JP2020040892A - Pulmonary hypertension therapeutic agent - Google Patents

Abstract

To provide a novel pulmonary hypertension therapeutic agent that does not use acute vasodilator action as the main effect, and a novel method for treating pulmonary hypertension.SOLUTION: The present invention provides a pulmonary vessel remodeling improvement agent containing acyclic retinoid or a salt thereof, or their solvates, and a pharmaceutical for prevention and/or treatment of pulmonary hypertension. The acyclic retinoid is preferably peretinoin.SELECTED DRAWING: None

Description

  The present invention relates to a medicament for preventing and / or treating pulmonary hypertension by preventing and / or improving pulmonary vascular remodeling, and a use of the medicament.

  Pulmonary hypertension (PH) includes pulmonary artery endothelial disorders (eg, persistent vasoconstriction, hyperplasia, proliferation and coagulation disorders), smooth muscle proliferation (eg, smooth muscle proliferation and abnormal apoptosis and abnormal Ca handling) ), Is an esoteric disease accompanied by an increase in pulmonary artery pressure against the background of pulmonary vascular remodeling caused by inflammation and immune abnormalities (Non-Patent Document 1).

Currently, the main drugs used to treat pulmonary hypertension are vasodilators (such as rioshiguato), endothelin receptor antagonists (such as ambrisentan and bosentan), prostacyclin preparations, etc. Vasodilators (such as epoprostenol and beraprost). Although the prognosis of PH has been improved by the combination therapy of these vasodilators, it is still not satisfactory and is still a poor prognosis disease.
Especially, in scleroderma pulmonary hypertension (SSc-PH) and other collagenous pulmonary hypertension (CTD-PH), not only pulmonary artery but also pulmonary vein remodeling is combined, and conventional vasodilators are effective There are not a few patient groups who suffer from fatal complications such as pulmonary edema due to insufficient pulmonary vein stenosis. In order to effectively treat pulmonary hypertension associated with such pulmonary vein remodeling, it is necessary to develop a therapeutic agent having an action mechanism different from that of conventional vasodilators and the like.

  In recent years, since tumor growth is observed in the pulmonary artery in PH, application of antitumor drugs to PH is expected (Non-Patent Document 1). Some vitamins also exhibit an antitumor effect. Vitamin A and its derivatives (retinoids) are classified as fat-soluble vitamins, and act via various receptors (genomic pathways) such as RARα, RARβ, RARγ, RXRα, RXRβ and RXRγ, and non-receptors (non- genomic pathway), and is used as a therapeutic drug for psoriasis and leukemia due to its cell growth inhibitory effect. In PH patients, blood retinoid levels are low, and it has been reported that RARα ligand all trans retinoic acid (ATRA) has an inhibitory effect on the growth of pulmonary artery smooth muscle cells associated with serotonin load (Non-patented) Reference 2). ATRA has also been reported to have a smooth muscle growth inhibitory effect in a monocrotaline-induced pulmonary hypertension rat model (Non-Patent Document 3). On the other hand, no PH improving effect was observed in the hypoxia-induced pulmonary hypertension rat model (Non-Patent Document 4). As can be seen from these reports, retinoids may have some association with pulmonary hypertension, but the details are still unknown.

  As described above, in the current treatment of PH, vasodilator administration is the main method, but in order to avoid fatal complications such as pulmonary edema, treatment that does not cause acute vasodilation Drugs are longing for.

EP2604263A1

Guignabert et al., CHEST 147: 529-537 2015 Preston et al., Circulation 111: 782-790 2005 Xin et al., Genetics and Molecular Research 14: 14308-14313 2015 Zhang et al., Circ J 74: 1696-1703 2010 Okita et al., J Gastroenterol 50: 191-202 2011

  In view of the above circumstances, an object of the present invention is to provide a novel remedy for pulmonary hypertension that does not have an acute vasodilating effect as a main effect, and to provide a novel method for treating hypertension.

The present inventors, unlike the cyclic retinoid ATRA, administered the acyclic retinoid peretinoin, which is a ligand of RARβ and RXRα, to a pulmonary arterial pulmonary hypertension model mouse (hypoxia-induced pulmonary hypertension model). The present inventors have found an effect of improving pulmonary vascular remodeling without going through a vasodilatory action in a period, and completed the present invention.
Peretinoin has already been completed in human phase II trials in suppressing hepatocellular carcinoma recurrence, and it has been confirmed that side effects that cause problems will not occur. In this regard, clinical application to humans is considered to be very easy (Patent Document 1 and Non-Patent Document 5).

That is, the present invention includes the following (1) to (4).
(1) An agent for improving pulmonary vascular remodeling, comprising an acyclic retinoid or a salt thereof, or a solvate thereof.
(2) The ameliorating agent according to (1), wherein the acyclic retinoid is peretinoin.
(3) A medicament for preventing and / or treating pulmonary hypertension, comprising a non-cyclic retinoid or a salt thereof, or a solvate thereof.
(4) The medicament according to the above (3), wherein the acyclic retinoid is peretinoin.

