JP2019205423A - Recombinant cells and method for producing pentamethylenediamine - Google Patents

Abstract

To provide a technology to efficiently produce pentamethylenediamine from methane which has not been used as a resource, particularly, to provide a technology to produce pentamethylenediamine with a methane-utilizing bacterium engineered to comprise a nucleic acid encoding an enzyme necessary for the production of pentamethylenediamine.SOLUTION: There is provided an unnatural methane-utilizing bacterium engineered to comprise a nucleic acid encoding an enzyme for the production of pentamethylenediamine. Typical examples of such microorganisms are exemplified with methane-utilizing bacterium which has been engineered to comprise nucleic acids encoding L-lysine decarboxylase, aspartate kinase, and dihydrodipicolinate synthase and may produce a high concentration of pentamethylenediamine when the expression level of these enzymes is induced to a high expression level.SELECTED DRAWING: None

Description

  The present invention provides a methane-utilizing bacterium with enhanced production of pentamethylenediamine, and further relates to a method for producing pentamethylenediamine from methane.

Pentamethylenediamine (also called 1,5-diaminopentane or cadaverine, which is a compound having the molecular formula C ₅ H ₁₄ N ₂ ) is a substance that is expected to be used as a resin raw material such as polyamide resin. While an efficient chemical synthesis method from a petrochemical raw material has not yet been established, it is known that it is easily produced biologically by enzymatic decarboxylation of L-lysine. Has been attracting attention (Non-Patent Document 1).

Until now, fermentative production of pentamethylenediamine using sugars such as glucose as raw materials has been extensively studied. For example, high-concentration production has been achieved by expressing L-lysine decarboxylase in microorganisms modified so as to be able to produce L-lysine at high levels such as Corynebacterium glutamicum and Escherichia coli (Non-patent Document 1). However, in the microbial fermentation method using sugarcane-derived sugar as a culture raw material, competition with food has been regarded as a problem. In addition, a method for enzymatically producing pentamethylenediamine from L-lysine is widely known (Patent Document 1). However, since L-lysine is also produced mainly by microbial fermentation from a sugar raw material, The essential problem of conflict cannot be solved. Accordingly, development of a method for producing biological pentamethylenediamine from raw materials that do not compete with food is desired.

  In relation to the above request, for example, when methanol is used as a non-edible raw material and L-lysine and pentamethylenediamine are produced by methanol-assimilating bacteria, they are cultured at a high concentration of 10 g / L or more. It is reported that it accumulates in a thing (nonpatent literatures 2 and 3). However, since these methods use highly toxic methanol as a raw material, they cannot be said to be low environmental impact processes, and since methanol has a low carbon ratio per molecule, it is necessary to produce organic substances mainly composed of carbon. In addition, there is an essential problem that the conversion rate from the raw material to the product per weight is poor.

  Under such circumstances, in recent years, a technique for directly producing a substance from methane by a microorganism has attracted attention. In this production technique, methane supplied as a gas has good separability from the product and low biological toxicity. In addition, since methane is a raw material having a high carbon ratio per molecule, the theoretical conversion rate per weight from the raw material to the organic product is also high. Furthermore, methane is abundantly contained in natural gas and the like as an inexpensive unused resource, or can be used abundantly as surplus biogas, and thus is expected as a next-generation carbon raw material. Naturally, there is a group of microorganisms called methane-utilizing bacteria that can grow using methane as a single carbon source and energy source, and the metabolism of these microorganisms is artificially generated so that a desired substance can be produced. It is also known that a certain useful substance can be biologically produced from methane by modifying it to (Non-patent Document 4).

  Therefore, applying this technology to pentamethylenediamine production is a very attractive issue, but there has been no such report so far. In this respect, Patent Document 2 describes the production of L-lysine, which is a precursor of pentamethylenediamine. In this document, expression of mutant aspartate kinase and mutant dihydrodipicolinate synthase, in which feedback inhibition is canceled in a methane-utilizing bacterium, or establishment of resistance to an analog compound of L-lysine is established. By carrying out in bacteria, the production concentration of L-lysine from methane has been improved. However, despite these modifications, the production concentration of L-lysine in batch culture conditions using the 30 mL test tube of the methane-utilizing bacterium is only 9.37 mg / L, and high concentration of methane in the bioreactor Even under the condition of continuously supplying the amount of 223 mg / L. This suggests that high production of pentamethylenediamine, which is a decarboxylation product of L-lysine, may not be realized simply by expressing a gene necessary for production of the substance.

  On the other hand, the types and number of substances that can be biologically produced from methane are still limited (Non-Patent Document 5). In addition, the concentration and production efficiency of the produced substance are significantly lower than when glucose or methanol is used as a culture raw material. In other words, the efficiency of substance production can be evaluated by calculating the production concentration (mg / L / OD) per Optical Density (OD), which is an index of bacterial cell concentration. The production efficiency (mg / L / OD) is very low (Non-patent Documents 5 and 6, Patent Document 3). For example, in Non-Patent Document 6, lactic acid production from methane is achieved by expressing lactate dehydrogenase in a methane-utilizing bacterium. However, the production efficiency is remarkably low at 32 mg / L / OD, and 60% of the total methane supplied as a raw material is wasted for the production of cells.

  Thus, while methane is strongly expected to be used as a next-generation carbon raw material, there is no example of realizing pentamethylenediamine production from methane by methane-utilizing bacteria. Moreover, even in the prior art related to the production of other compounds, considering that the production concentration and versatility were limited, it was difficult to say that pentamethylenediamine production by methane-utilizing bacteria was a practical process. .

Patent Document 1: Japanese Patent Application Laid-Open No. 2008-193899 Patent Document 2: Japanese Patent Application Laid-Open No. 2001-120292 Patent Document 3: WO2015 / 155791 pamphlet

Non Patent Literature 1: Tsuge, Y. et al. et al. , Engineering cell factories for producing building block chemicals for bio-polymer synthesis. , Microb. Cell Fact. , Vol. , 15, 19 (2016)
Non-Patent Document 2: Irla, M. et al. et al. , Genome-based genetic tool development for Bacillus methanolicus: theta-and rolling cipher-replicated production for inducible regeneration. , Front. Microbiol. , Vol. 7, 1481 (2016)
Non-Patent Document 3: Brautaset et al. , Bacillus methanolicus: a candidate for industrial production of amino acids from methanol at 50 ° C. , Appl. Microbiol. Biotechnol. , Vol. 74 (2007)
Non-Patent Document 4: Kalyuzhnaya, M .; G. et al. , Metabolic engineering in methanolic bacteria. , Metab. Eng. , Vol. 29, 142-152 (2015)
Non-Patent Document 5: Lee, O .; K. et al. , Metabolic engineering of methanotrophs and its applications to production of chemicals and biofuels from methane. Biofuels, Bioprod. Bioref. , Vol. 10, 6 (2016)
Non-Patent Document 6: Hennard, C .; A. et al. , Biological conversion of methanol to lactate by an anionic methanolic bacteria. , Sci. Rep. , Vol. 6, 21585 (2016)

  In view of the above situation, an object of the present invention is to provide a technique for producing pentamethylenediamine from methane, which is expected as a next-generation carbon raw material. Another object of the present invention is to provide a recombinant methane-utilizing bacterium useful for the production of pentamethylenediamine. In a preferred embodiment of the present invention, it is intended to provide a technique for producing pentamethylenediamine with a high efficiency unprecedented in the production of biological material from methane.

  As described above, it would be very promising if direct production of pentamethylenediamine from methane by a methane-utilizing bacterium was possible, but there was no such report. On the other hand, although production of L-lysine, which is a precursor of pentamethylenediamine, by methane-utilizing bacteria has been reported, the production concentration of the L-lysine was extremely low, so it may be difficult to increase production of pentamethylenediamine. Reasonably expected. However, as a result of intensive studies to solve the above-mentioned problems, the present inventors have found that pentamethylenediamine can be produced at high yield by using the methane-utilizing bacterium of the present invention.

  That is, the present inventors have previously tried to introduce a vector containing a sequence that constantly expresses the L-lysine decarboxylase gene into a methane-utilizing bacterium, but obtaining such a transformant itself. Even that was not realized. Therefore, the present inventors tried to use the expression induction system of the present invention, and found that the acquisition efficiency of the transformant can be remarkably improved. In addition, the present invention induces the expression of L-lysine biosynthetic enzymes and L-lysine decarboxylase to a high level, thereby enabling pentamethylene diamine with high efficiency unprecedented in biological production from methane. As a result, the present invention has been completed.

