JP2020075882A - Novel transcriptional repression fusion polypeptide - Google Patents

Abstract

To provide a new protein having an immune checkpoint molecule such as PD-1, as a target.SOLUTION: A fusion polypeptide contains a cell membrane permeable peptide, a DNA binding peptide bound to the base sequence of PD-1 (Programmed cell death 1) gene and a peptide having DNA methylation activity.SELECTED DRAWING: None

Description

  The present invention relates to novel fusion polypeptides that suppress PD-1 expression.

In recent years, as cancer immunotherapy, a method using a monoclonal antibody against an immune checkpoint molecule such as PD-1 (Programmed cell death 1) and CTLA-4 has been introduced, and has received a great deal of attention (Patent Document 1: International Published 2004/004771).
PD-1 is a molecule present on the surface of cytotoxic T cells (CTL) and natural killer cells (NK cells). It is known that when PD-1 binds to a ligand on cancer cells (such as PD-L1), the cytotoxic activity of CTLs and NK cells on cancer cells is suppressed. In such a mechanism, a monoclonal antibody against PD-1 inhibits the binding of PD-1 and PD-L1 to inhibit the suppression of the cytotoxic activity of CTL and NK cells, resulting in damage to cancer cells. It is known to be possible.

International Publication No. 2004/004771

  On the other hand, in order to expand the possibility of cancer immunotherapy, development of new proteins targeting immune checkpoint molecules such as PD-1 is required in addition to antibodies.

The present inventor, as a result of intensive studies to solve the above problems, a cell membrane-penetrating peptide, a DNA-binding peptide that binds to the base sequence of the PD-1 gene and a fusion polypeptide containing a peptide having DNA methylation activity. It was made. Then, by using the fusion polypeptide, succeeded in suppressing the expression of PD-1 in cytotoxic cells, further succeeded in sustaining the cytotoxic activity of the cells for several days after administration, The invention was completed.
That is, the present invention is as follows.
(1) A fusion polypeptide comprising a cell membrane-penetrating peptide, a DNA-binding peptide that binds to a base sequence of PD-1 (Programmed cell death 1) gene, and a peptide having DNA methylation activity, wherein the base sequence is a sequence A fusion polypeptide having the base sequence shown in No. 7, 8 or 9.
(2) The fusion polypeptide according to (1) above, wherein the peptide having DNA methylation activity is a DNMT3A, DNMT3B, a fusion peptide of DNMT3A and DNMT3L or a fusion peptide of DNMT3B and DNMT3L.
(3) The fusion polypeptide according to (1) or (2) above, wherein the cell-penetrating peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 5.
(4) The fusion polypeptide according to any one of (1) to (3) above, wherein the DNA-binding peptide is a transcriptional activator-like effector (TALE).
(5) The fusion polypeptide according to (4) above, wherein the DNA-binding peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 11, 13 or 15.
(6) The cell-penetrating peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 5, the DNA-binding peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 11, 13 or 15, and has a DNA methylation activity. The fusion polypeptide according to (5) above, wherein the peptide has a peptide containing a fusion peptide of DNMT3A and DNMT3L.
(7) The fusion polypeptide according to (6) above, which comprises the amino acid sequence shown in SEQ ID NO: 39, 41 or 43.
(8) A composition comprising the fusion polypeptide according to any one of (1) to (7) above.
(9) The composition according to (8) above, which is a PD-1 expression inhibitor.
(10) A cytotoxic cell into which the fusion polypeptide according to any one of (1) to (7) above has been introduced.
(11) A composition comprising the cytotoxic cell according to (10) above.
(12) The composition according to (11) above, which is a pharmaceutical composition for treating or preventing cancer.

  By using the fusion polypeptide of the present invention, the expression of PD-1 in cytotoxic cells can be suppressed, and the cytotoxic activity of the cells can be sustained for several days after administration.

It is a figure which shows the position of the target sequence of various TALE, and the analysis procedure of DNA methylation activity. It is a figure which shows the analysis result of DNA methylation activity. It is a figure which shows the expression analysis result of PD-1 gene. FIG. 3 shows that the fusion polypeptide of the present invention suppressed PD-1 gene expression. FIG. 3 is a diagram showing that the fusion polypeptide of the present invention induced DNA methylation in the PD-1 gene promoter region. FIG. 3 shows that the fusion polypeptide of the present invention suppressed PD-1 gene expression in PBMC. FIG. 3 shows that the fusion polypeptide of the present invention suppressed PD-1 protein expression in PBMC. FIG. 3 shows that the fusion polypeptide of the present invention induced DNA methylation in the PD-1 gene promoter region in PBMC. FIG. 3 is a schematic diagram showing an evaluation system for the effect of the present invention on the cytotoxic activity of PBMC. It is a histogram which shows that the cancer cell which shows apoptosis (Annexin V positive cell) increased by PBMC which made the fusion polypeptide of this invention act. It is a graph which shows that the cancer cell (Annexin V positive cell) which shows apoptosis increased by PBMC which made the fusion polypeptide of this invention act.

  Hereinafter, the present invention will be described in detail. The following embodiments are examples for explaining the present invention and are not intended to limit the present invention only to these embodiments. The present invention can be implemented in various forms without departing from the gist thereof.

1. Overview In recent years, a method using an antibody against an immune checkpoint molecule has been attracting attention as a cancer immunotherapy, and "adoptive immunotherapy" is known as one of the different cancer immunotherapy. This method is a method in which cancer cell-specific cytotoxic cells (CTL, NK cells, etc.) derived from a cancer patient are once cultured in vitro and proliferated, and the proliferated cells are administered to the same cancer patient.
In adoptive immunotherapy, when an immune checkpoint molecule such as PD-1 (Programmed cell death 1) is expressed on the surface of cytotoxic cells administered to a patient, the cytotoxic cells are PD-L1 on the cancer cells. And the cytotoxicity to cancer cells is suppressed.
In addition, systemic administration of an antibody against PD-1 is considered to enhance the cytotoxic activity of immunocompetent cells by blocking the binding between PD-1 and PD-L1. It is known that autoimmune disease-like symptoms such as enteritis, pneumonia, and myocarditis appear as serious side effects in the treated patients (Wang DY et al., JAMA Oncol., 2018 Sep 13).
On the other hand, the present invention is a fusion polypeptide containing a DNA-binding peptide that binds to the base sequence of the PD-1 gene and a peptide having DNA methylation activity, which enhances cytotoxic activity ex vivo on immunocompetent cells. The advantage is one of the advantages.
The fusion polypeptide of the present invention is capable of epigenome-modifying (specifically, methylating) the DNA of PD-1 gene, whereby PD-1 expression can be suppressed. In fact, peripheral blood mononuclear cells (PBMCs) containing CTLs and NK cells whose expression of PD-1 was suppressed by the present invention had enhanced cytotoxic activity against cancer cells as compared with controls (see the present specification. Example 2, FIGS. 6A and 6B). Furthermore, surprisingly, the PD-1 expression-suppressing action and the CTL cytotoxic activity can be maintained for several days even after the administration of the fusion polypeptide of the present invention is stopped.

