JP2019126309A - New lactonase - Google Patents

Abstract

To provide a new lactonase, and to provide methods for producing urolithin C, urolithin A, urolithin M6, or urolithin D using the lactonase.SOLUTION: There is provided a new lactonase having an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds present in ellagic acid. There is provided a manufacturing method of producing urolithin M5 by bringing the lactonase into contact with ellagic acid, and then making a microorganism having an ability of producing urolithin C and the like from the urolithin M5 produce urolithin C, urolithin A, urolithin M6, or urolithin D from the urolithin M5. The lactonase has an optimum pH of 7.0 to 9.0, an optimum temperature of 42 to 50°C, and a molecular weight of 37,800 to 46,200. The lactonase is derived from a microorganism belonging to a genus of Gordonibacter.SELECTED DRAWING: None

Description

  The present invention relates to a novel lactonase.

  Urolithins represented by urolithin A and urolithin C are known as ellagic acid metabolites derived from ellagitannins and the like contained in pomegranate, raspberry, blackberry, cloudberry, strawberry, walnut and the like.

  It is known that elazitanins are classified as hydrolyzable tannins, and when ingested, they are hydrolyzed in the body and converted to ellagic acid. In addition, it is also present in fruits and the like as ellagic acid. For example, with respect to the production of urolithins in vivo, it has been reported that urolitins are produced by ingesting ellagitannins such as geraniin into rats and then analyzing urine urines in urine (Non-patent Document 1). ). In humans, urolithins are detected in urine after ingestion of pomegranate extract containing ellagitannin, mainly punicalagin, and urolithin A and urolithin C are reported to be major ellagic acid metabolites. (Non-patent document 2).

  These urolitins are known to have various physiological activities, and are expected to be used as materials for pharmaceuticals, cosmetics, food and drink. For example, urolitin A has functions such as antioxidative action (non-patent document 3), anti-inflammatory action (non-patent document 4), antiglycation action (non-patent document 5), and mitophagy promoting action (non-patent document 6) It has been reported that the material has an anti-aging function and is expected to be developed.

  As a method for synthesizing these urolithins, 2-bromo-5-methoxybenzoic acid is used as a starting material to form 2-bromo-5-hydroxybenzoic acid by demethylation and react with resorcinol to obtain urolithin A. Et al. Have been reported (Non-Patent Document 7). However, chemical synthesis is not suitable for using urolitins as materials for functional foods (including beverages and supplements).

On the other hand, ellagitannin and ellagic acid are known to be metabolized by the intestinal microflora and converted into urolithins after being taken into the body. In recent years, Gordonibacter urolithinfaciens has been isolated and identified as an intestinal bacterium that produces urolithin C, a kind of urolithin from ellagic acid, and fermenting ellagic acid using this intestinal bacterium Thus, a method for producing urolitin C has been reported (Patent Document 1, Non-patent Document 8). However, the accumulated concentration of urolithin C in the fermentation broth was about 2 mg / L. In addition to Gordonibacter urolithinfaciens, Gordonibacter pamelaeae has also been reported to produce urolithin C from ellagic acid (Patent Document 1, Non-Patent Document 8). .
However, the pathway that acts on ellagic acid to metabolize urolithins has not been identified, the enzyme involved and the gene that encodes it have not been reported, and ellagic acid is expected to catalyze the initial reaction of ellagic acid metabolism. An enzyme that generates urolithin M5 from an acid and a gene encoding the enzyme have not been reported.

International Publication 2014/147280 brochure

J. Agric. Food Chem., 56, 393-400 (2008) Mol. Nutr. Food Res., 58, 1199-1211 (2014) Biosci. Biotechnol. Biochem., 76, 395-399 (2012) J. Agric. Food Chem., 60, 8866-8876 (2012) Mol. Nutr. Food Res., 55, S35-S43 (2011) Nature Medicine, 22, 879-888 (2016) J. Agric. Food Chem., 56, 393-400 (2008) Food Func., 5, 8, 1779-1784 (2014)

  An object of the present invention is to provide a novel lactonase.

  As a result of searching for a novel lactonase involved in the metabolism of urolithins, the present inventors have found a lactonase that catalyzes a reaction of hydrolyzing at least one of two ester (lactone) bonds present in ellagic acid. Was completed. One of the two ester bonds present in ellagic acid, which has been hydrolyzed, is a type of urolitins called uroritin M5, and the lactonase having the activity is a novel one. The present invention is as follows.

