIG. 9 is a diagram showing the measurement results of the ribosome precipitation profile as described in the examples.

Hereinafter, the details of the present invention will be described, but the present invention may take various aspects as long as the object is achieved.

Unless otherwise specified, each term in the present specification is used in the meaning commonly used by those skilled in the art and should not be construed as having an unreasonably limited meaning. Moreover, since the guesses and theories made in the present specification are based on the knowledge and experience of the present inventors, the present invention is not bound by such guesses and theories alone. Absent.

"RNA" is a kind of nucleic acid molecule, and is a polymer in which a large number of nucleotides, which are monomers, are bonded. The structure of RNA is specified by a "base sequence" that represents a sequence of bases (purine bases or pyrimidine bases) that are one of the constituents of nucleotides. That is, RNA is a polymer in which nucleotides are bound in the order of the bases indicated by the base sequence.
The "composition" is not particularly limited as having a commonly used meaning, but is, for example, a combination of two or more kinds of substances, specifically, a combination of an active ingredient and another substance. , And those made by combining two or more kinds of active ingredients, and more specifically, solids made by combining one or more kinds of active ingredients and one or more kinds of solid carriers or solvents. Examples thereof include compositions and liquid compositions.
“And / or” means any one, or any combination of two or more, or all combinations of a plurality of related items listed.
"Content" is synonymous with concentration and means the ratio of the amount of the component to the total amount of the composition. However, the total content of the components does not exceed 100%.
"~" In the numerical range is a range including the numerical values before and after that, and for example, "0% by mass to 100% by mass" means a range of 0% by mass or more and 100% by mass or less. ..
"Consistently consisting of a base sequence" means that the structure and / or function of the nucleic acid molecule represented by the base sequence is not impaired. It means that it consists of a base sequence in which a base is added to the 5'end side or the 3'end side of the base sequence.
"RNA homolog" means a group of RNAs having the same or similar structure and / or function and having the same or similar base sequence. The CeR-2a RNA homolog means the CeR-2a RNA and the RNA corresponding to the CeR-2a RNA in each organism. The CeR-2a RNA homolog forms a base pair complementary to the base sequence on the 5'end side of the base sequence of 26S rRNA, and has a base sequence that is the same as or similar to that of the CeR-2a RNA.

[Mutant CeR-2a RNA homolog]
The mutant CeR-2a RNA homolog is a base sequence having a base substitution in the base sequence of the CeR-2a RNA homolog (hereinafter, also referred to as a wild-type CeR-2a RNA homolog), or a base substitution and addition and / or It is an RNA molecule having a base sequence having a deletion. Here, "base substitution" means that the base in the sequence has been replaced with another base, and "base addition" means that a new base has been added so as to be inserted. , "Base deletion" means that there is a missing or missing base in the sequence. In the present specification, a change in a base sequence by substituting, adding and / or deleting a base is referred to as "mutation".

The mutant CeR-2a RNA homolog of one aspect of the present invention forms a highly complementary base pair with the 5'terminal base sequence of the 26S rRNA base sequence in the wild CeR-2a RNA homolog of nematodes. It consists essentially of a base sequence with a mutation that has been modified to do so. With such a base sequence, the mutant CeR-2a RNA homolog of one aspect of the present invention binds to 26S rRNA more strongly than the wild-type CeR-2a RNA homolog.

The mutant CeR-2a RNA homolog of one aspect of the present invention can reduce ribosome biogenesis in C. elegans, resulting in suppression of C. elegans individual growth and delay in spawning initiation. The following possibilities are presumed as to the reason why such reduction in ribosome biogenesis leads to growth suppression and spawning suppression. That is, by binding more strongly to 26S rRNA, protein synthesis is reduced due to decreased ribosome synthesis, and germ cell formation (the most active cell division in adults, and therefore active protein synthesis). Delayed growth in the larval stage and delayed start of spawning may be observed due to the reduced (possible). In addition, since the processing of the LSU rRNA precursor is not performed normally, the synthesis of the 60S subunit is reduced, and as a result, the protein constituting the ribosome and / or the 40S ribosomal subunit is left in the cell. , These may signal growth delay and spawning start delay by some mechanism.

The wild-type CeR-2a RNA homologue of C. elegans has a mutually similar structure and base sequence. The nucleotide sequence alignment of a typical wild-type CeR-2a RNA homolog is shown in the following nucleotide sequence alignment (1). Some of the bases shown underlined in the base sequence alignment (1) form complementary base pairs with the base sequence on the 5'-terminal side of 26S rRNA of each organism.

（１）

(1)

Similar to the wild-type CeR-2a RNA homolog, the 26S rRNA possessed by C. elegans has a mutually similar structure and base sequence. In particular, the 5'terminal base sequence that forms a complementary base pair with the wild-type CeR-2a RNA homolog is well conserved. For example, C.I. elegans, C.I. inopinata, C.I. briggsay, C.I. remanei, C.I. The base sequence of the 5'end of 26S rRNA of Caenorhabditis nematodes such as brenner is common. Furthermore, the base sequence of the 5'end of 26S rRNA of Hemoncus nematodes such as Haemonchus contortus and Sifacia nematodes such as Symphacia muris is only a few bases different from those of Caenorhabditis nematodes. The nucleotide sequence of these 26S rRNAs aligned at the 5'end is shown in the following nucleotide sequence alignment (2). Some of the bases shown underlined in the base sequence alignment (2) form complementary base pairs with the base sequence on the 5'end side of the wild-type CeR-2a RNA homolog of each organism.

（２）

(2)

Base sequence alignment (1) and (2) are aligned with respect to the underlined bases in the following base sequence alignment (3) (T is replaced with U). Complementary base pairs are formed between the bases of the shaded portion in the base sequence alignment (3).

（３）

(3)

As shown in the base sequence alignment (3), several bases in the base sequence consisting of the bases at the 1st to 8th positions on the 5'end side in the base sequence of the wild type CeR-2a RNA homolog are 5 in the base sequence of 26S rRNA. 'Forms a base pair complementary to the base sequence consisting of the bases at positions 21 to 28 on the terminal side. In addition, several bases in the base sequence consisting of the bases at the 9th to 18th positions on the 5'end side in the base sequence of the wild type CeR-2a RNA homolog are the 4th to 13th positions on the 5'end side in the base sequence of 26S rRNA. It forms a base pair complementary to the base sequence consisting of the base at the position.

As mentioned above, the 5'terminal nucleotide sequences of wild-type CeR-2a RNA homologues and 26S rRNA are well conserved among C. elegans. As a result, C.I. Mutant CeR-2a RNA for elegans is described in C.I. inopinata, C.I. briggsay, C.I. remanei, C.I. Not only Caenorhabditis nematodes such as brenner, but also H. Hemoncus nematodes such as contourtus and S. cerevisiae. It is likely to have a similar effect on other nematodes such as nematodes of the genus Sifacia such as muris. Therefore, the nematode targeted by the mutant CeR-2a RNA homolog of one aspect of the present invention is not particularly limited, but it is preferably a nematode expressing the wild CeR-2a RNA homolog, and Caenorhabditis genus. (Caenorhabditis) nematodes, more preferably at least one nematode selected from the group consisting of Haemonchus genus (Haemonchus) nematodes and Shifashia genus (Syphacia) nematodes, it is mosquitoes Enola Budhi infantis genus nematodes Is even more preferable.

