JP2019147786A - Humanized antibodies against human gp130 receptor - Google Patents

Abstract

To provide an anti-human gp130 receptor antibody of which amino acid sequence other than the complementarity determining site is of a human antibody (humanized), without lowering the affinity to human gp130 receptor of a mouse antibody which inhibits signaling of human interleukin-6 and family cytokines thereof by binding to human gp130 receptor.SOLUTION: The above problem is solved by using an amino acid sequence derived from a human antibody for the framework region without reducing the affinity as compared to the affinity of the original mouse antibody. Such an amino acid sequence is selected by screening a library of humanized antibodies constructed by replacing the amino acid sequence of the framework region of the mouse antibody with various framework amino acid sequences of human antibodies having high homology to the framework amino acid sequence of the mouse antibody.SELECTED DRAWING: None

Description

  The present invention relates to an antibody capable of suppressing signal transduction via the human gp130 receptor by binding to the human gp130 receptor. In particular, the present invention replaces the amino acid sequence of the anti-human gp130 receptor mouse antibody other than the complementarity determining region with an amino acid sequence derived from a human antibody (humanized), and has an affinity for the human gp130 receptor. The present invention relates to an antibody that is equivalent to or more than the mouse antibody.

  Interleukin-6 (IL-6) has many autoimmune diseases such as rheumatoid arthritis and Castleman's disease, skeletal diseases, cancer, heart disease, obesity, diabetes, asthma, Alzheimer's disease, multiple sclerosis, etc. It is believed to be involved in other diseases. These suggest that suppression of IL-6 signaling may be beneficial in the treatment of these diseases.

  IL-6 binds to the IL-6 receptor (IL-6R) and is transmitted by further dimerization of a trimer formed by binding of the complex to the gp130 receptor (Non-Patent Literature). 1). In addition, IL-6R and gp130 receptors are present not only on the cell membrane but also in a soluble form, and are thought to transmit and suppress IL-6 signals in vivo (Non-patent Document 2). In addition to IL-6, gp130 receptor is interleukin 11 (IL-11), interleukin 27 (IL-27), leukocyte migration inhibitory factor (LIF), oncostatin M (OSM) belonging to the IL-6 family. It is also involved in signal transduction of ciliary neurotrophic factor (CNTF), cardiotrophin-1 (CT-1), etc. (Non-patent Document 3).

  In recent years, development of pharmaceuticals (antibody pharmaceuticals) using monoclonal antibodies has been promoted. For example, antibody drugs against tumor necrosis factor (TNF-α) and IL-6R have been sold as antibody drugs against inflammation caused by rheumatism and have been highly effective.

  Usually, monoclonal antibodies are produced using animal cells derived from mice, rats, rabbits and the like. Therefore, when these monoclonal antibodies are directly administered to humans, they are recognized as foreign substances by the human immune system. When a general mouse monoclonal antibody is administered to humans, a human anti-mouse antibody (“HAMA”) is produced and an immune response is generated and excluded as a foreign substance. Therefore, mouse antibodies cannot be administered repeatedly to humans. In order to administer such an antibody to humans, it is necessary to improve the antibody molecule so as not to cause a HAMA response while retaining the specificity of the antibody.

  In general, an antibody (immunoglobulin) is composed of a heavy chain having a large molecular weight (H chain) and a light chain having a small molecular weight (L chain). Both the heavy chain and the light chain have regions having different amino acid sequences called variable regions at about 110 residues from the N-terminus. The heavy chain variable region is represented as VH, and the light chain variable region as VL. Is done. The VH and VL are composed of three CDRs (complementarity determining regions) and four FRs (framework regions) working to maintain the three-dimensional structure. VH and VL are opposed to each other. By forming an electrostatic bond, an antigen binding site is formed. The region of the CDR that has a particularly high frequency of amino acid sequence variation is called the hypervariable region. The hypervariable region of the heavy chain and the hypervariable region of the light chain create an antigen-binding site structure unique to the antibody, and have affinity for the antigen. Determine sex and specificity.

  In order to avoid a HAMA response, an antibody that is similar in structure to a human antibody and is not recognized as a foreign substance is required. So far, a chimeric antibody having a human antibody structure only in the constant region other than the variable region of the antibody, and a humanized antibody having a human antibody structure in the constant region and the variable region other than the CDR (FIG. 1). ) And human antibodies. For human antibodies, immortalization of human B cells, a method of screening by gene recombination of antibody genes obtained from human B cells or artificially produced human antibody variable region genes, or mice capable of producing human antibodies are used. It is produced by this. Humanized antibodies are considered to be less immunogenic than chimeric antibodies because they are more similar in structure to human antibodies than chimeric antibodies.

  In general, when humanizing an antibody, select the FR of a human antibody whose amino acid sequence is close to that of the antibody before the humanization, or select the FR of a human antibody that does not break the CDR structure by simulation using computational chemistry To design and create molecules. However, in many cases, since the affinity of the designed humanized antibody is lower than that of the antibody before humanization, much effort is required to obtain a humanized antibody maintaining the affinity.

Boulanger J. et al. M.M. , Et al. , Science, 300, 2101-2104 (2003) Narazaki M. et al. et al. , Blood, 82, 1120-1126 (1993) Heinrich P.M. C. et al. Biochem. J. et al. 334, 297-314 (1998)

  It is an object of the present invention to determine complementarity without reducing the affinity for a human gp130 receptor of a mouse antibody that inhibits signal transduction of human interleukin-6 and its family cytokines by binding to the human gp130 receptor. The object is to provide an anti-human gp130 receptor antibody in which the amino acid sequence other than the region is substituted (humanized) with an amino acid sequence derived from a human antibody.

  As a result of intensive studies to solve the above problems, the present inventors have found that the human gp130 receptor possessed by a mouse antibody that inhibits signal transduction of human interleukin-6 and its family cytokines by binding to the human gp130 receptor. The present inventors have completed the present invention by finding the amino acid sequence of a framework region (FR) derived from a human antibody that does not reduce the affinity.

  That is, in the first aspect of the present invention, the heavy chain variable (VH) region is the amino acid sequence set forth in SEQ ID NO: 25, or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 25, In which the light chain variable (VL) region is 90% or more homologous to the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80, or the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80 An anti-human gp130 receptor antibody having a KD value of 0.6 nM or less for the human gp130 receptor.

  The second aspect of the present invention is a polypeptide in which the VL region comprises the amino acid sequence set forth in SEQ ID NO: 76 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 76, The anti-human gp130 receptor antibody according to the first aspect, which has a KD value for human gp130 receptor of 0.3 nM or less.

  The third aspect of the present invention is the amino acid sequence having a heavy chain variable (VH) region represented by SEQ ID NO: 25 or an amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 25, In which the light chain variable (VL) region is 90% or more homologous to the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80, or the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80 And an anti-human gp130 receptor antibody capable of suppressing human IL-6 signals and signals of other cytokines belonging to the IL-6 family.

  In the fourth aspect of the present invention, the VH region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 25, and the VL region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 76, 77 or 80. The anti-human gp130 receptor antibody according to the first or third aspect.

  Furthermore, the fifth aspect of the present invention provides an anti-human gp130 receptor anti-protein comprising the amino acid sequence shown in SEQ ID NO: 25 or an amino acid sequence having 90% or more homology with the amino acid sequence shown in SEQ ID NO: 25. A polynucleotide encoding a variable body weight chain (VH) region.

  Furthermore, the sixth aspect of the present invention is an amino acid sequence represented by SEQ ID NO: 76, 77 or 80, or an amino acid sequence having 90% or more homology to the amino acid sequence represented by SEQ ID NO: 76, 77 or 80, A polynucleotide encoding an anti-human gp130 receptor antibody light chain variable (VL) region.

  The seventh aspect of the present invention is a vector comprising at least the polynucleotide according to the fifth and / or sixth aspect.

  In addition, an eighth aspect of the present invention provides a trait obtained by co-transformation with a vector comprising at least the polynucleotide according to the fifth aspect and a vector comprising at least the polynucleotide according to the sixth aspect. It is a conversion body.

  The ninth aspect of the present invention is a transformant obtained by transforming with a vector containing at least the polynucleotide according to the fifth and sixth aspects.

  According to a tenth aspect of the present invention, the transformant according to the eighth or ninth aspect is cultured to express an anti-human gp130 receptor antibody, and the transformant is expressed from the culture of the transformant. Recovering the anti-human gp130 receptor antibody, and a method for producing the anti-human gp130 receptor antibody.

  Hereinafter, the present invention will be described in detail.

  As used herein, an antibody refers to an immunoglobulin molecule comprising four polypeptide chains, that is, two heavy chains (H chains) and two light chains (L chains) linked together by disulfide bonds. To do. Each heavy chain includes a heavy chain variable (VH) region and a heavy chain constant region. The heavy chain constant region includes three domains (CH1, CH2 and CH3). Each light chain includes a light chain variable (VL) region and a light chain constant region. The light chain constant region is comprised of one domain (CL1). The VH and VL regions are further classified into complementarity determining regions (CDR) regions and highly conserved regions called framework regions (FR). As for the definition of CDR, the definitions of Kabat (Kabat et al., Sequences of Proteins of Immunological Interest 5th edition (1991)), Chothia, AbM, and contact are generally used. Is based on the definition of Each of the VH region and VL region is composed of 3 CDRs and 4 FRs, which are arranged in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 in the direction from the amino terminus to the carboxy terminus. ing.

The antibody of the present invention specifically binds to the human gp130 receptor and inhibits signal transduction of cytokines belonging to human IL-6 and other IL-6 families. The heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 15 (H Chain) and an anti-human gp130 receptor mouse monoclonal antibody having a light chain consisting of the amino acid sequence set forth in SEQ ID NO: 20 (L chain), an amino acid sequence other than CDRs is converted into an amino acid sequence derived from a human antibody ( It is an antibody that is equal to or higher than the affinity (specifically, KD value = 0.6 nM) for the human gp130 receptor possessed by the mouse monoclonal antibody. An example of the antibody of the present invention is an antibody in which the VH region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 25 and the VL region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 76 or 77.

  Among the variable regions (VH region and VL region), the FR region has the ability to bind to the human gp130 receptor (specifically, the KD value is 0.6 nM or less) or human IL-6 and other IL-6 families. As long as the activity of suppressing the signal of cytokines belonging to is retained, amino acid substitution, deletion, insertion or addition (hereinafter collectively referred to as “modification”) of one or several residues may occur. The ratio of the modification is 10% or less with respect to the entire variable region (that is, 90% or more homology with the amino acid sequence described in SEQ ID NO: 25 in the VH region, and SEQ ID NOs: 76 and 77 in the VL region). Or 90% or more homology with the amino acid sequence described in the amino acid sequence described in 80), 5% or less is preferable, and 2% or less is more preferable.

