JP2019178115A - Vanadium species binding material and use thereof - Google Patents

Abstract

To provide a material that binds to metal vanadium and vanadium ions using peptides and a method for using the same.SOLUTION: A screening method for the peptides includes the steps of preparing one or more peptides in which one or more and eight or less of following amino acid sequence: VSVTGVEGG are substituted with other amino acids; and evaluating the binding properties of the one or more peptides to vanadium species.SELECTED DRAWING: None

Description

  The present specification relates to vanadium species binding materials and uses thereof.

  Vanadium has been conventionally used as an additive for steel for improving heat resistance and tensile strength, and as an exhaust gas removal catalyst. In recent years, the use of additives for artificial fuel cells and implants for improving the performance of fuel cells has attracted attention. It is also known in the living body as an important metal involved in enzyme activation and redox reaction.

  As a technique for separating and recovering such vanadium, for example, a method using an ion exchange resin is known (Patent Documents 1 and 2). Moreover, the method of using a specific hydroxy oxime compound as an extractant is known (patent document 3).

JP 2002-256354 A JP 2002-346559 A JP-A-7-292425

  Such a conventional method is a combination of a resin using an ion exchange resin and vanadium ions, or solution extraction with a specific compound, and the separation operation is not easy. In addition, if the labeling of vanadium compounds and the construction of vanadium-containing nanomaterials are realized, various new materials that take advantage of their usefulness will be developed. However, to date, no peptide has been provided that binds to, complexes, or mineralizes vanadium ions with vanadium compounds such as vanadium ions and metal vanadium.

  The present specification provides materials that bind to metal vanadium and vanadium ions and uses thereof.

  The present inventors constructed a random peptide library and screened the peptide library for peptides that bind to metal vanadium. As a result, certain peptides interacted and bound to metal vanadium to form a complex. I got the knowledge to do. Further examination of this type of peptide has also revealed that vanadium ions are mineralized into vanadium-containing minerals. Based on these findings, the present specification provides the following means.

[1] The following amino acid sequence;
V X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ G G (SEQ ID NO: 8)
V X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ AG (SEQ ID NO: 9)
V X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ LG (SEQ ID NO: 10)
_{V X 1 X 2 X 3 X} 4 X 5 X 6 G P ( SEQ ID NO: 11)
(However,
X ₁ represents any one selected from serine (S), proline (P), leucine (L), and threonine (T),
X ₂ represents any one selected from valine (V), leucine (L) and glycine (G);
X ₃ represents any one selected from threonine (T), proline (P), lysine (K) and serine (S);
X ₄ represents any one selected from glycine (G) and arginine (R),
X ₅ represents any one selected from any amino acid,
X ₆ represents any selected from any amino acid. )
A peptide having one or more peptide chains consisting of an amino acid sequence selected from the above, and having a binding property to a vanadium species.
[2] X ₅ represents any one selected from valine (V), glutamic acid (D) and isoleucine (I),
Represents any selected from any amino acid,
X ₆ represents any one selected from glutamic acid (D), aspartic acid (E), lysine (K), alanine (A) and glycine (G).
The peptide according to [1].
[3] The following amino acid sequences;
VX ₁ VX ₃ X ₄ X ₅ X ₆ GG (SEQ ID NO: 12)
VX ₁ VX ₃ X ₄ X ₅ X ₆ AG (SEQ ID NO: 13)
(However,
X ₁ represents any one selected from serine (S), leucine (L), and threonine (T),
X ₃ represents any one selected from threonine (T) and serine (S);
X ₄ represents any one selected from glycine (G) and arginine (R),
X ₅ represents any one selected from any amino acid,
X ₆ represents any selected from any amino acid. )
A peptide having one or more peptide chains consisting of an amino acid sequence selected from the above, and having a binding property to a vanadium species.
[4] The following amino acid sequences;
V P X ₂ X ₃ G X ₅ X ₆ LG (SEQ ID NO: 14)
V P X ₂ X ₃ G X ₅ X ₆ GP (SEQ ID NO: 15)
(However,
X ₂ represents any one selected from leucine (L) and glycine (G),
X ₃ represents any one selected from proline (P) and lysine (K);
X ₅ represents any one selected from any amino acid,
X ₆ represents any selected from any amino acid. )
A peptide having one or more peptide chains consisting of an amino acid sequence selected from the above, and having a binding property to a vanadium species.
[5] A peptide having one or more peptide chains consisting of an amino acid sequence selected from the following amino acid sequences.
VSVTGVEGG (SEQ ID NO: 1)
VSVTGVDGG (SEQ ID NO: 2)
VVSSGIGGG (SEQ ID NO: 3)
VLVTRDKGG (SEQ ID NO: 4)
VTVTGVDAG (SEQ ID NO: 5)
VPGPGGDLG (SEQ ID NO: 6)
VPLKGIAGP (SEQ ID NO: 7)
[6] A vanadium species binder containing the peptide according to any one of [1] to [5].
[7] A peptide screening method comprising:
The following amino acid sequence;
VSVTGVEGG (SEQ ID NO: 1)
A step of preparing one or more peptides in which one or more and eight or less of the above are substituted with other amino acid residues;
Evaluating the binding of the one or more peptides to the vanadium species;
A method comprising:
[8] A peptide screening method comprising:
The following amino acid sequence;
Any one selected from the group consisting of VSVTGVDGG (SEQ ID NO: 2), VVSVGIGGG (SEQ ID NO: 3), VLVTRDKGG (SEQ ID NO: 4), VTVTGVDAG (SEQ ID NO: 5), VPGPGGDLG (SEQ ID NO: 6), and VPLKGGIAGP (SEQ ID NO: 7). A step of preparing one or two or more peptides in which one or more and eight or less amino acid residues of the amino acid sequence are substituted with other amino acid residues;
Evaluating the binding of the one or more peptides to the vanadium species;
A method comprising:
[9] A peptide screening method comprising:
An amino acid sequence represented by the following formula (1) (SEQ ID NO: 16);
VX ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ (1)
(However,
X ₁ is any selected from any amino acid,
X ₂ represents any one selected from valine (V), glycine (G) and leucine (L);
X ₃ is any selected from any amino acid,
X ₄ represents any one selected from glycine (G) and arginine (R),
X ₅ is any selected from any amino acid,
X ₆ is any selected from any amino acid,
X ₇ is any one selected from glycine (G), alanine (A) and leucine (L);
X ₈ represents one selected from glycine (G) and proline (P). )
Preparing one or more peptides having
Evaluating the binding between the one or more peptides and the panadium species;
A method comprising:
[10] The method according to [9], wherein X ₂ represents valine.
[11] The method according to [9] or [10], wherein X ₄ represents glycine.
[12] The method according to any one of [9] to [11], wherein X ₇ represents glycine.
[13] The method according to any one of [9] to [12], wherein X ₈ represents glycine.
[14] A method for screening peptides,
Any of the following amino acid sequences;
VX ₁ VX ₃ GX ₅ X ₆ GX ₈ (SEQ ID NO: 17)
VX ₁ VX ₃ GX ₅ X ₆ X ₇ G (SEQ ID NO: 18), and VX ₁ VX ₃ GX ₅ X ₆ GG (SEQ ID NO: 19)
_{(Wherein, X 1, X 3, X} 5 and X ₆ represents any amino acid, X ₇ represents any one selected from glycine (G), alanine (A) and leucine (L), X ₈ represents one or more peptides having glycine (G) or proline (P));
Evaluating the binding of the one or more peptides to the vanadium species;
A method comprising:
[15] The method according to [14], wherein X ₃ represents any one selected from threonine (T) and serine (S).
[16] The method according to [14] or [15], wherein X ₅ represents any one selected from valine (V), glycine (G), isoleucine (I) and aspartic acid (D).
[17] The method according to any one of [14] to [16], wherein X ₆ represents any one selected from glutamic acid (E), aspartic acid (D), and lysine (K).