  For example, when the present inventors cultured the recombinant methane-utilizing bacterium of the present invention expressing L-lysine decarboxylase, it is clear that 31.6 mg / L of pentamethylenediamine can be produced in just 24 hours. Became. This greatly exceeded both the accumulated concentration of L-lysine (9.37 mg / L) and the production rate described in Patent Document 4 after culturing for 65 hours. Furthermore, when the present inventors also expressed a gene that contributes to the improvement of L-lysine production in the methane-utilizing bacterium, the substance production efficiency (mg / L / OD) was further remarkably improved, and methane supply was improved. It has been found that substance production at a concentration as high as 124 mg / L is possible even with limited laboratory scale (~ mL) batch culture. Moreover, it became clear that the production efficiency of pentamethylenediamine greatly depends on the expression intensity of the enzyme for the production of pentamethylenediamine. This fact supported the importance of a technology capable of inducing the expression of an enzyme necessary for pentamethylenediamine production at a high level in order to produce pentamethylenediamine with high efficiency.

That is, the present invention provides the following:
(1) A recombinant methane-assimilating bacterium containing a gene encoding an enzyme for producing pentamethylenediamine, wherein the methane-assimilating bacterium lacking the enzyme is induced by expression of the enzyme A recombinant methane-utilizing bacterium characterized in that it leads to increased production of pentamethylenediamine compared to the bacterium;
(2) The methane-utilizing bacterium according to (1), wherein the expression of the enzyme is induced by addition of an inducer;
(3) The methane-utilizing bacterium according to (1) or (2) above, wherein expression of the enzyme is induced by addition of theophylline;
(4) The methane-utilizing bacterium according to any one of (1) to (3) above, wherein the enzyme for producing pentamethylenediamine is L-lysine decarboxylase;
(5) the L- lysine decarboxylase is characterized in that it CadA and Ldc of Escherichia coli, Aliivibrio salmonicida of CadA, and any one or more selected from the group consisting of CadA of Klebsiella pneumoniae, the ( 4) methane-utilizing bacteria;
(6) The enzymes for producing pentamethylenediamine are aspartate kinase (LysC), dihydrodipicolinate synthase (DapA), meso-diaminopimelate dehydrogenase (DDH), diaminopimelate decarboxylase (LysA), Selected from the group consisting of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transhydrogenase, aspartate aminotransferase (AspC), phosphoenolpyruvate carboxylase (PEPC), and pyruvate carboxylase (PYC) Any one or more of the above (1) to (5) methane-utilizing bacteria;
(7) The methane-utilizing bacterium according to (6) above, wherein the LysC, DapA, PEPC, and PYC are mutant enzymes in which feedback inhibition is released;
(8) The methane-assimilating bacterium according to (6), wherein the GAPDH is NADPH-dependent;
(9) The methane-assimilating bacterium according to (8) above, wherein the GAPDH is a mutant enzyme having an improved affinity for NADPH compared to the corresponding wild-type enzyme;
(10) The methane-utilizing bacterium according to any one of (1) to (9) above, wherein at least one of genes encoding the enzyme is integrated on the chromosome of a host microorganism;
(11) The methane-utilizing bacterium according to any one of (1) to (9) above, wherein at least one of genes encoding the enzyme is introduced into a host microorganism as a vector containing the gene ;
(12) The host microorganism may be Methylomonas, Methylobacter, Methylococcus, Methylocinus, Methylocyst, Methylophilid, Methylophilus A methane-utilizing bacterium according to any one of (1) to (11) above, which is selected from the group consisting of:
(13) the host microorganism, characterized in that it is a Methylococcus capsulatus Bath (NCIMB 11132), methane-utilizing bacteria of the above (12);
(14) Phenamethylenediamine is produced by bringing methane into contact with any one of the above methane-assimilating bacteria (1) to (13) and culturing under conditions suitable for the growth of the microorganism. And production method of pentamethylenediamine.

  According to the present invention, a high concentration of pentamethylenediamine can be produced by inducing expression of an enzyme necessary for production of pentamethylenediamine in cells of a methane-utilizing bacterium. Furthermore, in addition to L-lysine decarboxylase, pentamethylenediamine can be produced from methane with high efficiency by inducing expression of L-lysine biosynthetic enzymes such as aspartate kinase and dihydrodipicolinate synthase. .

FIG. 1 is a plasmid map of pmk61A. In the figure, “Ptrc” is the trc promoter, “riboswitch” is the riboswitch sequence, “RBS” is the ribosome binding sequence, “GFP” is the sfGFP gene, “mob” is the mob gene, and “kanR” is kanamycin. The resistance gene, “Rep”, indicates the origin of replication. 2, in Methylococcus capsulatus Bath was introduced Pmk61A, is a graph showing the relationship between the theophylline addition concentration and GFP fluorescence intensity. FIG. 3 is a plasmid map of pmk96, pmk99, pmk127, pmk167, pmk141, and pmk142. In the figure, “Ptrc” is the trc promoter, “Ptrc E *” is the trc promoter linked to the riboswitch sequence, “RBS” is the ribosome binding sequence, “T1” is the terminator, and “mob” is the mob gene. “KanR” represents the kanamycin resistance gene, “Rep” represents the origin of replication, “cadA (A.s)” represents cadA of Alivivio salmonicida , “cadA (E.c)” represents cadA of Escherichia coli , “ cadA the (K.p) "is of Klebsiella pneumoniae cadA," the ^{lysC T352I} "is Eschericia coli of aspartate kinase, which is releasing the feedback inhibition (lysC) mutant," the ^{dapA E84T} "is feedback inhibition Dihydrodipicolinate synthase (dapA) variants of dividing been Eschericia coli, respectively, are shown. 4, (expressed cadA of Aliivibrio salmonicida) pmk99, (expressed cadA of Escherichia coli) pmk127, pmk167 in 48 hours culture (Klebsiella expressing cadA of pneumoniae) the Methylococcus capsulatus Bath introduced respectively, cell proliferation (a ) And the production amount of pentamethylenediamine (b). 5, Methylococcus capsulatus Bath to pmk141 (Aliivibrio salmonicida of cadA, express ^{lysC T352I} and ^{dapA E84T} of Eschericia coli) Strain 1 was introduced, pmk142 (in Escherichia coli cadA, express ^{lysC T352I} and ^{dapA E84T} of Eschericia coli) It is a graph which shows the relationship between cell growth (a) and pentamethylenediamine production amount (b) in 48 hours culture | cultivation of Strain 2 which introduce | transduced. 6, Methylococcus capsulatus Bath to pmk141 (Aliivibrio salmonicida of cadA, express ^{lysC T352I} and ^{dapA E84T} of Eschericia coli) Strain 1 was introduced, pmk142 (in Escherichia coli cadA, express ^{lysC T352I} and ^{dapA E84T} of Eschericia coli) It is a graph which shows the relationship between cell growth (a) and pentamethylenediamine production amount (b) in 96 hours culture | cultivation of Strain 2 which introduce | transduced. In FIG. 6 c, “1 present invention” indicates the production efficiency (mg / L / OD) of pentamethylenediamine in Strain 2, and “2” indicates the 5 L bioreactor culture of Mylomicrobium burate 5GB1 described in Non-Patent Document 3. The efficiency of lactic acid production, “3” is the efficiency of succinic acid production in 30 mL test tube culture of Mycococcus capsulatus Bath described in WO2015 / 155791, and “4” is 0 of Mylomicrobium butylate 5GB1 described in Non-Patent Document 3. Each shows the efficiency of lactic acid production by 5L bioreactor culture. FIG. 7 shows that theophylline concentration when a strain in which pmk142 (expressing ^{cadA of} Escherichia coli , lysC ^T352I and dapA ^E84T ) was introduced into Mythococcus capsulatus Bath under various theophylline-added conditions for 48 hours. It is a graph which shows the relationship with production efficiency. In the figure, “ND” indicates that pentamethylenediamine was below the lower limit of detection. In addition, the dotted line in the figure shows the efficiency of lactic acid production by 5L bioreactor culture of Mylomicrobium buriate 5GB1 described in Non-Patent Document 3, which has the highest production efficiency among the prior arts in the field of substance production from methane. 8, Methylococcus capsulatus Bath to pmk142 cell growth and production levels of pentamethylenediamine when cultured in (the Escherichia coli ^{cadA, lysC T352I} and ^{dapA E84T} expression) the introduced strain 1L of aeration agitation culture device It is the shown graph.

  The present invention will be specifically described below.