  Among the variable regions (VH region and VL region), CDR (specifically, H chain CDR1: SEQ ID NO: 17 [50th to 54th in SEQ ID NO: 15, 31st to 35th in SEQ ID NO: 25) Amino acid residues], H chain CDR2: SEQ ID NO: 18 [69th to 85th amino acid residues in SEQ ID NO: 15 and 50th to 66th amino acid residues in SEQ ID NO: 25], H chain CDR3: SEQ ID NO: 19 [SEQ ID NO: 15 In SEQ ID NO: 25, amino acid residues 99 to 109 in SEQ ID NO: 25], L chain CDR1: SEQ ID NO: 22 [46 to 55 in SEQ ID NO: 20, 24 in SEQ ID NO: 76, 77 and 80] Amino acid residues from position No. to position 33], L chain CDR2: SEQ ID NO: 23 [71 to 77 in SEQ ID NO: 20, SEQ ID NO: 76 Amino acid residues 49 to 55 in 77 and 80], L chain CDR3: SEQ ID NO: 24 [110 to 118 in SEQ ID NO: 20, amino acids from 88 to 96 in SEQ ID NO: 76, 77 and 80 Residue]) is not modified in principle, but the ability to bind to human gp130 receptor (specifically, KD value is 0.6 nM or less) or signal transduction of cytokines belonging to human IL-6 and other IL-6 families One or several residue modifications may occur as long as the inhibiting activity is retained. The ratio of the modification is preferably 30% or less for each CDR (however, in addition to the modification in the FR region, the ratio of modification to the entire variable region is 10% or less, the same applies hereinafter), and more preferably 20% or less And even more preferably 10% or less.

  In addition, the amino acid substitution mentioned above includes substitution (conservative amino acid substitution) in which the functional property is not substantially changed. Examples of conservative amino acid substitution include valine-leucine-isoleucine substitution, phenylalanine-tyrosine substitution, lysine-arginine substitution, alanine-valine substitution, glutamic acid-aspartic acid substitution, asparagine-glutamine substitution Can be substituted.

  Among the antibodies of the present invention, when the VL region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 76, the affinity for the human gp130 receptor is improved (KD value 0.3 nM or less) compared to the mouse antibody. This can be said to be a preferred embodiment of the antibody of the invention. Even if the VL region is a polypeptide having 90% or more homology with the amino acid sequence set forth in SEQ ID NO: 76 (amino acid substitution within 10% of the entire VL region has occurred), the affinity As long as it has sex (KD value for human gp130 receptor is 0.3 nM or less), it is included in a preferred embodiment of the antibody of the present invention.

When humanizing an anti-human gp130 receptor mouse antibody to obtain the antibody of the present invention, the most important point is the selection of the FR region amino acid sequence derived from the human antibody. Several methods for producing humanized antibodies have been reported so far, but can be roughly divided into three methods. The first method is a method using a human antibody frame whose three-dimensional structure has already been clarified (Riechmann L. et al., Nature 332, 323-327 (1988); Tempst, PR. Et al.,). Protein Engineering, 7, 1501-1507 (1994)). The second method is a method in which a human antibody variable region having the highest homology with the mouse antibody variable region of interest is selected from a database and the frame is used (Queen C. et al., Proc Natl Acad Sci USA). 86, 1000029-10033 (1989)). The third method is a method of selecting the most commonly used amino acid in the frame of a human antibody (Kettleborough CA. et al., Protein Engineering _, 4 _, 773-783 (1991)). Although the second method is selected in the examples of the present specification, the antibody of the present invention can also be obtained using other methods.

  Among the antibodies of the present invention, there are no particular limitations on the constant regions other than the VH region and the VL region. For example, in the case of humans, there are four types: IgG1, IgG2, IgG3, and IgG4 in the H chain constant region, and there are two types in the L chain constant region: κ chain and λ chain. The constant region of the H chain is known to affect the strength of antibody-dependent cytotoxic activity (ADCC) and complement-dependent cytotoxic activity (CDC) in vivo. Just choose. When preparing an antibody for the purpose of killing a target cell by ADCC or CDC, a subclass that increases ADCC or CDC may be selected. When an antibody that does not require ADCC or CDC is prepared, ADCC or CDC Select a lower subclass. The enhancement or reduction of ADCC or CDC in the antibody may be performed by substituting amino acid residues in the constant region of the antibody and / or changing the sugar chain added to the antibody.

Further, the antibody of the present invention may be miniaturized. By miniaturized antibody is meant a fragment of an antibody that retains the ability to specifically bind to an antigen (eg, human gp130 receptor). For example,
(I) Fab fragment: fragment consisting of VL region, VH region, CL1 domain and CH1 domain (ii) F (ab ′) ₂ fragment: fragment comprising two Fab fragments linked by disulfide bridge in hinge region (iii) Fd fragment: a fragment consisting of VH region and CH1 domain (iv) Fv fragment: a fragment consisting of VL region and VH region of a single arm of an antibody. Of these, (iv) the two regions of the Fv fragment, the VL region and the VH region, are usually encoded by separate genes, but the VL region and the VH region are paired, and both regions are bound via a synthetic linker. A linked embodiment (single chain Fv (scFv)) may be produced using a gene recombination technique.

  Since the above-described antibodies and miniaturized antibodies are proteins, polynucleotides encoding these proteins may be introduced into host cells as they are, but they are cloned into an expression vector containing a promoter or signal peptide, It is preferable to produce by culturing a transformant obtained by transforming a host. When designing a polynucleotide encoding an antibody or a miniaturized antibody, the polynucleotide is preferably converted in consideration of the codon usage in the host to be transformed. For example, when the host is Escherichia coli, AGA / AGG / CGG / CGA is used for arginine (Arg), ATA is used for isoleucine (Ile), CTA is used for leucine (Leu), and GGA is used for glycine (Gly). However, since CCC is less frequently used in proline (Pro) (because it is a so-called rare codon), it may be converted so as to avoid those codons. Analysis of codon usage frequency can also be performed by using a public database (for example, Codon Usage Database on the website of Kazusa DNA Research Institute). The host cell is not particularly limited, and examples thereof include mammalian cells (CHO (Chinese Hamster Ovaly) cells, HEK cells, Hela cells, COS cells, etc.), yeasts (Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorphism, Schizosaccharomyces octosporus, Schizosaccharomyces pombe, etc., insect cells (Sf9, Sf21 etc.), E. coli (JM109 strain, BL21 (DE3) strain, W3110 strain etc.) and Bacillus subtilis, B. subtilis, B. Among them, when expressing antibody molecules, mammalian cells are preferable, and CHO cells are particularly preferable.

  The expression vector only needs to contain a promoter or signal peptide according to the host. For example, when a mammal is used as a host, a CMV promoter, SV40 promoter, CAG promoter, and EF1α promoter can be exemplified, and signal peptides added to various secreted proteins may be combined. When E. coli is used as the host cell, T7 promoter, trc promoter, lac promoter and the like can be exemplified, and the signal peptide can be exemplified by PelB, DsbA, MalE and TorT. In addition, if necessary, a drug marker such as an antibiotic may be introduced into the expression vector in order to select a host cell into which a polynucleotide encoding the expressed protein has been introduced. Further, a marker for gene amplification (for example, dihydrofolate reductase (dhfr) gene) performed when producing a high-expression cell line in CHO cells may be included in the expression vector.

When a polynucleotide encoding the antibody of the present invention is cloned into an expression vector and a host is transformed with the vector to produce a transformant capable of expressing the antibody of the present invention,
A polynucleotide encoding a polypeptide containing the VH region of the antibody of the present invention and a polynucleotide encoding a polypeptide containing the VL region of the antibody of the present invention are cloned into different expression vectors, respectively, and then the two vectors are used as hosts. May be produced by transforming
A polynucleotide encoding a polypeptide containing the VH region of the antibody of the present invention and a polynucleotide encoding a polypeptide containing the VL region of the antibody of the present invention are cloned into one expression vector, and then the host is used with the one vector. It may be produced by co-transformation.

  The antibody expressed by culturing the transformant is produced by purifying and recovering from the transformant culture by combining affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography, etc. it can.

  The antibody of the present invention is an antibody in which the amino acid sequence other than the complementarity determining region in the amino acid sequence of the anti-human gp130 receptor mouse antibody is substituted with an amino acid sequence derived from a human antibody. The sex has dropped significantly. On the other hand, the affinity of the antibody of the present invention for the human gp130 receptor is equal to or higher than that of the mouse antibody. Therefore, the antibody of the present invention is expected to be useful for the treatment of diseases caused by abnormalities of IL-6 family cytokines (for example, autoimmune diseases such as rheumatoid arthritis).

It is a schematic diagram of a mouse antibody and an antibody of the present invention (humanized antibody). It is the figure which showed the inhibitory effect of the human IL-6 signal by the humanized miniaturized antibody. 16 is a vector map of the expression vector pEFd used in Example 15. It is the figure which showed the inhibitory effect of the human IL-6 signal by a humanized antibody.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail using an Example, this invention is not limited to the said Example.

Example 1 Preparation of Soluble Human gp130 Receptor (1) Extracellular region (region from the first methionine of SEQ ID NO: 1 to the 619th glutamic acid) of the human gp130 receptor comprising the amino acid sequence set forth in SEQ ID NO: 1. A vector for expression of was constructed by the following method.
(1-1) A restriction enzyme SacII recognition sequence (CCGCGGG) on the 5 ′ end side and 3 ′ end side of a gene encoding dihydrofolate reductase (dhfr) and SV40 PolyA consisting of the nucleotide sequence set forth in SEQ ID NO: 2 ) Was totally synthesized (consigned to Integrated DNA Technologies) and cloned into a plasmid.
(1-2) Escherichia coli JM109 strain was transformed with the plasmid prepared in (1-1). The obtained transformant was cultured, the plasmid was extracted, and digested with restriction enzyme SacII to prepare a gene encoding dhfr-SV40PolyA and named dhfr-SV40PolyA-P1.
(1-3) SEQ ID NO: 3 (5′-TCC [CCGCCG] GCGGGACTCTGGGGTTCCGAAATGACCCG-3 ′) and SEQ ID NO: 4 (5′-TCC [CCGCCGGG] GGTGCTCTAGCCCTTAAGTTCGAGACT-3 ′) using pIRES vector (Clontech) as a template PCR was carried out using oligonucleotide primers consisting of the sequences described (the brackets in SEQ ID NO: 3 and SEQ ID NO: 4 indicate the restriction enzyme SacII recognition sequence). Specifically, a reaction solution having the composition shown in Table 1 was prepared, and the reaction solution was heat-treated at 98 ° C. for 30 seconds, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction with the third step of 5 minutes at 1 ° C. as one cycle was repeated 25 times. By this PCR, a region excluding the neomycin resistance gene in the pIRES vector was amplified.