It is a figure which shows the outline | summary of the biopanning for isolating T7 phage which displays the peptide couple | bonded with vanadium seed | species from a random peptide display type T7 phage library. It is a figure which shows the sequence-analysis result of the peptide couple | bonded with vanadium. It is a figure which shows the binding evaluation result with respect to vanadium about the phage clone 4B which displays the peptide (VBP-1) of a specific amino acid sequence. It is a figure which shows the evaluation result of the mineralization function of the peptide (VBP-1) of a specific amino acid sequence. It is a figure which shows the design of the gene sequence of the secondary peptide library based on VBP-1. It is a figure which shows the sequence-analysis result of the constructed secondary peptide library. It is a figure which shows the amino acid sequence of the peptide which showed binding property with the vanadium seed | species in a secondary peptide library. It is a figure which shows the amino acid sequence of the peptide which showed binding property with the vanadium seed | species in a secondary peptide library. It is a figure which shows the amino acid sequence by which the overlap with the vanadium seed | species was confirmed and the duplication of the amino acid sequence was confirmed in the secondary peptide library.

  The disclosure herein provides materials that bind to vanadium species. The material of the present disclosure is a peptide (hereinafter also simply referred to as the present peptide). This peptide can capture metal vanadium by interacting with metal vanadium. Moreover, this peptide interacts with vanadium ion and can mineralize vanadium ion. Therefore, this peptide interacts with metal vanadium and vanadium ions, and these can be detected, separated and recovered as metal vanadium or vanadium mineral, as well as complexed metal vanadium or vanadium mineral with other materials, It can be used for mineral labeling or modification.

  In the present specification, the vanadium species refers to vanadium (metal vanadium), vanadium ions having various valences (for example, oxidation numbers 1, 2, 3, 4 and 5, etc.) and compounds containing vanadium (hereinafter referred to as “vanadium”). It is simply called a vanadium compound.) Examples of vanadium compounds include oxides, hydroxides, sulfides, nitrides, oxynitrides, halides, and various salts containing vanadium.

  In this specification, an amino acid means an L-amino acid, and means 20 known amino acids that exist in nature. Cysteine (C) includes a state in which the SH group is a cystine bond. Peptide means a molecule (polypeptide) in which amino acids are linked by peptide bonds. An amino acid residue means an amino acid in a form dehydrated by incorporation into a peptide. For convenience, an amino acid residue in the amino acid sequence may be referred to as an amino acid.

  In the present specification, the binding refers to a connection through interaction between two substances or compounds. In particular, the type of interaction is not limited, but the disclosure in the present specification is not limited, but in the bond between metal vanadium or vanadium ion and peptide, for example, ionic bond, hydrogen bond, fan It is presumed to be due to identification by coupling such as Dell-Wars coupling.

(peptide)
The peptide can interact with vanadium to capture metal vanadium. In addition, the vanadium ions can be mineralized by interacting with the vanadium ions.

  Whether a peptide interacts with or binds to a vanadium species is determined by labeling a peptide containing a peptide chain of an amino acid sequence randomly constructed under a specific or fixed condition with colored plastic beads or the like, or a peptide-displaying phage And contact with metal vanadium powder (in HEPES buffer (Tween 20 0.1%) etc., leave it at 25-30 ° C. for 1 hour) and centrifuge (2000 g, about 3 minutes) It can be confirmed by performing washing operations to remove the liquid several times to about 10 times and detecting the peptide bound to metal vanadium by a method according to the label or measuring the number of displayed phages by plaque assay. it can.