[1] Lactonase having the following property (1):
(1) It has an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds present in ellagic acid.
[2] The lactonase according to [1], further having the following properties (2) to (4):
(2) the optimum pH is 7.0 or more and 9.0 or less;
(3) the optimum temperature is 42 ° C. or higher and 55 ° C. or lower;
(4) The molecular weight is 37,800 or more and 46,200 or less.
[3] or [1] derived from a microorganism belonging to the genus Gordonibacter,
Lactonase as described in 2].
[4] A microorganism belonging to the genus Gordonibacter, which belongs to the genus Gordonibacter urolithinfaciens, a microorganism belonging to the genus Gordonibacter pamelaeae, and a microorganism which belongs to the genus Gordonibacter pamelaeae; [3] The lactonase according to [3], which is selected from the group consisting of microorganisms belonging to Gordonibacter faecihominis.
[5] Lactonase which is a protein of the following (A) or (B):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4;
(B) In the amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4, present in ellagic acid, consisting of amino acids in which one to several amino acids are substituted or deleted, or one to several amino acids are inserted or added A protein having an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds.
[6] including the step of culturing a microorganism belonging to the genus Gordonibacter [
The method for producing lactonase according to [1] or [2].
[7] The following polynucleotide (a) or (b):
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2;
(B) containing a base sequence having 90% or more homology with the base sequence represented by SEQ ID NO: 1 or 2 and catalyzing a reaction that hydrolyzes at least one of two ester bonds present in ellagic acid A polynucleotide encoding a protein having the following activity:
[8] A recombinant vector comprising the polynucleotide according to [7].
[9] A transformant carrying the polynucleotide according to [7] in an expressible manner, or carrying the vector according to [8] in an expressible manner.
[10] A method for producing a protein encoded by the polynucleotide according to [7], which comprises the step of culturing the transformant according to [9].
[11] A process for producing urolitin M5, which comprises the following step (I):
Step (I): a step of contacting one or more selected from the following (i) to (iv) with ellagic acid.
(I) Lactonase according to any one of [1] to [5];
(Ii) a protein encoded by the polynucleotide according to [7];
(Iii) said lactonase or a microorganism producing said protein;
(Iv) Treated product of the microorganism.
[12] A process for producing uroritin C, which comprises the following steps (I) and (II) and wherein the steps (I) and (II) are carried out in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) Lactonase according to any one of [1] to [5];
(Ii) a protein encoded by the polynucleotide according to [7];
(Iii) a microorganism that produces the lactonase or the protein;
(Iv) A processed product of the microorganism.
Step (II): a step of causing a microorganism having the ability to produce urolithin C from the urolithin M5 to produce urolithin C from the urolithin M5.
[13] A method for producing uroritin A, which comprises the following steps (I) to (III), and the steps (I) to (III) are performed in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) Lactonase according to any one of [1] to [5];
(Ii) a protein encoded by the polynucleotide according to [7];
(Iii) said lactonase or a microorganism producing said protein;
(Iv) Treated product of the microorganism.
Step (II): a step of causing a microorganism having the ability to produce urolithin C from the urolithin M5 to produce urolithin C from the urolithin M5.
Step (III): a step of causing a microorganism having the ability to produce urolitin A from the urolitin C to produce urolitin A from the urolitin C.
[14] A process for producing uroritin M6, which comprises the following steps (I) and (IV), wherein the steps (I) and (IV) are carried out in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) Lactonase according to any one of [1] to [5];
(Ii) a protein encoded by the polynucleotide according to [7];
(Iii) a microorganism that produces the lactonase or the protein;
(Iv) Treated product of the microorganism.
Step (IV): producing a urolitin M6 from the urolitin M5 by a microorganism having an ability to generate the urolitin M6 from the urolitin M5.
[15] A method for producing uroritin D, which comprises the following steps (I) and (V), and the steps (I) and (V) are performed in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) Lactonase according to any one of [1] to [5];
(Ii) a protein encoded by the polynucleotide according to [7];
(Iii) a microorganism that produces the lactonase or the protein;
(Iv) Treated product of the microorganism.
Step (V): A step of causing a microorganism having an ability to produce urolithin D from urolithin M5 to produce urolithin D from urolithin M5.