(1-4) The PCR product prepared in (1-3) was purified, digested with restriction enzyme SacII, and ligated with dhfr-SV40PolyA-P1 prepared in (1-2). Escherichia coli JM109 was transformed with the ligation product, and a plasmid was extracted from the cultured transformant to obtain an expression vector pIRES-dhfr containing the dhfr gene.

  (2) SEQ ID NO: 5 (5′-ACGC [GTCGAC] ACTAGAAGCTTTATTGCCGGTTAGTTTATCAC-3 ′) and SEQ ID NO: 6 (5′-ACGC [GTCGAC] AGATCTGTGCGCCATGGTGGACAAAG described in (1)) using pIRES-dhfr prepared in (1) as a template PCR was performed using an oligonucleotide primer having the sequence of (SEQ ID NO: 5 and square brackets in SEQ ID NO: 6 indicate the restriction enzyme SalI recognition sequence). Specifically, a reaction solution having the composition shown in Table 1 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, followed by a first step at 98 ° C. for 10 seconds, a second step at 55 ° C. for 5 seconds, 72 The reaction with the third step of 7 minutes at 1 ° C. as one cycle was repeated 30 times. By this PCR, a region excluding the CMV promoter gene of the pIRES-dhfr vector was amplified and named pIRES-dhfr-P1.

  (3) SEQ ID NO: 7 (5′-ACGC [GTCGAC] GGATCTGACATTGATTATTGACTAG-3 ′) and SEQ ID NO: 8 (5′-ACGC [GTCGGAC] CAAAATGATAGGACAGACACACAA) using pEBMulti-Neo (manufactured by Fujifilm Wako Pure Chemical Industries) as a template PCR was performed using oligonucleotide primers having the sequence described in ') (the brackets in SEQ ID NO: 7 and SEQ ID NO: 8 indicate the restriction enzyme SalI recognition sequence). Specifically, a reaction solution having the composition shown in Table 1 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction with the third step of 2 minutes at 1 ° C. as one cycle was repeated 30 times. By this PCR, a gene encoding the CAG promoter (Japanese Patent No. 2824433) contained in pEBMulti-Neo was amplified and named CAG-P1.

  (4) pIRES-dhfr-P1 prepared in (2) and CAG-P1 prepared in (3) were each digested with restriction enzyme SalI, purified and ligated. Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid was extracted from the cultured transformant to obtain an expression vector pCAG-dhfr containing a CAG promoter gene.

  (5) A polynucleotide encoding the extracellular region (the region from the first methionine to the 619th glutamic acid of SEQ ID NO: 1) of the human gp130 receptor consisting of the amino acid sequence set forth in SEQ ID NO: 1, An oligonucleotide encoding histidine and a polynucleotide (SEQ ID NO: 9) to which a restriction enzyme NheI recognition sequence (GCTAGGC) and a NotI recognition sequence (GCGGCCGC) have been added (totally consigned to FASMAC), cloned into a plasmid, and then the plasmid Was used to transform E. coli strain JM109. The obtained transformant was cultured, the plasmid was extracted, digested with restriction enzymes NheI and NotI and purified to obtain a gene encoding the extracellular region of human gp130 receptor.

  (6) The pCAG-dhfr prepared in (4) is digested with restriction enzymes NheI and NotI, the gene encoding the extracellular region of the human gp130 receptor prepared in (5) is ligated, and then the ligation product is used for Escherichia coli JM109. Strains were transformed. By extracting a plasmid from the culture of the transformant, an expression vector pCAG-hgp130 for expressing the extracellular region of the human gp130 receptor was obtained.

  (7) The pCAG-hgp130 prepared in (6) was introduced into a CHO cell (DG44 strain) using a Neon Transfection System (manufactured by Thermo Fisher Scientific). Thereafter, the transformed cells are cultured with CD OptiCHO Medium (manufactured by Thermo Fisher Scientific), gene amplification is performed using methotrexate (MTX), and then stable soluble human gp130 receptor protein-producing cells are obtained by limiting dilution. Got the stock.

(8) The cell line obtained in (7) is cultured with shaking in a CO ₂ incubator (37 ° C., 8% CO ₂ ) using CD OptiCHO Medium and Erlenmeyer flask to secrete and express soluble human gp130 receptor protein I let you. The obtained culture supernatant was dialyzed with 20 mM Tris-HCl buffer (pH 7.4) containing 20 mM imidazole and 150 mM sodium chloride, and then the supernatant obtained by removing cells and impurities by centrifugation was used. , 1 mL HisTrap HP column (GE Health) equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 20 mM imidazole and 150 mM sodium chloride using AKTAprime plus (manufactured by GE Healthcare). Applied at a flow rate of 1 mL / min. After washing with the buffer used for the equilibration, elution was performed with 20 mM Tris-HCl buffer (pH 7.4) containing 0.5 M imidazole and 150 mM sodium chloride. The eluate was buffer-exchanged with a 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride with an ultrafiltration membrane to obtain a highly pure soluble human gp130 receptor protein.

Example 2 Production of Anti-gp130 Receptor Antibody-Producing Hybridoma (1) The soluble human gp130 receptor protein produced in Example 1 was injected into the peritoneal cavity of BALB / c mice, 50 μg once every 10 days for a total of 4 times. To immunize.

  (2) Spleen cells were excised from the mice and fused with myeloma cells (SP2 / 0 strain) derived from mice using polyethylene glycol. After cell fusion, hybridomas were produced by culturing in DMEM medium (Thermo Fisher Scientific) containing HAT (Gibco) and 10% (w / v) bovine serum.

(3) The hybridoma prepared in (2) is cultured in a 96-well plate, and the culture supernatant is secreted with an antibody that binds to the human gp130 receptor protein by using Enzyme-Linked ImmunoSorbent Assay (ELISA) shown below. Wells in which hybridomas were present were selected.
(3-1) The soluble human gp130 receptor prepared in Example 1 was immobilized at 1 μg / well in a well of a 96-well microplate (overnight at 4 ° C.). After immobilization, 2% (w / v) SKIM MILK (Becton Dickinson) and 150 mM
Blocking was performed with 20 mM Tris-HCl buffer (pH 7.4) containing sodium chloride.
(3-2) A hybridoma containing an antibody after washing with a washing buffer (20 mM Tris-HCl buffer (pH 7.4) containing 0.05% [w / v] Tween 20 and 150 mM NaCl). The supernatant was added to react the antibody with the immobilized recombinant human gp130 receptor protein (1 hour at 30 ° C.).
(3-3) After completion of the reaction, the resultant was washed with the washing buffer and an anti-mouse antibody labeled with peroxidase diluted to 100 ng / mL (manufactured by Bethyl) was added at 100 μL / well.
(3-4) After reacting at 30 ° C. for 1 hour and washing with the washing buffer, TMB Peroxidase Substrate (manufactured by KPL) was added at 50 μL / well. Thereafter, the color development was stopped by adding 1 M phosphoric acid at 50 μL / well, the absorbance at 450 nm was measured using a microplate reader (manufactured by Tecan), and a hybridoma having a high measured value was selected.

(4) The following operation was performed for the hybridoma selected in (3).
(4-1) A mouse-derived anti-human gp130 receptor monoclonal AM64 antibody (JP-A-3-219944) was immobilized in each well of a 96-well plate.
(4-2) The soluble human gp130 receptor prepared in Example 1 was added to each well and allowed to bind to the human gp130 receptor antibody.
(4-3) In each well, recombinant human interleukin-6 (IL-6) (manufactured by Fujifilm Wako Pure Chemical Industries) and recombinant human IL-6 receptor (IL-6R) (manufactured by PeproTech) And the culture supernatant of each hybridoma were added simultaneously.
(4-4) An anti-IL-6R polyclonal antibody and alkaline phosphatase produced by immunizing IL-6R in guinea pigs with IL-6R immobilized through the AM64 antibody and soluble human gp130 receptor under the above conditions A labeled anti-guinea pig immunoglobulin antibody was added, and after washing, an alkaline phosphatase substrate was added to measure the IL-6 binding inhibitory effect of the antibody against the added soluble human gp130 receptor protein.
(4-5) Cells that showed the IL-6 binding inhibitory effect in (4-4) were monocloned by the limiting dilution method to obtain hybridomas. The monoclonal antibody obtained from the obtained hybridoma was named antibody A.

(5) Antibody A was prepared by the method shown below.
(5-1) The hybridoma that produces antibody A obtained in (4) is 5 150 mmφ dishes (manufactured by Sumitomo Bakelite) containing 30 mL of Hybridoma-SFM medium (Thermo Fisher Scientific). Each was cultured. After culture, the culture supernatant was obtained by centrifugation.
(5-2) Using the supernatant obtained in (5-1), 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride in advance using AKTAprime plus (manufactured by GE Healthcare). 1 ml of HiTrap Protein G HP Columns (manufactured by GE Healthcare) was applied at a flow rate of 1 mL / min.
(5-3) After washing with the buffer used for equilibration, elution was performed with 0.1 M glycine hydrochloride buffer (pH 2.8). The obtained eluate was adjusted to near neutral pH by adding 1/4 volume of 1M Tris-HCl buffer (pH 8.0). By this purification, about 5 mg of highly pure antibody A was obtained.

Example 3 Sequence Analysis of Antibody Gene (1) DMEM medium containing 100 μg / mL kanamycin and 10% (w / v) bovine serum of the hybridoma producing antibody A obtained in Example 2 (4) The cells were cultured in a culture dish of 90 mmφ to which 10 mL (Thermo Fisher Scientific) was added. When the subclass of each antibody was confirmed using the culture strip using IsoStripe Mouse Monoclonal Antibody Isotyping Kit (manufactured by Roche), it was confirmed that antibody A had an H chain of IgG1 and an L chain of κ.

  (2) The cultured cells were collected, and total RNA was extracted using RNeasy Mini Kit (manufactured by QIAGEN), and then a cDNA library was prepared using cDNA Library Construction Kit (manufactured by Takara Bio Inc.).

(3) The antibody gene was amplified by PCR using the cDNA library prepared in (2) as a template.
Specifically, for amplification of the heavy chain (H chain) gene of antibody A, a hybridoma cDNA library expressing antibody A was used as a template, and SEQ ID NO: 10 (5′-GCATA [GAATTC] CCCGGG was used as a PCR primer. -3 ′) and an oligonucleotide consisting of the sequence described in SEQ ID NO: 11 (5′-ATGAAT [GCGGCCGC] TCATTTACCAGGAGATGGGGAGAGCTCCTTC-3 ′). Square brackets indicate restriction enzyme NotI recognition sequence).
In addition, the light chain (L chain) gene of antibody A was amplified using a cDNA library of a hybridoma that expresses antibody A as a template, and SEQ ID NO: 10 and SEQ ID NO: 12 (5′-ATGAAT [GCGGCCGC]) as PCR primers. CTAACACTCATTCCTGTTTGAAGCTCTTGAC-3 ′) was used as an oligonucleotide (the brackets in SEQ ID NO: 12 indicate the restriction enzyme NotI recognition sequence).
For PCR, a reaction solution having the composition shown in Table 2 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, and at 72 ° C. The reaction with 3 steps of 1.5 minutes as 1 cycle was repeated 30 times.