The mutant CeR-2a RNA homolog of one aspect of the present invention is a base pair of the wild CeR-2a RNA homolog to form a highly complementary base pair with the base sequence on the 5'end side of the base sequence of 26S rRNA. In the sequence, the base sequence consisting of the bases at positions 1 to 8 on the 5'end side is complementary to the base sequence consisting of the bases at positions 21 to 28 on the 5'end side in the base sequence of 26S rRNA, and 6 or more. It is preferable to have a mutation modified to form a target base pair.

C. inopinata is a recently identified new species of nematode (Kanzaki, N. et al. Nat. Commun. 9: 3216. Doi: 10.1038 / s41467-018-05712-5, 2018.) and hosts fig fruits. And. In addition, H. Contortus is a blood-sucking nematode that parasitizes the abomasum of sheep, goats, and cattle, and causes great economic loss to livestock farmers. S. muris is a rodent pinworm.

Further, in the mutant CeR-2a RNA homolog of one aspect of the present invention, in the base sequence of the wild type CeR-2a RNA homolog, the base sequence consisting of the bases at the 9th to 18th positions on the 5'end side is 26S rRNA. It is preferable to have a mutation modified to form 9 or more complementary base pairs with a base sequence consisting of bases at positions 4 to 13 on the 5'-terminal side of the base sequence.

Further, the mutant CeR-2a RNA homolog of one aspect of the present invention is a 26S rRNA between the base at the 8th position and the base at the 9th position on the 5'end side in the base sequence of the wild type CeR-2a RNA homolog. It is preferable to have a mutation modified to insert a base sequence complementary to a part or all of the base sequence consisting of the bases at positions 14 to 20 on the 5'end side in the base sequence of.

Hereinafter, the mutant CeR-2a RNA homolog of one aspect of the present invention will be described by taking the mutant CeR-2a RNA of one embodiment as an example, but the mutant CeR-2a RNA homolog of one aspect of the present invention will be described. It is not limited to mutant CeR-2a RNA.

Wild-type CeR-2a RNA (SEQ ID NO: 1) is a type of small nucleolar RNA (snoRNA) in Caenorhabditis elegans (hereinafter, also referred to as Ce) and is involved in the processing of rRNA precursors. doing. Human ( Homo sapiens ) U8 snoRNA (SEQ ID NO: 4) corresponds to CeR-2a RNA.

The base sequence on the 5'end side of the wild-type CeR-2a RNA forms a partially complementary base pair with the base sequence on the 5'end side of the 26S rRNA of Ce (SEQ ID NO: 2). Similarly, the 5'terminal nucleotide sequence of U8 snoRNA is partially complementary to the 5'terminal nucleotide sequence of 28S rRNA (SEQ ID NO: 5). Here, the combinations of bases forming complementary base pairs in RNA include a combination of adenine (A) and uracil (U), a combination of cytosine (C) and guanine (G), and guanine (G). There is a combination with uracil (U).

FIG. 1 shows the structure of wild-type CeR-2a RNA and the formation mode of complementary base pairs between wild-type CeR-2a RNA and Ce 26S rRNA. In addition, FIG. 1 also shows the structure of human U8 snoRNA and the formation mode of complementary base pairs between human U8 snoRNA and human 28S rRNA. In other nematodes (Nematoda), snoRNA corresponding to CeR-2a RNA is also found. The snoRNA possessed by each nematode has a D box, an LSm binding motif-like sequence and a C box in common, and is structurally well conserved.

As shown in FIG. 1, a base sequence consisting of bases from the 1st to 18th positions on the 5'end side of the wild-type CeR-2a RNA (5'-CAGUCUUCAGUAUGGGUC-3') (1st to 18th positions of SEQ ID NO: 1). The base) is a part of the base sequence consisting of the bases from the 4th to 28th positions on the 5'end side of the 26S rRNA of Ce (3'-CCCAUUAGUGCUGACUCAACUCCAA-5') (bases at the 4th to 28th positions of SEQ ID NO: 2). Form complementary base pairs.

For example, a base sequence consisting of bases from the 1st to 8th positions on the 5'end side of wild-type CeR-2a RNA (5'-CAGUCUUC-3') (bases from the 1st to 8th positions of SEQ ID NO: 1) and Ce. Is formed between the base sequence consisting of bases from positions 21 to 28 on the 5'end side of 26S rRNA (3'-CCCAUAG-5') (bases at positions 21 to 28 of SEQ ID NO: 2). The number of complementary base pairs is four.

In the mutant CeR-2a RNA of one aspect of the present invention, the base sequence consisting of the bases from the 1st to 8th positions on the 5'end side is from the 21st to 28th positions on the 5'end side of the 26S rRNA of Ce. It has a base sequence consisting of bases and mutations modified to form 6 or more complementary base pairs.

Specifically, in the mutant CeR-2a RNA, the 1-position base (C) on the 5'-terminal side is replaced with G, the 2-position base (A) is replaced with G, and the 5-position base (C) is used. ) To A and at least two or more substitutions selected from the group consisting of substitution of the base (U) at position 6 to A. The greater the complementarity between the 5'terminal base sequence of the mutant CeR-2a RNA and the 5'terminal base sequence of the Ce 26S rRNA (the greater the number of complementary base pairs formed), the more the mutant type. Since the nematode growth inhibitory effect and / or the nematode spawning inhibitory effect of CeR-2a RNA is increased, the number of the substitutions is preferably 3 or more, and more preferably all 4.

Nucleotide sequence consisting of bases from positions 9 to 18 on the 5'end side of wild-type CeR-2a RNA (5'-AGUAUGGGUC-3') (base sequence at positions 9 to 18 of SEQ ID NO: 1) and Ce It is formed between the base sequence consisting of the bases from the 4th to 13th positions on the 5'end side of 26S rRNA (3'-UCACUCCAA-5') (the base sequence at the 4th to 13th positions of SEQ ID NO: 2). The number of complementary base pairs is eight.

Therefore, in the mutant CeR-2a RNA, the base sequence consisting of the bases from the 9th to 18th positions on the 5'end side is the base consisting of the bases from the 4th to 13th positions on the 5'end side of the 26S rRNA of Ce. It is preferable to have a sequence modified to form 9 or more complementary base pairs.

Specifically, the mutant CeR-2a RNA is selected from at least a group consisting of the substitution of the base (A) at the 12-position on the 5'-terminal side with U and the substitution of the base (C) at the 18-position with U. It is preferable to have a mutation modified so that one or more substitutions have been made. From the viewpoint of the nematode growth inhibitory effect and / or the nematode spawning inhibitory effect of the mutant CeR-2a RNA, the substitution should be the substitution of the base (A) at the 12-position on the 5'-terminal side with U. Is preferable, and it is more preferable that the number of the substitutions is all two.

On the 5'end side of the wild-type CeR-2a RNA, a base sequence consisting of bases from the 14th to 20th positions on the 5'end side of the 26S rRNA of Ce (3'-UGCUGAC-5') (SEQ ID NO: 2). There is no base sequence consisting of bases that form a complementary base pair with the base sequence at positions 14 to 20).

Therefore, the mutant CeR-2a RNA is located between the 8th base (C) and the 9th base (A) on the 5'end side, and the 14th to 20th positions on the 5'end side of the 26S rRNA of Ce. A mutation modified to insert a base sequence complementary to a part or all of the base sequence consisting of up to, for example, the base sequence represented by 5'-ACGACUG-3'(SEQ ID NO: 6). It is preferable to have.