  Another aspect in which the peptide interacts with or binds to the vanadium species is an aspect in which the peptide interacts with the vanadium ion and is mineralized. Whether a peptide interacts with and binds to vanadium ions is determined by artificially synthesizing a peptide containing a peptide chain having a specific amino acid sequence, a peptide concentration of 100 μM (DMSO 10%), and a vanadium ion concentration of 10 mM (for example, vanadium chloride). ) Acetate buffer (50 mM, pH 5.0) and incubate for 72 hours at 15-25 ° C. with stirring at room temperature. Thereafter, this mixed solution was centrifuged at about 20000 to 22000 g (for example, 15000 rpm) for about 10 minutes, the supernatant was removed, and an appropriate amount of ultrapure water was added and stirred and washed. This operation can be confirmed by repeating this operation twice in total, dispersing the pellet with an appropriate amount of ultrapure water, sampling it in a nanopercolator, and observing it with SEM / EDX or the like to detect the vanadium-containing compound.

  This peptide can be equipped with the 1 type, or 2 or more types of peptide chain selected from the following amino acid sequences I-IV, for example. This peptide may be a peptide consisting of only one of the following amino acid sequences, or this peptide may be provided with two or more of the following amino acid sequences. When two or more types of amino acid sequences are provided, these may be provided continuously, or may be provided via a linker such as an appropriate peptide linker.

These amino acid sequences I to IV are determined based on the amino acid sequence of the metal vanadium-binding peptide obtained based on the evaluation of the binding property to metal vanadium by the peptide-displaying T phage lanthanum peptide library described later. . The amino acid sequences of these peptides are shown below.
VSVTGVEGG (SEQ ID NO: 1)
VSVTGVDGG (SEQ ID NO: 2)
VVSSGIGGG (SEQ ID NO: 3)
VLVTRDKGG (SEQ ID NO: 4)
VTVTGVDAG (SEQ ID NO: 5)
VPGPGGDLG (SEQ ID NO: 6)
VPLKGIAGP (SEQ ID NO: 7)

Amino acid sequence I:
V X ₁ X ₂ (V / L / G) X ₃ X ₄ (G / R) X ₅ X ₆ X ₇ (G) X ₈ (G) (SEQ ID NO: 8)
Amino acid sequence II:
V X ₁ X ₂ (V / L / G) X ₃ X ₄ (G / R) X ₅ X ₆ X ₇ (A) X ₈ (G) (SEQ ID NO: 9)
Amino acid sequence III
V X ₁ X ₂ (V / L / G) X ₃ X ₄ (G / R) X ₅ X ₆ X ₇ (L) X ₈ (G) (SEQ ID NO: 10)
Amino acid sequence IV:
V X ₁ X ₂ (V / L / G) X ₃ X ₄ (G / R) X ₅ X ₆ X ₇ (G) X ₈ (P) (SEQ ID NO: 11)
(Wherein X ₁ represents any one selected from serine (S), proline (P), leucine (L) and threonine (T), and X ₃ represents threonine (T), proline (P), lysine) (K) represents one selected from serine (S), X ₅ represents any selected from any amino acid, and X ₆ represents any selected from any amino acid.

[Amino acid sequence I and amino acid sequence II]
The amino acid sequences I and II can be mainly based on the amino acid sequences represented by SEQ ID NOs: 1 to 5, and the amino acid sequence I is mainly the amino acid sequence represented by SEQ ID NOs: 1 to 4, mainly the amino acid sequence II. Can be based on the amino acid sequence represented by SEQ ID NO: 5, respectively.

In the amino acid sequences I and II, X ₁ can represent any one selected from, for example, serine (S), proline (P), leucine (L), and threonine (T). S), leucine (L) and threonine (T), for example, serine (S) or leucine (L), for example, serine (S) or threonine (T) . Serine (S), threonine (T), proline (P) and leucine (L) are all neutral amino acids. Serine (S), threonine (T) and leucine are similarly neutral amino acids, and serine (S) and threonine (T) are amino acids having a hydroxyl group.

X ₂ can represent any one selected from, for example, valine (V), leucine (L), and glycine (G), for example, valine (V) or glycine (G), and for example, Valine (V). Valine (V), leucine (L) and glycine (G) are all neutral amino acids and are hydrophobic or uncharged amino acids.

X ₃ can represent any one selected from, for example, threonine (T), proline (P), lysine (K), and serine (S), but also, for example, threonine (T), serine (S) And proline (P), for example, serine (S) or threonine (T), for example, threonine (T). Threonine (T), proline (P) and serine (S) are neutral and uncharged amino acids, threonine (T) and serine (S) are polar amino acids, and proline (P) is nonpolar. Although it is an amino acid, all are neutral amino acids.

X ₄ represents glycine (G) or arginine (R), for example, and is glycine (G), for example.

X ₅ can represent any amino acid, for example, and can represent any one selected from, for example, valine (V), isoleucine (I), aspartic acid (D), and glycine (G). And, for example, any one selected from valine (V), isoleucine (I) and aspartic acid (D), and also, for example, valine (V) or isoleucine (I).

X ₆ represents any one selected from, for example, glutamic acid (E), aspartic acid (D), glycine (G), lysine (K), and alanine (A). For example, glutamic acid (E), aspartic acid (D) represents any one selected from glycine (G) and lysine (K), and is, for example, glutamic acid (E), aspartic acid (D) or glycine (G).

“V X _{1 to} X ₃ ” of the amino acid sequences I and II can be, for example, VSVT, VSVS, VTVS, VTVT, VLVT, VTVL, VLVS, VSVL, VLVL, etc., and for example, VSVT, VSVS, VTVSS , VTVT, VLVT, VTVL, VLVS, etc., for example, VSVT, VSVS, VTVT, VLVT, etc.

“X _{5 to} X ₆ ” of amino acid sequences I and II are, for example, VE, VD, VG, VK, VA; IE, ID, IG, IK, IA; DG, DK, GE, GD, GK, GA And so on.

  The peptide can contain valine (V) and glycine (G). For example, in each sequence of amino acid sequences I to IV (the number of amino acid residues is 9), for example, the sum of V and G is 3 Or more, for example, 4 or more, for example, 5 or more, and, for example, 6 pieces.

  From the above, the present peptide includes the present peptide by the following combinations. All of these peptides have common features and can interact with vanadium and vanadium ions.