In the present invention, a methane-utilizing bacterium for use in the production of pentamethylenediamine is provided. The microorganism contains a gene encoding L-lysine decarboxylase. L- Lysine decarboxylase is an enzyme which catalyzes the conversion of pentamethylenediamine and CO ₂ L- lysine. L-lysine decarboxylase catalyzes an enzymatic reaction belonging to the gene ontology (GO) term ID of EC 4.1.1.18 (L-lysine decarboxylase activity) and GO: 0008923. As a source of a gene encoding the enzyme, any microorganism-derived microorganism capable of expressing the activity of each enzyme in a methane-utilizing bacterium can be used. Examples include, but are not limited to, Eschericia coli, Aliivibrio salmonicida, Salenomonas ruminantium, Klebsiella pneumoniae, Hafnia alvei, Klebsiella oxytoca, Klebsiella pneumoniae, Bacterium cadaveris, Glycine max , and the like. More preferred are Escherichia coli , Alivivrio salmonida , and Klebsiella pneumoniae . However, complete genome sequences are now available for more than 500 species (more than half of these are available in public databases such as NCBI), for example, identification of similar sequences based on known sequences and desired Not only can mutants having activity be produced, but also new isolation and identification from natural samples such as metagenome is routine and well known in the art. Therefore, the gene source encoding L-lysine decarboxylase is not limited to the above microorganism.

  In a preferred embodiment, the microorganism has enhanced activity of at least one of L-lysine biosynthetic enzymes. The enzyme is not particularly limited. For example, aspartate kinase (LysC), dihydrodipicolinate synthase (DapA), meso-diaminopimelate dehydrogenase (DDH), diaminopimelate decarboxylase (LysA), glyceraldehyde- Examples include 3-phosphate dehydrogenase (GAPDH), aspartate aminotransferase (AspC), phosphoenolpyruvate carboxylase (PEPC), and pyruvate carboxylase (PYC).

Aspartate kinase (lysC) is an enzyme that catalyzes the reaction of converting aspartate and adenosine triphosphate (ATP) into 4-phosphoaspartate and adenosine diphosphate. LysC catalyzes an enzymatic reaction belonging to the gene ontology (GO) term ID of EC 2.7.2.4 (aspartate kinase activity) and GO: 0404072. Examples of the source of the gene encoding this enzyme include, but are not limited to, Escherichia coli , Bacillus subtilis , Corynebacterium glutamicum , Saccharomyces cerevisiae, and the like. Since all living organisms possess this enzyme activity, it may be derived from a methane-utilizing bacterium that is a host cell, and it is also effective to introduce a foreign gene as necessary. In addition, it is generally recognized that wild-type lysC is feedback-inhibited by L-lysine. Accordingly, those having a mutation that cancels feedback inhibition are preferred. Hereinafter, lysC derived from Escherichia coli will be described as an example, but the gene used in the present invention is not limited thereto. As a mutant lysC that is not subject to feedback inhibition by L-lysine, the threonine residue at position 352 in the amino acid sequence was replaced with an isoleucine residue, and the threonine residue at position 253 was replaced with an arginine residue. Examples include, but are not limited to:

Dihydrodipicolinate synthase (dapA) is a reaction that converts pyruvate and aspartate semialdehyde to (2S, 4S) -4-hydroxy-2,3,4,5-tetrahydro- (2S) -dipicolinate and water. It is an enzyme that catalyzes. dapA catalyzes an enzymatic reaction belonging to the gene ontology (GO) term ID of EC 4.3.3.7 (dihydrodipicolinate synthase activity) and GO: 0008840. Examples of the source of the gene encoding this enzyme include, but are not limited to, Escherichia coli , Bacillus subtilis , Corynebacterium glutamicum , Saccharomyces cerevisiae, and the like. Since all living organisms possess this enzyme activity, it may be derived from a methane-utilizing bacterium that is a host cell, and it is also effective to introduce a foreign gene as necessary. In addition, it is generally recognized that the enzyme activity of wild-type dapA is feedback-inhibited by L-lysine. Accordingly, those having a mutation that cancels feedback inhibition are preferred. Hereinafter, dapA derived from Escherichia coli will be described as an example, but the gene used in the present invention is not limited thereto. The mutant dapA that is not subject to feedback inhibition by L-lysine has an amino acid sequence in which the 81st alanine residue is replaced with a valine residue, and the 84th glutamic acid residue is replaced with a threonine residue. And those in which the 118th histidine residue is substituted with an arginine residue or a tyrosine residue, but are not limited thereto.

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) converts glyceraldehyde-3-phosphate, phosphate and NAD (P) ⁺ to 1,3-bisphosphoglycerate and NAD (P) H It is an enzyme that catalyzes the reaction that occurs. It is generally recognized that this reaction is a reversible reaction. GAPDH is an enzyme reaction belonging to the gene ontology (GO) term ID of EC 1.2.1.12 and GO: 0008943, or belongs to the GO term ID of EC 1.2.1.13 and GO: 0047100. It catalyzes the enzymatic reaction. Examples of sources of the gene encoding this enzyme is not particularly limited, Eschericia coli, Bacillus subtilis, Corynebacterium glutamicum, Saccharomyces cerevisiae, Synechococcus elongatus, Synechocystis sp. Euglena gracilis , Arabidopsis thaliana, and the like. Since this enzyme activity is possessed by many organisms, it may be derived from a methane-utilizing bacterium that is a host cell, and it is also effective to introduce a foreign gene if necessary.

In the present invention, effective means for improving the productivity of pentamethylenediamine include increasing the intracellular NADPH concentration. Production of one molecule of pentamethylenediamine (L-lysine) requires as many as four molecules of NADPH. Therefore, as a strategy for improving the productivity of pentamethylenediamine (L-lysine), many metabolic modifications intended to increase intracellular NADPH concentration have been used. For example, in the fermentation production of pentamethylenediamine using glucose as a culture raw material, intracellular NADPH production and pentamethylenediamine productivity are improved by using the main glucose catabolism pathway as an oxidative pentose phosphate pathway ( Kind et al., Metabolic Engineering, Vol. 25, 113-123 (2014)). Methane assimilating bacteria cannot assimilate glucose, and thus the above-described method for enhancing the metabolic flux of the oxidative pentose phosphate pathway cannot be utilized. A suitable alternative source of NADPH is the electron transfer reaction from NADH to NADP ⁺ by transhydrogenase. Alternatively, since most of GAPDH possessed by methane-utilizing bacteria is NADH-dependent, in the present invention, the intracellular NADPH concentration is increased by overexpression of NADPH-dependent GAPDH or replacement with NADH-dependent one. You can also. Examples of NADPH-dependent GAPDH include those derived from Clostridium acetobutyricum , those derived from Synechococcus elongatus , Synechocystis sp. Examples thereof include, but are not limited to, those derived from Euglena gracilis , those derived from Arabidopsis thaliana , and the like. In addition, a technique for modifying GAPDH, which was originally NADH-dependent, to NADPH-dependent is also generally recognized (Bommardedy et al., Metabolic Engineering, Vol. 25, 30-37 (2014)). Can also be applied. Hereinafter, GAPDH derived from Corynebacterium glutamicum will be described as an example, but the gene used in the present invention is not limited thereto. As NADPH-dependent mutant GAPDH, the amino acid sequence in which the 35th aspartic acid residue is substituted with a glycine residue, the 36th leucine acid residue is substituted with an arginine residue, the 192nd The proline residue is substituted with a serine residue, but is not limited thereto.

  In the present invention, the production efficiency of pentamethylenediamine is expressed by the ratio (mg / L / OD) of the production concentration (mg / L) of pentamethylenediamine and OD600, which is an indicator of the cell concentration. In the production of substances by microorganisms, since cell biomass is a by-product, it is desirable to suppress the production amount and maximize the yield of the target substance. That is, it is desirable that mg / L / OD is as large as possible. In the methane-utilizing bacterium provided in the present invention, the expression level of the enzyme is adjusted so that the production efficiency of pentamethylenediamine can be maximized.

  In the present invention, pentamethylenediamine can be quantified by techniques well known to those skilled in the art. Examples thereof include ion chromatography, high performance liquid chromatography, gas chromatography and the like. In the present invention, OD600 is an index that indirectly represents the cell density in the culture sample. It is generally recognized that cell density (cell count / mL) and OD600 correlate under certain conditions (Volkmer et al., PLoS One, Vol. 6, e23126 (2011)). The OD600 can be quantified by techniques well known to those skilled in the art, and is generally determined by measuring the absorbance of the sample at 600 nm when the optical path length is 1 cm.