  The medicament of the present invention exerts an excellent effect in treating pulmonary hypertension through preventing and improving the progress of pulmonary vascular remodeling.

  The medicament of the present invention is different from the existing therapeutic agent for pulmonary hypertension, and improves the pathological condition of pulmonary hypertension without causing vasodilation in the acute phase. In this case, the present invention can be applied to the pathological condition of pulmonary hypertension (for example, CTD-PH etc.), which causes the hatred.

  The medicament of the present invention is less likely to cause problematic side effects in administered patients.

Effect of peretinoin administration on cardiac dynamics exacerbated by pulmonary hypertension (1). The PAT (Pulmonary Accelation Time) and PAT / ET (Ejection Time) values of the control group, PH group, and peretinoin administration group are shown. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6). * p <0.05 (Mann-Whitney U-test) Effect of peretinoin administration on cardiac dynamics exacerbated by pulmonary hypertension (2). The analysis result of the pressure-volume curve (PV loop) of a control group, PH group, and peretinoin administration group is shown. Effect of peretinoin administration on heart dynamics exacerbated by pulmonary hypertension (3). RVSP (right ventricular systolic pressure), RV (right venticule) / IVS (interventricular septum) + LV (left venticule), HR (heart rate) and BW (body weight) values of the control group, PH group and peretinoin administration group Show. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6). * p <0.05 (Mann-Whitney U-test) Effect of peretinoin administration on cardiac dynamics exacerbated by pulmonary hypertension (4). The values of CO (cardiac output), SV (stroke volume), RVEDV (right ventricular end-diastolic volume) and Ea (arterial elastance) of the control group, PH group and peretinoin administration group are shown. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6). * p <0.05 (Mann-Whitney U-test) Effect of peretinoin administration on cardiac dynamics exacerbated by pulmonary hypertension (5). The values of RVEF (right ventricular ejection fraction) of the control group, PH group, and peretinoin administration group are shown. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6). * p <0.05 (Mann-Whitney U-test) Effect of peretinoin administration on acute hemodynamics. C57B6 / 6J mice were administered epoprostenol (epoprostenol) and peretinoin (pretinoin) (the time of administration of each drug is indicated by an arrow), and the changes in right ventricular pressure (upper figure) and cardiac output (lower figure) were measured. The results are shown.

Histological examination of the effect of peretinoin on the pulmonary artery media that thickens due to pulmonary hypertension (1). FIG. 3 shows the results of EVG (Eastica Van Gieson) staining of tissue sections of the pulmonary artery media of mice in the control group, PH group, and peretinoin-administered group. Histological examination of the effect of peretinoin on the pulmonary artery media that thickens due to pulmonary hypertension (2). The image of FIG. 7 was calculated by analyzing with Image J. In the analysis, 20 pulmonary arteries having a diameter of 25 μm-50 μm were randomly extracted from each mouse, and the medial well thickness,% wall thickness and medial thickness index shown below were analyzed. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6). * p <0.05 (Mann-Whitney U-test) Medial well thickness: (outer diameter-inner diameter) / 2% wall thickness: (medial wall thickness / outer diameter) x 100 Medial thickness index: [(area ext-area int ) / area ext] × 100 Medial well thickness: Pulmonary artery media thickness outer diameter: Pulmonary artery inner diameter inner diameter: Pulmonary artery inner diameter% wall thickness: Ratio of media thickness to pulmonary artery outer diameter Medial thickness index: Index of the thickness of the media area ext: Area of the area surrounded by the outer elastic plate area int: Area of the area surrounded by the inner elastic plate Histological examination of the effect of peretinoin on the pulmonary artery media that thickens due to pulmonary hypertension (3). The results of immunostaining of tissue sections derived from the pulmonary artery of the mice in the control group, PH group and peretinoin administration group with an anti-actin antibody are shown. Examination of the effect of peretinoin on gene expression related to pulmonary vascular remodeling (1). The results of measuring the expression levels of IL-6, ET1, survivin140 and TGFβ by qRT-PCT using RNA prepared from the lung tissue of the control group, PH group and peretinoin administration group are shown. Data are shown as mean ± SEM (n = 6 for each group). * p <0.05 (Mann-Whitney U-test) Examination of the effect of peretinoin on gene expression related to pulmonary vascular remodeling (2). FIG. 4 shows the results of measuring the expression levels of αSMA and Fn (fibronectin) by qRT-PCT using RNA prepared from lung tissues of a control group, a PH group, and a peretinoin-administered group. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6). * p <0.05 (Mann-Whitney U-test)