As an example, this peptide having the following amino acid sequence can be mentioned.
_{VSVT (X 1 ~X 3) G} / R (X 4) VE / VD / IG / DK / GD (X 5 X 6) GG / AG (X 7 X 8)
VSVS G / R VE / VD / IG / DK / GD GG / AG
VTVS G / R VE / VD / IG / DK / GD GG / AG
VTVT G / R VE / VD / IG / DK / GD GG / AG
VLVT G / R VE / VD / IG / DK / GD GG / AG
VTVL G / R VE / VD / IG / DK / GD GG / AG
VLVS G / R VE / VD / IG / DK / GD GG / AG
VSVL G / R VE / VD / IG / DK / GD GG / AG
VLVL G / R VE / VD / IG / DK / GD GG / AG

[Amino acid sequence III and amino acid sequence IV]
The amino acid sequence III can be based mainly on the amino acid sequence represented by SEQ ID NO: 6, and the amino acid sequence IV can be based mainly on the amino acid sequence represented by SEQ ID NO: 7.

In the amino acid sequences III and IV, X ₁ represents any one selected from, for example, serine (S), proline (P), leucine (L), and threonine (T). is there.

X ₂ represents, for example, any one selected from valine (V), leucine (L), and glycine (G), and is selected from, for example, valine (V), glycine (G), and leucine (L). For example, glycine (G) or leucine (L). Glycine (G) and leucine (L) are both neutral amino acids and uncharged amino acids. Leucine (L) and valine (V) are hydrophobic neutral amino acids.

X ₃ represents any one selected from, for example, threonine (T), proline (P), lysine (K), and serine (S), and is also, for example, proline (P) or lysine (K).

X ₄ represents glycine (G) or arginine (R), for example, and is glycine (G), for example.

X ₅ represents any amino acid, for example, and is any one selected from, for example, valine (V), isoleucine (I), aspartic acid (D) and glycine (G), and for example, valine (V ), Glycine (G) and isoleucine (I), for example, glycine (G) or isoleucine (I).

X ₆ represents, for example, any one selected from glutamic acid (E), aspartic acid (D), glycine (G), lysine (K), and alanine (A), but aspartic acid (D) or alanine (A ).

“V X _{1 to} X ₃ ” in the amino acid sequences III and IV can be, for example, VPGP, VPGK, VPLK, VPLP, VPVP, VPPVK, and the like, and can be, for example, VPGP, VPLK, and the like.

Also, "X ₅ to X _6" of an amino acid sequence III and IV, for example, can be GD, GA, ID, IA, VA, VD and the like to.

  From the above, for example, according to amino acid sequences III and IV, the present peptide by the following combinations can be mentioned. All of these peptides have common features and can interact with vanadium and vanadium ions.

As an example, the present peptide having the following amino acid sequence can be mentioned.
VPGP G GD / GA / ID / IA / VA / VD LG / GP
VPGK G GD / GA / ID / IA / VA / VD LG / GP
VPLK G GD / GA / ID / IA / VA / VD LG / GP
VPLP G GD / GA / ID / IA / VA / VD LG / GP
VPVP G GD / GA / ID / IA / VA / VD LG / GP
VPVK G GD / GA / ID / IA / VA / VD LG / GP

  This peptide can be produced using a known chemical or genetic engineering method. This peptide may be modified by, for example, a known method. For example, a known signal element may be bound using an appropriate peptide linker. Examples of the signal element include known fluorescent labeling compounds used for protein and peptide labels, fluorescent proteins, enzymes such as peroxidase and alkaline phosphatase, color formers, antibodies or fragments thereof, fine metal particles, colored beads, and the like. Examples include biotin.

  The peptide may be linear or may be cyclized by introducing cysteine (C) to the N-terminal side and C-terminal side to form a disulfide bond, for example. This peptide may be in a state displayed on T7 phage, or may be displayed on the surface of yeast such as S. cerevisiae.

  In addition, the peptide may be bound to the surface of a particle material such as polymers, ceramics, and glass of various sizes provided in an appropriate label or probe. Moreover, this peptide may be held on at least a part of the surface of a well plate or various substrates.

(Use of this peptide)
The peptide can interact with vanadium to form the peptide-vanadium complex. For this reason, this peptide can be used for detecting, quantifying, separating, recovering and concentrating vanadium. That is, this peptide can be used as a vanadium sensing agent, quantitative agent, separation / recovery agent, concentrating agent, and the like.

  Moreover, since this peptide can form a complex with vanadium, it can be used as a complexing agent for forming a composite material of this peptide and vanadium. In addition, from the same viewpoint, since the present peptide can be further complexed with other various compounds and the like, it can be used as a mediator for complexing such other compounds with vanadium. From the same viewpoint, the present peptide can be used as a coating agent (coating agent) for various forms of vanadium-containing materials such as particles, plates, and films. From the same viewpoint, the peptide can also be used as a vanadium labeling agent or modifying agent. In this case, it is advantageous if the peptide is labeled.

  The peptide can interact with vanadium ions to form a vanadium-containing compound (mineralization) and form a complex with the vanadium-containing compound. For this reason, this peptide can be used as a mineralization agent for vanadium ions. Since this peptide can be used as a vanadium ion mineralization agent, this peptide can be used as a vanadium ion sensing agent, quantitative agent, separation / recovery agent, concentrating agent, vanadium ion (or generated vanadium-containing compound). It can also be used as a complexing agent, a labeling agent or a modifying agent for vanadium ions (or generated vanadium-containing compounds). When used as a labeling agent or modifying agent, it is advantageous that the peptide is labeled.