  In the present invention, the enzymes necessary for the production of pentamethylenediamine are not limited to the enzymes belonging to the production pathway using L-lysine as a precursor. In general, amines are produced from the corresponding aldehydes by aminotransferases. Furthermore, aldehydes can be generated by designing a redox reaction from the corresponding alcohol, carboxylic acid, or alkane. Therefore, pentamethylenediamine is 5-aminopentanal, 5-aminopentanol, 5-aminovaleric acid, 5-aminopentane, 5-pentanal, valeric acid, 5-pentanol, pentane, 5-formylpentanal, Precursors of compounds such as 5-formylpentanol, 5-formylpentanoic acid, 5-carboxypentanal, 5-carboxypentanol, glutaric acid, 5-hydroxypentanal, 5-hydroxypentanol, 5-hydroxyvaleric acid Can be generated as For example, if valeric acid that can be produced by fatty acid biosynthesis is converted to 5-hydroxyvaleric acid by an alkane oxidase, it can be a precursor of pentamethylenediamine. In addition, valeric acid, 5-pentanal, and 5-pentanol can be generated from pyruvic acid by a carbon chain extension reaction utilizing an L-leucine biosynthesis pathway gene (Marcheschi et al., ACS Chemical Biology, Vol. 7, 689-697 (2012), Dhande et al., Process Biochemistry, Vol. 47, 1965-971 (2012)).

“Expression induction” in the present invention means to increase the expression level of a specific gene only under a specific condition and period. As specific expression induction methods, in addition to artificially changing the culture environment such as addition of inducer and culture conditions (temperature, nutrient concentration, light), non-artificial change of culture environment accompanying culture is used. Can be selected from any one or combination thereof. It is generally recognized that methane-utilizing bacteria can induce expression in any of the above methods. For example, Methylomonas sp. From these genomic DNAs, an expression promoter sequence capable of inducing expression of a specific gene in a specific culture environment has been specified (WO2015 / 195972 pamphlet). In addition, in the case of the Mylomicrobium buriatese 5GB1 strain, it has been shown that a tetracycline-inducible promoter functions well as an expression induction system (Henard, CA et al., Biological conversion of methanol to lactate benzoate bioactivatorate lactate to lactate to lactate. Bacterium., Sci. Rep., Vol. 6, 21585 (2016)). That is, for expression induction in the present invention, a generally recognized expression induction system can be arbitrarily selected and used. Therefore, one mode of public expression induction in the present invention is the riboswitch of the examples described later, but is not limited thereto.

  In the present invention, the expression level of the enzyme for producing pentamethylenediamine can be adjusted as appropriate according to the production efficiency to be achieved. The method for regulating the expression level is not particularly limited, but the use of an artificial expression induction system, the use of a dynamic expression control system (Dahl et al., Nature Biotechnology, Vol. 31, 1039-1046 (2014), Doong et al., Proceedings of the National Academy of Sciences of the United States of America, Vol. 115, 2964-2969 (2018), changes in expression promoter sequence, M. Ribosome binding sequence H. The ribosome biding site calculator., Methods Enzymol., Vol. 498, 19-42 (2011)) Codon optimization of genes encoding enzymes to be expressed (Quax et al., Codon Bias as a Means to Fine-Tone Gene Expression., Mol. Cell., Vol. 59, 2 (2015)), introduction of soluble tags And enhancement of enzyme solubility by co-expression of molecular chaperones (Rosano et al., Frontiers in Microbiology, Vol. 5, (2014)), deletion of protease, and the like, and combinations thereof may also be used. Since the expression can be flexibly adjusted by the amount of the inducer, the timing of addition, and the like, use of an artificial expression induction system is a preferred embodiment. The method for artificially inducing expression is not particularly limited, and examples thereof include a transcription control type such as lacO, tetO, and T7, and a translation control type represented by a riboswitch. In addition, an autonomous expression induction system (Kim et al., Metabolic Engineering, Vol. 44, 325-336 (2017)) using an intercellular information transmission mechanism (quorum sensing) and low cost using light as an induction signal. It is also possible to use various expression induction methods (Zhao et al., Nature, (2018)) and the like.

  In the present invention, the expression level of the enzyme required for the production of pentamethylenediamine can be evaluated by a technique well known to those skilled in the art, and can be directly evaluated by the production efficiency of pentamethylenediamine described above (FIG. 7). In addition, it is possible to evaluate by the specific activity of the expressed enzyme, SDS-PAGE, immunoprecipitation method and the like. For example, the activity of L-lysine decarboxylase can be quantified by a technique well known to those skilled in the art. Specifically, for example, a cell-free extract contains a substrate (L-lysine), pyridoxal-5-phosphate, It can be easily carried out by adding a reaction buffer or the like (Kou et al., Journal of Molecular Analysis B: Enzymatic, Vol. 133, 88-94 (2016)).

  In the present invention, when the production efficiency of pentamethylenediamine, the production concentration, etc., or the specific activity of the enzyme is close to the maximum in the range of the inducer concentration without host cell growth inhibition, an “optimal expression level” was obtained. Alternatively, it can be determined that “expressed (induced) at a high level”. It is also possible to indirectly evaluate the expression level by introducing a reporter gene such as GFP or LacZ protein. For example, in the case of GFP, when the GFP fluorescence per cell is in the vicinity of the maximum in the concentration range of the inducer that does not inhibit the growth of the host cell, an “optimal expression level” was obtained, or “high level expression” (Fig. 2). However, it is rarely seen that the expression level of the enzyme desired to be expressed does not correlate with that of the reporter protein due to the difference in the expression construct structure and expression efficiency of each enzyme (Oliver et al., Metabolic Engineering, Vol. .22, 76-82 (2014)).

  The optimum expression level specified by these may be replaced with another expression induction system, or may be replaced with a constitutive expression system that is known to realize an expression level equivalent to the optimal expression level. An example of the procedure will be described below, but the genes, expression constructs, and the like used in the present invention are not limited thereto. For example, a method for reproducing the maximum value of the production concentration of pentamethylenediamine obtained by the expression induction system using the constant expression system is as follows. First, the concentration of the inducer added at which the maximum value of the pentamethylenediamine production concentration is obtained is determined. Next, the expression gene is replaced with GFP from the production enzyme of pentamethylenediamine, and the GFP fluorescence intensity (GFP / OD) when induced by the addition of an inducer at the same concentration is quantified, and this is set as the optimum expression level. In the case of replacement with a constant expression system, replacement with the constant expression system is possible by selecting a promoter capable of realizing expression equivalent to the optimal expression level or modifying an existing promoter. That is, in the present invention, the expression of an enzyme essential for realizing high production efficiency is not limited to expression induction. Examples of constitutive expression systems include methanol dehydrogenase promoter, methane monooxygenase promoter, ribosomal protein promoter, hexulose-6-phosphate synthase promoter, phosphohexulose isomerase promoter, glyceraldehyde-6, depending on the expression level desired to be achieved. -One or two of phosphate dehydrogenase promoter, rhaBAD promoter, araBAD promoter, tet promoter, trc promoter, tac promoter, trp promoter, lac promoter, lacUV5 promoter, phoA promoter, T7 promoter, lambda phage PR promoter, PL promoter, etc. It can be selected as a combination of more than species. However, when a gene desired to be expressed by the constitutive expression system competes with the growth of the host cell or has toxicity, a transformant may not be obtained by constantly maintaining the optimal expression level.

  The riboswitch used in one preferred embodiment of the expression induction of the present invention refers to RNA that selectively binds to a specific low molecular weight compound, and this low molecular weight compound is called a ligand. In the absence of a ligand, it forms a secondary structure with RNA base pairs and affects nucleic acids around the riboswitch. In particular, when a ribosome binding site is included downstream of the riboswitch, the translation of the mRNA of the gene located further downstream is prevented by preventing the ribosome from approaching the ribosome binding site. On the other hand, in the presence of the ligand, the ribosome can approach the ribosome binding site through the elimination of the secondary structure accompanying the ligand binding. Therefore, the gene mRNA is translated only when the ligand is added, and the expression of the target gene is induced.

  The “ligand” in the present invention is not particularly limited. It only needs to be able to eliminate the secondary structure of the riboswitch in the absence of the ligand, and one or any of naturally occurring, modified, artificially modified ones can be selected. .