When the fusion polypeptide of the present invention having such an effect is used for adoptive immunotherapy, not only during the time when the immunocompetent cells collected from the patient are cultured in the presence of the polypeptide, but also after the completion of the culture (after the administration is stopped) ), It is possible to sustain the PD-1 expression suppressing action and the CTL cytotoxic activity for several days. That is, in the adoptive immunotherapy using the present invention, cytotoxic cells with enhanced or maintained PD-1 expression suppressing action and cytotoxic activity can be administered to a patient.
Furthermore, since the fusion polypeptide of the present invention has no possibility of being integrated into the genome like plasmid DNA and the like, it can be expected to alleviate autoimmune disease-like symptoms observed by systemic administration of the antibody, and thus it is clinically expected. Is also very safe.
Thus, the fusion polypeptide of the present invention is extremely useful for enabling new cancer immunotherapy which could not be achieved by conventional immunotherapy such as antibody therapy.

2. Fusion Polypeptide (1) Cell Membrane Penetrating Peptide The fusion polypeptide of the present invention is a fusion polypeptide containing a cell membrane penetrating peptide, a DNA-binding peptide that binds to the base sequence of the PD-1 gene, and a peptide having DNA methylation activity. is there.
In the present invention, the “cell membrane-permeable peptide” is not particularly limited in its amino acid sequence as long as it is a peptide that can pass through a cell membrane. Whether or not the test peptide can pass through the cell membrane can be confirmed using a known cell membrane passage evaluation system (International Publication No. 2008/108505).

  Known cell membrane permeable peptides can be used as the cell membrane permeable peptide contained in the fusion polypeptide of the present invention (International Publication No. 2008/108505, Pharmacol. Ther., 2015, Vol. 154, p. 78-86, Database (Oxford), 2012, bas015). For example, as the cell membrane-penetrating peptide contained in the fusion polypeptide of the present invention, a polypeptide containing the amino acid sequences RI, FI and RIGC and having 25 or less amino acid residues can be used. In one embodiment, the cell membrane-penetrating peptide contained in the fusion polypeptide of the present invention includes the amino acid sequence represented by SEQ ID NO: 1 (RILQQLLFIHFRIGCRHSRI) or the amino acid sequence represented by SEQ ID NO: 2. A peptide containing the sequence (RILQQLLFIHFRIGCRH) or consisting of this amino acid sequence, containing the amino acid sequence shown in SEQ ID NO: 3 (RILQQLLFIHFRIGC) or containing this amino acid sequence, containing the amino acid sequence shown in SEQ ID NO: 5 (RIFIHFRIGC) or Examples thereof include a peptide consisting of an amino acid sequence, or a peptide containing the amino acid sequence (RIFIRIGC) shown in SEQ ID NO: 6 or consisting of this amino acid sequence. Preferred is a peptide containing or consisting of the amino acid sequence (RIFIHFRIGC) shown in SEQ ID NO: 5. The nucleotide sequence encoding the amino acid sequence (RIFIHFRIGC) shown in SEQ ID NO: 5 is shown in SEQ ID NO: 4.

(2) DNA-binding peptide In the present invention, the "DNA-binding peptide that binds to the base sequence of the PD-1 gene" is a DNA-binding polypeptide that binds to the transcriptional regulatory region of the PD-1 gene.
The transcription regulatory region is not particularly limited as long as it is a region involved in PD-1 gene expression regulation, and examples thereof include a promoter region and an enhancer region.

  In the present invention, the "DNA-binding peptide that binds to the base sequence of the PD-1 gene" is not limited, but for example, a DNA-binding peptide that binds to the base sequence shown in SEQ ID NO: 7, 8 or 9. Is mentioned.

  In the present invention, “bind” as used for a DNA-binding peptide means that it has an affinity for DNA having a target nucleotide sequence. Further, "binds" means not only direct binding to the target nucleotide sequence but also indirectly binding to the target nucleotide sequence by binding to the polynucleotide binding to the target nucleotide sequence. .. Therefore, the DNA-binding polypeptide contained in the fusion polypeptide of the present invention is not only a polypeptide that directly binds to a target base sequence, but also indirectly a target that binds to a polynucleotide that binds to a target base sequence. A polypeptide that binds to the nucleotide sequence of is also included.

  As a DNA-binding peptide that indirectly binds to a target nucleotide sequence by binding to a polynucleotide that binds to a target nucleotide sequence, for example, CRISPR / CAS9 (Science, 2013, Vol.339, p.819-823) Can be used. Since the technology for producing CRISPR / CAS9 is known, those skilled in the art can, based on the technology, design a polynucleotide designed to bind to a target nucleotide sequence, and a peptide that binds to the polynucleotide. It can be produced (Science, 2013, Vol.339, p.819-823, Science, 2013, Vol.339, p.823-826).

  Further, in the present specification, the term “bind” used for a DNA-binding polypeptide means that not only is it actually bound to the target nucleotide sequence, but also that it is designed to bind to the target nucleotide sequence. means. Therefore, the DNA-binding polypeptide contained in the fusion polypeptide of the present invention includes not only the DNA-binding polypeptide that actually binds to the target nucleotide sequence, but also the DNA-binding polypeptide designed to bind to the target nucleotide sequence. Peptides are also included.

  Whether the test peptide can bind to the target nucleotide sequence or the polynucleotide that binds to the target nucleotide sequence is determined by using a known binding activity measurement method such as gel shift assay or ChIP (Chromatin immunoprecipitation) -seq assay. You can check.

  Whether or not the test peptide was designed to bind to the target base sequence can be confirmed, for example, by whether or not the test peptide contains an amino acid sequence reported to bind to the target base sequence. As an amino acid sequence that is reported to bind to the target nucleotide sequence, for example, Science, 2009, Vol.326, p.1509-1512, Nat.Biotechnol., 2011, Vol.29, p.143-148, The amino acid sequences described in JP-A-2015 / 33365 and Proc.Natl.Acad.Sci.USA., 1997, Vol.94, p.5525-5530 can be mentioned. In addition, whether or not the test peptide was designed to bind to the target base sequence was determined by using a known binding activity measurement method such as gel shift assay or ChIP-seqm assay as in the above. You may check whether it actually binds to the array.

Examples of DNA-binding peptides designed to bind to the nucleotide sequence of the PD-1 gene include, for example, transcriptional activator-like effector (TALE) (Science, 2009, Vol.326, p.1509-1512) or Zinc- Finger protein (Proc. Natl. Acad. Sci. USA., 1996, Vol.93, p.1156-1160) can be used. Techniques for producing TALE and Zinc-finger proteins are known (Nat. Biotechnol., 2011, Vol.29, p.143-148, Proc. Natl. Acad. Sci. USA., 1997, Vol.94, p. .5525-5530), when producing TALE, a method of producing TALE having high binding activity to a nucleotide sequence can be used (JP2015 / 33365, Platinum Gate TALEN construction protocol (Yamamoto lab) Ver.1.0 [October 22, 2018 search], Internet <URL: https: //www.addgene.org/static/cms/files/Platinum_Gate_protocol.pdf>).
For the binding region (target nucleotide sequence) of TALE, for example, a peripheral sequence of a gene to be bound is searched in a known database (eg, Ensembl genome browser), and the gene that is expected to act as a promoter or enhancer of the gene. Can be selected from the gene region upstream (for example, about 1 to 500 base pair (bp) upstream, about 1 to 50,000 bp upstream) from the transcription initiation point of.