  According to the present invention, novel lactonase can be provided. In a preferred embodiment, the lactonase can be reacted with ellagic acid to produce urolithin M5. In another preferred embodiment, urolithin M5 and urolithin A (provided that urolithin A passes through urolithin C). ), Urolithin C, or urolithin D can be produced.

It is a figure which shows the pH dependence of the activity of the lactonase which concerns on one embodiment of this invention. It is a figure which shows the temperature dependence of the activity of the lactonase which concerns on one embodiment of this invention.

<1. Lactonase>
One embodiment of the present invention is a lactonase having the following property (1).
(1) It has an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds present in ellagic acid.
As shown below, two ester bonds exist in ellagic acid.

One obtained by hydrolyzing one of the two ester bonds present in ellagic acid is urolithin M5. The uroritin M5 can also be said to be an intermediate formed during hydrolysis of both of the two ester bonds present in ellagic acid.
The optimum pH of the lactonase according to this embodiment is preferably 6.0 or more and 9.5 or less, more preferably 7.0 or more and 9.0 or less.
The optimum temperature is preferably 28 ° C. or more and 60 ° C. or less, more preferably 42 ° C. or more and 55 ° C. or less.
Moreover, the molecular weight is 37,800 or more and 46,200 or less as a molecular weight measured by SDS-PAGE, Preferably it is 42,000.

The lactonase according to this embodiment is preferably derived from a microorganism belonging to the genus Gordonibacter, and among them, a microorganism belonging to Gordonibacter urolithinfaciens, Gordonibacter pamlithaeae ( More preferred are those derived from microorganisms belonging to Gordonibacter pamelaeae, microorganisms belonging to Gordonibacter faecihominis, and the like.
In addition, Gordonibacter urolithinfaciens (Gordonibacter urolithinfacie
ns), the DSM 27213 strain is more preferable, and the microorganism belonging to Gordonibacter pamelaeae is DSM 19378.
The strain is more preferable, and the JCM 16058 strain is more preferable if it is a microorganism belonging to Gordonibacter faecihominis. One kind of the microorganism may be used, or a plurality of kinds may be used.

In the present specification, the accession number of the strain starting with the word “DSM” is the number assigned to the microorganism stored in DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH). In addition, the strain accession number starting with the word “JCM” is the number assigned to the microorganism stored in the BioResource Center of RIKEN.
Further, the DSM 27213 strain, the DSM 19378 strain, and the JCM 16058 strain are not limited to the same strain as each strain, and may be substantially equivalent strains. A substantially equivalent strain has a homology that the 16S rRNA gene base sequence is 97.5% or more, preferably 98% or more, more preferably 99% or more, with the 16S rRNA gene base sequence of the strain. It is the microbe which it possesses. Further, any of them may be a strain bred from each strain or a strain substantially equivalent thereto by mutation treatment, gene recombination, selection of a natural mutant strain, or the like. This applies equally to all the microorganisms described herein.

The amino acid sequence of lactonase possessed by Gordonibacter urolithinfaciens strain DSM 27213 and the base sequence of the gene encoding it are shown in SEQ ID NO: 3 and SEQ ID NO: 1, respectively.
The amino acid sequence of lactonase possessed by Gordonibacter pamelaeae DSM 19378 and the base sequence of the gene encoding it are shown in SEQ ID NO: 4 and SEQ ID NO: 2, respectively.