(Method for determining amino acid sequence of peptide and method for screening peptide)
The method for determining the amino acid sequence of a peptide disclosed herein (hereinafter, also simply referred to as “the determination method”) is a method of determining one or more amino acid residues of amino acid sequence: VSVTGVEGG (SEQ ID NO: 1). Providing one or more peptides substituted with other amino acid residues, and evaluating the interaction of the one or more peptides with vanadium or vanadium ions. it can. This amino acid sequence has a high interaction with vanadium and vanadium ions. For this reason, according to this determination method, the amino acid sequence of a peptide with high ability to interact with vanadium or vanadium ion can be determined. Moreover, since this determination method screens a peptide with high ability to interact with vanadium or vanadium ion, it can also be implemented as a screening method for such a peptide. The number of amino acid residues to be substituted may be, for example, 2 or more, for example, 3 or more, for example, 4 or more, for example, 5 or more, for example, 7 or less, for example, 6 or less. Also, for example, it may be 5 or less.

  This determination method also includes amino acid sequences: VSVTGVDGG (SEQ ID NO: 2), VVSVGIGGG (SEQ ID NO: 3), VLVTRDKGG (SEQ ID NO: 4), VTVTGGDAG (SEQ ID NO: 5), VPGPGGDLG (SEQ ID NO: 6), VPLKGGIAGP (SEQ ID NO: 7). A step of preparing one or two or more kinds of peptides in which one or more and eight or less amino acid residues of any amino acid sequence selected from the group consisting of: Or a step of evaluating the binding of two or more peptides to vanadium species. These amino acid sequences also have high interaction with vanadium and vanadium ions. For this reason, according to this determination method, the amino acid sequence of a peptide with high ability to interact with vanadium or vanadium ion can be determined. The number of amino acid residues to be substituted may be, for example, 2 or more, for example 3 or more, for example 4 or more, for example 5 or more, for example 7 or less, for example 6 or less, For example, it may be 5 or less.

  There is no particular limitation on preparing one or two or more types of peptides in which one or more amino acid residues in one or more of these amino acid sequences are substituted with other amino acid residues. The template DNA is designed so that all the amino acid residues of the amino acid sequence to be randomized are randomized, and the randomization rate is, for example, 60% or less, such as 50% or less, for example, 40% or less. It can be obtained by genetic engineering techniques such as cell-free protein synthesis, display on phages, etc. using DNA.

The present determination method and screening method also include an amino acid sequence represented by the following formula (1) (SEQ ID NO: 16);
VX ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ (1)
(However,
X ₁ is any selected from any amino acid,
X ₂ represents any one selected from valine (V), glycine (G) and leucine (L);
X ₃ is any selected from any amino acid,
X ₄ represents any one selected from glycine (G) and arginine (R),
X ₅ is any selected from any amino acid,
X ₆ is any selected from any amino acid,
X ₇ is any one selected from glycine (G), alanine (A) and leucine (L);
X ₈ represents one selected from glycine (G) and proline (P). )
It can also implement as a method provided with the process of preparing the 1 type (s) or 2 or more types of peptide which has these, and the process of evaluating the interaction of the said 1 type (s) or 2 or more types of peptide, and vanadium or vanadium ion.

The various aspects of the amino acid residues X _{1 to} X _{8 in} the amino acid sequence represented by the formula (1) are all specific amino acid sequences consisting of 9 amino acid residues that are confirmed to bind to vanadium. When the amino acid sequences of the seven types of peptides (SEQ ID NOs: 1 to 7) are aligned, they are based on the amino acid residues identified in X _{1 to} X ₈ (see the following table). Therefore, it is considered that peptides that bind to vanadium can be efficiently screened by applying these amino acid residues to the amino acid sequence represented by the formula (1).

In the amino acid sequence represented by the formula (1) (SEQ ID NO: 16), X ₁ is any _one selected from amino acids. For example, serine (S), threonine (T), leucine (L) And proline (P), for example, one selected from serine (S), threonine (T) and leucine, and for example, serine (S) or threonine (T) is there. For example, X ₁ is proline (P).

X ₂ represents, for example, any one selected from valine (V) and glycine (G), and is, for example, valine (V).

X ₃ is any amino acid selected from, for example, any one selected from threonine (T), serine (S), proline (P), and lysine (K); For example, it represents one selected from threonine (T), serine (S), and proline (P), and is, for example, threonine (T) or serine (S).

X ₄ can be glycine (G) or arginine (R), for example, glycine (G).

X ₅ is any one selected from amino acids, for example, any one selected from valine (V), aspartic acid (D), glycine (G) and isoleucine (I), Also, for example, any one selected from valine (V), isoleucine (I) and glycine (G), and any one selected from valine (V) and isoleucine (I), for example.

X ₆ is any one selected from amino acids, and is selected from, for example, glutamic acid (E), aspartic acid (D), lysine (K), glycine (G) and alanine (A). And any one selected from, for example, glutamic acid (E), aspartic acid (D), lysine (K), and glycine (G), and also, for example, glutamic acid (E), aspartic acid (D) And lysine (K), for example, glutamic acid (E) or aspartic acid (D).

X ₇ is, for example, any one selected from glycine (G), alanine (A), and leucine (L), and is, for example, glycine (G).

X ₈ is glycine (G) or proline (P), for example, glycine (G).

  The preparation of such one or more kinds of peptides is not particularly limited, but cell-free by artificially synthesizing a peptide having a predetermined amino acid sequence or synthesizing a DNA template for the predetermined amino acid sequence. They can be synthesized by genetic engineering techniques such as protein synthesis and phage display.

This determination method and screening method also include any of the following amino acid sequences;
VX ₁ VX ₃ GX ₅ X ₆ GX ₈ (SEQ ID NO: 17)
VX ₁ VX ₃ GX ₅ X ₆ X ₇ G (SEQ ID NO: 18), and VX ₁ VX ₃ GX ₅ X ₆ GG (SEQ ID NO: 19)
Any amino acid is applied to X ₁ , X ₃ , X ₅ and X ₆ , and X ₇ is any one selected from glycine (G), alanine (A) and leucine (L), and X ₈ A step of preparing one or two or more peptides obtained by applying glycine (G) or proline (P), and a step of evaluating the binding properties of the one or two or more peptides to vanadium species And can be provided. According to the determination method and the screening method, since the binding motif for vanadium is more specified, the amino acid sequence of the vanadium species-binding peptide can be efficiently determined and the peptide can be screened.