As used herein, "TALE" means a peptide containing a repeat structure in which structural units consisting of 34 amino acids are linked by a repeating number of 10 to 30 (hereinafter, also referred to as "DNA binding repeat portion"). To do. In the present invention, TALE comprises a DNA-binding repeat portion designed to bind to a target base sequence on the genome of interest and an amino terminal region containing an amino acid sequence designed to bind to thymine ( RCSB Protein Data Bank, Molecule of the Month, 2014, No.180, Nat. Biotechnol., 2011, Vol.29, p.143-148). As the amino acid sequence of the amino terminal region including the amino acid sequence of the DNA-binding repeat portion designed to bind to the target base sequence and the amino acid sequence designed to bind to thymine, for example, a known amino acid sequence is used. (Science, 2009, Vol.326, p.1509-1512, Nat. Biotechnol., 2011, Vol.29, p.143-148, JP2015 / 33365).
In the present invention, examples of the amino acid sequence of the “DNA binding repeat portion designed to bind to the target base sequence” include the amino acid sequences shown in SEQ ID NOs: 11, 13 or 15, but are not limited thereto. Not done.
In the present invention, examples of the amino acid sequence of the above-mentioned “amino terminal region containing an amino acid sequence designed to bind to thymine” include, but are not limited to, the amino acid sequence shown in SEQ ID NO: 17. ..

  In the present invention, the "DNA-binding peptide that binds to the base sequence of the PD-1 gene" is not limited, and examples thereof include TALE that binds to the base sequence shown in SEQ ID NO: 7, 8 or 9. Be done.

In the present invention, the “DNA-binding peptide that binds to the nucleotide sequence of the PD-1 gene” is not limited, and examples thereof include TALE including the amino acid sequence shown in SEQ ID NO: 11, 13 or 15. It is preferably TALE containing the amino acid sequence shown in SEQ ID NO: 19, 21 or 23, and more preferably TALE containing the amino acid sequence shown in SEQ ID NO: 25, 27 or 29 or consisting of this amino acid sequence.
The amino acid sequences shown in SEQ ID NOs: 11, 13 and 15 are amino acid sequences of the DNA binding repeat portion designed to bind to the target base sequence.
The amino acid sequence shown in SEQ ID NO: 19, 21 or 23 is (i) an amino terminal region containing an amino acid sequence designed to bind to thymine, and (ii) a DNA binding designed to bind to a target base sequence. It is an amino acid sequence containing a repeat part.
The amino acid sequence shown in SEQ ID NO: 25, 27 or 29 is (i) an amino terminal region containing an amino acid sequence designed to bind to thymine, and (ii) a DNA binding designed to bind to a target base sequence. It is an amino acid sequence containing a repeat portion and (iii) a carboxyl-terminal region downstream of the DNA-binding repeat portion.

(3) Peptide having DNA methylation activity In the present invention, the “ peptide having DNA methylation activity” means a peptide having the activity of methylating the DNA of the PD-1 gene. Such peptides are not limited, for example, DNMT3A, DNMT3B, a fusion peptide of DNMT3A and DNMT3L (hereinafter "DNMT3A / 3L"), a fusion peptide of DNMT3B and DNMT3L (hereinafter "DNMT3B / 3L"). ) And the like (Gowher H et al., J Biol Chem. 2005 Apr 8; 280 (14): 13341-8. Epub 2005 Jan 24), and preferably DNMT3A / 3L and DNMT3B / 3L. The nucleotide sequences and amino acid sequences of DNMT3A, DNMT3B and DNMT3L are known, and those skilled in the art can prepare peptides having DNA methylation activity based on known databases (Genbank etc.).
In the present invention, DNMT3A / 3L includes, for example, a peptide containing or consisting of the amino acid sequence shown by SEQ ID NO: 31. Moreover, examples of the polynucleotide encoding DNMT3A / 3L include a polynucleotide containing or consisting of the base sequence shown in SEQ ID NO: 30.
The presence or absence of DNA methylation activity can be analyzed using a known method. For example, genomic DNA containing a CpG island that can be a target of methylation is cloned and this DNA is used as a substrate. In the presence of adenosylmethionine (NEB), this substrate is reacted with the test peptide, and after the reaction is completed, the non-methylated cytosine is converted into uracil by the bisulfite treatment in the protein-free DNA. Then, by performing a sequence analysis on the treated DNA, it can be examined whether or not the test peptide has a methylating activity.

  In the fusion polypeptide of the present invention, the positions of the cell-penetrating peptide, the DNA-binding peptide that binds to the base sequence of the PD-1 gene, and the peptide having DNA methylation activity have the activity of suppressing the expression of the PD-1 gene. As long as it is not limited. Preferably, the cell-penetrating peptide is located N-terminal or C-terminal to the fusion polypeptide of the invention. More preferably, the cell membrane penetrating peptide is located N-terminal to the fusion polypeptide of the invention. In one embodiment, the fusion polypeptide of the present invention is composed of a cell membrane-penetrating peptide, a DNA-binding peptide that binds to the base sequence of the PD-1 gene, and a peptide having DNA methylation activity in this order from the N-terminal side. ..

  Included in the fusion polypeptide of the present invention, cell membrane-permeable peptide, the DNA-binding peptide that binds to the base sequence of the PD-1 gene and the biological species from which the peptide having DNA methylation activity is derived are not limited, Examples thereof include mice, rats, rabbits, humans, monkeys, dogs, cows, birds, and the like, but mice, rats, humans, monkeys are preferable, and humans are more preferable.

  As long as the fusion polypeptide of the present invention is capable of suppressing the expression of PD-1, the fusion polypeptide between the cell membrane-permeable peptide, the DNA-binding peptide that binds to the base sequence of the PD-1 gene and the peptide having DNA methylation activity is used. May include a peptide such as a peptide linker.

Further, the fusion polypeptide of the present invention, as long as the expression of PD-1 can be suppressed, Glutathione S-transferase (GST) or histidine tag (His tag) at the N-terminal or C-terminal of the fusion polypeptide of the present invention. Peptide tags such as
In the present invention, examples of the histidine tag include, but are not limited to, those containing the amino acid sequence shown in SEQ ID NO: 33.

Further, the fusion polypeptide of the present invention may contain a protease recognition sequence such as a TEV protease recognition sequence and a precision protease recognition sequence as long as it can suppress the expression of PD-1. The position of the protease recognition sequence in the fusion polypeptide of the present invention is not limited.
In the present invention, examples of the TEV protease recognition sequence include those containing the amino acid sequence shown in SEQ ID NO: 35, and examples of the precision protease recognition sequence include those containing the amino acid sequence shown in SEQ ID NO: 37. Examples include, but are not limited to:

  In one embodiment, the fusion polypeptide of the present invention comprises (i) a cell membrane-penetrating peptide comprising or consisting of the amino acid sequence (RIFIHFRIGC) shown in SEQ ID NO: 5, (ii) SEQ ID NO: 11, 13 or TALE containing the amino acid sequence shown by 15 and (iii) DNMT3A / 3L containing the amino acid sequence shown by SEQ ID NO: 31 or consisting of this amino acid sequence. In addition, in addition to this, the fusion polypeptide of the present invention comprises (iv) a TEV protease recognition sequence containing the amino acid sequence shown in SEQ ID NO: 35, and / or (v) a precision sequence containing the amino acid sequence shown in SEQ ID NO: 37. It may further include a protease recognition sequence.

  In one embodiment, the fusion polypeptide of the invention is a polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 39, 41 or 43.