The riboswitch in the present invention is not particularly limited, and may be RNA that causes a secondary structure change upon ligand binding. For example, theophylline responsive riboswitch, adenosylcobalamin responsive riboswitch, cyclic di GMP responsive riboswitch, flavin mononucleotide responsive riboswitch, glucosamine-6-phosphate responsive riboswitch, glutamine responsive riboswitch, Glycine responsive riboswitch, lysine responsive riboswitch, preQ ₁ responsive riboswitch, purine responsive riboswitch, S-adenosylhomocysteine responsive riboswitch, S-adenosylmethionine responsive riboswitch, S-adenosyl Homocysteine & S-adenosylmethionine responsive riboswitch, tetrahydrofolate responsive riboswitch, thiamine pyrophosphate responsive riboswitch, molybdenum responsive riboswitch, adenine responsive riboswitch It is not limited to. Riboswitches may be any of those already known to exist in nature, newly isolated from nature, artificially designed, or a combination of one or more .

The riboswitch in the present invention is preferably a theophylline-responsive riboswitch. The theophylline-responsive riboswitch is not particularly limited as long as the RNA secondary structure in the absence of theophylline is eliminated by theophylline binding. For example, 5'-GGTACC GGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACC CTGCTAAGGAGGCAACAAG-3 '( SEQ ID NO: 1), 5'-GGTACC GGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACC CTGAGAAGGGGCAACAAG-3' ( SEQ ID NO: 2), 5'-GGTACC GGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACC CGCTGCGCAGGGGGTATCAACAAG-3 '( SEQ ID NO: 3), 5'-GGTACCTGATAAGATAGG GGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACC AAGGGACAACAAG-3 ' ( SEQ ID NO: 4), 5'-GGTACC G TGATACCAGCATCGTCTTGATGCCCTTGGCAGCACC CTGCTAAGGTAACAACAAG-3 '(SEQ ID NO: 5), 5'-GGTACC GGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACC CTGCTAAGGAGGTAACAACAAG-3' ( SEQ ID NO: 6) include those having a sequence such as, but not limited to. More preferably, it has the sequence of 5′-GGTACC GGTGATACCCAGCATCGTCTTGATGCCCTTGGCAGCACC CTGCTAAGGAGGCAACAAAG-3 ′ (SEQ ID NO: 1).

  The theophylline as a ligand may be a derivative of theophylline. The concentration of theophylline or a derivative thereof added to the culture of the transformant of the present invention as a ligand is preferably 0.1 to 10 mM, but is not limited thereto.

  The riboswitch in the present invention is located downstream of a natural or artificial promoter, and is thereby operably linked to the promoter. The promoter is a DNA located upstream of the expressed gene, and includes a promoter sequence that attracts the RNA polymerase of the host microorganism to the template DNA.

  The promoter in the present invention is not particularly limited as long as it operates in methane-utilizing bacteria. Therefore, the nucleic acid is not limited to a nucleic acid derived from a methane-utilizing bacterium, but may be a naturally occurring nucleic acid or an artificially designed and modified one. For example, methanol dehydrogenase promoter, methane monooxygenase promoter, ribosomal protein promoter, hexulose-6-phosphate synthase promoter, phosphohexulose isomerase promoter, glyceraldehyde-6-phosphate dehydrogenase promoter, rhaBAD promoter, araBAD promoter, tet promoter , Trc promoter, tac promoter, trp promoter, lac promoter, lacUV5 promoter, phoA promoter, T7 promoter, lambda phage PR promoter, PL promoter and the like. Further, as the promoter of the present invention, either homeostasis or inducibility can be selected according to the expression level property to be achieved, and one or a plurality of them can be combined. An example of a preferred promoter in the present invention is a trc promoter.

  The nucleic acid in the present invention includes a ribosome binding sequence. The ribosome binding sequence is a nucleic acid generally having a length of 4 to 10 bases, and is necessary for binding ribosome and mRNA to initiate translation. Although it has a feature rich in adenine or guanine, it is not particularly limited as long as it is operable in a methane-utilizing bacterium. Therefore, the ribosome binding sequence of the present invention may be a naturally occurring sequence or an artificially designed sequence, and a suitable one can be selected according to the performance and purpose to be achieved. For example, as shown in Non-Patent Document 3, it can be arbitrarily designed according to the gene expression level desired to be achieved. Preferred examples of the ribosome binding sequence of the present invention include sequences having 5'-AAGGAGGG-3 '. These ribosome binding sequences are typically placed downstream of the riboswitch of the present invention and thereby operably linked to the riboswitch. Accordingly, a preferred embodiment of the present invention is a nucleic acid in which the riboswitch is located downstream of a natural or artificial promoter and the ribosome binding sequence is located downstream of the riboswitch.

  In the present invention, “operably linked” includes both cases where both sequences are directly linked and cases where they are linked via an appropriate number of bases. For example, an extra sequence found in the vicinity of a known promoter and a spacer composed of an appropriate number of bases may exist between the promoter and the riboswitch. Further, the ribosome binding sequence and the riboswitch may be linked via a spacer composed of an appropriate number of bases. The length of the spacer can typically be 1-20 bases, preferably 5-10 bases.

  The transformant in the present invention includes a nucleic acid encoding RNA that enables gene expression induction in a methane-utilizing bacterium. Such a nucleic acid of the present invention can be integrated on a vector or a chromosome. When there are two or more nucleic acids to be integrated, all of them may be integrated into the vector or may be integrated into the chromosome, or some of them may be integrated into the vector and others may be integrated into the chromosome.

  When the nucleic acid according to the present invention is contained in a vector, the vector is not particularly limited. For example, an origin of replication that enables autonomous replication in a methane-utilizing bacterial cell, a selection marker, and an origin of conjugation transmission Can be included. Introduction of the vector into the cell can be performed by means known to those skilled in the art. For example, a junction transfer method, an electroporation method, etc. can be mentioned (Kim et al., Applied Biochemistry and Biotechnology, Vol. 73, 81-88 (1998)).

  It is also a preferred embodiment that the nucleic acid in the present invention is integrated into the chromosome of a methane-utilizing bacterium that is a host cell. Such incorporation can also be done by means known to those skilled in the art. For example, Csaki et al. , Microbiology, Vol. 149, 1785-1795 (2003).

The methane-utilizing bacteria in the present invention may be those already isolated and preserved, newly separated from nature, genetically modified, Escherichia coli and yeast modified to metabolize methane, and methanol assimilation Any non-methane-utilizing bacterium such as a genus bacterium can be arbitrarily selected. The methane-assimilating bacterium in the present invention is not particularly limited, and for example, methyl acid phyllum, methylocella, methylotenera, methylophaga, methylomethas, and methyromathas. Methylococcus, Methylosinus, Methylocytis, Methylomicrobium, Methylotherm, Methylumum, Methylomynum , Methanococcus, Methanothermobacter, Methanomonas, Methanosalucina, Methanogenium, Methanogenium, Methanogenium, Methanogenium, Methanogenium, Methanogenium ), Metanokokkoido (Methanococcoides), Metanosaeta (Methanosaeta), Metanorobasu (Methanolobus), can be selected from Methylobacterium (Methylobacterium) microorganisms belonging to such, more preferably, Me hylococcus capsulatus is a Bath (NCIMB 11132).

  The transformant of the present invention can be cultured by a known culture method suitable for host cell growth. For example, the medium used in the present invention may be either a natural medium or a synthetic medium as long as it contains methane as a carbon source and further contains a nitrogen source, inorganic ions, and other organic trace components as required. The culture can be selected from aerobic or anaerobic, and can be selected according to the purpose such as shaking culture, stationary culture or aeration and agitation culture.

  For example, when shaking or stationary culture is performed in a closed system, 1 to 75% of methane gas is added to the gas phase in contact with the medium. When aeration culture is performed in an open system, a mixed gas containing 1 to 75% of methane gas is blown. In any of the above examples, a gas such as oxygen, carbon dioxide, or nitrogen can be added as necessary. Methanol may be used as an alternative / additional carbon source for methane, and 0.01-5% methanol is added to the medium.

  As the nitrogen source, potassium nitrate, sodium nitrate, nitric acid, ammonia gas, aqueous ammonia, ammonium chloride, ammonium sulfate, ammonium nitrate, ammonium acetate, ammonium phosphate, urea, etc. are added to the 0.01-10% medium for use. Besides these, potassium phosphate, sodium phosphate, magnesium sulfate, calcium chloride, iron-EDTA, sodium molybdate, sodium carbonate, sodium bicarbonate, copper sulfate, copper chloride, iron sulfate, zinc sulfate, manganese chloride Components such as cobalt chloride, nickel chloride, and boric acid can be added in small amounts. When the microorganism species to be cultured is heterotrophic, 0.01 to 10% of a sugar source such as glucose or xylose, or a carbon source such as glycerol, acetic acid or succinic acid may be added.