  For preparing such one or more peptides, there is no particular limitation. For example, with any amino acid defined by X as a randomization target, the randomization rate is, for example, 60% or less, In addition, for example, template DNA is designed to be 50% or less, for example, about 40% or less, and obtained by genetic engineering techniques such as cell-free protein synthesis or display to phages, etc. using the template DNA. be able to.

  In addition, based on the amino acid sequence of a peptide that is known to bind to vanadium in the amino acid sequence of one or more peptides to be screened, for example, of 9 residues, glycine (G) and valine It has been found that it may be advantageous to have a total of 3 to 6 (V).

  One or more peptides to be screened may be provided with serine (S), cysteine (C) at the N-terminus and cysteine (C) and serine (S) at the C-terminus. In this case, the peptide may be linear or may be cyclized using cysteine.

  Hereinafter, in order to explain the disclosure of the present specification more specifically, specific examples will be described. The following examples are intended to illustrate the disclosure herein and are not intended to limit the scope thereof.

(Construction of random peptide display type T7 phage library)
An attempt was made to construct a random peptide library using the T7 phage display system (Novagen). Two types of oligonucleotide primers T7-Libup (ATG AAT ACC AGG ATC CGA ATT CAG GTG GAG GTT CG) (SEQ ID NO: 20), T7-Libdown (ACT ATC GTC GGC CGC AAG CTT TTA GCT) (SEQ ID NO: 21) PCR reaction is used to amplify template DNA (CGA ATT CAG GTG GAG GTT CGT GT (up to here SEQ ID NO: 22) (NNK) _9-12 TGT AGC TAA AAG CTT GCG GCC GA) (after TGT, SEQ ID NO: 23) did. However, (NNK) _9-12 in the template DNA was synthesized with the following nucleotide composition. N is a mixed base of A 25%, T 25%, G 25%, C 25% (A / T / G / C equivalent mixed base, K is A 0%, T 50%, G 50%, C 0% mixed base.

  The amplified DNA fragment was subjected to phenol treatment and butanol concentration according to a general protocol, and then purified using QIAquick PCR Purification Kit (QIAGEN). The purified DNA was treated with restriction enzymes Hind III and EcoR I (Takara Bio), and then ligated to T7 select 10-3 vector arm (Novagen) to construct a T7 phage genome.

The constructed phage genome was mixed with a T7 select packaging solution (Novagen) to construct a T7 phage having a random peptide gene-introduced T7 genomic DNA. At this time, the number of the constructed phage population was counted using a part, and it was confirmed that a phage library having a sequence diversity of 1.0 × 10 ^{6 to} 4.0 × 10 ⁷ was constructed. did.

The constructed phage population was amplified by infecting E. coli BLT 5403 strain cultured to OD _600nm = 0.6 to 1.0, and then concentrated and purified by 8% polyethylene glycol, 0.22 μm filter treatment. . As a result of counting the number of phages after purification, each library had about 1.0 × 10 ¹² pfu / ml of phage, and was amplified 100,000 to 1,000,000 times per one kind of peptide phage. It was confirmed.

(Biopanning for vanadium species using random peptide-displaying T7 phage library)
From the random peptide-displaying T7 phage library prepared in Example 1, an attempt was made to isolate a T7 phage that displays a peptide that binds to a vanadium species. A series of flows is shown in FIG. Vanadium synthesized according to Japanese Patent Application No. 2006-529148 was washed with methanol: acetone = 1: 1 solvent, then washed with isopropanol, and then dispersed in HEPES buffer (50 mM HEPES, 150-300 mM NaCl, Tween 20 0.1%). It was.

  A solution in which 1 to 0.5 mg of vanadium is dispersed is mixed with a T7 phage library, reacted at room temperature for 1 hour, and then the particles are precipitated by centrifugation (6,000 rpm, 3 min), and the supernatant is removed. The phage was removed.

  After removing the supernatant, add HEPES buffer (50 mM HEPES, 150-500 mM NaCl, Tween 20 0.1%) solution to disperse the vanadium, and centrifuge again to remove the non-specifically bound phage. Tried. By repeating this operation (washing operation) 3 to 15 times, peptide phages that nonspecifically bind to vanadium were removed.

Unbound phages and non-specifically bound phages were removed by washing, and then mixed with 10 ml of E. coli BLT 5403 solution cultured to OD _{600 nm} = 0.6 to 1.0. Culturing was performed at 37 ° C. until lysis.

  After E. coli was completely lysed, 1/10 amount of 5M NaCl was added to the culture solution and centrifuged (3,500 rpm, 15 min) to precipitate an insoluble fraction such as the cell wall of E. coli, and the supernatant was collected.

  A 1/6 amount of 50% polyethylene glycol 6,000 solution was added to the collected supernatant, and after stirring, centrifuged at 3,500 rpm for 15 min to precipitate T7 phage. The precipitated T7 phage population was dissolved in HEPES buffer, 0.22 μm filtered, and stored at 4 ° C. until use.

(Concentration confirmation of vanadium species phage)
The phage pools obtained in Example 2 from the first round to the fifth round were evaluated for binding properties to vanadium species.

  500 μg of vanadium washed and dispersed in HEPES buffer and each phage pool were mixed and reacted at room temperature for 1 hour, followed by centrifugation (6,000 rpm, 3 min) to remove the supernatant. Subsequently, washing operation was performed 10 times with HEPES buffer. After washing, the number of phage bound to vanadium was determined by plaque assay. From the measurement results, it was confirmed that the binding property to vanadium increased as the panning round progressed. It was considered that vanadium-binding phages were concentrated in the phage pool.

(Display peptide sequence analysis of monoclonal phage)
As a result of single cloning of the phage pool after 5 rounds of panning and analysis of the displayed peptide sequences for 96 randomly selected phages, as shown in FIG. confirmed.