In addition, the fusion polypeptide of the present invention includes, in addition to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 39, 41 or 43, one or several amino acids in the amino acid sequence shown in SEQ ID NO: 39, 41 or 43. Include a polypeptide having an amino acid sequence in which is deleted, substituted, inserted, or added, or mutated by a combination thereof, and has an action of suppressing the expression of the PD-1 gene.
In the amino acid sequence shown in the above SEQ ID NOs: 39, 41 or 43, one or several amino acids are deleted, substituted, inserted, or added, or as an amino acid sequence mutated by a combination thereof, for example,
(I) 1 to 10 in the amino acid sequence shown in SEQ ID NO: 39, 41 or 43 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2 and even more preferably 1) Amino acid sequence in which the amino acid of
(Ii) 1 to 10 in the amino acid sequence shown in SEQ ID NO: 39, 41 or 43 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2 and still more preferably 1) Amino acid sequence in which the amino acid of is replaced with another amino acid,
(Iii) 1 to 10 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2 and even more preferably 1) in the amino acid sequence shown in SEQ ID NO: 39, 41 or 43. Amino acid sequence in which the amino acid of
(Iv) 1 to 10 (for example, 1 to 5, preferably 1 to 3, more preferably 1 to 2 and even more preferably 1) amino acid sequences shown in SEQ ID NOs: 39, 41 or 43. An amino acid sequence with amino acids added,
(V) Examples include amino acid sequences mutated by the combination of (i) to (iv) above.

  In the present invention, the “action of suppressing the expression of PD-1 gene” means the action of decreasing the expression level of PD-1 gene in cells. “Having an action of suppressing the expression of the PD-1 gene” means that the test fusion polypeptide is compared with the expression level of the PD-1 gene in cells cultured in a medium to which the test fusion polypeptide is not added. 10% or more, 20% or more, 30% or more, 40% or more, preferably 50% or more is meant to have an action of reducing the expression level of the PD-1 gene. The action of suppressing the expression of the PD-1 gene is, for example, the amount of mRNA of the PD-1 gene in cells cultured in a medium containing the fusion peptide of the present invention is measured by a known method, for example, Real-time PCR. By doing so, it can be confirmed.

  The fusion peptide of the present invention includes, in addition to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 39, 41 or 43, about 80% or more, 85% or more with the amino acid sequence shown in SEQ ID NO: 39, 41 or 43. , 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more with an amino acid sequence having an identity, and having an action of suppressing the expression of the PD-1 gene Peptides are included.

The term “identity” as used herein means a value obtained by using EMBOSS NEEDLE program (J.Mol.Biol., 1970, Vol.48, p.443-453) search using parameters prepared by default. Means Identity. The parameters are as follows:
Gap penalty = 10
Extend penalty = 0.5
Matrix = EBLOSUM62

In order to prepare a polypeptide having the above mutation, a mutation is introduced into a polynucleotide encoding the polypeptide by using a site-directed mutagenesis method such as Kunkel method or Gapped duplex method. Kits such as QuikChange ^TM Site-Directed Mutagenesis Kit (manufactured by Stratagene), GeneTailor ^TM Site-Directed Mutagenesis System (Thermo Fisher Scientific), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc.): Takara Bio Co., Ltd.) and the like. In addition, methods such as the site-directed mutagenesis method described in “Molecular Cloning, A Laboratory Manual (4th edition)” (Cold Spring Harbor Laboratory Press (2012)) and the like can be used.

  The fusion polypeptide of the present invention is known in the art based on the sequence information of the cell membrane-penetrating peptide, the DNA-binding peptide that binds to the PD-1 gene, and the peptide having DNA methylation activity disclosed herein. Can be easily made by one of ordinary skill in the art. The fusion polypeptide of the present invention is not particularly limited, but can be produced, for example, according to the method described in “7. Method for producing fusion polypeptide” described below.

3. Polynucleotide The polynucleotide of the present invention includes a polynucleotide containing a nucleotide sequence encoding the fusion polypeptide of the present invention.
In the present invention, examples of the nucleotide sequence encoding the cell membrane-penetrating peptide include those including the nucleotide sequence shown in SEQ ID NO: 4, and examples of the nucleotide sequence encoding TALE include SEQ ID NO: 10, 12 or Examples of the nucleotide sequence encoding the DNMT3A / 3L include, but are not limited to, those including the nucleotide sequence of SEQ ID NO: 30. Further, the base sequence encoding the TEV protease recognition sequence and the base sequence encoding the precision protease recognition sequence respectively include, for example, the base sequence shown in SEQ ID NO: 34 and the base sequence shown in SEQ ID NO: 36. Examples include, but are not limited to:
Moreover, examples of the base sequence encoding the fusion polypeptide of the present invention include, but are not limited to, those containing the base sequence shown in SEQ ID NO: 38, 40, or 42.
Furthermore, the polynucleotide of the present invention can have its codon optimized depending on the type of host that expresses the fusion polypeptide of the present invention. By this optimization, the expression level in the host can be improved.

  The polynucleotide of the present invention can be easily produced by a person skilled in the art based on its nucleotide sequence using a method known in the art. For example, the polynucleotide of the present invention can be synthesized using a gene synthesis method known in the art.

4. Expression Vector The expression vector of the present invention includes an expression vector containing a polynucleotide containing a nucleotide sequence encoding the fusion polypeptide of the present invention.

The expression vector used for expressing the polynucleotide of the present invention includes a wheat embryo that expresses a polynucleotide containing a nucleotide sequence encoding the fusion polypeptide of the present invention in a reaction solution containing RNA polymerase and nucleoside triphosphate. Various kinds of eukaryotic cells (eg, animal cells, insect cells, plant cells, yeast) and / or prokaryotic cells (eg, Escherichia coli) as long as they can produce the polypeptide encoded by these in the extract. There is no particular limitation as long as the polynucleotide containing the nucleotide sequence encoding the fusion polypeptide of the present invention can be expressed in the host cell of, and the polypeptide encoded by these can be produced. Examples of such an expression vector include a plasmid vector, a viral vector (eg, adenovirus, adeno-associated virus, retrovirus, Sendai virus) and the like, and preferably pEU-E01-MCS (Cell Free Science) , PCold ^™ vector (Takara Bio) can be used.

  The expression vector of the present invention may include a promoter operably linked to the polynucleotide of the present invention. Examples of promoters for expressing in a reaction solution containing RNA polymerase and nucleoside triphosphates include T3 promoter, T7 promoter, SP6 promoter and the like. Examples of promoters for expressing the polynucleotide of the present invention in animal cells include virus-derived promoters such as Cytomegalovirus (CMV), Rous sarcoma virus (RSV), and Simian virus 40 (SV40), actin promoter, EF (elongation factor). ) 1α promoter, heat shock promoter and the like. Examples of the promoter for expression in bacteria (eg, Escherichia bacterium) include trp promoter, lac promoter, λPL promoter, tac promoter, T3 promoter, T7 promoter, SP6 promoter and the like. Examples of promoters for expression in yeast include GAL1 promoter, GAL10 promoter, PH05 promoter, PGK promoter, GAP promoter, ADH promoter and the like.