The mutant CeR-2a RNA is not particularly limited as long as it has the above-mentioned mutation. Specific examples of the mutant CeR-2a RNA include the mutant CeR-2a RNA essentially consisting of the nucleotide sequence set forth in SEQ ID NO: 3, and the mutant CeR-2a essentially consisting of the nucleotide sequence set forth in SEQ ID NO: 7. Examples thereof include RNA and mutant CeR-2a RNA essentially consisting of the nucleotide sequence set forth in SEQ ID NO: 23. FIG. 2 schematically shows an embodiment of forming a complementary base pair between a wild-type CeR-2a RNA or a mutant CeR-2a RNA consisting of the base sequence set forth in SEQ ID NO: 3 and 26S rRNA.

The mutant CeR-2a RNA homolog of one aspect of the present invention exerts a nematode growth inhibitory effect and / or a nematode spawning inhibitory effect by binding to 26S rRNA in the nucleolus of a nematode cell. .. Therefore, the mutant CeR-2a RNA homolog may be designed to easily reach and enter the nucleolus of C. elegans.

The mutant CeR-2a RNA homolog can be produced by applying previously known nucleic acid synthesis techniques, for example, enzymatically or chemically synthesized by a manual or automated reaction. .. For example, in the genomic DNA of Ce, the portion containing the region encoding the wild-type CeR-2a RNA (8,428,478-8,429,157 of the IV chromosome of Ce) is used as a template on the 5'end side. A nucleic acid synthesis reaction is carried out using a primer to which a base sequence consisting of a base having the above-mentioned mutation is added (for example, a primer having a base sequence of SEQ ID NOs: 25 to 27). Then, the obtained reaction product is collected, and PCR is carried out using the reaction product as a template to obtain a DNA fragment encoding the mutant CeR-2a RNA. The DNA fragment is inserted into a plasmid suitable for RNA synthesis, the plasmid is linearized, and then subjected to an RNA synthesis reaction using RNA polymerase. Then, as a reaction product, a mutant CeR-2a RNA is obtained. At this time, the mutant CeR-2a RNA may be purified by extraction using a solvent or a resin, precipitation, electrophoresis, chromatography and the like. When acquiring the mutant CeR-2a RNA homolog, a contract manufacturing service using a contract manufacturing company such as Gene Design, Dharmacon, Qiagen, or Sigma-Aldrich may be used.

Variant CeR-2a RNA homologs can be introduced into C. elegans cells or tissues, or into C. elegans and used to bind 26S rRNA in the target nucleolus. By binding the RNA homolog to 26S rRNA, it is possible to induce the suppression of nematode growth and / or the suppression of nematode spawning. The introduction of the mutant CeR-2a RNA homolog can be appropriately carried out by those skilled in the art by a method known in the art. For example, in order to apply the mutant CeR-2a RNA homolog to nematodes, spraying or injecting the mutant CeR-2a RNA homolog into soil and / or plants, the mutant CeR-2a RNA homolog is expressed. Applying the recombinant virus to nematodes, BioClay (Elizabeth A. Worrall et al., Frontiers Plant Science, March 2019, Volume 10, Article 265, [https: /] See /www.nature.com/articles/nplants2016207])).

The mutant CeR-2a RNA homolog may be designed to be produced within the nematode. For example, a DNA fragment encoding a mutant CeR-2a RNA homolog may be inserted into an expression vector for nematode cells. Examples of such an expression vector include a plasmid vector having a U6 snRNA promoter upstream of the cloning site.

[Compositions and pesticides containing mutant CeR-2a RNA homolog as an active ingredient]
Another aspect of the present invention is a composition for suppressing the growth of nematodes, which contains the mutant CeR-2a RNA homolog of one aspect of the present invention as an active ingredient. Another aspect of the present invention is a composition for suppressing spawning of nematodes, which contains the mutant CeR-2a RNA homolog of one aspect of the present invention as an active ingredient.

The nematode growth-suppressing composition utilizes the nematode growth-suppressing effect of the mutant CeR-2a RNA homolog. The "nematode growth inhibitory action" means at least one action selected from the group consisting of an action of suppressing the rate at which the body length of the nematode grows and an action of suppressing the maximum body length of the nematode.

Ce has a maximum of 370 μm in the L1 stage 9 hours after hatching, a maximum of 480 μm in the L2 stage 12 hours after the L1 stage (21 hours after hatching), and a maximum of 480 μm in the L2 stage 8 hours after the L2 stage (29 hours after hatching) at 20 ° C. It is said that the maximum is 640 μm, the maximum is 850 μm in the L4 stage 8 hours after the L3 stage (37 hours after hatching), and about 1,060 μm in the adult stage 18 hours after the L4 stage (55 hours after hatching).

In the following, each action of the nematode Cerium when incubated at 20 ° C. under the liquid culture conditions described in Examples described later will be described.

When the composition for suppressing the growth of nematodes exerts the effect of suppressing the rate at which the body length of the nematodes grows, the body lengths of the nematodes in the L2 to adult stages, preferably the L2 to L4 stages, can be adjusted. It can be made smaller than when the nematode growth inhibitory composition is not used. For example, it is expected that the body length of the L4 stage nematode will be less than 850 μm by using the composition for suppressing the growth of the nematode.

Even when the nematode growth-inhibiting composition exerts an action of suppressing the rate at which the nematode body length increases, the nematode body length can reach 1,060 μm 55 hours after hatching. Therefore, the composition for suppressing the growth of nematodes does not necessarily suppress the maximum body length of nematodes just because it exerts an action of suppressing the rate at which the body length of nematodes grows.

On the other hand, when the nematode growth-suppressing composition exerts the effect of suppressing the maximum body length of the nematode, the maximum body length of the nematode is compared with the case where the nematode growth-suppressing composition is not used. , Can be made smaller. For example, when the nematode growth-suppressing composition is not used, the maximum body length of the nematode reaches 1,400 μm or more, but when the nematode growth-suppressing composition is used, it can be suppressed to less than 1,400 μm. Be expected.

The nematode spawning inhibitory composition utilizes the nematode spawning inhibitory effect of the mutant CeR-2a RNA homolog. The "nematode spawning inhibitory action" means the action of delaying the spawning start time of the nematode.

By using the nematode spawning inhibitory composition, the average spawning start time of the nematode is longer than when the nematode spawning inhibitory composition is not used, preferably 5 hours or more or 1.10 times. The above time is more preferably 7 hours or more or 1.15 times or more.

When the nematode spawning inhibitory composition is not used, most nematodes start spawning within 50 hours after hatching. On the other hand, when a composition for suppressing spawning of nematodes is used, most nematodes do not start spawning within 50 hours after hatching, but spawn 50 hours after hatching, preferably 55 hours after hatching. Start.

The composition for suppressing spawning of nematodes can delay the start time of spawning of nematodes, but does not necessarily suppress the number of spawning of nematodes. However, the composition for suppressing spawning of nematodes may be one that suppresses the number of spawning of nematodes.

The nematode growth inhibitory action and the nematode spawning inhibitory action can be confirmed and evaluated by the methods described in Examples described later. Specifically, the growth inhibitory effect of the nematode can be evaluated by measuring the body length of the nematode over time and confirming the body length growth profile and / or the average time when the body length reaches 1 mm. The spawning inhibitory effect of nematodes measures the number of fertilized eggs and / or the number of spawning start individuals of nematodes over time, and determines the number of fertilized eggs per hour, the number of spawning start individuals per hour and / or the average spawning start time. By confirming, it can be evaluated.