  (4) The PCR product obtained in (3) is purified, digested with restriction enzymes EcoRI and NotI, ligated to the expression vector pAP3neo (manufactured by Takara Bio Inc.) previously digested with restriction enzymes EcoRI and NotI, and the ligation product Was used to transform E. coli strain JM109.

  (5) The vector pAP-AH capable of expressing the heavy chain of antibody A using QIAprep Spin Miniprep kit (manufactured by QIAGEN) after culturing the obtained transformant in an LB medium containing 100 μg / mL ampicillin. And a vector pAP-AL capable of expressing the light chain was extracted.

  (6) Among the expression vectors prepared in (5), a region around the gene encoding the H chain and L chain of antibody A was used for BigDye Terminator Ver. Based on the chain terminator method. 3.1 Cycle sequencing reaction was performed using Cycle Sequencing Kit (Applied Biosystems), and nucleotide sequence was analyzed with a fully automatic DNA sequencer ABI Prism 3700 DNA analyzer (Applied Biosystems). In the analysis, an oligonucleotide having the sequence described in SEQ ID NO: 13 (5'-TAATACGACTCACTATAGGGG-3 ') or SEQ ID NO: 14 (5'-ATTAACCCTCACTAAAGGGCG-3') was used as a sequencing primer.

  The amino acid sequence of the antibody A heavy chain polypeptide expressed by the expression vector pAP-AH is shown in SEQ ID NO: 15, and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO: 16, respectively. According to the definition of Kabat, the complementarity-determining region (CDR) of the antibody A heavy chain polypeptide consisting of the sequence set forth in SEQ ID NO: 15 is the 54th from the 50th aspartic acid (Asp). The region from aspartic acid (Asp) (SEQ ID NO: 17, CDR1), the region from 69th aspartic acid (Asp) to 85th aspartic acid (Asp) (SEQ ID NO: 18, CDR2) and 118th threonine ( Thr) to the 128th tyrosine (Tyr) (SEQ ID NO: 19, CDR3).

  The amino acid sequence of the antibody A light chain polypeptide expressed by the expression vector pAP-AL is shown in SEQ ID NO: 20, and the sequence of the polynucleotide encoding the polypeptide is shown in SEQ ID NO: 21, respectively. Of the antibody A light chain polypeptide consisting of the sequence shown in SEQ ID NO: 20, CDR is the region from 46th asparagine (Asn) to 55th tyrosine (Tyr) (SEQ ID NO: 22, CDR1), 71st A region from leucine (Leu) to 77th serine (Ser) (SEQ ID NO: 23, CDR2) and a region from 110th glutamine (Gln) to 118th threonine (Thr) (SEQ ID NO: 24, CDR3) .

Example 4 Humanization of VH region of antibody A In the amino acid sequence shown in SEQ ID NO: 15, the amino acid residues from the 20th glutamic acid (Glu) to the 139th serine (Ser) are variable in the heavy chain of antibody A ( VH) region. As described above, in the amino acid sequence shown in SEQ ID NO: 15, the 50th aspartic acid (Asp) to the 54th aspartic acid (Asp) are from CDR1 of the heavy chain of antibody A, and the 69th aspartic acid (Asp). The 85th aspartic acid (Asp) is the CDR2 of the heavy chain of antibody A, and the 118th threonic acid (Thr) to the 128th tyrosine (Tyr) are the CDR3 of the heavy chain of antibody A. Therefore, the framework region (FR) 1 from the 20th glutamic acid (Glu) to the 49th threonine (Thr), the FR2 from the 55th tryptophan (Trp) to the 68th glycine (Gly), the 86th lysine For the amino acid sequences of FR3 from (Lys) to 117th arginine (Arg) and FR4 from 129th tryptophan (Trp) to 139th serine (Ser), an amino acid sequence derived from a human antibody was designed, A polynucleotide encoding the amino acid sequence was generated.

  (1) Regarding the amino acid sequences of the four FRs described above, the amino acid sequence of the mouse antibody (antibody A) is changed to the amino acid sequence of the human antibody (hereinafter also referred to as humanized antibody A). (Chemical Computing Group). The amino acid sequence of the designed VH region (hAH1) of humanized antibody A is shown in SEQ ID NO: 25, and the sequence of the polynucleotide encoding hAH1 is shown in SEQ ID NO: 26.

  (2) The restriction enzyme EcoRI recognition sequence (GAATTC) and NheI recognition in the polynucleotide (polynucleotide consisting of the sequence described in SEQ ID NO: 26) encoding the VH region (hAH1) of humanized antibody A designed in (1) Polynucleotides added with the sequence (GCTAGC) and adjusted so as not to undergo frame shift after cloning were totally synthesized (consigned to FASMAC) and cloned into plasmids, respectively.

  (3) SEQ ID NO: 27 (5′-TTTAAAATCA [GCGGCCGC] GCAGCACCATGGCCTGAAATAACCTCTCTG-3 ′) and SEQ ID NO: 28 (5′-GCAATAGAAACCTCTACAATGTGGTAAAA-CGTGAAAA ) By using an oligonucleotide primer having the sequence described in (1), a square bracket in SEQ ID NO: 27 represents a restriction enzyme NotI recognition sequence, and a square bracket in SEQ ID NO: 28 represents a restriction enzyme PvuI recognition sequence). I did it. Specifically, a reaction solution having the composition shown in Table 3 was prepared, and the reaction solution was heat-treated at 98 ° C. for 1 minute, followed by a first step at 98 ° C. for 10 seconds, a second step at 55 ° C. for 5 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. The PCR product amplified by this PCR (SV40 promoter, dhfr, SV40 region up to PolyA) was named dhfr-P1.

  (4) pFUSEss-CHIg-hG1 (manufactured by InvivoGen) containing the heavy chain constant region of human antibody, pFUSE2ss-CLIg-hk (manufactured by InvivoGen) containing the light chain constant region of human antibody and (3) The dhfr-P1 was digested and purified with restriction enzymes NotI and PvuI, respectively, and ligated. Escherichia coli JM109 strain was transformed with the ligation product, and plasmids were extracted from the cultured transformants to obtain pFUSEss-CHIg-hG1 and pFUSE2ss-CLIg-hk containing SV40 promoter, dhfr and SV40 PolyA. . A plasmid in which SV40 promoter, dhfr and SV40 PolyA were incorporated into pFUSEss-CHIg-hG1 was named pFU-CHIg-dhfr, and pFUSE2ss-CLIg-hk was incorporated with SV40 promoter, dhfr and SV40 PolyA into pFU. -It was named CLIg-dhfr.

  (5) Escherichia coli JM109 strain was transformed with the plasmid prepared in (2) and containing the polynucleotide encoding hAH1. The obtained transformant was cultured, extracted with a plasmid, and digested with restriction enzymes EcoRI and NheI to prepare a polynucleotide encoding hAH1 (polynucleotide containing the sequence described in SEQ ID NO: 26).

  (6) The pFU-CHIg-dhfr produced in (4) was digested and purified with restriction enzymes EcoRI and NheI, and then ligated with the polynucleotide prepared in (5). Escherichia coli JM109 strain was transformed with the ligation product, and the plasmid was extracted from the cultured transformant to prepare a plasmid expressing the heavy chain (H chain) of humanized antibody A.

  Among the prepared plasmids, a plasmid containing a polynucleotide (SEQ ID NO: 26) encoding hAH1 (SEQ ID NO: 25) was named pFU-hAH1.

Example 5 Construction of Miniaturized Antibody (Fab) Expression Vector (Part 1)
A vector capable of expressing hAH1 and the L chain of antibody A was constructed by the method described below.

  (1) SEQ ID NO: 29 (5′-GAG [CCATGG] GCCAGGTTCAACTCCAGCAACCAGG-3 ′) and SEQ ID NO: 30 (5′-ATT [AAGCTT] ATTTATCGTTCTCTTTAATGCGCCACAAGATTTGGCTCAACTTTGGGCTCAACT TGGCTCCAACT) PCR was carried out using primers (the brackets in SEQ ID NO: 29 represent the restriction enzyme NcoI recognition sequence, and the brackets in SEQ ID NO: 30 represent the restriction enzyme HindIII recognition sequence). Specifically, a reaction solution having the composition shown in Table 3 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 15 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. By this PCR, a polynucleotide encoding a constant region necessary for Fab expression and a FLAG tag (DYKDDDDK) added to hAH1 was amplified, and the resulting PCR product was named hAH1-FLAG-P.

  (2) hAH1-FLAG-P and pET26b (manufactured by Novagen) obtained in (1) were digested with restriction enzymes NcoI and HindIII, respectively, and ligated after purification. Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid was extracted from the cultured transformant to obtain pET-hAH1 containing hAH1.

  (3) Using pET-hAH1 obtained in (2) as a template, SEQ ID NO: 31 (5′-ATT [GAATTC] TATGAAATACCTGCTGCCGACCGC-3 ′) and SEQ ID NO: 32 (5′-ATT [AAGCTT] <GCGGCCGC> TTATTTATCGTGTGTCATTGTA 3 ′) an oligonucleotide primer comprising the sequence described above (the brackets in SEQ ID NO: 31 indicate the restriction enzyme EcoRI recognition sequence, the brackets in SEQ ID NO: 32 indicate the restriction enzyme HindIII recognition sequence, and the angle brackets indicate the restriction enzyme NotI. PCR was performed using the recognition sequences shown). Specifically, a reaction solution having the composition shown in Table 3 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. By this PCR, a polynucleotide encoding the amino acid sequence of PelB signal + hAH1 + part of constant region + FLAG tag (DYKDDDDK) was amplified, and the resulting PCR product was named PelB-hAH1-P.

  (4) PelB-hAH1-P and pUC118 (manufactured by Takara Bio Inc.) obtained in (3) were digested with restriction enzymes EcoRI and HindIII, respectively, purified and then ligated. Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid was extracted from the cultured transformant to obtain pUC-hAH1 containing hAH1.

  (5) SEQ ID NO: 33 (5′-GCC [CTCGAG] CAAAGTGTTCTCCAGTCTCCCAGC-3 ′) and SEQ ID NO: 34 (5′-ATA [AAGCTT] CTAACACTCATTCCTGTTTGAAGCTC-3 using the pAP-AL obtained in Example 3 (5) as a template PCR is carried out using an oligonucleotide primer comprising the sequence described in ') (the square brackets in SEQ ID NO: 33 represent a restriction enzyme XhoI recognition sequence, and the square brackets in SEQ ID NO: 34 represent a restriction enzyme HindIII recognition sequence). Was done. Specifically, a reaction solution having the composition shown in Table 4 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. By this PCR, a polynucleotide encoding the amino acid sequence of the L chain of antibody A was amplified, and the resulting PCR product was named AL-P.