  When a reaction solution containing RNA polymerase and nucleoside triphosphate and a wheat germ extract are used, or when animal cells, insect cells, or yeast are used as host cells, the expression vector of the present invention has a start codon and a stop codon. May be included. In this case, the expression vector of the present invention comprises an enhancer sequence, untranslated regions 5 ′ and 3 ′ of the gene encoding the fusion polypeptide of the present invention, a secretory signal sequence, a splicing junction, a polyadenylation site, or It may include a replicable unit or the like. When E. coli is used as the host cell, the expression vector of the present invention may contain a start codon, a stop codon, a terminator region, and a replication-competent unit. In this case, the expression vector of the present invention may include a selection marker usually used depending on the purpose (for example, tetracycline resistance gene, ampicillin resistance gene, kanamycin resistance gene, neomycin resistance gene, dihydrofolate reductase gene). ..

5. Transformed Host Cell The transformed host cell of the present invention includes a host cell transformed with the expression vector of the present invention.

The host cell to be transformed is not particularly limited as long as it is compatible with the expression vector used and can be transformed with the expression vector to express the protein. Examples of the host cell to be transformed include various cells such as natural cells or artificially established cells usually used in the technical field of the present invention (for example, animal cells (for example, CHO cells), insect cells (for example, , Sf9), bacteria (Escherichia, etc.), yeast (Saccharomyces, Pichia, etc.), etc., preferably bacteria (Escherichia, etc.), cultured cells such as CHO cells, 293 cells, NS0 cells, etc. Can be used.
The method for transforming a host cell is not particularly limited, but, for example, the calcium phosphate method, the electroporation method or the like can be used.

6. Cytotoxic cells into which the fusion polypeptide has been introduced Cytotoxic cells into which the fusion polypeptide of the present invention has been introduced include immunocompetent cells having cytotoxic activity into which the fusion polypeptide of the present invention has been introduced, such as cytotoxicity. Includes sex T cells and NK cells. The cytotoxic cell may be a T cell-derived cell line (eg, MOLT-4, Jurkat, CEM), or isolated from human peripheral blood-derived mononuclear cells (PBMC) or PBMC. It may be an immunocompetent cell (T cell, NK cell, etc.) having the specified cytotoxic activity.
The cytotoxic activity of the test cells can be measured using a known method, for example, a method of counting the number of Annexin-V positive cells by FACS or the like.

7. Method for producing fusion polypeptide In the method for producing the fusion polypeptide of the present invention, mRNA synthesized in a reaction solution containing RNA polymerase and nucleoside triphosphate using the expression vector of the present invention is extracted from a wheat germ extract. And a step of culturing the transformed host cell of the present invention to express the fusion polypeptide, thereby producing the fusion polypeptide.
Examples of the reaction solution containing RNA polymerase and nucleoside triphosphate and the wheat germ extract used in the method include reagents contained in WEPRO7240G Expression Kit (Cell Free Science). In addition, preferred host cells used in the method include the above 5. The cells listed as the “transforming host cell” in.

  Culture of the transformed host cell can be performed by a known method. Culture conditions such as temperature, pH of medium and culture time are appropriately selected. The fusion polypeptide of the present invention can be produced by culturing a host cell.

  The method for producing the fusion polypeptide of the present invention comprises a step of synthesizing mRNA in a reaction solution containing RNA polymerase and nucleoside triphosphates using the expression vector of the present invention, and the synthesized mRNA as a wheat germ extract. In addition to the step of reacting and expressing the fusion polypeptide, it may further include a step of recovering, preferably isolating or purifying the fusion polypeptide. As the isolation or purification method, for example, the fusion polypeptide of the present invention fused with a GST tag can be bound to glutathione sepharose beads and then purified by affinity chromatography by eluting with excess reduced glutathione. ..

  In addition, the method of producing the fusion polypeptide of the present invention includes the steps of culturing the transformed host cell of the present invention and expressing the fusion polypeptide, further comprising the step of fusing from the transformed host cell. A step of recovering, preferably isolating or purifying the polypeptide may be included. Examples of the isolation or purification method include a method utilizing solubility such as salting out and solvent precipitation, a method utilizing difference in molecular weight such as dialysis, ultrafiltration and gel filtration, ion exchange chromatography, and hydroxylapatite chromatography. Methods that utilize charges such as chromatography, methods that utilize specific affinity such as affinity chromatography, methods that utilize differences in hydrophobicity such as reversed-phase high-performance liquid chromatography, isoelectric points such as isoelectric focusing The method of utilizing the difference of is mentioned. Preferably, the fusion polypeptide accumulated in the culture supernatant can be purified by various chromatographies.

  The fusion polypeptide of the present invention also includes the fusion polypeptide produced by the method for producing the fusion polypeptide of the present invention.

  The medium used in the method of the present invention is not particularly limited as long as it is a medium usually used in the field of cell culture. In addition, serum can be added to the medium depending on the cell type.

  The culture conditions used in the method of the present invention can be appropriately selected by those skilled in the art depending on the type of cell.

  The concentration of the fusion polypeptide of the present invention added to the medium varies depending on the cell type and the number of cells, the transcriptional regulatory activity of the fusion polypeptide, etc., but is, for example, about 0.01 nM to 10 μM, preferably about 0.1 nM to 5 μM. Can be used.

  The timing and frequency of adding the fusion polypeptide of the present invention are not particularly limited. The timing at which the fusion polypeptide of the present invention is added (administered) to the medium may be, for example, at the start of culture or after the start of culture. When the fusion polypeptide of the present invention is added to the medium after the start of culture, for example, 1 hour, 5 hours, 10 hours, 15 hours, 24 hours (1 day), 36 hours, 48 hours after the start of culture It may be added later (2 days later), 3 days later, 4 days later, or 5 days later.

  The fusion polypeptide of the present invention suppresses the expression of PD-1 in cytotoxic cells and further enhances or maintains the cytotoxic activity, even if the addition is stopped after addition to the culture medium of cytotoxic cells for several days. can do.

  Whether or not the fusion polypeptide of the present invention can suppress the expression of PD-1 can be confirmed by using a known gene expression level measurement method. Examples of the method for measuring the gene expression level include methods such as Real-Time PCR. If Real-Time PCR is used, in an exemplary method, can the test fusion polypeptide suppress the expression of the PD-1 gene by using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific)? You can check whether or not. As a specific method for evaluating the gene expression level, for example, the method described in Example 2 described later can be used.

8. Composition The composition of the present invention comprises a fusion polypeptide comprising a cell membrane-penetrating peptide, a DNA binding peptide that binds to the base sequence of the PD-1 gene, and a peptide having DNA methylation activity. The fusion polypeptide contained in the composition of the present invention is as described in the above “2. Fusion polypeptide of the present invention”.
Since the composition containing the fusion polypeptide of the present invention can suppress the expression of PD-1, it can be used as a PD-1 expression inhibitor.

  The composition of the present invention can be used by adding it to a cell culture medium. The composition of the present invention can also be used as the medium itself. When the composition of the present invention is used as a medium, the composition of the present invention, in addition to the fusion polypeptide of the present invention or a polynucleotide encoding the fusion polypeptide, a carbon source, vitamins, nutrient sources such as inorganic salts, And growth factors, and other components necessary for ordinary cell culture.

  In another aspect, the composition of the present invention comprises cytotoxic cells into which the fusion polypeptide of the present invention has been introduced. The cytotoxicity contained in the composition of the present invention is as described in the above “6. Cytotoxic cells into which the fusion polypeptide of the present invention has been introduced”.

  In addition to the fusion polypeptide of the present invention or the polynucleotide encoding the fusion polypeptide, or the cytotoxic cell of the present invention, the composition of the present invention may be any carrier (liposome, lipid) suitable for the composition of the present invention. Vesicles, micelles, etc.), diluents, excipients, wetting agents, buffers, suspending agents, lubricants, emulsifiers, disintegrating agents, absorbents, preservatives, surfactants, coloring agents and the like.