The mutant CeR-2a RNA homolog has a nematode growth-suppressing effect and a nematode spawning-suppressing effect. The mutant CeR-2a RNA homolog is a ribosomal constituent of Ce as compared with the wild-type CeR-2a RNA, 26S rRNA. It is presumed that the mechanism of action is that it binds strongly to the precursor of 26S rRNA, thereby inhibiting the processing of 26S rRNA. As a result, when the mutant CeR-2a RNA is in the nucleolus, the rRNA precursor accumulates unprocessed and ribosome biogenesis is suppressed.

Thereby, another aspect of the present invention is a composition for promoting the accumulation of rRNA precursors of nematodes, which contains the mutant CeR-2a RNA homolog of the present invention as an active ingredient. Another aspect of the present invention is a composition for suppressing nematode ribosome synthesis, which contains the mutant CeR-2a RNA homolog of the present invention as an active ingredient.

By using a composition for promoting the accumulation of rRNA precursors of C. elegans or a composition for suppressing the synthesis of ribosomes in C. elegans, 40S, which is a small unit of ribosomes, and a large unit are used as compared with the case where such a composition is not used. The ratio of a certain 60S (40S / 60S) becomes large, preferably 50% or more, or 1.5 times or more, more preferably 70% or more, or the case where the composition is not used as compared with the case where the composition is not used. It will be 2.0 times or more compared to that. This is due to the fact that the 26S rRNA precursor is processed and becomes one of the constituents of 60S, whereas when the 26S rRNA is not processed, the amount of 60S is reduced and the ratio of 40S / 60S is increased. The quantification of the nematode ribosome and each unit of the ribosome can be measured by the method described in Examples described later.

The mutant CeR-2a RNA homolog has at least one action selected from the group consisting of growth inhibitory action, egg laying inhibitory action, rRNA precursor accumulation promoting action and ribosomal synthesis inhibitory action on C. elegans. It can be used as an active ingredient of pesticides against. Therefore, another aspect of the present invention is a pesticide for nematodes containing the mutant CeR-2a RNA homolog of one aspect of the present invention as an active ingredient.

By using the pesticide of one aspect of the present invention, by acting on the nematodes attached to the soil and / or the plant body, for example, by suppressing the growth of the nematodes, before the nematodes become adults. Sufficient growth of young shoots of plants that are susceptible to adult nematodes; killing nematodes with other nematode agents before they start spawning by suppressing nematode spawning Destruction; It is expected that by promoting the accumulation of rRNA precursors and suppressing the synthesis of ribosomes, the synthesis of proteins that lead to drug resistance of C. elegans will be suppressed, and the susceptibility of C. elegans to drugs will be increased. ..

The content of the mutant CeR-2a RNA homolog in the composition of one aspect of the present invention and the pesticide is not particularly limited as long as the required action and effect are exhibited, but for example, the composition or the pesticide. It is 0.0001% by mass to 99% by mass, preferably 0.001% by mass to 10% by mass, based on the total amount. The amount and number of times of use of the composition and pesticide according to one aspect of the present invention are appropriately determined according to the type and number of nematodes to be applied, the target of application, the form of application, temperature, humidity, the application environment such as indoors and outdoors. It can be set and is not particularly limited, for example, the amount used once is 0.001 μg to 1,000 mg per mutant CeR-2a RNA homolog as the active ingredient; the number of times of use is once a day to Multiple times or once to multiple times every few days to several weeks. The compositions and pesticides of one aspect of the invention are preferably applied over a period of time, eg, weeks to months.

The growth inhibitory effect of Ce and the spawning inhibitory effect of Ce possessed by the mutant CeR-2a RNA tend to be more strongly exerted at 25 ° C. than at 20 ° C. and 15 ° C. Therefore, when the composition and pesticide according to one aspect of the present invention are used outdoors, the temperature is preferably 20 ° C. or higher, more preferably 25 ° C. or higher in spring, summer and autumn. When the composition and pesticide according to one aspect of the present invention are used indoors, the temperature is preferably set to 20 ° C. or higher, more preferably 25 ° C. or higher.

The composition and pesticide according to one aspect of the present invention may use the mutant CeR-2a RNA homolog as an active ingredient alone, or may be used in combination with one or more nematode-killing agents.

The dosage form of the composition and pesticide according to one aspect of the present invention is not particularly limited as long as the contained mutant CeR-2a RNA homolog exerts an action and effect as an active ingredient, and is not particularly limited, but for example, tablets and capsules. Solid agents such as agents, pills, powders and granules; liquid agents such as liquids, suspensions and emulsions.

The composition and pesticide according to one aspect of the present invention are formulated using a mutant CeR-2a RNA homolog, a pharmaceutically acceptable carrier, an additive, and the like, depending on the dosage form. For example, in the case of a solid agent, it can be formulated with an excipient, a binder, a disintegrant, a lubricant, a pH adjuster and the like. In the case of a liquid preparation, it can be formulated using a physiological saline solution, a buffer solution, a surfactant, a pH adjuster, or the like.

The composition and pesticide according to one aspect of the present invention are preferably formulated together with a nucleic acid introduction aid so that the mutant CeR-2a RNA homolog can be easily transferred into the cells of the nematode. Examples of the nucleic acid introduction aid include, but are not limited to, lipofectamine, oligofectamine, liposome, polyamine, DEAE dextran, calcium phosphate, dendrimer and the like.

The composition and pesticide according to one aspect of the present invention are preferably packaged. The container is not particularly limited and can be appropriately selected depending on the dosage form and the like. For example, a pack, a bottle, a can, a pouch or a pouch made of coated paper, plastic such as PET or PTP, metal such as aluminum, or glass. Examples include a layered or laminated film bag.

The method of using the composition and pesticide according to one aspect of the present invention is not particularly limited, but for example, the composition and pesticide according to one aspect of the present invention can be used as it is, with water or the like, or diluted with water or the like. can do.

Another aspect of the present invention is a method of utilizing the composition or pesticide of the other aspect of the present invention. The method of one aspect of the present invention suppresses the growth of nematodes, suppresses spawning, and promotes the accumulation of rRNA precursors by applying the composition or pesticide of one aspect of the present invention to nematodes. And / or a method of attenuating C. elegans or a method of protecting a plant from C. elegans, comprising the step of suppressing the synthesis of ribosomes. The above items can be appropriately referred to for the administration method, the method for confirming the attenuation of nematodes, and the like.

[Method for producing mutant nucleolar RNA]
Another aspect of the present invention is a method for producing mutant nucleolar RNA. In the production method of one aspect of the present invention, based on the information of the base sequence on the 5'end side of the rRNA precursor such as 26S rRNA and 28S rRNA of the organism, a base pair relatively highly complementary to the base sequence is obtained. The basic configuration is to design small nucleolar RNAs that form.

One aspect of the production method of the present invention is a step of obtaining a nucleolar RNA that forms a complementary base pair with the base sequence on the 5'end side of the rRNA precursor of an organism and binds to the rRNA precursor, and a nucleolar RNA. A step of obtaining a mutant nucleolar RNA by modifying the base sequence on the 5'end side of a small RNA so as to have high complementarity with the base sequence on the 5'end side of an rRNA precursor. At least include.

"Modifying the rRNA precursor so that it is highly complementary to the base sequence on the 5'end side" means that the base sequence on the 5'end side is rRNA compared to the unmutated wild-type nucleolar RNA. It means that the number of base pairs that form complementary base pairs with the base sequence on the 5'end side of the precursor is increased.