  (6) SEQ ID NO: 35 (5′-TAT [GCGGCCGC] GGGAATTGTGAGGCGATATACAATTCC-3 ′) and SEQ ID NO: 36 (5′-GAGAACACTTTTG [CTCGAG] GGCCATGCCCGCTGGGGGAGAGCG-described from SEQ ID NO: 3) using pET26b (manufactured by Novagen) as a template PCR was performed using the following oligonucleotide primer (the square brackets in SEQ ID NO: 35 represent the restriction enzyme NotI recognition sequence, and the square brackets in SEQ ID NO: 36 represent the restriction enzyme XhoI recognition sequence). Specifically, a reaction solution having the composition shown in Table 4 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 15 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. By this PCR, a polynucleotide encoding a ribosome binding site and a PelB signal necessary for gene expression was amplified, and the resulting PCR product was named PelB-P.

(7) AL-P obtained in (5) and PelB-P obtained in (6) contain overlapping portions. Thus, PCR was performed using these two (AL-P and PelB-P) as templates and oligonucleotide primers having the sequences described in SEQ ID NO: 35 and SEQ ID NO: 34. Specifically, a reaction solution having the composition shown in Table 5 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, followed by a first step at 98 ° C. for 10 seconds, a second step at 55 ° C. for 15 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. A polynucleotide encoding ribosome binding site, PelB signal and AL necessary for gene expression was amplified by this PCR, and the obtained PCR product was named Pel-AL-P.

(8) Pel-AL-P obtained in (7) and pUC-hAH1 obtained in (4) were digested with restriction enzymes NotI and HindIII, respectively, and ligated after purification. An Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid was extracted from the cultured transformant, whereby a Fab expression vector pUC containing hAH1, part of the constant region of human IgG1, and the L chain of antibody A (mouse). -Fab-hAH1mAL was obtained.

Example 6 Construction of Miniaturized Antibody (Fab) Expression Vector (Part 2)
The pUC-Fab-hAH1mAL obtained in Example 5 (8) has a humanized H chain, while the L chain uses the L chain of antibody A (mouse). Therefore, a miniaturized mouse antibody A expression vector was prepared by replacing the humanized H chain (hAH1) with the H chain of antibody A (mouse).

  (1) SEQ ID NO: 37 (5′-AGTG [TGGCCA] AAGAGGTCCCTGCTGCAACAGTCTGGG-3 ′) and SEQ ID NO: 38 (5′-TCA [GCGGGCATGCTCTCATTGCTGTCTCTCTGTAGCTGTCTCTCTATGATCGTCCATTGTATGATCGTCCATTGTATGATCG] PCR is carried out using an oligonucleotide primer comprising the sequence described in ') (the brackets in SEQ ID NO: 37 indicate the restriction enzyme MscI recognition sequence, and the brackets in SEQ ID NO: 38 indicate the restriction enzyme NotI recognition sequence). Was done. Specifically, a reaction solution having the composition shown in Table 3 was prepared, and the reaction solution was heat-treated at 98 ° C. for 1 minute, followed by a first step at 98 ° C. for 10 seconds, a second step at 55 ° C. for 5 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. The PCR product amplified by this PCR (mouse antibody A H chain + FLAG tag) was named mAH-P.

(2) The mAH-P obtained in (1) and the pUC-Fab-hAH1mAL obtained in Example 5 (8) were digested with restriction enzymes MscI and NotI, respectively, purified and then ligated. The Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid was extracted from the cultured transformant, so that a Fab expression vector pUC-Fab-mAHmAL containing a part of the H chain of antibody A and the L chain of antibody A was obtained. Obtained.

Example 7 Preparation of Miniaturized Antibody (Fab) The miniaturized antibody was expressed from the expression vectors obtained in Examples 5 and 6 by the method described below.

  (1) Escherichia coli strain JM109 transformed with pUC-Fab-hAH1mAL obtained in Example 5 (8) or pUC-Fab-mAHmAL obtained in Example 6 (2) was treated with 0.1% (w / v ) Glucose and 100 μg / L carbenicillin added 3 mL of 2 × YT medium (16 g / L tryptone, 10 g / L yeast extract, 5 g / L sodium chloride), respectively, and shaking culture at 37 ° C. overnight. did.

  (2) Each cultured transformant was added to 2 × YT medium supplemented with 20 mL of 0.1% (w / v) glucose and 100 μg / L carbenicillin in 4 100 mL baffle flasks per sample. Inoculated and cultured with shaking at 37 ° C. for 3 hours.

  (3) After changing the culture temperature to 30 ° C. and shaking culture for 30 minutes, IPTG (isopropyl-β-thiogalactopyranoside) was added to a final concentration of 1 mM, and the culture was further continued for 20 hours. After completion of the culture, the cells and the culture supernatant were separated by centrifuging at 8000 rpm for 20 minutes at 4 ° C. to obtain a culture supernatant.

(4) The miniaturized antibody was purified from the culture supernatant obtained in the culture of (3) by the following method.
(4-1) 0.5 mL of anti-FLAG M2 affinity gel (manufactured by Sigma-Aldrich) equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride was cultured in (3). The obtained culture supernatant was added.
(4-2) After washing with the buffer used for equilibration in (4-1), elution was performed with 4 mL of 0.1 M glycine hydrochloride buffer (pH 3.0). Immediately after elution, the pH was returned to the neutral range by adding 1/4 volume of 1M Tris-HCl buffer (pH 8.0).
(4-3) A 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride was added to the eluate neutralized in (4-2) using a 10 KDa cut ultrafiltration membrane (Millipore). The solution was concentrated while exchanging the buffer.

  About 0.3 mg of a miniaturized mouse antibody A expressed from pUC-Fab-mAHmAL (Example 6) purified to a high purity by the above-mentioned method, and an H chain expressed from pUC-Fab-hAH1 mAL (Example 5) About 0.1 mg of a miniaturized antibody (hereinafter also referred to as hAH1mAL) in which the humanized H chain (hAH1) and L chain are L chains of antibody A (mouse) were prepared.

Example 8 Affinity of Miniaturized Antibody (Fab) (1) Each miniaturized antibody prepared in Example 7 (4) was 8 μg / mL, 4 μg in HBS-EP + buffer (GE Healthcare). / ML, 2 μg / mL, 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL and 0.125 μg / mL.

  (2) The human gp130 receptor prepared in Example 1 was diluted with 10 mM acetate buffer (pH 5.0) to 10 μg / mL, and amine coupling method to sensor chip CM5 (manufactured by GE Healthcare). (Immobilization amount 352RU equivalent).

  (3) A dilute solution of each miniaturized antibody prepared in (1) is flowed to a chip on which human gp130 receptor is immobilized under the conditions of a contact time of 200 seconds, a dissociation time of 800 seconds, a flow rate of 30 μL / min, and a temperature of 25 ° C. The interaction with the immobilized human gp130 receptor was measured with Biacore T200 (manufactured by GE Healthcare). The chip after measurement was regenerated by washing with 0.1 M glycine hydrochloride buffer (pH 3.0).

As a result of analyzing the affinity of the obtained measurement results using analysis software, the affinity of the miniaturized mouse antibody A is ka = 1.41 × 10 ⁵ [1 / Ms], kd = 8.42 × 10 ^{−. 5} [1 / s], KD = 5.98 × 10 ⁻¹⁰ [M] (0.60 nM). Among the miniaturized mouse antibodies A, the affinity of the miniaturized antibody hAH1mAL obtained by humanizing the VH region is ka = It was 1.78 × 10 ⁵ [1 / Ms], kd = 8.21 × 10 ⁻⁵ [1 / s], KD = 4.60 × 10 ⁻¹⁰ [M] (0.46 nM). From this, it was found that the affinity of hAH1mAL for the gp130 receptor is almost equivalent to that of the mouse-derived antibody (antibody A).

Example 9 Humanization of VL region of antibody A (sequence design)
The amino acid residue from the 23rd glutamine (Gln) to the 127th leucine (Leu) in the amino acid sequence shown in SEQ ID NO: 20 is the light chain variable (VL) region of antibody A. As described above, the 46th asparagine (Asn) to 55th tyrosine (Tyr) of the amino acid sequence shown in SEQ ID NO: 20 is the CDR1 of the light chain of antibody A, the 77th from the 71st leucine (Leu). The serine (Ser) of the antibody A is the CDR2 of the L chain of the antibody A, and the 110th glutamine (Gln) to the 118th threonine (Thr) is the CDR3 of the L chain of the antibody A. Therefore, the framework region (FR) 1 from the 23rd glutamine (Gln) to the 45th cysteine (Cys), the FR2 from the 56th tryptophan (Trp) to the 70th tyrosine (Tyr), the 78th glycine For the amino acid sequences of FR3 from (Gly) to 109th cysteine (Cys) and FR4 from 119th phenylalanine (Phe) to 127th leucine (Leu), an amino acid sequence derived from a human antibody was designed, A polynucleotide encoding the amino acid sequence was generated.

  (1) The above-mentioned four FR amino acid sequences are changed from mouse antibody amino acid sequences to human antibody amino acid sequences (hereinafter also referred to as humanized antibody A), and the integrated computational chemistry system "MOE" (Chemical Computing Group) Designed). Of the 13 designed humanized antibody A VL regions (named AVL1 to AVL13, respectively), the amino acid sequence of AVL1 is SEQ ID NO: 39, the sequence of the polynucleotide encoding AVL1 is SEQ ID NO: 40, and the amino acid sequence of AVL2 The sequence is SEQ ID NO: 41, the sequence of the polynucleotide encoding AVL2 is SEQ ID NO: 42, the amino acid sequence of AVL3 is SEQ ID NO: 43, the sequence of the polynucleotide encoding AVL3 is SEQ ID NO: 44, and the amino acid sequence of AVL4 is In SEQ ID NO: 45, the sequence of the polynucleotide encoding AVL4 is SEQ ID NO: 46, the amino acid sequence of AVL5 is SEQ ID NO: 47, the sequence of the polynucleotide encoding AVL5 is SEQ ID NO: 48, and the amino acid sequence of AVL6 is SEQ ID NO: 49 shows the arrangement of the polynucleotide encoding AVL6. SEQ ID NO: 50, the amino acid sequence of AVL7 in SEQ ID NO: 51, the sequence of the polynucleotide encoding AVL7 in SEQ ID NO: 52, the amino acid sequence of AVL8 in SEQ ID NO: 53, and the sequence of the polynucleotide encoding AVL8 No. 54, the amino acid sequence of AVL9 in SEQ ID NO: 55, the sequence of the polynucleotide encoding AVL9 in SEQ ID NO: 56, the amino acid sequence of AVL10 in SEQ ID NO: 57, and the sequence of the polynucleotide encoding AVL10 in SEQ ID NO: 58 The amino acid sequence of AVL11 is SEQ ID NO: 59, the sequence of the polynucleotide encoding AVL11 is SEQ ID NO: 60, the amino acid sequence of AVL12 is SEQ ID NO: 61, the sequence of the polynucleotide encoding AVL12 is SEQ ID NO: 62, The amino acid sequence of AVL13 is SEQ ID NO: 3, in SEQ ID NO: 64 sequence of the polynucleotide encoding AVL13, respectively.