  The expression induction of the target gene using the expression induction system by the riboswitch of the present invention can be achieved by bringing the riboswitch ligand into contact with the transformant as described above. A method can be selected in which a ligand is artificially supplied from the outside at an arbitrary timing when gene expression induction is desired, or is supplied autonomously by a host cell. The latter can be achieved, for example, by selecting a metabolite that accumulates in growing cells as a ligand (Zhou et al., ACS Synthetic biology, Vol. 4, 1335-1340 (2015)). It is also possible to supply the ligand autonomously by introducing a gene necessary for the biosynthesis of the ligand into the host cell.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.

  The composition of the medium used in each example is as follows.

(LB medium)
The composition is as follows: 20 g / L LB medium, Lennox (Difco).
[Steam sterilization was performed at 120 ° C. for 20 minutes. If necessary, a final concentration of 50 mg / L kanamycin sulfate, 1.5% Bacto agar (Difco) was added. ]

(NMS medium)
The composition is as follows: 0.8 mM MgSO ₄ .7H ₂ O, 10 mM NaNO ₃ , 0.14 mM CaCl ₂ , 1.2 mM NaHCO ₃ , 2.35 mM KH ₂ PO ₄ , 3.4 mM K ₂ HPO ₄ , 20.7 μM Na ₂ MoO ₄ .2H ₂ O, 1 μM CuSO ₄ .5H ₂ O, 10 μM Fe ^III -Na-EDTA, 1 mL trace metal solution (500 mg / L FeSO ₄ .7H ₂ O, 400 mg / L ZnSO ₄ .7H ₂ O, 20 mg / L MnCl ₂ .7H ₂ O, 50 mg / L CoCl ₂ .6H ₂ O, 10 mg / L NiCl ₂ .6H ₂ O, 15 mg / L H ₃ BO ₃ , 250 mg / L EDTA)
[7.5-10 mg / L kanamycin sulfate, 25 mg / L nalidixic acid, 1.5% Bacto agar were also added as needed. Further, Phosphate, bicarbonate, CuSO ₄ .5H ₂ O, Fe ^III -Na-EDTA, and NaHCO ₃ were added after steam sterilization at 120 ° C. for 20 minutes. ]

[Example 1] Regulation and maximization of gene expression level in a mycococcus capsule bath using GFP as an index

(Plasmid construction)
Phusion polymerase (manufactured by New England BioLabs) was used for PCR amplification of nucleic acid fragments necessary for plasmid construction. In-Fusion HD Cloning kit (Clontech) was used for plasmid construction. Pmk61A was constructed by cloning a hybrid of riboswitch and trc promoter (Ptrc E *) and sfGFP gene into pBHR1 (manufactured by MoBiTec), which is a broad host vector. Ptrc E * and sfGFP were synthesized by Genscript. First, the Ptrc E * fragment was amplified with mk316 and mk173R. Next, the sfGFP fragment was amplified with mk176 and mk317R. Finally, the vector backbone was amplified with mk318 and mk319R. These three fragments were ligated by the In-Fusion HD Cloning kit and E. coli having pmk61A . A clone of E. coli XL1-Blue (manufactured by Nippon Gene) was obtained. After extracting and purifying the plasmid DNA from the cells, it was confirmed by sequencing that pmk61A was obtained correctly. FIG. 1 shows an outline of pmk61A. Moreover, the said arrangement | sequence is shown below.

(Introduction of pmk61A to Methylococcus capsulatus Bath)
pmk61A was introduced into Methylococcus capsulatus Bath by a transformation method using conjugative transmission reported by Ali et al. (Ali et al., Microbiology, Vol. 152, 2931-2942 (2009)).

First, pmk61A was conjugated to E. coli which is a conjugative transfer donor by electroporation . and introduced into E. coli S17-1. Transformants were selected using growth on an LB agar medium containing 50 mg / L kanamycin as an indicator, and the sequence of the plasmid was confirmed by sequence analysis. Transformant colonies were suspended in LB medium containing 50 mg / L kanamycin and cultured overnight at 37 ° C. with shaking. 500 μL of the overnight culture was inoculated into 25 mL of LB medium containing 50 mg / L kanamycin, and cultured with shaking at 37 ° C. until the OD ₆₀₀ was around 0.5. The cultured cells were collected by centrifugation, washed 3 times with fresh NMS medium, and suspended in 1 mL of the same medium.

Simultaneously with the culture of S17-1, a mycococcus capsulatus Bath wild strain (NCIMB 11132), a recipient of conjugative transmission, was inoculated into a 130 mL serum bottle containing 10 mL of fresh NMS medium. The bottle was sealed with a butyl rubber septum, and 60 mL of the bottle air was replaced with the same volume of 10% methane / 90% nitrogen mixed gas. The bottle was incubated at 43 ° C. for 18 hours. The cultured cells were collected by centrifugation and suspended in 5 mL of fresh NMS medium.

The mixture was mixed so that the product of OD ₆₀₀ and volume was 1: 5 with S17-1 and Methylococcus capsules Bath, and then filtered through a 0.22 μm nitrocellulose membrane (Millipore). This was placed on an NMS agar medium containing 0.02% proteosepeptone (Difco) and incubated at 37 ° C. for 24 hours in a 5% methane atmosphere. The cells on the membrane were washed away with 10 mL of fresh NMS medium, and the cells were collected by centrifugation, and then resuspended in 200 μL of the same medium. This was applied to an NMS agar medium containing 7.5 mg / L kanamycin and 25 mg / L nalidixic acid and incubated in a 5% methane atmosphere at 45 ° C. until colonies appeared. The obtained clone was confirmed by PCR for the presence of the plasmid.

(Regulation and maximization of gene expression level in the mycococcus capsule bath using GFP as an index)
Transformant colonies were inoculated into 130 mL serum bottles containing 10 mL of NMS medium supplemented with 10 mg / L kanamycin and either 0, 0.1, 2, 5, 7.5, or 10 mM theophylline. . As a control, the wild strain was inoculated into the same medium containing no theophylline. The bottle was sealed with a butyl rubber septum, and 60 mL of the bottle air was replaced with the same volume of 10% methane / 90% nitrogen mixed gas. The bottles were incubated for 24 hours at 43 ° C. The culture solution was diluted 10-fold with a fresh NMS medium, and the fluorescence intensity (Ex: 488 nm, Em: 530 nm) was measured with a fluorescence plate reader (infinite200Pro, Tecan). The fluorescence intensity value was divided by the respective OD ₆₀₀ and then subtracted from that in the wild strain (blank). The results are shown in FIG. Fluorescence at the time of non-induction was not detected, and favorable expression induction was shown depending on theophylline concentration, indicating that the system was optimal for adjusting the expression level (FIG. 2).

[Example 2] and [Comparative Example 1] Expression of L-lysine decarboxylase in the mycococcus capsule bus

(Plasmid construction)
Pmk96 and pmk99 were constructed by cloning the cadA gene encoding L-lysine decarboxylase into pmk61A (FIG. 3). Based on the report of Kou et al., CadA derived from Alivivrio salmonicida was synthesized by Genscript (Kou et al., Journal of Molecular Catalysis B: Enzymatic, Vol. 13). Furthermore, in order to select an optimal L-lysine decarboxylase expressed in methane-utilizing bacteria, the cadA gene encoding the L-lysine decarboxylase of Escherichia coli and Klebsiella pneumoniae was cloned into pmk61A. pmk127 and pmk167 were constructed (FIG. 3).

For construction of pmk96, the cadA gene region was PCR amplified with mk412 and mk413R. Next, the vector backbone excluding the riboswitch region was amplified with mk414 and mk415R. These fragments were ligated with an In-Fusion HD Cloning kit and E. coli having pmk96 . A clone of E. coli XL1-Blue was obtained. After extracting plasmid DNA by a conventional method, it was confirmed by sequencing that pmk96 was obtained correctly. FIG. 3 shows an outline of pmk96.

For the construction of pmk99, the cadA gene region was PCR amplified with mk425 and mk426R and the vector backbone was PCR amplified with mk427 and mk428R. These fragments were ligated by the In-Fusion HD Cloning kit and E. coli having pmk99 . A clone of E. coli XL1-Blue was obtained. After extracting plasmid DNA by a conventional method, it was confirmed by sequencing that pmk99 was correctly obtained. FIG. 3 shows an outline of pmk99.