Each step in the production method of one aspect of the present invention can be carried out by adopting a conventionally known method. For example, the nucleotide sequences of rRNA precursors such as 26S rRNA and 28S rRNA of an organism can be searched using a public database such as GenBank (https://www.ncbi.nlm.nih.gov/genbank/). is there.

A small nucleolar RNA that forms a complementary base sequence with the base sequence on the 5'end side of the rRNA precursor of an organism or a gene encoding the RNA is a genome obtained from the organism by a known method. For DNA or RNA, PCR (polymerizer) is based on information such as the base sequence of rRNA precursor, the base sequence of wild-type CeR-2a RNA (SEQ ID NO: 1), and the base sequence of human U8 snoRNA (SEQ ID NO: 4). It can be obtained by adopting known bioengineering techniques such as elongation reaction), hybridization, and cDNA preparation techniques.

The obtained nucleolar RNA is modified so as to have high complementarity with the base sequence on the 5'end side of the rRNA precursor by adopting the same method as in which the mutant CeR-2a RNA was obtained. can do.

As long as the problem of the present invention can be solved, the method of one aspect of the present invention can incorporate various steps and operations in the first stage or the second stage of the above-mentioned steps or during the steps.

Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these Examples, and the present invention can take various aspects as long as the problems of the present invention can be solved. ..

[1. Outline of Examples]
As the nematode, Caenorhabditis elegans was used.

C. elegans was cultivated according to the standard protocol Brenner's literature (Brenner, S., The genetics of Caehorhabditis elegans. Genetics 77: 71-94., 1974). As the nematode, the strain shown in FIG. 3 was used.

CeR-2a RNA is C.I. It is a non-coding RNA discovered by elegans RNomics and is encoded on chromosome IV. CeR-2a RNA is localized in the nucleolus, and its gene-deficient strain (MT16939) has been confirmed to accumulate ribosomal large subunit rRNA (LSU rRNA) precursors (see Non-Patent Document 1).

As the results described later show, the accumulation of LSU rRNA precursor was eliminated in the strain (MTcer) in which the gene cer-2a was rescued to MT16939. Therefore, CeR-2a RNA is considered to be involved in cleavage of 5.8S and 26S in LSUrRNA processing. These facts suggest that CeR-2a RNA is a nematode homologue of U8 snoRNA in vertebrates.

Here, using MT16939, MTcer, and a strain (MTcerX) into which the mutant gene cer-2a (cerX) was introduced, time-dependent body length measurement and egg production number measurement were performed. In addition, cell extracts were prepared for each strain from C. elegans, ribosomes were separated by sucrose density gradient centrifugation, and the proportions of 40S, 60S and 80S ribosomes were analyzed.

A plasmid having the Mos1 transposon on chromosome II (MT4322) is injected with a plasmid encoding the selectable marker gene (unc-119) and the gene cer-2a (SEQ ID NO: 1) or the mutant gene cerX (SEQ ID NO: 3). , The gene was introduced by inducing homologous recombination (MosSCI method). All deficiencies in chromosome IV result from mating with males of MT16939.

A summary of the genotypes of each of the above strains is shown in FIG.

[2. Liquid culture of nematodes]
E. enriched as a food source. In order to prepare the coli W3110 strain, W3110 precultured overnight in LB medium (50 ml) was added to LB medium (3 L) and cultured at 37 ° C. for 8 hours while shaking at 125 rpm / min. W3110 was recovered by centrifugation at 4,500 rpm for 5 minutes at 4 ° C. The recovered W3110 pellets were resuspended in 50 ml of distilled water to obtain a resuspension of W3110.

On an NGM plate with a diameter of 15 cm, nematodes in a state in which various developmental stages are mixed are subjected to E.I. The coli strain OP50 (obtained from CGC) was inoculated with 200 μl of an overnight culture and precultured. Preculture solution (filling volume) of nematodes was about 40 μl, and E.I. 100 ml of S medium containing 2 ml of resuspension of colli W3110 was cultured at 20 ° C. for 164 hours with shaking at 125 rpm / min, and then 1 ml of resuspension of W3110 was added to the culture broth. The nematodes were cultured for an additional 21 hours and centrifuged at 6,000 rpm for 3 minutes at 4 ° C. for recovery. C. elegans was subjected to sucrose floating method using 2M sucrose. It was separated from coli and washed with 0.1 M NaCl containing 100 mg / ml cycloheximide. The yield of nematodes from 100 ml S medium was 300 μl to 400 μl in packing volume.

[3. Mos1-mediated single-copy installation (MosSCI)]
The nematode strains HUJ0003 and HUJ0004 are described in the literature of Frokjar-Jensen et al. (Frokjar-Jensen et al., Single-copy insertion of transgene in Caenorhabditis elegans. Nat Genet. 40: 1375-1383, 2008; Improved Mos1-mediated transgenesis in C. It was prepared by the MosSCI method described in .elegans. Nat Methods, 9: 117-118, 2012).

The genomic DNA regions of chromosome IV, including cer-2a (8,428,478-8,429,157) and cer-2b (4,880,391-4,881,412), were subjected to primers CP1 and CP2 and, respectively. Amplified by PCR with primers CP3 and CP4.

The obtained amplification product was cleaved with restriction enzymes SbfI and XhoI and inserted into the multicloning site of pCFJ151. The resulting plasmids were named pTKD843 with cer-2a and pTKD844 with cer-2b, respectively.

pTKD843 and pTKD844 as co-introduction markers in nematode strain EG4322 with pRF4 (roll-6 (su1006)) 50 ng / μl and pCFJ601 (Peft-3 :: Mos1 transposase :: tbb-2 3'UTR) 50 ng / μl. It was injected at / μl by the microinjection method.

Single worm PCR was performed with primers CF420 and CF421 to confirm that the transgene was inserted into the correct locus. The absence of the Mos1 element was verified by single worm PCR with primers oJL102 and oJL103 according to the above literature by Frockjar-Jensen et al. The strains obtained by introducing cer-2a and cer-2b into the obtained chromosome II were named HUJ0003 and HUJ0004, respectively.

The strains obtained by crossing the hermaphrodite of HUJ0003 and HUJ0004 with the male of MT16939 were named HUJ0005 and HUJ0006, respectively. The strain obtained by crossing the hermaphrodite of EG4322 with the male of MT16939 was named HUJ0007 (MT4322).

Cb-unc-119 was inserted into chromosome II of the mutant strain EG4322 as a single copy by the MosSCI method using the plasmid pCFJ151 (obtained from Addgene). As co-introduction markers, 50 ng / μl pRF4 (roll-6 (su1006)) and 50 ng / μl pCFJ601 (Peft-3 :: Mos1 transposase :: tbb-2 3'UTR) were used. DNA was introduced into C. elegans by the microinjection method. The obtained strain was named HUJ0011 (EG119).

The strain obtained by crossing the hermaphrodites of MT16939 with the male of HUJ0011 was named HUJ0008 (MT119).