  (2) A restriction enzyme EcoRI recognition sequence (GAATTC) and a BsiWI recognition sequence (GATITC) and a polynucleotide shown in SEQ ID NOs: 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62 and 64 ( Polynucleotides added with CGTACG) and adjusted so as not to undergo frame shift after cloning were totally synthesized (consigned to FASMAC) and cloned into plasmids.

  (3) Escherichia coli JM109 strain was each transformed with the plasmid prepared in (2) and containing 13 kinds of polynucleotides encoding the VL region of humanized antibody A. The obtained transformant was cultured, extracted with a plasmid, and then digested with restriction enzymes EcoRI and BsiWI, so that polynucleotides encoding VL regions of 13 types of humanized antibody A (SEQ ID NOs: 40, 42, 44, 46) were obtained. , 48, 50, 52, 54, 56, 58, 60, 62 and 64).

  (4) Polynucleotides encoding the VL regions of 13 humanized antibodies A prepared in (3) after digesting and purifying pFU-CLIg-dhfr prepared in Example 4 (4) with restriction enzymes EcoRI and BsiWI And ligated respectively. Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid expressing the humanized antibody A L chain was prepared by extracting the plasmid from the cultured transformant.

  Among the prepared plasmids, a plasmid containing a polynucleotide (SEQ ID NO: 40) encoding AVL1 (SEQ ID NO: 39) is named pFU-AL1, and a polynucleotide (SEQ ID NO: 42) encoding AVL2 (SEQ ID NO: 41) is designated as pFU-AL1. The plasmid containing is named pFU-AL2 and the plasmid containing the polynucleotide (SEQ ID NO: 44) encoding AVL3 (SEQ ID NO: 43) is named pFU-AL3 and the polynucleotide encoding AVL4 (SEQ ID NO: 45) (SEQ ID NO: 45) The plasmid containing No. 46) is named pFU-AL4, and the plasmid containing the polynucleotide (SEQ ID No. 48) encoding AVL5 (SEQ ID No. 47) is designated pFU-AL5 and encodes AVL6 (SEQ ID No. 49). A plasmid containing the polynucleotide (SEQ ID NO: 50) is designated pF. -A plasmid designated as AL6 and containing a polynucleotide (SEQ ID NO: 52) encoding AVL7 (SEQ ID NO: 51) was designated pFU-AL7 and a polynucleotide (SEQ ID NO: 54) encoding AVL8 (SEQ ID NO: 53) The plasmid containing is named pFU-AL8 and the plasmid containing the polynucleotide (SEQ ID NO: 56) encoding AVL9 (SEQ ID NO: 55) is named pFU-AL9 and the polynucleotide encoding AVL10 (SEQ ID NO: 57) (sequence The plasmid containing No. 58) is named pFU-AL10, and the plasmid containing the polynucleotide (SEQ ID NO: 60) encoding AVL11 (SEQ ID NO: 59) is named pFU-AL11 and encodes AVL12 (SEQ ID NO: 61). A plasmid containing the polynucleotide (SEQ ID NO: 62) Named FU-AL12, a plasmid containing a polynucleotide encoding a AVL13 (SEQ ID NO: 63) (SEQ ID NO: 64) was designated pFU-AL13.

Example 10 Humanization of VL region of antibody A (frame library preparation)
From the plasmid containing the polynucleotide encoding the VL region of humanized antibody A obtained in Example 9, a frame library was prepared by the following method.

  (1) Among the 13 types of plasmids in which the L chains of humanized antibody A prepared in Example 9 were cloned, pFU-AL1, pFU-AL2, pFU-AL3, pFU-AL4, pFU-AL5, pFU-AL6 , PFU-AL7, pFU-AL8, and pFU-AL9 mixed at 50 ng / μL, respectively, as a template, SEQ ID NO: 65 (5′-ATTA [CTCGAG] GACATTCAGATGAACTCAGTCT-3 ′) and SEQ ID NO: 66 (5 PCR was performed using an oligonucleotide having the sequence described in '-GAGGTTACGGAGGAGCTCACGTTT-3') as a primer (the brackets in SEQ ID NO: 65 indicate the restriction enzyme XhoI recognition sequence). For PCR, a reaction solution having the composition shown in Table 4 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, followed by a first step at 98 ° C. for 10 seconds, a second step at 55 ° C. for 5 seconds, and 30 ° C. at 72 ° C. The reaction was repeated 30 cycles, with the third step of seconds as one cycle. The obtained PCR product encodes FR1 out of 4 FRs in the variable region of the humanized L chain, and this was named AL-FR1A.

  (2) Among the 13 types of plasmids in which the L chain of humanized antibody A prepared in Example 9 was cloned, pFU-AL10, pFU-AL11, and pFU-AL12 were mixed so that each would be 50 ng / μL. As a template and an oligonucleotide consisting of the sequence described in SEQ ID NO: 67 (5′-ATTA [CTCGAG] GAGATGTGCTCGACTCAGTTCCCAG-3 ′) and SEQ ID NO: 66 as a primer (the brackets in SEQ ID NO: 67 indicate the restriction enzyme XhoI recognition sequence) PCR was performed in the same manner as (1). The obtained PCR product encodes FR1 out of four FRs in the variable region (VL region) of the humanized L chain, and this was named AL-FR1B.

  (3) Among the 13 types of plasmids in which the L chain of humanized antibody A prepared in Example 9 was cloned, pFU-AL13 was adjusted to 50 ng / μL as a template, and SEQ ID NO: 68 (5 '-ATTA [CTCGAG] GAGCTGGTGCTGACTCAGAG-3') and an oligonucleotide consisting of the sequence described in SEQ ID NO: 66 as a primer (the square brackets in SEQ ID NO: 68 indicate the restriction enzyme XhoI recognition sequence) and PCR (1) It carried out like. The obtained PCR product encodes FR1 out of four FRs in the variable region (VL region) of the humanized L chain, and this was named AL-FR1C.

  (4) SEQ ID NO: 69 (5′-AACGTGAGCTCCCTCCGTACACCTC-3) using as a template a mixture of the 13 types of humanized antibody A L-chain plasmids prepared in Example 9 mixed at 50 ng / μL. PCR was performed in the same manner as (1) except that oligonucleotides having the sequences described in ') and SEQ ID NO: 70 (5'-AGATGCCCAGATTGGAGGTCAG-3') were used as primers. The obtained PCR product encodes FR2 out of 4 FRs in the variable region of the humanized L chain, and was named AL-FR2.

  (5) SEQ ID NO: 71 (5′-CTGACCTCCAATCTGGCATCT-3) using as a template a mixture of the 13 types of humanized antibody A L-chain plasmids prepared in Example 9 mixed at 50 ng / μL. PCR was carried out in the same manner as in (1) except that oligonucleotides having the sequences described in ') and SEQ ID NO: 72 (5'-GTCAAGGGATTGGTGGACCACTGCTG-3') were used as primers. The obtained PCR product encodes FR3 out of 4 FRs in the variable region of the humanized L chain, and was named AL-FR3.

  (6) SEQ ID NO: 73 (5′-CAGCAGTGGTCCACCAATCCCTTGAC-3) using as a template a mixture of the 13 types of humanized antibody A L-chain plasmids prepared in Example 9 mixed at 50 ng / μL. ') And an oligonucleotide having the sequence described in SEQ ID NO: 74 (5'-GAT [AAGCTT] CTAACACTCTCCCCCTGTTTAGAGCT-3') as a primer (the brackets in SEQ ID NO: 74 indicate the restriction enzyme HindIII recognition sequence). Except for the above, PCR was performed in the same manner as in (1). The obtained PCR product encodes FR4 and the constant region among four FRs in the variable region of the humanized L chain, and was named AL-FR4.

  (7) Using the PCR products (AL-FR1A, AL-FR2, AL-FR3 and AL-FR4) obtained in (1), (4), (5) and (6) as templates, SEQ ID NO: 65 and SEQ ID NO: PCR was performed using an oligonucleotide having the sequence of No. 74 as a primer. Specifically, a reaction solution having the composition shown in Table 5 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction in which the third step of 1 minute at 1 ° C. was 1 cycle was repeated 30 times. AL-FR1A, AL-FR2, AL-FR3, and AL-FR4 each contain an overlapping region, and the obtained PCR product is an L-chain of antibody A in which the L-chain frame region has been humanized into a library. This was named hAL1A.

  (8) Using the PCR products (AL-FR1B, AL-FR2, AL-FR3 and AL-FR4) obtained in (2), (4), (5) and (6) as templates, SEQ ID NO: 67 and sequence PCR was carried out in the same manner as in (7) except that the oligonucleotide having the sequence of No. 74 was used as a primer, and the obtained PCR product was a humanized L chain frame region of antibody A which was made into a library. It encodes the L chain and was named hAL1B.

  (9) Using the PCR products (AL-FR1C, AL-FR2, AL-FR3 and AL-FR4) obtained in (3), (4), (5) and (6) as templates, SEQ ID NO: 68 and SEQ ID NO: PCR was carried out in the same manner as in (7) except that the oligonucleotide having the sequence of No. 74 was used as a primer, and the obtained PCR product was a humanized L chain frame region of antibody A which was made into a library. It encodes the L chain and was named hAL1C.

  (10) The PCR products obtained in (7), (8) and (9), hAL1A, hAL1B and hAL1C are purified, digested with restriction enzymes XhoI and HindIII, and similarly with restriction enzymes XhoI and HindIII. The digested and purified product was ligated with pUC-Fab-hAH1mAL prepared in Example 5 (8). By transforming E. coli JM109 strain with the obtained ligation product and spreading it on LB plate medium containing 100 μg / mL carbenicillin, the humanized L chain frame region of antibody A was humanized and became a library. A colony of a chain frame library was obtained.

Example 11 Screening of Humanized Antibody A (Part 1)
(1) The humanized L chain frame library colony obtained in Example 10 was treated with 2 × YT medium containing 100 μL / mL carbenicillin and 0.1% (w / v) glucose in each well. A 96-well deep well plate containing 200 μL was inoculated and cultured overnight at 37 ° C. and 1300 rpm with shaking.