For the construction of pmk127, the cadA (E.c) gene region was PCR amplified with mk478 and mk479R using the cadA gene fragment synthesized by Genewiz as a template. The vector backbone was then amplified with mk465 and mk466R. These fragments were ligated by the In-Fusion HD Cloning kit and E. coli having pmk127 . A clone of E. coli XL1-Blue was obtained. After extracting plasmid DNA by a conventional method, it was confirmed by sequencing that pmk127 was correctly obtained. FIG. 3 shows an outline of pmk127.

For the construction of pmk167, the cadA (Kp) gene region was PCR amplified by mk567 and mk568R using the genomic DNA of Klebsiella pneumoniae MGH78578 as a template. Next, the vector backbone was PCR amplified with mk465 and mk466R using pmk61A as a template. These fragments were ligated by the In-Fusion HD Cloning kit and E. coli having pmk167 . A clone of E. coli XL1-Blue was obtained. After extracting plasmid DNA by a conventional method, it was confirmed by sequencing that pmk167 was correctly obtained. FIG. 3 shows an outline of pmk167. Moreover, the said arrangement | sequence is shown below.

(Introduction of pmk96, pmk99, pmk127, and pmk167 into Methylococcus capsulatus Bath)
In the same manner as described in Example 1 was tried respectively by conjugal transfer the introduction into Methylococcus capsulatus Bath of Pmk96,99,127, and 167. When colonies were obtained, the presence of the plasmid was confirmed by PCR.

  As a result of the transformation, no pmk96 transformant was obtained, but many colonies of pmk99, pmk127, and pmk167 transformants were obtained. This result means that the expression of the L-lysine decarboxylase gene competing with the growth of the methane-utilizing bacterium was suppressed to an extremely low level by the expression control system.

(Production of pentamethylene diamine by Methylococcus capsulatus Bath expressing various L-lysine decarboxylase)
Transformant colonies with confirmed introduction of pmk99, pmk127, and pmk167 into OD600 = 0.2 into 130 mL serum bottles containing 10 mL of NMS medium containing 10 mg / L kanamycin and 5 mM theophylline. Inoculated. The bottle was sealed with a butyl rubber septum, and 60 mL of the bottle air was replaced with the same volume of 10% methane / 90% nitrogen mixed gas. The bottle is shake-cultured at 43 ° C., and 1 mL of the culture solution is collected every 24 hours and used for the determination of pentamethylenediamine concentration and OD600, and the air in the bottle is the same volume of 10% methane / 90% as above. The culture was continued by exchanging with a mixed gas of nitrogen. OD600 was measured by NanoDrop 2000c (manufactured by Thermo Fisher Scientific) for absorbance at 600 nm under the condition of an optical path length of 10 mm using NMS medium as a blank. For quantification of the pentamethylenediamine concentration, a supernatant obtained by centrifuging the collected culture was diluted 4-fold with 8 mM methanesulfonic acid (MSA). This diluted solution was analyzed in a cation mode using a DIONEX ICS-3000 equipped with a Dionex IonPac CS19 (inner diameter 2 mm, length 250 mm) column. Analysis was performed by gradient elution using a flow rate of 0.35 mL / min, a column thermostat at 30 ° C., a detector current of 72 mA, and 8 mM MSA and 70 mM MSA as mobile phases. The pentamethylenediamine concentration was determined by an absolute quantitative method. The results are shown in FIGS. When cadA derived from any microbial species was expressed, both cell growth and pentamethylenediamine production were equivalent, and 29-35 mg / L was produced in 48 hours (FIGS. 4a and b). Moreover, when the wild strain of Methylococcus capsulatus Bath was cultured under the same conditions, the pentamethylenediamine concentration was below the lower limit of detection. That is, it has been clarified that the mycococcus capsulatus Bath does not inherently have the ability to produce pentamethylenediamine, and expression of L-lysine decarboxylase results in increased production of pentamethylenediamine.

[Example 3] Expression of L-lysine biosynthetic enzyme in Methylococcus capsulatus Bath introduced with L-lysine decarboxylase

(Plasmid construction)
Pmk141 and pmk142 were constructed by cloning the genes of aspartate kinase mutant (lysC ^T352I ) and dihydrodipicolinate synthase mutant (dapA ^E84T ) desensitized to feedback inhibition into pmk99 and pmk127 (FIG. 3).

First, prior to the construction of pmk141 and pmk142, lysC ^T352I and dapA ^E84T were cloned into pmk61A, whereby each gene was transferred to a riboswitch (FIG. 3, “Ptrc E *”) and a terminator (FIG. 3, “T1”). Connected. Thereafter, this ligated fragment was ligated with pmk99 and pmk127 to complete pmk141 and pmk142.

The lysC ^T352I gene region was PCR amplified by mk472 and mk473R using the lysC ^T352I gene fragment synthesized by ^Genewiz as a template. Next, the vector backbone was PCR amplified with mk465 and mk466R using pmk61A as a template. These fragments were ligated with an In-Fusion HD Cloning kit . A clone of E. coli XL1-Blue was obtained. Similarly, the dapA ^E84T gene region was PCR amplified by mk474 and mk475R using the dapA ^E84T gene fragment synthesized by ^Genewiz as a template. Next, the vector backbone was PCR amplified with mk465 and mk466R using pmk61A as a template. These fragments were ligated with an In-Fusion HD Cloning kit . A clone of E. coli XL1-Blue was obtained.

After each plasmid DNA was extracted by a conventional method, a ligated fragment consisting of Ptrc E *, lysC ^T352I and T1 was PCR amplified with mk515 and mk516R, and a ligated fragment consisting of Ptrc E *, dapA ^E84T and T1 was PCR with mk517 and mk518R. Amplified. Next, the vector backbone containing the ligated fragment consisting of Ptrc E *, cadA and T1 was PCR amplified by mk519 and mk520R using pmk99 and pmk127 as templates, respectively. These fragments were ligated by the In-Fusion HD Cloning kit and E. coli having pmk141 and pmk142 . A clone of E. coli XL1-Blue was obtained. After extracting plasmid DNA by a conventional method, it was confirmed by sequencing that pmk141 and pmk142 were obtained correctly. FIG. 3 shows an outline of pmk141 and pmk142. Moreover, the said arrangement | sequence is shown below.

(Production of pentamethylenediamine by Methylococcus capsulatus Bath transformants introduced with pmk127 and 142)
Transformant colonies obtained by introducing pmk127 and pmk142 in the same manner as in Example 1 were transferred to a 130 mL serum bottle containing 10 mL of NMS medium containing 10 mg / L kanamycin and 5 mM theophylline. Inoculated to 0.2. The bottle was sealed with a butyl rubber septum, and 60 mL of the bottle air was replaced with the same volume of 10% methane / 90% nitrogen mixed gas. The bottles were incubated at 43 ° C with shaking. Collect 1 mL of culture solution every 24 hours, use it for the determination of pentamethylenediamine concentration and OD600, and replace the air in the bottle with the same volume of 10% methane / 90% nitrogen mixed gas as above. Continued. OD600 was measured by NanoDrop 2000c (manufactured by Thermo Fisher Scientific) for absorbance at 600 nm under the condition of an optical path length of 10 mm using NMS medium as a blank. For quantification of the pentamethylenediamine concentration, a supernatant obtained by centrifuging the collected culture was diluted 4-fold with 8 mM methanesulfonic acid (MSA). This diluted solution was analyzed in a cation mode using a DIONEX ICS-3000 equipped with a Dionex IonPac CS19 (inner diameter 2 mm, length 250 mm) column. Analysis was performed by gradient elution using a flow rate of 0.35 mL / min, a column thermostat at 30 ° C., a detector current of 72 mA, and 8 mM MSA and 70 mM MSA as mobile phases. The pentamethylenediamine concentration was determined by an absolute quantitative method. The results are shown in FIGS. With the expression of aspartate kinase and dihydrodipicolinate synthase, the production concentration of pentamethylenediamine was not improved, but the cell proliferation was significantly reduced (FIGS. 5a and b). The production efficiency showed about a 2-fold improvement from 52 mg / L / OD to 103 mg / L / OD. That is, it became clear that the production efficiency of pentamethylenediamine from methane can be remarkably improved by the expression of L-lysine biosynthetic enzymes (aspartate kinase and dihydrodipicolinate synthase).