Comparison of the effects of ATRA and peretinoin on pulmonary vascular remodeling (1). The values of CO, RVSV, Ea and RV / IVS + LV in the control group, PH group, peretinoin administration group and ATRA administration group are shown. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6). * p <0.05 (Mann-Whitney U-test) Comparison of the effects of ATRA and peretinoin on pulmonary vascular remodeling (2). 3 shows EF (ejection fraction) values of a control group, a PH group, a peretinoin administration group, and an ATRA administration group. Data are shown as mean ± SEM (control group: n = 7, PH group: n = 5, peretinoin administration group: n = 6, ATRA administration group: n = 6). * p <0.05 (Mann-Whitney U-test)

Examination of the effect of peretinoin administration on remodeled pulmonary vessels (1). RV / IVS + LV, RVEDV, and Ea of the PH group and the peretinoin administration group (in contrast to FIGS. 1 to 13, administration of peretinoin to the model mouse after completion of the pulmonary hypertension model mouse. The same in FIG. 15). And the values of Pmax (synonymous with RVSP, right ventricular maximum pressure). Data are shown as mean ± SEM (PH group: n = 5, peretinoin administration group: n = 4). * p <0.05 (Mann-Whitney U-test) Examination of the effect of peretinoin administration on remodeled pulmonary vessels (2). 3 shows Emax (maximum elastance) and EF values of a PH group and a peretinoin administration group. Data are shown as mean ± SEM (PH group: n = 5, peretinoin administration group: n = 4). * p <0.05 (Mann-Whitney U-test) Histological examination of the effect of peretinoin administration on the remodeled pulmonary artery media (1). Control group (Control (B6)), group 3 weeks after administration of SU5416 (HySU 3 weeks), group 3 weeks after administration of SU5416 and peretinoin (HySU / ACR 3 weeks), group 5 weeks after administration of SU5416 (HySU 5 weeks) 3) shows the results of EVG staining of tissue sections of the media of the pulmonary artery of the mice in the group (HySU 3 weeks + HYSU / ACR 2 weeks) in which peretinoin was administered for 2 weeks together with SU5416 after administration of SU5416 for 3 weeks. Histological examination of the effect of peretinoin administration on the remodeled pulmonary artery media (2). The image in FIG. 16 was analyzed with Image J in the same manner as in FIG. 8, and the Medial well thickness was calculated. Data are shown as mean ± SEM (HySU 3 weeks: n = 5, HySU / ACR 3 weeks: n = 6, HySU 5 weeks: n = 4, HySU 3 weeks + HYSU / ACR 2 weeks: n = 4) . * p <0.05 (Mann-Whitney U-test) Confirmation of the effect of peretinoin administration to pulmonary hypertension model mice by echo. The echo (upper figure) and HE-stained image (lower figure) of the heart short-axis section of a pulmonary hypertension model mouse (PH group) and a mouse to which peretinoin was administered after completion of the pulmonary blood pressure model (peretinoin administration group) are shown.

A first embodiment of the present invention is a pulmonary vascular remodeling improving agent comprising an acyclic retinoid or a salt thereof, or a solvate thereof.
Here, “retinoid” refers to vitamin A and its derivatives, and is classified into cyclic retinoids and acyclic retinoids based on its structural characteristics. Examples of the cyclic retinoid include ATRA (all trans retinoic acid) described above, and 9-cis retinoic acid (aritretinoin).
In the embodiment of the present invention, “acyclic retinoid” means a retinoid having no ring structure in the molecule. Examples of the “acyclic retinoid” include, but are not particularly limited to, for example, peretinoin (CAS number: 81485-25-8), geranylgeranoic acid, dihydrogeranylgeranoic acid (2,3-dihydrogeranylgeranoic acid, 4,5-didehydro-10,11-dihydrogeranylgeranoic acid and 14,15-dihydrogeranylgeranoic acid), tetrahydrogeranylgeranoic acid and the like, and preferably, peretinoin.

  In embodiments of the present invention, salts of acyclic retinoids may be used. The salt of the acyclic retinoid may be a pharmaceutically acceptable salt, for example, when an acidic group is present, lithium, sodium, potassium, magnesium, calcium and other alkali metal and alkaline earth metal salts Ammonia, methylamine, dimethylamine, trimethylamine, dicyclohexylamine, tris (hydroxymethyl) aminomethane, N, N-bis (hydroxyethyl) piperazine, 2-amino-2-methyl-1-propanol, ethanolamine, N- Examples include salts of amines such as methylglucamine and L-glucamine; and salts with basic amino acids such as lysine, δ-hydroxylysine, and arginine. When a basic group is present, salts of mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid; methanesulfonic acid, benzenesulfonic acid, paratoluenesulfonic acid, acetic acid, propionate, and tartaric acid With organic acids such as fumaric acid, maleic acid, malic acid, oxalic acid, succinic acid, citric acid, benzoic acid, mandelic acid, cinnamic acid, lactic acid, glycolic acid, glucuronic acid, ascorbic acid, nicotinic acid, salicylic acid, etc. Salts; and salts with acidic amino acids such as aspartic acid and glutamic acid.