  (2) Transformant cultured in (1) in a 96-well deep well plate containing 500 μL of 2 × YT medium containing 100 μL / mL carbenicillin and 0.1% (w / v) glucose in advance. Was inoculated, and cultured with shaking at 37 ° C. and 1300 rpm for 2 hours.

  (3) After changing the temperature to 30 ° C. and culturing with shaking for 0.5 hours, 11 mM IPTG (IsoProyl β-D-1-ThioGalactopyranoside), 100 μL / mL carbenicillin and 0.1% (w / v) glucose 2 × YT medium containing 25 μL / well was added (IPTG at a final concentration of 0.5 mM). After culture overnight at 37 ° C. and 1300 rpm, the culture supernatant containing humanized antibody A expressed in the form of a miniaturized antibody (Fab) was obtained by centrifugation at 2500 rpm for 20 minutes at 4 ° C.

  (4) Example 2 (except that the culture supernatant obtained in (3) was used as a sample and an anti-FLAG tag antibody (manufactured by Rockland Immunochemicals) labeled with peroxidase was used as a detection antibody. ELISA was performed in the same manner as described in 3), and clones showing the ability to bind to the human gp130 receptor were selected. Selected clones were cultured and plasmids were extracted.

  (5) Example 3 (Example 3) except that the plasmid obtained in (4) was used as a sample and the oligonucleotide having the sequence described in SEQ ID NO: 75 (5′-CACCTCTCACTGTACTTTGCC-3 ′) was used as a sequence primer. Sequence analysis was performed in the same manner as described in 6).

  As a result of sequence analysis, an L chain in which the L chain variable region of antibody A was the amino acid sequence described in SEQ ID NO: 76 and SEQ ID NO: 77 was obtained. A Fab expression vector containing a polynucleotide encoding the amino acid sequence set forth in SEQ ID NO: 76 (SEQ ID NO: 78) is designated as pUC-Fab-hAH1hAL1, and a polynucleotide encoding the amino acid sequence set forth in SEQ ID NO: 77 (SEQ ID NO: 79). ) Was designated as pUC-Fab-hAH1hAL2. Since the polynucleotide encoding the VH region contained in these expression vectors is a polynucleotide encoding hAH1 (SEQ ID NO: 25), which is the VH region of humanized antibody A, a miniaturized antibody (Fab) to be expressed. Is humanized in both VH region and VL region.

Example 12 Affinity of humanized antibody A (part 1)
(1) The Escherichia coli JM109 strain transformed with the expression vectors pUC-Fab-hAH1hAL1 and pUC-Fab-hAH1hAL2 obtained in Example 11 was cultured in the same manner as in Examples 7 (1) to (3). Then, Fab was expressed, and purified and concentrated in the same manner as in Example 7 (4). About 20 μg of a miniaturized antibody (hereinafter also referred to as hAH1hAL1) obtained from pUC-Fab-hAH1hAL1 and having a VH region consisting of the amino acid sequence set forth in SEQ ID NO: 25 and a VL region consisting of the amino acid sequence set forth in SEQ ID NO: 76; About 10 μg of a miniaturized antibody (hereinafter also referred to as hAH1hAL2) obtained from pUC-Fab-hAH1hAL2 and having a VH region consisting of the amino acid sequence shown in SEQ ID NO: 25 and a VL region consisting of the amino acid sequence shown in SEQ ID NO: 77 Respectively.

  (2) The affinity of hAH1hAL1 and hAH1hAL2 for human gp130 receptor was measured in the same manner as in Example 8 except that the amount of human gp130 receptor immobilized on sensor chip CM5 was 235.2 RU.

As a result, the affinity of the miniaturized antibody hAH1hAL1 is ka = 2.57 × 10 ⁵ [1 / Ms], kd = 5.60 × 10 ⁻⁵ [1 / s], KD = 2.18 × 10 ⁻¹⁰ [M ] (0.22 nM). The affinity of the miniaturized antibody hAH1hAL2 is ka = 1.19 × 10 ⁵ [1 / Ms], kd = 7.05 × 10 ⁻⁵ [1 / s], KD = 5.94 × 10 ⁻¹⁰ [M]. (0.59 nM).

  Compared with the affinity (KD value 0.60 nM, Example 8) possessed by the miniaturized mouse antibody A (mouse antibody before humanization), the affinity possessed by hAH1hAL1 is improved (KD value 0.22 nM), It can be seen that the affinity of hAH1hAL2 is almost equivalent (KD value 0.59 nM). Therefore, in an antibody in which the VH region is a polypeptide containing the amino acid sequence shown in SEQ ID NO: 25 and the VL region is a polypeptide containing the amino acid sequence shown in SEQ ID NO: 76 or 77, amino acids other than CDRs are humanized. And has an affinity for the human gp130 receptor equivalent to or higher than that of the mouse antibody before humanization. Among them, an antibody in which the VH region is a polypeptide containing the amino acid sequence shown in SEQ ID NO: 25 and the VL region is a polypeptide containing the amino acid sequence shown in SEQ ID NO: 76 or 77 is more human than a mouse antibody before humanization. Since the affinity for the gp130 receptor is also improved, it is considered to be a candidate for a therapeutic antibody for diseases caused by abnormalities of IL-6 family cytokines (for example, autoimmune diseases such as rheumatoid arthritis).

Example 13 Suppression of IL-6 signal by humanized anti-gp130 receptor miniaturized antibody (1) A cell line that is sensitive to human IL-6 and whose cell growth is promoted by addition of human IL-6 7- TD-1 (RIKEN BRC Cell Bank No. RCB1190 provided by RIKEN BRC via the Ministry of Education, Culture, Sports, Science and Technology National BioResource Project) DMEM medium (Thermo Fisher Scientific, Inc.) containing 10% (w / v) bovine serum ).

(2) After culturing, cell count was performed, and the cells were added to a 24-well plate at 1 × 10 ⁵ cells / well (1 mL of medium).

(3) Human IL-6 (manufactured by FUJIFILM Wako Pure Chemical Industries, Ltd.) was added to the well to a final concentration of 50 ng / mL, and the miniaturized mouse antibody A prepared in Example 7 and hAH1hAL1 prepared in Example 13 and After adding hAH1hAL2 to a final concentration of 150 or 500 ng / mL, the 24-well plate was cultivated at 37 ° C. under 5% CO ₂ for 10 days.

  (4) After culturing in (3), the number of cells in a well to which human IL-6 has not been added, only human IL-6 has been added, human IL-6 and an antibody (each miniaturized antibody or human antibody) has been automatically measured The measurement was carried out with an apparatus Countness (manufactured by Thermo Fisher Scientific).

  The cell count measurement results are shown in FIG. As shown in FIGS. 2 (A) to 2 (D), the number of 7-TD-1 cells in the well is increased by adding human IL-6 as compared to when human IL-6 is not added. From these results, it was confirmed that 7-TD-1 increased in cell number by human IL-6. On the other hand, when miniaturized mouse antibody A was added to a well to which human IL-6 was added as shown in FIG. 2 (A), the growth of 7-TD-1 in the well was dependent on the concentration of the miniaturized antibody added. Thus, it can be seen that miniaturized mouse antibody A can suppress IL-6 signaling by binding to human gp130 receptor. Further, as shown in FIGS. 2B and 2C, the proliferation of 7-TD-1 in the wells depending on the concentration of the humanized miniaturized antibody added also in the humanized miniaturized antibody A (hAH1hAL1 and hAH1hAL2). Therefore, it can be seen that humanized miniaturized antibody A (hAH1hAL1 and hAH1hAL2) can suppress IL-6 signaling by binding to the human gp130 receptor. As shown in FIG. 2 (D), even when human IgG1 (hIgG1) (manufactured by Sigma) that is not specific for the human gp130 receptor is added, the proliferation of 7-TD-1 in the well is not increased by the amount of antibody added. Since it is not dependent and not inhibited, it can be seen that an antibody having no specificity for the human gp130 receptor cannot suppress the signal of human IL-6.

Example 14 Screening of Humanized Antibody A (Part 2)
(1) By performing the screening described in Example 11, clones expressing humanized miniaturized antibody A that showed binding ability to human gp130 receptor were selected. The selected clone was cultured, the plasmid was extracted, and sequence analysis was performed in the same manner as described in Example 3 (6) using the oligonucleotide described in SEQ ID NO: 75 as a sequence primer.

  (2) As a result of sequence analysis, an L chain in which the L chain variable region was the amino acid sequence set forth in SEQ ID NO: 80 was obtained. The Fab expression vector containing the polynucleotide (SEQ ID NO: 81) encoding the amino acid sequence shown in SEQ ID NO: 80 was designated as the humanized L chain whose amino acid sequence of the obtained variable region is shown in SEQ ID NO: 80 as hAL3. -It was named Fab-hAH1hAL3.

Example 15 Production of Humanized Antibody A Expression Vector (1) Using pUC-Fab-hAH1AL3 obtained in Example 14 as a template, SEQ ID NO: 82 (5′-GCCTCTTCCCGGGCCCACATTCAGATGAACTC-3 ′) and SEQ ID NO: 83 (5′-AAT) [GCGGCCGC] TACTAACACTCTCCCCCTGTTTGAAGC-3 ′) (square brackets in SEQ ID NO: 83 indicate the restriction enzyme NotI recognition sequence). Specifically, a reaction solution having the composition shown in Table 6 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction was carried out by repeating 30 cycles of the third step at 30 ° C. for 30 seconds. The PCR product obtained after amplification and purification of the gene encoding hAL3 by this PCR was named hAL3-P1.

  (2) Using hAL3-P1 obtained in (1) as a template, SEQ ID NO: 84 (5′-CTA [GAATTC] GCCACATGACCCGGCTGACC-3 ′) and SEQ ID NO: 83 (square brackets in SEQ ID NO: 84 recognize the restriction enzyme EcoRI. In order to add a signal sequence (MTRLTVLALLAGLLASSRA) consisting of the amino acid sequence shown in SEQ ID NO: 85 to hAL3 using the oligonucleotide primer consisting of the sequence shown in SEQ ID NO: 85, the amino acid sequence shown in SEQ ID NO: 85 PCR was performed by adding the polynucleotide described in SEQ ID NO: 86 (5′-ATGACCCGCGCTGACCGTGCTGGCCCCTGCTGGCTGGCCTGCTCGCCCCTTCCCGGGGCC-3 ′). Specifically, a reaction solution having the composition shown in Table 7 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction was carried out by repeating 30 cycles of the third step at 30 ° C. for 30 seconds. The PCR product obtained after amplification by purifying a gene obtained by adding a gene encoding the signal sequence shown in SEQ ID NO: 85 to the gene encoding hAL3 by this PCR was named hAL3-P2.