(Production of pentamethylene diamine by a Mylococcus capsulatus Bath transformant introduced with pmk141 and pmk142)
Transformant colonies obtained by introducing pmk141 and pmk142 were inoculated into a 130 mL serum bottle containing 10 mL of NMS medium containing 10 mg / L kanamycin so that OD600 = 0.15. The bottle was sealed with a butyl rubber septum, and 60 mL of the bottle air was replaced with the same volume of 10% methane / 90% nitrogen mixed gas. After 6 hours of shaking culture at 37 ° C., expression was induced by adding 5 mM theophylline. Thereafter, 1 mL of the culture solution is collected every 24 hours and used to determine the concentration of pentamethylenediamine and OD600, and the air in the bottle is replaced with the same volume of 10% methane / 90% nitrogen mixed gas as above. The culture was continued at OD600 was measured by NanoDrop 2000c (manufactured by Thermo Fisher Scientific) for absorbance at 600 nm under the condition of an optical path length of 10 mm using NMS medium as a blank. For quantification of the pentamethylenediamine concentration, a supernatant obtained by centrifuging the collected culture was diluted 4-fold with 8 mM methanesulfonic acid (MSA). This diluted solution was analyzed in a cation mode using a DIONEX ICS-3000 equipped with a Dionex IonPac CS19 (inner diameter 2 mm, length 250 mm) column. Analysis was performed by gradient elution using a flow rate of 0.35 mL / min, a column thermostat at 30 ° C., a detector current of 72 mA, and 8 mM MSA and 70 mM MSA as mobile phases. The pentamethylenediamine concentration was determined by an absolute quantitative method. The results are shown in FIGS. Both the pmk141 and pmk142 plasmid transformants showed high production efficiency of 73 mg / L / OD and 96 mg / L / OD, and the pmk141 transformant produced as much as 124 mg / L of pentamethylenediamine. (Figure 6b). The production efficiency obtained here has an unprecedented level in biological material production from methane (FIG. 6c).

[Example 4] Expression weight controlling and optimizing enzymes for pentamethylenediamine produced in Methylococcus capsulatus Bath was introduced pmk142

(Pentamethylenediamine production by Methylococcus capsulatus Bath introduced with pmk142 under various theophylline addition concentration conditions)
Transformant colonies obtained by introducing pmk142 by the same method as in Example 3 are put into a 130 mL serum bottle containing 10 mL of NMS medium containing 10 mg / L kanamycin so that OD600 = 0.15. Inoculated. The bottle was sealed with a butyl rubber septum, and 60 mL of the bottle air was replaced with the same volume of 10% methane / 90% nitrogen mixed gas. After shaking culture at 37 ° C. for 6 hours, expression induction was performed by adding 0, 0.5, 2, 5, 7.5 mM theophylline. Thereafter, 1 mL of the culture solution is collected every 24 hours and used to determine the concentration of pentamethylenediamine and OD600, and the air in the bottle is replaced with the same volume of 10% methane / 90% nitrogen mixed gas as above. The culture was continued at OD600 was measured by NanoDrop 2000c (manufactured by Thermo Fisher Scientific) for absorbance at 600 nm under the condition of an optical path length of 10 mm using NMS medium as a blank. The quantification of the pentamethylenediamine concentration was carried out in the same manner as in Example 3. The results are shown in FIG. Pentamethylenediamine was not detected when 0.5 mM theophylline was added, but the production concentration of pentamethylenediamine increased from 2 mM depending on theophylline concentration. In addition, when 5 mM or more of theophylline was added, production efficiency was unprecedented in the past. In other words, it was shown that it is essential to adjust and optimize the enzyme required for pentamethylenediamine production so that it can be expressed at a high level in order to obtain high production efficiency.
[Example 5] Production of pentamethylenediamine by Methylococcus capsules Bath in aeration and agitation culture Cultivation by continuous aeration and agitation of methane gas was performed using a 1 L microorganism culture apparatus BMJ-01P1 (manufactured by Able Co., Ltd.). A pentamethylenediamine producing strain ( Methylococcus capsulatus Bath into which pmk142 plasmid was introduced) cultured in 500 mL of NMS1.0 medium containing 10 mg / L kanamycin in the same manner as in Example 3 and Example 4 was OD600 = 0. The suspension was suspended to obtain a culture start time. The culture temperature was 43 ° C., the stirring speed was 750 rpm, and a mixed gas (5% methane, 45% nitrogen, 50% air) was blown at 200 ml / min. The pH of the culture solution was adjusted each time with 1N nitric acid so as to maintain pH 7.0 at all times. 16 hours after the start of culture, the 50 ml medium was removed, and 50 ml of NMS medium containing 46 mM theophylline was added to initiate induction. Further, 20 hours after the start of the culture, 50 mg of an antifoaming agent ADEKA NOL LG-109 (ADEKA) was added during the culture. The exhaust gas is analyzed by gas chromatography (GC-2014T; manufactured by Shimadzu Corporation) having a TCD detector with SHINCARBON ST (manufactured by Shinwa Chemical Co., Ltd.) as a separation column, and monitoring of methane consumption and oxygen consumption Went.
1 ml was sampled at a predetermined time, and OD600 measurement and pentamethylenediamine concentration determination were carried out in the same manner as in Example 3 and Example 4. At 41 hours after the start of the culture, 25 ml of the medium was removed, and 25 ml of NMS medium concentrated 20 times was added as an additional component.
The results are shown in FIG. When cultivated for 64 hours, 91 mg / L / OD and a high production efficiency equivalent to the result shown in Example 3 were shown, and a high production of 182 mg / L pentamethylenediamine was observed. It was shown that it could be realized.

(Deposit of plasmid)
The plasmid pmk61A described herein is the deposit number NITE P-02625, the plasmid pmk96 is the deposit number NITE P-02626, and the plasmid pmk99 is the deposit number NITE P-02627. On February 1, 2018.

  Since the present invention enables efficient production of pentamethylenediamine, it can be used in the production of the substance and industries that use the substance as a raw material (for example, a resin raw material).

Claims (14)

  Recombinant methane-utilizing bacterium containing a gene encoding an enzyme for producing pentamethylenediamine, which is compared to a methane-utilizing bacterium that lacks the enzyme by inducing expression of the enzyme And a recombinant methane-utilizing bacterium characterized by causing an increase in production of pentamethylenediamine.   The methane-utilizing bacterium according to claim 1, wherein expression of the enzyme is induced by addition of an inducer.   The methane-assimilating bacterium according to claim 1 or 2, wherein expression of the enzyme is induced by addition of theophylline.   The methane-assimilating bacterium according to any one of claims 1 to 3, wherein the enzyme for producing pentamethylenediamine is L-lysine decarboxylase. The L- lysine decarboxylase is characterized in that it CadA and Ldc of Escherichia coli, Aliivibrio salmonicida of CadA, and any one or more selected from the group consisting of CadA of Klebsiella pneumoniae, according to claim 4 Methane-utilizing bacteria.   The enzymes for producing pentamethylenediamine are aspartate kinase (LysC), dihydrodipicolinate synthase (DapA), meso-diaminopimelate dehydrogenase (DDH), diaminopimelate decarboxylase (LysA), glyceraldehyde Any one selected from the group consisting of -3-phosphate dehydrogenase (GAPDH), transhydrogenase, aspartate aminotransferase (AspC), phosphoenolpyruvate carboxylase (PEPC), and pyruvate carboxylase (PYC) The methane-utilizing bacterium according to any one of claims 1 to 5, which is one or more species.   The methane-assimilating bacterium according to claim 6, wherein the LysC, DapA, PEPC, and PYC are mutant enzymes in which feedback inhibition is released.   The methane-assimilating bacterium according to claim 6, wherein the GAPDH is NADPH-dependent.   The methane-assimilating bacterium according to claim 8, wherein the GAPDH is a mutant enzyme having an improved affinity for NADPH compared to a corresponding wild-type enzyme.   The methane-utilizing bacterium according to any one of claims 1 to 9, wherein at least one of the genes encoding the enzyme is integrated on a chromosome of a host microorganism.   The methane-utilizing bacterium according to any one of claims 1 to 9, wherein at least one of genes encoding the enzyme is introduced into a host microorganism as a vector containing the gene.   The host microorganisms are Methylomonas, Methylobacter, Methylococcus, Methylocinus, Methylocyst, Methylophilus, Methylophilus, Methylophilus The methane-utilizing bacterium according to any one of claims 1 to 11, which is selected from the group. Wherein the host microorganism is characterized in that it is a Methylococcus capsulatus Bath (NCIMB 11132), methane-utilizing bacteria of claim 12.   A pentamethylene diamine is produced by bringing methane into contact with the methane-assimilating bacterium according to any one of claims 1 to 13 and culturing under conditions suitable for the growth of the microorganism. Production method of diamine.

Images