A DNA fragment containing cerX was inserted into chromosome II of EG4322 as a single copy by the MosSCI method using the plasmid pTKD845. 50 ng / μl pRF4 (roll-6 (su1006)) and 50 ng / μl pCFJ601 (Peft-3 :: Mos1 transposase :: tbb-2 3'UTR) were used as co-introduction markers. DNA was introduced into C. elegans by the microinjection method. The obtained strain was named HUJ0012 (N2cerX). In HUJ0012, cer-2a is inserted into chromosome II in the background of EG4322. In addition, EG4322 is a nematode strain for MosSCI, and the mutant strain prepared by the MosSCI method this time and the strain prepared by crossing with those mutant strains have an EG4322 background and are modified cer-2a. The non-related genes are almost the same as N2.

pTKD845 was prepared by inserting a DNA fragment obtained by overlap extension PCR (OE-PCR) into the multi-cloning site of pCFJ151. pTKD845 has a sequence of cerX and its surroundings. OE-PCR consists of two PCR reactions. The first PCR consists of two types of reaction solutions. In the first PCR, the template DNA was pTKD843, respectively, and the reaction using the primers cer-2a-BPstr_F and the primer cer-2a + 105 + xho, and the reaction using the primers cer-2a-398 + sbfI and the primer cer-2a-BPstr_R were carried out. .. In the second PCR, the first PCR reaction solution was mixed and treated with the restriction enzyme DpnI, which was used as a template. Primers used were cer-2a + 105 + xho and cer-2a-398 + sbfI.

The strain obtained by crossing the hermaphrodites of MT16939 with the male of HUJ0012 was named HUJ0009 (MTcerX).

The sequences of the primers used are shown in Table 1.

[4. Absolute quantification of CeR-2a and CeR-2b RNA in mutants using real-time PCR]
The absolute copy numbers of CeR-2a and CeR-2b RNA in 1 μg of total RNA from C. elegans were measured using the calibration curve method according to the following procedure.

Template DNA for in vitro transcription was generated by nested PCR according to the description in Non-Patent Document 1. The first PCR was performed using pCFJ151 containing cer-2a as a template and primers RTP1 and CeR2aT7F1. The first PCR product was used as a template and the second PCR was performed with primers RTP1 and EcoRIT7. The primers CeR2aT7F1 and EcoRIT7 include a T7 promoter sequence region.

The DNA fragment obtained by the second PCR was used as a template for in vitro transcription, and CeR-2a RNA was generated using MEGAshortscript T7 transcription Kit (Ambion Inc.). The transcript was quantified and used as a standard sample for qRT-PCR. A 10-fold serial dilution of 4.4 × 10 ^{9 to 4.4 × 10 2 copies of CeR-2a RNA was used.}

Total RNA was extracted from C. elegans cultured in liquid medium using TRIzol reagent (Life Technologies) and then treated with DNase I (Promega). cDNA was synthesized from 1 μg of total RNA using PrimeScript Reverse Transcriptase (TaKaRa Bio) and primer RTP1. The obtained cDNA was subjected to real-time PCR using Brilliant III Ultra-Fast SYBR Green QPCR Master Mixes (Agilent Technologies) and cer-2 specific primers RTF1 and RTR1. Real-time PCR was performed using DNA Engine OPTICON 2 Continuous Fluorescence Detection system (MJ Research). The threshold line was set according to the default setting for MJ Operation Monitor Analysis Software Version 3.1 (Bio-Rad). CT values were calculated under the same conditions. By absolute quantification, the copy number of CeR-2 RNA of each nematode strain was determined according to the CT value with respect to the calibration curve. The final data was expressed as the copy number per 1 μg of total RNA.

The sequences of the primers used are shown in Table 2.

[5. Northern Hybridization]
Total C. elegans RNA (1 μg) was separated on a 1.0% denatured agarose gel containing formaldehyde and blotted onto Biodyne Plus membrane (Pall Corporation) by capillary blotting. Oligonucleotides NB1 and NB2 were labeled with DIG-ddUTP using DIG Oligonucleotide Tailing Kit 2nd generation (Roche) and used as probes for hybridization.

The sequences of the oligonucleotides used are shown in Table 3.

[6. Measurement of ribosome sedimentation profile]
The ribosome sedimentation profile is described in the literature of Kirstein-Miles et al. (Kirstein-Miles, J., et al., The nascent polypeptide-associated complex is a key regulator of proteostasis. EMBO J. 32: 1451-1468, 2013. ) And Saijo et al. (Saijou, E., et al., RBD-1, a nucleolar RNA-binding protein, is essential for Caenorhabditis elegans early development through 18S ribosomal RNA processing. Nucleic Acids Res. 32: 1028-1036. , 2004), the sucrose density gradient centrifugation method was analyzed by a method with minor modifications.

Nematodes with a packing volume of about 400 μl were added to lysis buffer (50 mM Tris-HCl [pH 7.5], 25 mM KCl, 5 mM MgCl ₂ , 0.5% Triton X-100, 250 mM sucrose) and mixed. The resulting mixture was homogenized at 3500 rpm for 2 minutes at 4 ° C. using Microsoft Mash MS-100 (Tomy Seiko Co. Ltd.).

The homogenized cell debris was removed by centrifugation at 14,000 g for 10 minutes at 4 ° C. The recovered supernatant was layered on a 10-30% (w / v) sucrose density gradient solution and centrifuged at 36,000 rpm for 200 minutes in a swingout rotor (HITACHI, P40ST-1714) at 4 ° C. did. _{Each gradient was fractionated and the absorbance (A 254} ) at 254 nm was measured using MODEL 152 Piston Gradient Fractionator ipTM (BioComp Instruments, Inc.) and ECONO UV MONITOR (Bio-Rad).

[7. Measurement of nematode body length]
Twenty L1 stage nematodes, E.I. The colli OP50 was placed on the seeded NGM plate. Immediately after the arrangement was set as time 0 (t = 0). NGM plates seeded with L1 stage nematodes were incubated at 20 ° C, 25 ° C or 15 ° C.

Images of nematodes were taken every 12 hours under a stereomicroscope (Olympus SZ60) using a digital camera. C. elegans every 48 hours. The colli OP50 was transferred to the seeded NGM plate to prevent the L1 stage nematodes from moving to the L2 stage.

The body length was measured from the nose to the anus of the nematode using ImageJ (Mörck, C., andPillion, M., 2006). Data were converted from pixels to a micrometer using a stage microphone MR-4 (NADEC CO., LTD.). Since the nose and anus of the L1 stage larva are not detectable on the image, the data after 12 hours are shown.

[8. Nematode spawning assay]
Fifty L1 nematodes were treated with E. coli. The colli OP50 was placed on the seeded NGM plate. NGM plates seeded with L1 stage nematodes were incubated at 20 ° C, 25 ° C or 15 ° C.

C. elegans was observed every 3 hours using a stereomicroscope (Olympus SZ60) after the young adult period until spawning on a plate. Every 3 hours, the number of eggs laid by the nematodes on the plate was counted.

[9. result]
The results of body length measurement of nematodes incubated at 20 ° C and 25 ° C are shown in FIGS. 4 and 5, respectively. As shown in each figure, N2cerX and MTcerX expressing the mutant CeR-2a RNA had a slower growth rate of body length than the corresponding N2 and MTcer, respectively. It was also found that when the nematodes were incubated at 15 ° C., they showed the same tendency as in FIGS. 4 and 5.

The results of measuring the number of spawning nematodes incubated at 20 ° C and 25 ° C are shown in FIGS. 6 and 7, respectively. In addition, the results of measuring the time to reach 1 mm in length and the time to start spawning of nematodes incubated at 20 ° C. and 25 ° C. are shown in FIG. As shown in each figure, N2cerX and MTcerX expressing the mutant CeR-2a RNA had a later time to reach 1 mm in length and a time to start spawning than the corresponding N2 and MTcer, respectively. It was also found that when the nematodes were incubated at 15 ° C., the same tendency as in FIGS. 6 to 8 was exhibited.