  (3) The hAL3-P2 obtained in (2) and the expression vector (pEFd) described in FIG. 3 were digested with restriction enzymes EcoRI and NotI, respectively, purified and then ligated. Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid was extracted from the cultured transformant to obtain pEFd-hAL3 capable of expressing hAL3 in animal cells. The pEFd vector shown in FIG. 3 has a promoter (EFd pro) in which nucleotides from the 621st guanine to the 798th guanine are deleted among the EF1α promoter shown in SEQ ID NO: 88, and SV40 It also has polyA and dhfr genes.

  Sequence analysis was performed in the same manner as described in Example 3 (6) using SEQ ID NOs: 75 and 84 as primers. The amino acid sequence around hAL3 of pEFd-hAL3 is shown in SEQ ID NO: 87. Of the sequence shown in SEQ ID NO: 87, the first methionine (Met) to the 19th alanine (Ala) are signal sequences, and the 20th aspartic acid (Asp) to the 125th lysine (Lys). The variable region of hAL3, from the 126th arginine (Arg) to the 232nd cysteine (Cys) is the constant region of hAL3.

  (4) SEQ ID NO: 89 (5′-GCCTCTTCCCGGGCCCAGGTTCAACTCCAG-3 ′) and SEQ ID NO: 90 (5′-AAT [GCGGCCGC] TATCATTTACCCGGAGACAGGGAGAG-3 ′) (in SEQ ID NO: 89) using pFU-hAH1 prepared in Example 4 as a template PCR was performed using an oligonucleotide primer having the sequence described in (1) indicates the restriction enzyme NotI recognition sequence. Specifically, a reaction solution having the composition shown in Table 6 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction was carried out by repeating 30 cycles of the third step of 1.5 minutes at ° C. for 30 cycles. The PCR product obtained after purification by amplification of the gene encoding the full length of hAH1 by this PCR was named hAH1-P1.

  (5) Using the hAH1-P1 obtained in (4) as a template, an oligonucleotide primer consisting of the sequences shown in SEQ ID NO: 84 and SEQ ID NO: 90, and a signal sequence consisting of the amino acid sequence shown in SEQ ID NO: 85 ( In order to add (MTRLTVLALLAGLLASSRA) to hAH1, a polynucleotide described in SEQ ID NO: 86 was added and PCR was performed. Specifically, a reaction solution having the composition shown in Table 7 was prepared, and the reaction solution was heat-treated at 98 ° C. for 5 minutes, then the first step at 98 ° C. for 10 seconds, the second step at 55 ° C. for 5 seconds, 72 The reaction was carried out by repeating 30 cycles of the third step of 1.5 minutes at ° C. for 30 cycles. A PCR product obtained by amplifying and purifying a gene obtained by adding a gene encoding the signal sequence described in SEQ ID NO: 85 to the gene encoding hAH1 by this PCR was named hAH1-P2.

  (6) The hAH1-P2 obtained in (5) and the expression vector (pEFd) described in FIG. 3 were digested with restriction enzymes EcoRI and NotI, respectively, purified and ligated. Escherichia coli JM109 strain was transformed with the ligation product, and a plasmid was extracted from the cultured transformant to obtain pEFd-hAH1 capable of expressing hAH1 in animal cells.

  An oligonucleotide consisting of the sequence set forth in SEQ ID NO: 84, SEQ ID NO: 91 (5′-GAGTTCCCACGACACCGTCAC-3 ′), SEQ ID NO: 92 (5′-GCTAGCACCCAAGGGCCCATC-3 ′) and SEQ ID NO: 93 (5′-CGGGAGGAGATAGGACACAGAAC-3 ′) As a primer, sequence analysis was performed in the same manner as described in Example 3 (6). The amino acid sequence around hAH1 of pEFd-hAH1 is shown in SEQ ID NO: 94. Of the sequence set forth in SEQ ID NO: 94, the first methionine (Met) to 19th alanine (Ala) is the signal sequence, and the 20th glutamine (Gln) to 139th alanine (Ala) is hAH1. The region from the 140th alanine (Ala) to the 469th lysine (Lys) is the constant region of hAH1.

Example 16 Affinity of humanized antibody A (part 2)
(1) pEFd-hAL3 and pEFd-hAH1 prepared in Example 15 were prepared, and genes were introduced into CHO cells (DG44 strain) using a NeonTransfection System (manufactured by Thermo Fisher Scientific). Then, petri dish culture was performed using CD OptiCHO Medium (Thermo Fisher Scientific) containing 40 mL / L GlutaMAX (Thermo Fisher Scientific). Gene transfer was shaken cultured CD OptiCHO Medium containing GlutaMAX of 40 mL / L of 20mL flask (Corning Co.) in 125mL was added in a CO ₂ incubator at the time the cells were grown (37 ℃, 8% of _CO 2, 130 rpm).

  (2) About 80 mL of the culture solution obtained by repeating the culture and supernatant collection was equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride in advance, and 1 mL of MabSelect Sure LX ( GE Healthcare). Thereafter, the plate was washed with the buffer used for equilibration and eluted with 4 mL of 0.1 M glycine hydrochloride buffer (pH 3.0). By quickly adding 1 mL of 1M Tris-HCl buffer (pH 8.0) to the eluate, the pH is brought to the neutral range, concentrated with an ultrafiltration membrane, and buffer exchange is performed so that the H chain is hAH1 and the L chain is About 0.74 mg of a full-length humanized anti-gp130 receptor antibody (hereinafter referred to as hAH1hAL3) of hAL3 was obtained.

  (3) The affinity of the humanized antibody hAH1hAL3 was measured in the same manner as in Example 8 except that the amount of human gp130 receptor immobilized on the sensor chip CM5 was 376 RU.

As a result, the affinity of hAH1hAL3 was ka = 1.24 × 10 ⁵ [1 / Ms], kd = 7.25 × 10 ⁻⁵ [1 / s], KD = 5.85 × 10 ⁻¹⁰ [M] (0 .59 nM).

  The results and the results of Examples 8 and 12 are summarized in Table 8. The affinity (KD value 0.59 nM) of the humanized antibody hAH1hAL3 is as follows: the miniaturized mouse antibody A (KD value 0.60 nM, Example 8) and the humanized miniaturized antibody hAH1hAL2 (KD value 0.59 nM, Example 12). It can be seen that it is equivalent to the affinity of Therefore, an antibody in which the VH region is a polypeptide containing the amino acid sequence set forth in SEQ ID NO: 25 and the VL region is a polypeptide containing the amino acid sequence set forth in SEQ ID NO: 80 has amino acids other than CDRs humanized. In addition, it can be seen that it has an affinity for the human gp130 receptor equivalent to that of the mouse antibody before humanization.

Example 17 Suppression of IL-6 Signal by Humanized Anti-gp130 Receptor Antibody (1) 10% (w / v) of 7-TD-1, which is a cell line whose cell growth is promoted by addition of human IL-6 The cells were cultured in RPMI-1640 medium (produced by Fujifilm Wako Pure Chemical Industries) containing bovine serum. After culturing, cell count was performed and added to a 24-well plate at 1 × 10 ⁵ cells / well (1 mL of medium).

(2) Human IL-6 (manufactured by FUJIFILM Wako Pure Chemical Industries, Ltd.) was added to a final concentration of 50 ng / mL, humanized antibody hAH1hAL3 prepared in Example 16, antibody A prepared in Example 2, and Human IgG1 (hIgG1) (manufactured by Sigma) was added to final concentrations of 100 ng / mL, 500 ng / mL, and 1000 ng / mL, respectively, and then the 24-well plate was added under conditions of 37 ° C. and 5% CO _2. The culture was stationary for 1 day.

  (3) After culture, human IL-6 is not added, only human IL-6 is added, and the number of cells in a well to which human IL-6 and each antibody are added is measured with an automatic cell measuring device Countness (manufactured by Thermo Fisher Scientific). did.

  The cell count measurement results are shown in FIG. As shown in FIGS. 4 (A) to (C), the addition of human IL-6 increased the number of 7-TD-1 cells in the wells compared to when human IL-6 was not added. Even when human IgG1 (hIgG1) that is not specific for the human gp130 receptor antibody was added, the proliferation of 7-TD-1 cells was not suppressed (FIG. 4C). On the other hand, since humanized antibody hAH1hAL3 (FIG. 4 (A)) and antibody A (FIG. 4 (B)) inhibited the growth of 7-TD-1 cells depending on the added antibody concentration, these antibodies It can be seen that IL-6 signaling can be suppressed by binding to the human gp130 receptor. That is, it was confirmed that the humanized antibody hAH1hAL3 has the same ability to inhibit IL-6 signal as antibody A.

Claims (10)

A polypeptide comprising a heavy chain variable (VH) region having the amino acid sequence set forth in SEQ ID NO: 25 or an amino acid sequence having 90% or more homology with the amino acid sequence set forth in SEQ ID NO: 25;
A light chain variable (VL) region comprising the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80, or an amino acid sequence having 90% or greater homology to the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80 A polypeptide,
And the KD value for the human gp130 receptor is 0.6 nM or less,
Anti-human gp130 receptor antibody. The VL region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 76 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 76, and the KD value for the human gp130 receptor is 0. The anti-human gp130 receptor antibody according to claim 1, which is 3 nM or less. A polypeptide comprising a heavy chain variable (VH) region having the amino acid sequence set forth in SEQ ID NO: 25 or an amino acid sequence having 90% or more homology with the amino acid sequence set forth in SEQ ID NO: 25;
A light chain variable (VL) region comprising the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80, or an amino acid sequence having 90% or greater homology to the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80 A polypeptide,
And can suppress human IL-6 signal and other cytokine signal belonging to IL-6 family,
Anti-human gp130 receptor antibody. The VH region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 25, and the VL region is a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80. Anti-human gp130 receptor antibody. An anti-human gp130 receptor antibody heavy chain variable (VH) region comprising the amino acid sequence set forth in SEQ ID NO: 25 or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 25 Polynucleotide. An anti-human gp130 receptor antibody light chain comprising the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80, or an amino acid sequence having 90% or more homology to the amino acid sequence set forth in SEQ ID NO: 76, 77, or 80 A polynucleotide encoding a variable (VL) region. A vector comprising at least the polynucleotide according to claim 5 and / or 6. A transformant obtained by co-transformation with a vector comprising at least the polynucleotide of claim 5 and a vector comprising at least the polynucleotide of claim 6. A transformant obtained by transforming with a vector comprising at least the polynucleotide according to claim 5 or 6. 10. A step of culturing the transformant according to claim 8 or 9 to express an anti-human gp130 receptor antibody, and a step of recovering the anti-human gp130 receptor antibody expressed from the culture of the transformant. A method for producing an anti-human gp130 receptor antibody.