In the embodiment of the present invention, a solvate of an acyclic retinoid or a salt thereof may be used. Examples of the solvent that forms the solvate include, but are not limited to, water, pharmaceutically acceptable organic solvents (eg, ethanol, acetone, ethyl acetate, and hexane).
Acyclic retinoids and salts thereof and solvates thereof can be produced by known methods.For example, for peretinoin, those skilled in the art can refer to JP-A-56-140949, WO2012 / 041949 and the like. It can be easily manufactured. In the practice of the present invention, a commercially available acyclic retinoid may be used.

“Pulmonary vascular remodeling” refers to pulmonary vascular endothelial cells and pulmonary vascular smoothing due to various factors such as vascular endothelial cell damage, abnormal vasospasm, apoptosis resistance of vascular endothelial cells, inflammatory cell infiltration and adventitia fibrosis. Muscle cells exhibit cell proliferative changes similar to tumors, causing hypertrophy, thickening or fibrosis of the pulmonary vascular wall, resulting in narrowing and / or obstruction of the vascular lumen.
The “improving agent” in the present embodiment has an effect of suppressing the progress of pulmonary vascular remodeling and an effect of returning a blood vessel in a remodeling state to an original state or a state close to the original state (reverse remodeling). Refers to drugs that have

A second embodiment of the present invention is a medicament for preventing and / or treating pulmonary hypertension, comprising a non-cyclic retinoid or a salt thereof, or a solvate thereof.
The medicament according to the second embodiment of the present invention has pharmacological effects as a preventive and / or therapeutic agent for pulmonary hypertension by suppressing and / or restoring pulmonary vascular remodeling. Therefore, pulmonary hypertension targeted by the medicament according to the present embodiment includes all diseases accompanied by pulmonary vascular remodeling and causing an increase in pulmonary artery pressure. Examples of such pulmonary hypertension include, but are not limited to, idiopathic pulmonary arterial hypertension, hereditary pulmonary arterial hypertension, drug and toxicant-induced pulmonary arterial hypertension, and other diseases (connective tissue disease). Pulmonary arterial hypertension, pulmonary arterial hypertension, pulmonary vein obstructive disease, and / or pulmonary capillary angiomatosis associated with pulmonary arterial pulmonary hypertension associated with HIV infection, portal hypertension, congenital heart disease and schistosomiasis Lungs associated with left heart disease such as neonatal prolonged pulmonary hypertension, left ventricular systolic dysfunction, left ventricular diastolic dysfunction, valvular disease, congenital / acquired left heart inflow / outflow tract disorders and congenital cardiomyopathy Hypertension, chronic obstructive pulmonary disease, interstitial lung disease, other respiratory diseases with a combination of restricted and obstructive types, sleep-disordered breathing, alveolar hypoventilation, chronic exposure to high altitudes, growth disorders, etc. Lung disease and / or hypoxemia caused by Pulmonary hypertension, chronic thromboembolic obstructive pulmonary hypertension, blood disorders (chronic hemolytic anemia, bone hyperplasia disease, splenectomy, etc.), systemic diseases (sarcoidosis, pulmonary histiocytosis, lymphangiomyomatosis, etc.) , Metabolic diseases (diabetes, Gaucher disease, thyroid disease), other diseases (tumor obstruction, fibrous mediastinitis, chronic renal failure, segmental pulmonary hypertension), etc. Can be mentioned.

  A second embodiment of the present invention is a medicament containing an acyclic retinoid or a salt thereof, or a solvate thereof (hereinafter also referred to as “medicine of the present invention”), and a preferred acyclic retinoid is peretinoin. is there. The medicament of the present invention may be in the form of administering an acyclic retinoid or a salt thereof, which is an active ingredient, or a solvate thereof, but generally, in addition to these active ingredients, one or two or more It is desirable to administer in the form of a pharmaceutical composition containing a pharmaceutical additive (hereinafter also referred to as “the pharmaceutical composition of the present invention”). Further, the pharmaceutical composition according to the embodiment of the present invention may further contain other known drugs.

  The medicament or the pharmaceutical composition of the present invention may be in an oral or parenteral dosage form, and is not particularly limited. For example, tablets, capsules, granules, powders, syrups, suspensions, Preparations, ointments, creams, gels, patches, inhalants or injections. These preparations are prepared according to a conventional method. In the case of liquid preparations, they may be dissolved or suspended in water or another suitable solvent at the time of use. Tablets and granules may be coated by a known method. In the case of an injection, the antibody of the present invention or a functional fragment thereof is prepared by dissolving the same in water, but may be dissolved in a physiological saline solution or a glucose solution if necessary, An agent may be added.