(Screening of monoclonal phage displaying peptides that bind to vanadium species)
Among the peptide phages identified in Example 4, clone phages (3A, 4B, 3D, 12E) displaying characteristic sequences were evaluated for their binding properties to vanadium species. 500 μg of vanadium washed and dispersed in HEPES buffer and each cloned phage were mixed and reacted at room temperature for 1 hour, followed by centrifugation (6,000 rpm, 3 min) to remove the supernatant. Subsequently, washing operation was performed 10 times with HEPES buffer. After washing, the number of phage bound to vanadium was determined by plaque assay. The result of the binding evaluation for vanadium species is shown in FIG.

  As shown in FIG. 3, for the cloned phages 3A and 4B in which duplication of sequences was confirmed, the number of phage binding more than 100 times was confirmed as compared with the wild type.

(Evaluation of peptide synthesis and mineralization phenomenon)
A peptide (VBP-1: CVSVTGVEGGC) having an amino acid sequence displayed by clone phage 3A and 4B confirmed to be bound to vanadium species was synthesized by Fmoc solid phase synthesis. The N-terminus of the synthetic peptide was biotinylated via GGGS derived from the g10 sequence. S was added to the C-terminus.

  Mineralization function was evaluated using the synthesized VBP-1 peptide. An acetate buffer (50 mM, pH 5.0) having a peptide concentration of 100 μM (DMSO 10%) and a vanadium ion concentration of 10 mM (for example, vanadium chloride) was prepared and incubated at 15 to 25 ° C. with stirring at room temperature for 72 hours. . Thereafter, this liquid was centrifuged at about 22000 g (15000 rpm) for about 10 minutes, the supernatant was removed, and an appropriate amount of ultrapure water was added and washed with stirring. This centrifugation and stirring line are repeated twice in total, and the black precipitate is dispersed with an appropriate amount of ultrapure water, and finally the precipitate formed is subjected to a predetermined treatment with a nanopercolator and then dried, and then subjected to SEM / EDX. And analyzed. The analysis results are shown in FIG.

  As shown in FIG. 4, the precipitate was found to be a substance containing a large amount of vanadium. From the above, it was confirmed that VBP-1 produces a vanadium-containing mineral from the vanadium chloride solution.

(Construction of secondary library based on VBP-1)
An attempt was made to improve VBP-1 by constructing a secondary library based on the VBP-1 sequence and screening again for vanadium.

As shown in FIG. 5, the gene sequence of the secondary library was designed so that the amino acids constituting VBP-1 appear with the probability of 39-54%. That is, a primer annealing site is added to both ends of the secondary library gene to form a template sequence (5 '... GGATCCGAATTCAGGTGGAGGTTCGTGT (SEQ ID NO: 24 so far) WZNZYNWZNXYNWWNWZNWXXWWNWWN TGCAGCTAAAAGCTTGCGGCCG ... SEQ ID NO: 25) and Example 1 A peptide library was constructed in the same manner. N = A 25%, T 25%, G 25%, C 25% mixed base (A / T / G / C equivalent mixed base), W = G 70%, others include 10% each A mixed base, Y is a mixed base containing 70% of C and 10% of others, and Z is a mixed base containing 70% of T and 10% of others.

  The sequence analysis result of the constructed secondary library is shown in FIG. As shown in FIG. 6, it was confirmed that the occurrence of amino acids at each site was almost the same as the theoretical value. The peptide cut out from the resin and deprotected was formed with an intramolecular disulfide bond, purified by reverse phase HPLC, and lyophilized.

(Improved VBP-1)
Screening for vanadium was performed in the same manner as in Example 2. At this time, 500 μg of vanadium was dispersed in Tris buffer (50 mM Tris, 150 to 300 mM NaCl, Tween 0.1%) and reacted with the secondary library. Washing was performed 3 to 24 times using a Tris buffer (50 mM Tris, 150 to 500 mM NaCl, Tween 20 0.1%).

  The panning 4 or 5 round phage pool was cloned into a single clone, and the displayed peptide sequence of 91 clones selected at random was analyzed. The results are shown in FIGS. 7A and 7B. FIG. 8 shows five sequences in which duplication of sequences was confirmed.

As shown in FIG. 8, in the five sequences confirmed to overlap, the first valine (V), the third valine (V), glycine (G) and leucine (L ) 5th glycine (G) and arginine (R), 8th glycine (G), alanine (A) and leucine (L) and 9th glycine (G) or proline (P) An amino acid sequence (SEQ ID NO: 16) represented by the following formula (1) as a binding motif, which is considered to be a high and important residue for binding to vanadium species;
VX ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ (1)
(However,
X ₁ represents any amino acid, preferably any one selected from proline (P), leucine (L), serine (S) and threonine (T);
X ₂ represents any one selected from valine (V), leucine (L) and glycine (G), preferably valine (V),
X ₃ represents any amino acid, preferably any one selected from threonine (T), serine (S), proline (P) and lysine (K);
X ₄ represents any one selected from glycine (G) and arginine (R), preferably glycine (G),
X ₅ represents any one selected from any amino acid,
X ₆ represents one selected from any amino acid,
X ₇ represents any one selected from glycine (G), alanine (A) and leucine (L), preferably glycine (G),
X ₈ represents any one selected from glycine (G) and proline (P), and preferably represents glycine (G). )
was gotten. Among them, VX ₁ VX ₃ GX ₅ X ₆ GG was highly estimated as a binding motif.

With regard to X _{1 to} X ₈ of the binding motif thus obtained, a library in which the X site is randomized is prepared in the same manner as in the preparation of the secondary library, and the affinity for the vanadium species is improved by screening again. It is easily assumed that higher peptides can be isolated.