9. Pharmaceutical composition The composition of the present invention can be used as a pharmaceutical composition for treating or preventing cancer.
The pharmaceutical composition of the present invention includes a pharmaceutical composition comprising the cytotoxic cell of the present invention or the fusion polypeptide of the present invention and a pharmaceutically acceptable excipient.
The pharmaceutical composition of the present invention can be prepared by a commonly used method using an excipient usually used in the art, that is, a pharmaceutical excipient, a pharmaceutical carrier and the like. Examples of dosage forms of these pharmaceutical compositions include parenteral agents such as injections and infusions, which can be administered by intravenous administration, portal administration or subcutaneous administration. Upon formulation, excipients, carriers, additives, etc. depending on these dosage forms can be used within a pharmaceutically acceptable range. Examples of pharmaceutically acceptable excipients include physiological saline and buffer solutions. Moreover, if necessary, a component serving as a nutrient source for the cultured cells can be included.

  The cancer to be treated or prevented by the pharmaceutical composition of the present invention is not limited as long as it is a cancer targeted by PD-1 expressing immunocompetent cells (eg, cytotoxic cells). , PD-L1 or PD-L2 expressing cancer. In the present invention, as the cancer, for example, brain cancer, cervical cancer, esophageal cancer, tongue cancer, lung cancer, breast cancer, pancreatic cancer, gastric cancer, small intestine cancer, duodenal cancer, colon cancer, bladder cancer, renal cancer, liver cancer, prostate cancer, Examples thereof include, but are not limited to, uterine cancer, cervical cancer, ovarian cancer, thyroid cancer, gallbladder cancer, pharyngeal cancer, sarcoma, melanoma, leukemia, lymphoma, multiple myeloma and the like.

  The present invention includes a method for preventing or treating cancer, which comprises the step of administering a therapeutically effective amount of the cytotoxic cell of the present invention or the fusion polypeptide of the present invention. The present invention also includes the cytotoxic cell of the present invention or the fusion polypeptide of the present invention for use in the prevention or treatment of cancer. Further, the present invention includes the use of the cytotoxic cell of the present invention or the fusion polypeptide of the present invention in the manufacture of a pharmaceutical composition for preventing or treating cancer.

When using the cytotoxic cells of the present invention for the prevention or treatment of cancer, the number of cells to be administered to a patient can be appropriately set by those skilled in the art depending on the patient's symptoms, sex, age, etc. The dose is, for example, about 1 × 10 ⁴ to 1 × 10 ¹¹ , and preferably about 1 × 10 ⁶ to 1 × 10 ¹⁰ .

10. Reagent, Kit The fusion polypeptide of the present invention, a polynucleotide encoding the same, an expression vector, a cytotoxic cell into which the fusion polypeptide has been introduced, or a composition containing any of these is used in the form of a reagent or a kit. be able to. For example, the present invention, by adding to the culture medium of cells expressing PD-1, since it is possible to suppress the expression of PD-1 in the cells, a reagent for suppressing the expression of PD-1 or It can be used as a kit. In addition, the fusion polypeptide of the present invention and a composition containing the same can enhance or maintain the cytotoxic activity of cytotoxic cells against cancer cells as compared with a control, and therefore, can be used for culturing cytotoxic cells. It can be used as an additional reagent or kit for use.

  In the reagent or kit of the present invention, in addition to the fusion polypeptide of the present invention or a composition containing the same, a buffer solution, a diluting solution, a cell culture medium, a culture plate, other products necessary for cell culture, use Instructions etc. can be included.

Specific examples are provided herein for reference in order to provide a further understanding of the present invention, and these are for purposes of illustration and not limitation of the present invention.
[Example]

  For parts using commercially available kits or reagents, experiments were conducted according to the attached protocol unless otherwise specified. Further, for convenience, the concentration mol / L is expressed as M.

Fabrication of NTP-GM (genome modulator)
(1) Preparation of expression plasmid encoding NTP-GM The pEU-E01 vector (Cell Free Sciences Co., hereinafter CFS) was used as an expression vector used for protein preparation in a wheat embryo cell-free expression system. PEU-E01-GST-NTP (Takahashi et al. Biomaterials, 2018) prepared based on the pEU-E01 vector in a previous study contained DNA sequences encoding glutathione S transferase (GST) and NTP. .. A DNA fragment of about 1.2 kb encoding the 3'-side consensus sequence of TALE and DNMT3A, which is a DNA methylating enzyme, was synthesized (Eurofin), integrated into pEU-E01-GST-NTP, and the resulting vector was transformed into pEU-E01- It was named GST-NTP-TALE-DNMT3a. Then, a DNMT3L cDNA fragment having BstB1 and Nhe1 sites on the 5'side and 3'side respectively was newly synthesized (Eurofin), and the resulting vector was inserted into pEU-E01-GST-NTP to obtain pEU-E01-GST- It was named NTP-TALE-DNMT3a / 3L.
For TALE cDNA, we prepared five types of molecules targeting the following sequences located in the human PD-1 gene promoter region, and named “C17”, “D17”, “L17”, “M17” and “N17” respectively. I named it.
Target sequence of C17: tcccccagcactgcctc (SEQ ID NO: 7)
Target sequence of D17: tcccttcaacctgacct (SEQ ID NO: 8)
Target sequence of L17: tccaggcatgcagatcc (SEQ ID NO: 9)
Target sequence of M17: tccctccagacccctggctct (SEQ ID NO: 44)
Target sequence of N17: tccctccagacccctgg (SEQ ID NO: 45)

C17, D17 and L17 recognize the sense sequence, and M17 and N17 recognize the antisense sequence (see FIG. 1).
In addition, TALE targeting a scrambled sequence (SCR: tggctcccacaccctcg (SEQ ID NO: 46)) in which 17 bases were randomly arranged was used as a control protein. These 6 TALE cDNA fragments were respectively inserted between the NTP sequence and DNMT3A / 3L sequence of pEU-E01-GST-NTP-TALE-DNMT3A / 3L, and the resulting 6 construct DNAs were collectively referred to as pEU-NTP. -Named GM.

The pCold vector (TAKARA) was used as an expression vector used for protein expression in E. coli. With this vector, the expression of the recombinant protein is tightly regulated, and it is transcribed only after a temperature shift from 37 ° C to 15 ° C. NTP and TALE 5'side sequence (5'-CATG AGGATCTTCATCCACTTCCGGATCGGCTGT GAAAACCTGTATTTCCAATCTCTCGAGGATATCGTTTAAAC -3 ') (underlined sequence coding for NTP) (SEQ ID NO: 47)) was introduced into the multiple cloning site of this vector, followed by recognition of precision protease. An oligonucleotide DNA (5'-TTAGAGGTCTTGTTCCAGGGACCACACCACCACCATCATCAC (SEQ ID NO: 48)) encoding the sequence and His ₆ tag was introduced. The DNMT3A-DNMT3L cDNA fragment cut out from pEU-NTP-GM was inserted into this vector.

  As described above, plasmids expressing NTP-GM were prepared using the wheat germ cell-free expression system and Escherichia coli, respectively.