  The type of the pharmaceutical additive used in the production of the medicament or the pharmaceutical composition of the present invention, the ratio of the pharmaceutical additive to the active ingredient, or the method of producing the medicament or the pharmaceutical composition can be determined by those skilled in the art depending on the form. It can be appropriately selected. As the pharmaceutical additive, an inorganic or organic substance, or a solid or liquid substance can be used. Generally, for example, 0.1% by weight to 99.9% by weight, 1% by weight to 95.0% by weight, or between 1% and 90.0% by weight. Specifically, examples of pharmaceutical additives include lactose, glucose, mannitol, dextrin, cyclodextrin, starch, sucrose, magnesium aluminate metasilicate, synthetic aluminum silicate, sodium carboxymethylcellulose, hydroxypropyl starch, and carboxymethylcellulose calcium. , Ion exchange resins, methylcellulose, gelatin, gum arabic, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, polyvinyl alcohol, light anhydrous silicic acid, magnesium stearate, talc, tragacanth, bentonite, veegum, titanium oxide, sorbitan fatty acid ester, Sodium lauryl sulfate, glycerin, fatty acid glycerin ester, purified lanolin, glycerogelatin, polysodium Bate, macrogol, vegetable oils, waxes, liquid paraffin, white petrolatum, fluorocarbons, nonionic surfactants, propylene glycol or water and the like.

  To produce a solid preparation for oral administration, the active ingredient and excipient components, for example, lactose, starch, microcrystalline cellulose, calcium lactate or silicic acid are mixed to form a powder, or if necessary, A binder such as sucrose, hydroxypropylcellulose or polyvinylpyrrolidone, a disintegrant such as carboxymethylcellulose or calcium carboxymethylcellulose are added, and the mixture is granulated by wet or dry granulation to give granules. In order to produce tablets, these powders and granules may be compressed as they are or by adding a lubricant such as magnesium stearate or talc. These granules or tablets are coated with an enteric base such as hydroxypropylmethylcellulose phthalate, methacrylic acid-methyl methacrylate polymer and enteric coated, or coated with ethylcellulose, carnauba wax or hardened oil to obtain a sustained release preparation. You can also. In order to produce capsules, powders or granules are filled in hard capsules, or the active ingredient is used as it is, or is dissolved in glycerin, polyethylene glycol, sesame oil or olive oil, and then coated with gelatin to form soft capsules. be able to.

  In order to manufacture an injection, the active ingredient may be used as necessary, such as hydrochloric acid, sodium hydroxide, lactose, lactic acid, sodium, a pH adjuster such as sodium monohydrogen phosphate or sodium dihydrogen phosphate, sodium chloride or glucose, etc. Dissolved in distilled water for injection together with an isotonic agent, and sterile-filtered and filled into ampoules, or further, mannitol, dextrin, cyclodextrin, gelatin or the like is added and freeze-dried in vacuum to obtain a working-soluble injection. Is also good. In addition, reticin, polysorbate 80, polyoxyethylene hydrogenated castor oil or the like may be added to the active ingredient and emulsified in water to prepare an injection emulsion.

  In order to manufacture a rectal preparation, the active ingredient is dissolved by humidification together with a suppository base such as cocoa butter, fatty acid tri-, di- and monoglycerides or polyethylene glycol, and then poured into a mold and cooled, or the active ingredient is cooled. After dissolving in polyethylene glycol or soybean oil or the like, it may be coated with a gelatin film.

The dose and the number of times of administration of the medicament or the pharmaceutical composition according to the embodiment of the present invention are not particularly limited. Can be appropriately selected by the judgment of a doctor or a pharmacist according to the above conditions.
In general, the daily dose for oral administration in adults is about 0.01 to 1,000 mg (weight of active ingredient) and can be administered once or several times a day, or every few days . When used as an injection, it is desirable to continuously or intermittently administer a daily dose of 0.001 to 100 mg (weight of the active ingredient) to an adult.

  The medicament or pharmaceutical composition according to the embodiment of the present invention is prepared as a sustained-release preparation such as an implant or a delivery system encapsulated in microcapsules using a carrier capable of preventing immediate removal from the body. can do. As such carriers, biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid can be used. Such materials can be easily prepared by those skilled in the art. Also, a suspension of liposomes can be used as a pharmaceutically acceptable carrier. Liposomes are prepared through a filter of appropriate pore size to a size suitable for use as a lipid composition comprising, but not limited to, phosphatidylcholine, cholesterol, and PEG-derived phosphatidylethanol (PEG-PE). Can be purified by

The medicament or the pharmaceutical composition according to the embodiment of the present invention may be provided in the form of a kit together with instructions such as an administration method. The medicament or the pharmaceutical composition contained in the kit is manufactured from a material that maintains the activity of the active ingredient effectively for a long period of time, does not cause the agent or the like to adsorb to the inside of the container, and does not alter the components. Supplied by container. For example, a sealed glass ampoule may include a buffer or the like encapsulated in the presence of a neutral, non-reactive gas such as nitrogen gas.
The instructions for use of the kit may be printed on paper or the like, or may be stored and supplied on an electromagnetically readable medium such as a CD-ROM or DVD-ROM.