SEQ ID NOs: 1-19: Vanadium binding peptide SEQ ID NO: 20, 21: Primer SEQ ID NOs: 22-25: Template DNA for PCR

Claims (17)

The following amino acid sequence;
V X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ G G (SEQ ID NO: 8)
V X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ AG (SEQ ID NO: 9)
V X ₁ X ₂ X ₃ X ₄ X ₅ X ₆ LG (SEQ ID NO: 10)
_{V X 1 X 2 X 3 X} 4 X 5 X 6 G P ( SEQ ID NO: 11)
(However,
X ₁ represents any one selected from serine (S), proline (P), leucine (L), and threonine (T),
X ₂ represents any one selected from valine (V), leucine (L) and glycine (G);
X ₃ represents any one selected from threonine (T), proline (P), lysine (K) and serine (S);
X ₄ represents any one selected from glycine (G) and arginine (R),
X ₅ represents any one selected from any amino acid,
X ₆ represents any selected from any amino acid. )
A peptide having one or more peptide chains consisting of an amino acid sequence selected from the above, and having a binding property to a vanadium species. X ₅ represents any one selected from valine (V), glutamic acid (D) and isoleucine (I),
Represents any selected from any amino acid,
X ₆ represents any one selected from glutamic acid (D), aspartic acid (E), lysine (K), alanine (A) and glycine (G).
The peptide according to claim 1. The following amino acid sequence;
V X ₁ V X ₃ X ₄ X ₅ X ₆ G G (SEQ ID NO: 12)
V X ₁ V X ₃ X ₄ X ₅ X ₆ AG (SEQ ID NO: 13)
(However,
X ₁ represents any one selected from serine (S), leucine (L), and threonine (T),
X ₃ represents any one selected from threonine (T) and serine (S);
X ₄ represents any one selected from glycine (G) and arginine (R),
X ₅ represents any one selected from any amino acid,
X ₆ represents any selected from any amino acid. )
A peptide having one or more peptide chains consisting of an amino acid sequence selected from the above, and having a binding property to a vanadium species. The following amino acid sequence;
V P X ₂ X ₃ G X ₅ X ₆ LG (SEQ ID NO: 14)
V P X ₂ X ₃ G X ₅ X ₆ GP (SEQ ID NO: 15)
(However,
X ₂ represents any one selected from leucine (L) and glycine (G),
X ₃ represents any one selected from proline (P) and lysine (K);
X ₅ represents any one selected from any amino acid,
X ₆ represents any selected from any amino acid. )
A peptide having one or more peptide chains consisting of an amino acid sequence selected from the above, and having a binding property to a vanadium species. A peptide having one or more peptide chains consisting of an amino acid sequence selected from the following amino acid sequences.
VSVTGVEGG (SEQ ID NO: 1)
VSVTGVDGG (SEQ ID NO: 2)
VVSSGIGGG (SEQ ID NO: 3)
VLVTRDKGG (SEQ ID NO: 4)
VTVTGVDAG (SEQ ID NO: 5)
VPGPGGDLG (SEQ ID NO: 6)
VPLKGIAGP (SEQ ID NO: 7)   The vanadium seed | species binder containing the peptide in any one of Claims 1-5. A peptide screening method comprising:
The following amino acid sequence;
VSVTGVEGG (SEQ ID NO: 1)
A step of preparing one or more peptides in which one or more and eight or less of the above are substituted with other amino acid residues;
Evaluating the binding of the one or more peptides to the vanadium species;
A method comprising: A peptide screening method comprising:
The following amino acid sequence;
Any one selected from the group consisting of VSVTGVDGG (SEQ ID NO: 2), VVSVGIGGG (SEQ ID NO: 3), VLVTRDKGG (SEQ ID NO: 4), VTVTGVDAG (SEQ ID NO: 5), VPGPGGDLG (SEQ ID NO: 6), and VPLKGGIAGP (SEQ ID NO: 7). A step of preparing one or two or more peptides in which one or more and eight or less amino acid residues of the amino acid sequence are substituted with other amino acid residues;
Evaluating the binding of the one or more peptides to the vanadium species;
A method comprising: A peptide screening method comprising:
An amino acid sequence represented by the following formula (1) (SEQ ID NO: 16);
VX ₁ X ₂ X ₃ X ₄ X ₅ X ₆ X ₇ X ₈ (1)
(However,
X ₁ is any selected from any amino acid,
X ₂ represents any one selected from valine (V), glycine (G) and leucine (L);
X ₃ is any selected from any amino acid,
X ₄ represents any one selected from glycine (G) and arginine (R),
X ₅ is any selected from any amino acid,
X ₆ is any selected from any amino acid,
X ₇ is any one selected from glycine (G), alanine (A) and leucine (L);
X ₈ represents one selected from glycine (G) and proline (P). )
Preparing one or more peptides having
Evaluating the binding between the one or more peptides and the panadium species;
A method comprising: X ₂ represents a valine A method according to claim 9. X ₄ represents a glycine A method according to claim 9 or 10. The method according to any one of claims 9 to 11, wherein X ₇ represents glycine. X ₈ represents a glycine A method according to any of claims 9-12. A peptide screening method comprising:
Any of the following amino acid sequences;
VX ₁ VX ₃ GX ₅ X ₆ GX ₈ (SEQ ID NO: 17)
VX ₁ VX ₃ GX ₅ X ₆ X ₇ G (SEQ ID NO: 18), and VX ₁ VX ₃ GX ₅ X ₆ GG (SEQ ID NO: 19)
_{(Wherein, X 1, X 3, X} 5 and X ₆ represents any amino acid, X ₇ represents any one selected from glycine (G), alanine (A) and leucine (L), X ₈ represents one or more peptides having glycine (G) or proline (P));
Evaluating the binding of the one or more peptides to the vanadium species;
A method comprising: The method according to claim 14, wherein X ₃ represents one selected from threonine (T) and serine (S). The method according to claim 14 or 15, wherein X ₅ represents any one selected from valine (V), glycine (G), isoleucine (I) and aspartic acid (D). The method according to any one of claims 14 to 16, wherein X ₆ represents any one selected from glutamic acid (E), aspartic acid (D), and lysine (K).