(2) Preparation of NTP-GM protein WEPRO 7240G expression system (CFS) was used for protein expression in wheat germ cell-free system. First, mRNA was synthesized from pEU-NTP-GM using SP6 polymerase included in the kit, and reacted with a wheat germ extract also included in the kit at 15 ° C overnight. Recombinant proteins contained in this reaction solution were reacted with Glutathin beads Sepharose 4B (GE Healthcare) for 1 hour at 4 ° C, rinsed once with phosphate buffer (PBS), and then with PBS containing 20 mM glutatin. The protein of interest was eluted. Furthermore, the GST tag was cleaved by reacting precision protease (GE healthcare) at 4 ° C for 16 hours. The protein with the cleaved tag was confirmed by Coomassie Brilliant Blue staining after polyacrylamide gel electrophoresis containing sodium dodecyl sulfate.

  BL21 (DE3) (TAKARA) was used for expression in E. coli. The pCold-NTP-GM plasmid DNA was introduced, and the cells were cultured in the presence of 0.1 mM IPTG (Nakarai) for 16 hours at 15 ° C. After induction, centrifuged at 6000 rpm for 10 minutes, the recovered E. coli lysis buffer (20 mM sodium phosphate pH 7.6, 10% glycerol, 500 mM NaCl, 10 mM mercaptoethanol, 20 mM imidazole, 0.1% Nonidet P-40, 1 mM phenylmethylsulfonylfluoride, 1.5 mg / ml lysozyme). After reaction in ice for 30 minutes, the microbial cells were destroyed by sonication, the soluble protein was centrifuged at 18000 rpm for 30 minutes, and the supernatant was recovered.

Next, it was applied to a Ni-NTA column (Novagen) and eluted with 250 mM imidazole. In the second step, heparin HP column (GE healthcare) was used to elute the protein by the concentration gradient method of 50 mM-1 M NaCl. At that time, 10% glycerol, Tris-HCl pH 8.0, 0.1 mM dithiothreitol was used as a basal buffer. In the third step, an affinity purification method using αTALE antibody was used. At this time, the αTALE antibody (Takashina et al. Biomaterials, 2018) prepared in the previous study was used. This antibody recognizes an epitope in the TALE common region located on the carboxyl side of the TALE molecule. After reacting with αTALE-bound CNBr sepharose beads (GE Healthcare) for 2 hours at 4 ° C, the mixture was eluted with 0.1 M HEPES pH 2.5 buffer and then immediately neutralized with 1 M HEPES pH 8.0.
In this way, various NTP-GM proteins were prepared.

Functional evaluation of NTP-GM (1) Cell culture, addition of NTP-GM protein and statistical analysis Human acute lymphoblastic leukemia (T cell) -derived cell line (MOLT-4) and human T cell used in this example Cell line derived from sex leukemia (Jurkat), human acute lymphoblastic leukemia (T lymphocyte-like) derived cell line (CEM) and human myeloma cell line (RPMI8226) were donated by RIKEN Cell Bank, and 10% fetal calf Maintained with RPMI 1680 (Gibco) containing serum (FBS, Gibco). The culture was performed at 100% humidity, 37 ° C. and 5% CO ₂ . Peripheral blood-derived mononuclear cells (PBMC) were isolated by using LYMPHOPREP (Cosmo Bio) after receiving peripheral blood donation from a healthy male subject with consent. After washing twice with PBS, the cells were cultured in a plate coated with αCD3 (BD Bio science) in IL-2 plus KBM550 (KOHJIN BIO) medium containing 10% FCS.
MOLT-4 cells were seeded in a 96-well plate at a cell density of 2 × 10 ⁵ cells / ml, and 24 hours later, NTP-GM protein was added at a concentration of 1, 10 or 20 nM. The culture medium containing the NTP-GM protein was exchanged once a day for 5 consecutive days. From the 6th day after the first addition, the culture was continued without the NTP-GM protein. The culture medium was replaced every other day, and the cell density was reduced to 5 x 10 ⁵ cells / ml each time. The cells were collected 4, 6, 9 and 12 days after the initial addition and used for analysis.
Student's t-test was used for evaluation of the experimental data, and it was determined that there was a statistically significant difference when the P value was less than 0.05. The graph shows the average value ± standard deviation value.

(2) Enzyme activity evaluation of NTP-GM protein (methylated DNA analysis)
In the 5'side expression control region of PD-1 gene, there are two CpG islands that can be targets of methylation (Youngblood B. et al. Immunity, 2011), and they are named C and B, respectively (below. "CR-C" and "CR-B" (CpG region C and B), respectively).

About 2 kb of PD-1 gene expression control region genomic DNA was cloned and used as a substrate.
The presence or absence of DNA methylation induction was analyzed (Fig. 1). Specifically, an approximately 2 kb fragment containing the human PD-1 gene promoter region was cloned into the pBluescript SK vector (Stratagene). This DNA fragment was amplified by PCR using M13 forward / reverse primers and used as a substrate.
In the presence of 80 μM S adenosylmethionine (NEB), 10 nM NTP-GM protein was reacted with 1 nM DNA fragment for 3 hours at 37 ° C. As the reaction solution, 50 mM NaCl, 10 mM Tris-HCl pH 8.0, 10 mM MgCl ₂ , and 1 mM DTT were used. After completion of the reaction, the protein was deproteinized with a phenol / chloroform solution, recovered by ethanol precipitation, and subjected to methylated DNA analysis.

Genomic DNA from cultured cells was obtained using the DNeasy Blood & Tissue kit (QIAGEN). With respect to the DNA reacted with NTP-GM or the genomic DNA recovered from the cultured cells, unmethylated cytosine was converted to uracil using Cell to CpG Bisulfite Conversion kit (Applied biosystems). Next, the CR-C and CR-B regions in the human PD-1 gene promoter region, which is the analysis target site, were PCR-amplified using KOD-Muti & Epi- (TOYOBO) enzyme. The base sequences of the primers used are shown below.
CR-C Forward: GGGAGTGGTTTTTTGTTTATAAA (SEQ ID NO: 49)
CR-C Reverse: AAAATCCAATACCTAAACCTAACTAAC (SEQ ID NO: 50)
CR-B Forward: TTAATTTGATTTGGGATAGTTTTTTTT (SEQ ID NO: 51)
CR-B Reverse: CCCTCCAAACCCCTAACTCTAAAAC (SEQ ID NO: 52)

Each of the amplified DNA fragments was incorporated into pBluescript plasmid DNA, introduced into DH5a bacteria, and then selected with ampicillin to analyze each cloning. For the sequencing reaction, a big dye (Thermo Fisher Scientific) was used, and the base sequence was decoded with ABI3130xl.
As a result, among the five NTP-GM proteins, C17, D17 and L17 showed methylation activity (Fig. 2A). In FIG. 2A, ● indicates a sample (well) that showed methylation activity, ○ indicates a sample that did not show methylation activity, and × indicates the activity of a base that could not be read by sequence analysis.

(4) Measurement of gene expression level NTP-GM proteins C17, D17 and L17 were also applied to MOLT-4 cell line, a human T-cell leukemia cell line, at a concentration of 1 nM for 5 consecutive days. , Endogenous gene expression was analyzed. Specifically, the mRNA expression level was analyzed by the quantitative PCR method (qRT-PCR) after reverse transcription. RNA extraction and cDNA synthesis were performed continuously in one tube by using SuperPrep II Cell Lysis & RT Kit for qPCR (TOYOBO). qRT-PCR was performed using CFX Connect ^™ Real-Time PCR Detection System (BIO-RAD) and TB Green ^™ Premix Ex Taq ^™ II (TAKARA). The mRNA expression level was standardized using the expression level of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA, and each sample was compared. The base sequences of the primers used are shown in the table below.
As a result, all three NTP-GM proteins showed PD-1 expression inhibitory effects. Among them, the effects of D17 and L17 were particularly high (Fig. 2B).