From the above results, it was found that the mutant CeR-2a RNA exhibits a growth inhibitory effect and an egg laying inhibitory effect on nematodes. In particular, as shown in FIG. 8, in comparison with MTcer and MT4322 (assuming that the gene unc-119 is present on chromosome III) comparing the presence or absence of CeR-2a RNA, the body length is 1 mm at 20 ° C and 25 ° C. There was almost no difference between the arrival time and the spawning start time at 25 ° C., and it was found that the presence or absence of CeR-2a RNA had almost no effect on the nematode phenotype. Nevertheless, it is a surprising finding for the first time by the present inventors that the mutant CeR-2a RNA exhibits a nematode growth inhibitory effect and a nematode spawning inhibitory effect.

The measurement result of the ribosome precipitation profile is shown in FIG. FIG. 9A is a schematic diagram showing that ribosomes were separated into 40S, 60S and 80S by sucrose density centrifugation on cell extracts prepared from each nematode strain. FIG. 9B is a graph in which the absorbance of the obtained fraction at 254 nm was measured and the absorbance of each fraction was graphed. FIG. 9C is a diagram showing the results of calculating the ratios of 40S, 60S and 80S by obtaining the area of each peak for each nematode strain.

As shown in FIG. 9, in N2cerX and MTcerX expressing the mutant CeR-2a RNA, the amount of 60S is reduced without processing the 26S rRNA with respect to the corresponding N2 and MTcer, respectively, and the ratio of 40S / 60S. Has grown. From this, it was found that the mutant CeR-2a RNA exhibits rRNA precursor accumulation promoting action and ribosomal synthesis inhibitory action on C. elegans.

The base sequences described in the present specification are shown below.
[SEQ ID NO: 1] Nucleotide sequence of wild-type CeR-2a RNA
CAGUCUUCAGUAUGGGUCAAUCUCUGAUCUGCAACUGAAUAUGAUGAGUUCGGGCGAUGAUCUUCUGUGAUUACAUCGCACGGCGAGGUGGGAACGCAAUACCCGCCUGCCAGCCCGAUUCUGAAC
[SEQ ID NO: 2] 26S rRNA base sequence (extracted from the 1st to 100th positions on the 5'end side)
CUCAACCUGAACUCAGUCGUGAUUACCCGCUGAACUUAAGCAUAUCAUUUAGCGGAGGAAAAGAAACUAAAAAGGAUUCCCUUAGUAACGGCGAGUGAAA
[SEQ ID NO: 3] Nucleotide sequence of mutant CeR-2a RNA
GGGUAAUCAGUUUGGGUCAAUCUCUGAUCUGCAACUGAAUAUGAUGAGUUCGGGCGAUGAUCUUCUGUGAUUACAUCGCACGGCGAGGUGGGAACGCAAUACCCGCCUGCCAGCCCGAUUCUGAAC
[SEQ ID NO: 4] Nucleotide sequence of human U8 snoRNA
AUCGUCAGGUGGGAUAAUCCUUACCUGUUCCUCCUCCGGAGGGCAGAUUAGAACAUGAUGAUUGGAGAUGCAUGAAACGUGAUUAACGUCUCUGCGUAAUCAGGACUUGCAACACCCUGAUUGCUCCUGUCUGAUU
[SEQ ID NO: 5] 28S rRNA base sequence (extracted from the 1st to 100th positions on the 5'end side)
CGCGACCUCAGAUCAGACGUGGCGACCCGCUGAAUUUAAGCAUAUUAGUCAGCGGAGGAGAAGAAACUAACCAGGAUUCCCUCAGUAACGGCGAGUGAAC
[SEQ ID NO: 6] A base sequence complementary to the base sequence consisting of the bases at positions 14 to 20 on the 5'end side of the 26S rRNA of Ce.
CAGUCGU
[SEQ ID NO: 7] In the base sequence of mutant CeR-2a RNA, ACGACUG is inserted between the 8th and 9th positions.
GGGUAAUCGACUGAGUUUGGGUCAAUCUCUGAUCUGCAACUGAAUAUGAUGAGUUCGGGCGAUGAUCUUCUGUGAUUACAUCGCACGGCGAGGUGGGAACGCAAUACCCGCCUGCCAGCCCGAUUCUGAAC
[SEQ ID NO: 8] Primer CP1
AAACCTGCAGGTACTGGTACGATCCCTGTTC
[SEQ ID NO: 9] Primer CP2
AAACTCGAGATCGTGTATTTTATGTCAACG
[SEQ ID NO: 10] Primer CP3
AAACCTGCAGGGGGAAAAAATGAGTTGTAGGC
[SEQ ID NO: 11] Primer CP4
AAACTCGAGCGAAAATCTACCAAATCCTG
[SEQ ID NO: 12] Primer CF420
TTTCTCACATGTTTTGCTGC
[SEQ ID NO: 13] Primer CF421
ACATTGTCGAAATGTCCTCC
[SEQ ID NO: 14] Primer oJL102
CAACCTTGACTGTCGAACCACCATAG
[SEQ ID NO: 15] Primer oJL103
TCTGCGAGTTGTTTTTGCGTTTGAG
[SEQ ID NO: 16] Primer RTP1
GTTCAGAATCGGGCTG
[SEQ ID NO: 17] Primer CeR2aT7F1
CGACTCACTATAGTCTTCAGTATGGGTCA
[SEQ ID NO: 18] Primer EcoRIT7
AAAGAATTCTAATACGACTCACTATA
[SEQ ID NO: 19] Primer RTF1
GTCAATCTCTGATCTGCAAC
[SEQ ID NO: 20] Primer RTR1
CGGGTATTGCGTTCCCA
[SEQ ID NO: 21] Probe NB1
TGGAACGTTGACATTTCGACACTCAACTGA
[SEQ ID NO: 22] Probe NB2
AAGAAGAAGCCTAGACGCATATAGCCACCA
[SEQ ID NO: 23] In the base sequence of mutant CeR-2a RNA, the bases at positions 13 and 14 are replaced with "C" and "A", respectively.
GGGUAAUCAGUUCAGGUCAAUCUCUGAUCUGCAACUGAAUAUGAUGAGUUCGGGCGAUGAUCUUCUGUGAUUACAUCGCACGGCGAGGUGGGAACGCAAUACCCGCCUGCCAGCCCGAUUCUGAAC
[SEQ ID NO: 24] Probe cer-2a-BRstr_F
GGGTAATCAGTTTGGGTCAATCTCTGATCTG
[SEQ ID NO: 25] Probe cer-2a-105 + xho
AAACTCGAGATCGTGTATTTTATGTCAACG
[SEQ ID NO: 26] Probe cer-2a-BRstr_R
ACCCAAACTGATTACCCGAGAAAGGGTGAAAGTGTGC
[SEQ ID NO: 27] Probe cer + 398 + sbf
AAACCTGCAGGTACTGGTACGATCCCTGTTC
[SEQ ID NO: 28] Cele (2b)
CAGUCUUCAGUAUGGGUCAAAUAUUGAUCUGCAACUGAAAAUGAAGAGAUCGGGCGAUGAAAUUUUGUGAUUAAAUCGCACGGCGAGAUGGGAACGCAAUACCCGUCUGGCAGCCCGAUUCUGAAC
[SEQ ID NO: 29] Cino
CAGUCUUCAGUAUGGGUCAAUCUCUGAUCUGCAACUGAAAAUGAUGAGCUCGGGCGAUGAUCUUUUGUGAUUACAUCGCACGGCGAGGAGGGAACGCAAUACCCGCCUGCCAGCCCGAUUCUGAAC
[SEQ ID NO: 30] Cbri1
CAGUCUUCAGUAUGGGUCAAAUAUUGAUCUGCAACUGAAUAUGAUGAGUUCGGGCGAUGAUCUUUUGUGAUUAAAUCGCACGGCGAGAUGGGAACGCAAUACCCGUCUGGCAGCCCGAUUCUGAAC
[SEQ ID NO: 31] Cbri2
CAGUCUUCAGUAUGGGUCAAAUAUUGAUCUGCAACUGAAAAUGAAGAGAUCGGGCGAUGAAAUUCUGUGAUUACAUCGCACGGCGGGGUGGGAAACGCAAUACCUGACCGUCAGCCUCGAUUCUGACA
[SEQ ID NO: 32] Crem1
UAGUCUUCAGUAUGGGUCAAAUAUUGAUCUGCAACUGAAAAUGAUGAGUUCGGGCGAUGAUCUUCUGUGAUUAUCGCACGGCGAGGAGGGAACGCAAUACCCACCUGUCAGCCCGAUUCUGAA
[SEQ ID NO: 33] Crem2
UAGUCUUCAGUAUGGGUCAAAUAUUGAUCUGCAACUGAAUAUGAUGAGUUCGGGCGAUGAUCCUCUGUGAUUACAUCGCACGGCGAGUUGGGAACGCAAUACCUGACUGCCAGCCCGGUUCUGA
[SEQ ID NO: 34] Cbre1
CAGUCUUCAGUAUGGGUCAAUCUCUGAUCUGCAACUGAAUAUGAUGAGUUCGGGCGAUGACUCUCUGUGAUUACAUCGCACGGCGAGGUGGGAACGCAAUACCCGCCUGCCAGCCCGAUUCUGAAC
[SEQ ID NO: 35] Cbre3
UUGUCAUCAGUAUGGGUCAAUCUCUGAUCUGCAACUGAACAUGAUGAAAACGGGCGAUGAUCCAUCGGUGAUUAUAACGCACGGCGAGGAGGGAACGCAAUACCCACCUGUCUGCCCGAAUCUGA
[SEQ ID NO: 36] Cbre4
UUGUCAUCAGUAUGGGUCAAUCUCUGAUCUGCAACUGAACAUGAUGAUAACGGGCGAUGAUCCAUCGGUGAUUAUAACGCACGGCGAGGAGGGAACGCAAUACCCACCUGUCUGCCCGAAUCUGA
[SEQ ID NO: 37] Cbre5
UUGUCAUCAGUAUGGGUCAAUCUCUGAUCUGCAACUGAACAUGAUGAAAACGGGCGAUGAUCCUUUGGUGAUUAUAACGCACGGCGAGGAGGGAACGCAAUACCCACCUGUCUGCCCGAAUCUGA
[SEQ ID NO: 38] Hcon
UUGUCUUCAGUAAGGGUCAAUUCAGACCUGAAUCUGAAUAUGAUGAGAUCGGGCGAUGAGUCAAAGUGAGUUACGACGCACGGAUCGUCGGGACCGCAACUCCCGUACGAGGCCCGAAUCUGAA
[SEQ ID NO: 39] Smur
UCGGUCUCAGUAAGGGUCAAUUCAGACCUGAAUCUGAAACGUGAUGAGAUCGGGCGAUGAGUUCCAGAUGAGUUAAAGCGCACGGCGGCGCGAGUGUCGCAACUUGCGUUUGAUGCCUGAGUCUGAGUC
[SEQ ID NO: 40] Haemonchus contortus 26S rRNA
UGCAACCUGAGCUCAGGCGUGAUUACCCGCUGAACUUAAGCAUAUCACUUAGCGGAGA
[SEQ ID NO: 41] Symphacia muris 26S rRNA
UAGUACCUCAACUCAGUCGUGAUUACCCGCUGAAUUUAAGCAUAUACUAAGCGCGGAA
[SEQ ID NO: 42] Primer cer-2a-BPstr_F
GGGTAATCAGTTTGGGTCAATCTCTGATCTG
[SEQ ID NO: 43] Primer cer-2a + 105 + xho
AAACTCGAGATCGTGTATTTTATGTCAACG
[SEQ ID NO: 44] Primer cer-2a-398 + sbfI
AAACCTGCAGGTACTGGTACGATCCCTGTTC
[SEQ ID NO: 45] Primer cer-2a-BPstr_R
ACCCAAACTGATTACCCGAGAAAGGGTGAAAGTGTGC