A third embodiment of the present invention is a method for preventing and / or treating pulmonary hypertension, comprising administering a medicament or a pharmaceutical composition of the present invention to a patient.
Here, “treatment” refers to preventing or alleviating the progression and worsening of the disease state in patients who have already developed pulmonary hypertension, and thereby preventing or alleviating the progression and worsening of pulmonary hypertension. Is the action to be taken.
Further, "prevention" refers to a treatment intended to prevent the onset of pulmonary hypertension in advance by preventing the onset of pulmonary hypertension in a patient who may develop pulmonary hypertension. .

Where the specification is translated into English and includes the words "a", "an", and "the" in the singular, the singular as well as the singular unless the context clearly indicates otherwise. It shall include a plurality.
Hereinafter, the present invention will be further described with reference to examples. However, these examples are merely examples of the embodiments of the present invention, and do not limit the scope of the present invention.

1. Examination of the effect of peretinoin on the suppression of progression of mouse pulmonary hypertension 1-1. Pulmonary hypertension model mouse The effect of peretinoin was examined using a pulmonary hypertension model mouse (pulmonary arterial pulmonary hypertension model mouse) bred by administering a VEGFR antagonist under a low oxygen load condition.
As a pulmonary hypertension model mouse, 8-week-old male C57B6 / 6J mice were administered with SU5416 (AdooQ-BioScience: # A1243) at a single dose of 20 mg / kg, intraperitoneally three times a week, Those raised for 3 weeks in a low oxygen chamber (8.5% oxygen concentration) were used. Various measurements were performed three weeks after the first SU5416 administration. The PH (pulmonary hypertension) group of the pulmonary hypertension model mice was bred on a normal diet, and the peretinoin-administered group was bred on a diet containing 0.06% by weight of peretinoin from the first SU5416 administration. The control group was bred in a normal breeding environment (21% oxygen concentration) on a normal diet without administration of SU5416.

1-2. Echo measurement
Using the vevo 2100 (Fujifilm Visual Sonic), the pulse waveform of the right ventricular outflow tract was measured by the pulse Doppler method, and the PAT (Pulmonary Accelation Time; the time from the start of cardiac output to the time when the maximum flow velocity was reached) was calculated. ET (Ejection Time) was measured (FIG. 1).
Both PAT and PAT / ET were longer in the peretinoin-administered group than in the PH group. Since PAT / ET correlates with pulmonary artery pressure (the shorter the PAT / ET, the higher the pulmonary artery pressure), peretinoin is thought to reduce pulmonary artery pressure.

1-3. Measurement of pulmonary artery pressure and right ventricular function using a conductance catheter In order to investigate pulmonary artery pressure, right ventricular function, etc. in pulmonary hypertension model mice, conductance catheters (PVR 839 and PVR 1035; MPVS-Ultra pressure volume system; Millar Instruments) Was used to analyze the pressure-capacity curve (PV loop). The measurement was performed according to the method described in Am J Physiol Heart Circ Physiol 301: H2198-H2206, 2011.
In the PV loop, the PH group showed increased right ventricular pressure and decreased cardiac output, while the peretinoin-treated group had decreased right ventricular pressure and improved cardiac output, and was very similar to the curve of the control group. Was confirmed (FIG. 2).
RVSP (right ventricular systolic pressure) is approximately the same value as pulmonary artery systolic pressure, but significantly decreased by peretinoin administration (FIG. 3, RVSP). RV / IVS + LV is the weight ratio of RV (right venticule: right ventricle) to IVS (interventricular septum) + LV (left venticule: left ventricle), which reflects right ventricular weight and is high in right heart failure However, this value was significantly reduced by peretinoin administration (FIG. 3, RV / VS + LV).
The HR (heart rate: heart rate) and BW (body weight: body weight) were not significantly different among the control group, the PH group, and the peretinoin administration group.
From the above results, it was confirmed that the pulmonary artery systolic pressure and the right ventricular weight were improved.

In addition, peretinoin administration increases CO (cardiac output: stroke volume) and SV (stroke volume) (Fig. 4, CO and SV), and Ea (arterial elastance: pulmonary vascular resistance). Fell. RVEF (right ventricular ejection fraction: right ventricular ejection fraction) was also increased by administration of peretinoin, and improvement in contractile ability was observed (FIG. 5). RVEDV (right ventricular end-diastolic volume) was also reduced by peretinoin administration (FIG. 4, RVEDV).
From the above results, improvement in cardiac output and right ventricular afterload was confirmed.