(5) Functional evaluation of NTP-GM protein D17 The functional evaluation was further performed for D17, which showed the highest inhibitory effect on PD-1 expression in the above experiment.
Specifically, NTP-GM protein D17 was expressed in the above Escherichia coli expression system, and the purified recombinant protein was administered to Molt-4 cells for 5 consecutive days (added to the cell culture medium), and 5 days after the final administration. The PD-1 gene expression and DNA methylation was evaluated in the eye.
As a result, the expression of the PD-1 gene was suppressed (Fig. 3A), and the CR-B region of the PD-1 gene promoter was maintained in a significant methylation state (Fig. 3B).
From these results, it was shown that the fusion polypeptide of the present invention induces DNA methylation and expression suppression of PD-1 gene, and its effect lasts for 5 days after the final administration.

(6) Functional evaluation of NTP-GM protein D17 on human PBMC
It was examined whether the above-mentioned effects obtained using the MOLT-4 cell line are also observed in human peripheral blood mononuclear cells (PBMC).
The suppression of PD-1 gene expression and DNA methylation were evaluated by the same method as the method using the MOLT-4 cell line. Specifically, NTP-GM protein D17 was expressed in an Escherichia coli expression system, and the purified recombinant protein (20 nM) was administered to PBMC for 5 consecutive days. DNA methylation was assessed. The suppression of PD-1 protein expression was evaluated using flow cytometry (FACS). In the flow cytometry (FACS) analysis, the cultured cells were centrifuged at 1500 rpm for 10 minutes, collected, rinsed with PBS, and finally suspended in PBS containing 0.5% BSA (Sigma). Double staining was performed with αPD-1-PE antibody (1: 100 BD Bioscience) and αCD3-FITC antibody (1: 100 BD Bioscience) or CD56-APC antibody (1: 100 BioLegend). After reacting on ice for 1 hour, the cells were rinsed with PBS and analyzed by FACSVerse Flow cytometer (BD Bioscience).
As a result, the NTP-GM protein D17 suppressed the expression of PD-1 gene in PBMC (Fig. 4A), and the CR-B region of PD-1 gene promoter was significantly methylated (Fig. 4C). ). In addition, D17 reduced the number of PD-1 positive cells in T cells (CD3 positive) and NK cells (CD56 positive) contained in PBMC. This result shows that the expression of PD-1 protein was suppressed in T cells (CD3 positive) and NK cells (CD56 positive) (FIG. 4B).
From these results, the fusion polypeptide of the present invention induces DNA methylation and expression suppression of the PD-1 gene and expression suppression of the PD-1 protein, and the effect can be continued for 4 days after the final administration. Was shown.

(7) Evaluation of cytotoxic activity
PD-1 is known to inhibit the killing effect of PBMC on cancer cells. Therefore, it was examined whether suppression of PD-1 expression according to the present invention enhances the killing effect of PBMC on cancer cells. Specifically, in order to amplify PD-1 positive cells, PBMCs were cultured for 14 days in a state where IL-2, αCD3 antibody and αCD16 antibody (Biolegend) were added. To this PBMC, 20 nM of NTP-GM protein D17 was administered for 5 days, then the administration was discontinued, and the cytotoxic activity was evaluated 2 and 4 days after the final administration. RPMI8226 cells were used as target cells. At that time, in order to detect RPMI8226 cells, first, 5 μM 5- or 6- (N-Succinimidyloxycarbonyl) fluorescein 3 ′, 6′-diacetate (CSFE) (DOJINDO) was labeled for 30 minutes at 37 ° C. in the dark. About 3 times as much PBMC (3 × 10 ⁵ cells) was added to RPMI8226 cells (10 ⁵ cells), and the mixture was cultured at 37 ° C. for 16 hours. Then, the cells were collected and reacted with PerCP-Cy ^TM 5.5 Annexin V (1:20 BD Bio science) in a solution of Annexin-V binding buffer (10 mM HEPES pH 7.4, 140 mM NaCl, 2.5 mM CaCl). The cytotoxic activity was evaluated by counting the number of Annexin-V positive cells in the CSFE positive cells by FACS (Fig. 5).
As a result, the NTP-GM protein D17 increased the frequency of cells exhibiting apoptosis (Annexin V positive cells) both on the second day and the fourth day after the final administration (FIGS. 6A and 6B).
From this result, it was shown that the fusion polypeptide of the present invention enhances the cytotoxic activity in cytotoxic cells, and the effect lasts for 4 days after the final administration.

According to this example, the fusion polypeptide of the present invention suppresses the expression of the PD-1 gene and PD-1 protein by methylating the DNA of the PD-1 gene in human PBMC, and thereby human against cancer cells. It was shown to enhance the cytotoxic activity of PBMC.
Furthermore, the fusion polypeptide of the present invention was shown to sustain DNA methylation and suppression of PD-1 gene DNA expression in human PBMC for several days after the final administration, and also sustained cytotoxic activity.
Therefore, the fusion polypeptide of the present invention is useful as a PD-1 expression inhibitor, and is also extremely useful in cancer immunotherapy such as adoptive immunotherapy.

  The fusion polypeptide of the present invention is useful in that it can suppress the expression of PD-1 in cytotoxic cells and can further sustain the cytotoxic activity of the cells.

  Sequence number 1-60 is a synthetic DNA or a synthetic peptide.

Claims (12)

  A fusion polypeptide comprising a cell membrane-permeable peptide, a DNA-binding peptide that binds to the base sequence of PD-1 (Programmed cell death 1) gene, and a peptide having DNA methylation activity, wherein the base sequence is SEQ ID NO: 7, A fusion polypeptide having the base sequence shown in 8 or 9.   The fusion polypeptide according to claim 1, wherein the peptide having DNA methylation activity is a DNMT3A, DNMT3B, a fusion peptide of DNMT3A and DNMT3L or a fusion peptide of DNMT3B and DNMT3L.   The fusion polypeptide according to claim 1 or 2, wherein the cell-penetrating peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 5.   The fusion polypeptide according to any one of claims 1 to 3, wherein the DNA-binding peptide is a transcriptional activator-like effector (TALE).   The fusion polypeptide according to claim 4, wherein the DNA-binding peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 11, 13 or 15.   The cell membrane-permeable peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 5, the DNA-binding peptide is a peptide containing the amino acid sequence shown in SEQ ID NO: 11, 13 or 15, and a peptide having DNA methylation activity is The fusion polypeptide according to claim 5, which is a peptide including a fusion peptide of DNMT3A and DNMT3L.   The fusion polypeptide according to claim 6, comprising the amino acid sequence shown in SEQ ID NO: 39, 41 or 43.   A composition comprising the fusion polypeptide of any one of claims 1-7.   The composition according to claim 8, which is a PD-1 expression inhibitor.   A cytotoxic cell into which the fusion polypeptide according to any one of claims 1 to 7 has been introduced.   A composition comprising the cytotoxic cell according to claim 10.   The composition according to claim 11, which is a pharmaceutical composition for treating or preventing cancer.