The mutant CeR-2a RNA homolog, composition and pesticide of one aspect of the present invention protects plants in which adverse events caused by C. elegans occur by suppressing the growth rate of C. elegans and delaying the start of spawning. And can be used to promote growth.

Claims (11)

In the wild-type CeR-2a RNA homolog of nematodes, the mutant CeR-2a has a mutation modified to form a highly complementary base pair with the base sequence on the 5'end side of the base sequence of 26S rRNA. RNA homolog. The nematodes, mosquito Enola Budhi infantis genus (Caenorhabditis) nematodes are Haemonchus genus (Haemonchus) nematodes or Shifashia genus (Syphacia) nematodes, mutant CER-2a RNA homolog according to claim 1. In the base sequence of the wild-type CeR-2a RNA homolog, the base sequence consisting of the bases at positions 1 to 8 on the 5'end side consists of the bases at positions 21 to 28 on the 5'end side in the base sequence of 26S rRNA. The mutant CeR-2a RNA homolog according to any one of claims 1 and 2, which has a base sequence and a mutation modified to form 6 or more complementary base pairs. Furthermore, in the base sequence of the wild-type CeR-2a RNA homolog, the base sequence consisting of the bases at positions 9 to 18 on the 5'end side is from the bases at positions 4 to 13 on the 5'end side in the base sequence of 26S rRNA. The mutant CeR-2a RNA homolog according to claim 3, which has a nucleotide sequence and a mutation modified to form 9 or more complementary base pairs. Furthermore, in the base sequence of the wild type CeR-2a RNA homolog, between the base at the 8th position on the 5'end side and the base at the 9th position, the bases at the 14th to 20th positions on the 5'end side in the base sequence of 26S rRNA. The mutant CeR-2a RNA homolog according to any one of claims 3 to 4, which has a mutation modified to insert a base sequence complementary to a part or all of the base sequence consisting of. A mutant CeR-2a RNA homolog consisting essentially of the nucleotide sequence set forth in SEQ ID NO: 3, SEQ ID NO: 7 or SEQ ID NO: 23 of the Sequence Listing. A composition for suppressing the growth of nematodes or a composition for suppressing spawning of nematodes, which comprises the mutant CeR-2a RNA homolog according to any one of claims 1 to 6 as an active ingredient. A composition for promoting the accumulation of rRNA precursors of C. elegans or a composition for suppressing ribosomal synthesis of C. elegans, which contains the mutant CeR-2a RNA homolog according to any one of claims 1 to 6 as an active ingredient. A pesticide for nematodes containing the mutant CeR-2a RNA homolog according to any one of claims 1 to 6 as an active ingredient. A step of obtaining a small nucleolar RNA that forms a complementary base pair with the base sequence on the 5'end side of the rRNA precursor of an organism and binds to it.
Mutant nucleolar RNA by modifying the base sequence on the 5'end side of the nucleolar RNA so as to be highly complementary to the base sequence on the 5'end side of the rRNA precursor. A method for producing mutant nucleolar RNA, which comprises a step of obtaining a mutant nucleolar RNA. The production method according to claim 10, wherein the organism is a nematode.

Images