Changes in pulmonary vascular resistance were studied. Epoprostenol (epoprostenol) and peretinoin (pretinoin), which are pulmonary vasodilators conventionally used for pulmonary hypertension, were administered to C57B6 / 6J (wild type) mice (the administration time of each drug is indicated by an arrow), Fluctuations in right ventricular pressure (Fig. 6, upper waveform) and cardiac output (Fig. 6, lower waveform) were examined. As a result, right ventricular pressure decreased with the start of epoprostenol. After the administration of epoprostenol was stopped, the administration of peretinoin was started, and the blood pressure recovered to the base line. Right ventricular pressure is defined by vascular resistance and cardiac output, but since cardiac output was unchanged, it is probable that administration of each drug resulted in a change in vascular resistance, resulting in a change in pressure. . In fact, even when calculating the vascular resistance (Ea) immediately after drug administration, it was confirmed that vascular resistance was reduced by epoprostenol, but not by peretinoin.
From the above results, it is considered that the administration of peretinoin does not cause the pulmonary vasodilation in the acute phase, and thus can avoid the occurrence of side effects associated with the conventional administration of the pulmonary vasodilator.

1-4. Histological examination 1% formalin was administered into the trachea of mice that had deep sedation by inhalation anesthesia, the lungs were expanded by applying a pressure of 20 cm, fixed overnight with 10% formalin, and then embedded in paraffin. Elastica Van Gieson (EVG) staining was performed using the specimen (FIG. 7). Analysis was performed using Image J. Medial wll thickness (medial pulmonary artery thickness),% wall thickness (ratio of medial thickness to outer diameter of pulmonary artery) and Medial thickness index (index of medial thickness: large) Was calculated (FIG. 8). 7 and 8, it was confirmed that peretinoin improves the thickening of the media of the pulmonary artery.
Next, tissue sections from the pulmonary artery of the mice in the control group, PH group, and peretinoin administration group were stained with α-Actin antibody (1A4): sc-32251 (santa cluz). Staining was performed using the VECTOR MOM Immunodetection Peroxidase Kit.
From FIG. 9, a decrease in smooth muscle cells (αSMA-positive cells) in the media of the pulmonary artery was confirmed, suggesting that the administration of peretinoin suppressed the growth of smooth muscle cells.

1-5. Effect on expression of genes related to pulmonary vascular remodeling We examined how peretinoin administration affected the expression of genes involved in inflammation, adventitia fibrosis, and apoptosis resistance associated with pulmonary vascular remodeling .
Using total RNA extracted from lung tissue as a template, qRT-PCR was performed, and IL-6 (inflammation-related cytokine gene), ET1 (gene involved in fibrosis), survivin140 (apoptosis resistance gene) and TGFβ (pulmonary hypertension) In this study, the expression of a gene whose expression increased and that was one of the causes of abnormal growth was examined. The primers used are shown below.
・ Amplification of IL-6
Il6 forward: GATGGATGCTACCAAACTGGAT (SEQ ID NO: 1)
Il6 Reverse: CCAGGTAGCTATGGTACTCCAGA (SEQ ID NO: 2)
・ Amplification of ET1
ET-1 forward: CAAGGAGCTCCAGAAACAGC (SEQ ID NO: 3)
ET-1 Reverse: TCTGCACTCCATTCTCAGCTC (SEQ ID NO: 4)
・ Amplification of Survivin140
Survivin140 forward: TGGACAGACAGAGAGCCAAG (SEQ ID NO: 5)
Survivin140 Reverse: AGTTCTTGAAGGTGGCGATG (SEQ ID NO: 6)
・ Amplification of TGFβ
Tgfb1 forward: GCAACATGTGGAACTCTACCAGAA (SEQ ID NO: 7)
Tgfb1 Reverse: GACGTCAAAAGACAGCCACTCA (SEQ ID NO: 8)
As a result, as shown in FIG. 10, IL6, ET1, survivin140 and TGFβ whose expression was increased in the PH group were reduced to the respective gene expression levels in the control group by peretinoin administration.

The expression of αSMA and Fn (fibronectin) genes, which are components of the pulmonary media and adventitia, were also examined. The primers used for qRT-PCR are as follows.
・ Amplification of αSMA
aSMA forward: GGCATCCACGAAACCACCTA (SEQ ID NO: 9)
aSMA reverse: CACGAGTAACAAATCAAAGC (SEQ ID NO: 10)
・ Fn amplification
Fn forward: ATGTGGACCCCTCCTGATAGT (SEQ ID NO: 11)
Fn Reverse: GCCCAGTGATTTCAGCAAAGG (SEQ ID NO: 12)
As a result, it was confirmed that the expression of αSMA and Fn increased in the PH group was both decreased by peretinoin administration (FIG. 11).
The above results suggest that peretinoin has an effect of improving inflammation, fibrosis, apoptosis resistance and the like of pulmonary blood vessels, and suppressing remodeling of pulmonary adventitia and media.

2. Comparison of cyclic retinoid with ATRA 2-1. ATRA dose The effect of ATRA, a cyclic retinoid, on pulmonary vascular remodeling was studied in comparison with peretinoin.
For the comparative experiment, the aforementioned pulmonary hypertension model mouse (pulmonary arterial pulmonary hypertension model mouse) was used. According to a previous report (Kada et al., Arterioscler Thromb Vasc Biol. 27: 1535-1541 2007), peretinoin 100 mg / kg administration and ATRA 10 mg / kg are equivalent titers as retinoids. ATRA was ingested at doses of 100 mg / kg and 10 mg / ml, respectively. When mice were fed a diet containing 100 mg / kg / day of ATRA, all died in 2 weeks.

2-2. Investigation of the effects of ATRA administration on pulmonary vascular and cardiac dynamics CO, RVSP, Ea and RV / IVS + LV were measured using a conductance catheter. As a result, all functions were improved in the peretinoin administration group, whereas almost no effect was exhibited in the ATRA administration group (FIG. 12). Also, no improvement was observed in the EF (ejection fraction: ejection fraction) in the ATRA administration group (FIG. 13).
From the above results, it was found that administration of peretinoin improved all the measured items, whereas administration of ATRA had almost no effect.

3. Examination of reverse remodeling effect of peretinoin on remodeled pulmonary blood vessels. Showed that the administration of peretinoin simultaneously with the progression of pulmonary vascular remodelin using model mice effectively suppressed the progression of pulmonary hypertension.
Next, when peretinoin is administered to a model mouse in which pulmonary vascular remodeling has already occurred (that is, a pulmonary hypertension model mouse is prepared and then administered to the model mouse), the remodeled pulmonary blood vessels are improved. I examined whether it could be done.
3-1. Pulmonary hypertension model mouse
8-week-old male C57B6 / 6J mice were bred in a hypoxic chamber (8.5% oxygen concentration) for 3 weeks while intraperitoneally administered SU5416 at a dose of 20 mg / kg three times a week. Hypertensive mice were created. During this time, they were bred on a normal diet without peretinoin. The created pulmonary hypertensive mice were divided into two groups, a diet group containing 0.06% by weight of peretinoin and a normal diet group, and were continuously bred in a hypoxic chamber and administered once weekly with SU5416 for 2 weeks. Five weeks after the administration), various measurements were performed. The control group was bred on a normal diet in a normal breeding environment (21% oxygen concentration) without administration of SU5416.

3-2. RVEDV, Ea and Pmax (synonymous with RVSP; right ventricular maximum pressure) have significant differences when peretinoin is administered to pulmonary hypertension model mice with remodeled pulmonary vessels Although RV / IVS + LV was not significantly different, it showed a decreasing tendency (FIG. 14).
Emax (maximum elastance, one of the indicators of end-systolic maximal elastance, an index of contraction), which was compensated by the increase in pulmonary vascular resistance, significantly decreased, and the decreased EF significantly increased (FIG. 15).
From the above results, pulmonary hypertension was found to be improved even when peretinoin was administered in a state where pulmonary vascular remodeling had already occurred.

3-3. Histological examination Histological examination was performed to further confirm that peretinoin exhibits a reverse remodeling effect. Specimens were collected and stained by the methods described in 1-4 above. EVG staining confirmed improvement in pulmonary artery medial hyperplasia, and showed that reverse remodeling was obtained by peretinoin administration ("HYSU 3 weeks + Hysu / ACR 2 weeks" in FIGS. 16 and 17).

3-4. Echo measurement Echo (upper figure in FIG. 18) and HE-stained image (lower figure in FIG. 18) of a heart short-axis cross section of a pulmonary hypertension model mouse (PH group) and a mouse to which peretinoin was administered after pulmonary blood pressure remodeling (peretinoin administration group) )It was confirmed. From FIG. 17, it was found that the enlarged right heart (FIG. 18A) of the pulmonary hypertension model mouse was reduced by peretinoin administration (FIG. 18B).

  From the above results, it was confirmed that peretinoin was effective for pulmonary hypertension in which pulmonary vascular remodeling had already occurred.

  The present invention provides a prophylactic or therapeutic agent for pulmonary hypertension containing an acyclic retinoid such as peretinoin. The medicament according to the present invention reduces side effects that can be caused by existing medicaments and exhibits an unprecedented therapeutic effect. Therefore, the present invention is greatly expected to be used in the medical field.

Claims (4)

  An agent for improving pulmonary vascular remodeling, comprising an acyclic retinoid or a salt thereof, or a solvate thereof.   The ameliorating agent according to claim 1, wherein the acyclic retinoid is peretinoin.   A medicament for preventing and / or treating pulmonary hypertension, comprising a non-cyclic retinoid or a salt thereof, or a solvate thereof.   The medicament according to claim 3, wherein the acyclic retinoid is peretinoin.