Moreover, in the amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4, the lactonase according to this embodiment is an amino acid in which 1 to several amino acids are substituted or deleted, or one to several amino acids are inserted or added Or a protein having an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds present in ellagic acid.
The number is preferably 1 to 35, more preferably 1 to 30, still more preferably 1 to 10, particularly preferably 1 to 3, and the amino acid is N-terminal and / or C-terminally. The same applies to the case of being added to the side.
The substitution is preferably a conservative substitution. When the substitution site is an aromatic amino acid, the substitution is between Phe, Trp, Tyr, and when the substitution site is a hydrophobic amino acid, Leu, Ile, In the case of polar amino acids between Val, between Gln and Asn, in the case of basic amino acids Lys
When Ar is an acidic amino acid between Arg and His, it indicates substitution between Asp and Glu, and when it is an amino acid having a hydroxyl group, Ser and Thr are substituted with each other. As conservative substitution, specifically, substitution from Ala to Ser or Thr, substitution from Arg to Gln, His or Lys, substitution from Asn to Glu, Gln, Lys, His or Asp, Asp to Asn, Glu or Gln substitution, Cys to Ser or Ala substitution, Gln to Asn, Glu, Lys, His, Asp or Arg substitution, Glu to Gly, Asn, Gln, Lys or Asp substitution, Gly to Replacement to Pro, substitution from His to Asn, Lys, Gln, Arg or Tyr, substitution from Ile to Leu, Met, Val or Phe, substitution from Leu to Ile, Met, Val or Phe, Lys to Asn, Glu, Gln, His or Arg substitution, Met to Ile, Leu, Val or Phe substitution, Phe to Trp, Tyr, Met, Ile or Leu substitution, Ser to Thr or Ala substitution, Thr to Substitution to Ser or Ala, substitution from Trp to Phe or Tyr, substitution from Tyr to His, Phe or Trp, and substitution from Val to Met, Ile or Leu.
In addition, the lactonase according to this embodiment has an amino acid sequence (for example, represented by SEQ ID NO: 3 or SEQ ID NO: 4) as long as it has an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds present in ellagic acid. A protein having a homology of 80% or more, preferably 90% or more, more preferably 95% or more, still more preferably 97% or more, particularly preferably 99% or more to the total length of Also good.

  In addition, the lactonase according to this embodiment has a base sequence (eg, SEQ ID NO: 1 or SEQ ID NO: 2) as long as it has an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds present in ellagic acid. And a protein encoded by a polynucleotide that hybridizes under stringent conditions. The “stringent conditions” are, for example, polynucleotides having homology of 80% or more, preferably 90% or more, more preferably 95% or more, still more preferably 97% or more, particularly preferably 99% or more. Examples include a condition in which polynucleotides that hybridize and polynucleotides having lower homology do not hybridize with each other.

  The activity catalyzing the reaction of hydrolyzing at least one of the two ester bonds present in ellagic acid by the lactonase according to this embodiment is, for example, using ellagic acid as a raw material (substrate) as in the examples described later. It can be evaluated by measuring the generated uroritin M5.

<2. Method for Producing Lactonase>
Another embodiment of the present invention is a method for producing lactonase having the property (1) above, comprising the step of culturing a microorganism belonging to the genus Gordonibacter.
A detailed description of the properties possessed by the microorganism belonging to the genus Gordonibacter (Gordonibacter) in the production method and the properties possessed by lactonase are the same as above.

The microorganisms belonging to the genus Gordonibacter include Anaerobe Basal Broth (CM0957 manufactured by ThermoFisher Scientific), Wilkins-Chalgren Anaerobe Broth (CM0643 manufactured by ThermoFisher Scientific), GAM medium (Nissui Pharmaceutical Co., Ltd.), Modified GAM medium (Nissui Pharmaceutical Co., Ltd.) is cultured in a general medium used for culturing anaerobic bacteria.
The culture temperature is preferably 25 ° C. or higher, more preferably 30 ° C. or higher, further preferably 33 ° C. or higher, while preferably 45 ° C. or lower, more preferably 40 ° C. or lower, and even more preferably 38 ° C. or lower. .

Furthermore, for example, a water-soluble organic substance can be added as a carbon source. Examples of water-soluble organic substances include saccharides such as sorbose, fructose, glucose, dextrin, and soluble starch; alcohols such as methanol; organic acids such as valeric acid, butyric acid, propionic acid, acetic acid, formic acid, and succinic acid; arginine, And amino acids such as methionine, phenylalanine, valine, and glutamic acid.
The concentration of the organic substance to be added to the culture medium as a carbon source can be appropriately adjusted for efficient growth. Usually, it can select in the range of 0.1-10 wt / vol%.

In addition to the above carbon source, a nitrogen source may be added to the medium. As the nitrogen source, various nitrogen compounds that can be used for normal culture and fermentation can be used.
Preferred inorganic nitrogen sources are ammonium salts and nitrates. More preferably, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium hydrogen phosphate, triammonium citrate, potassium nitrate and sodium nitrate are used.
On the other hand, preferred organic nitrogen sources are amino acids, yeast extract, peptones (milk-derived peptone, soybean-derived peptone, soybean-derived peptide, etc.), meat extract (eg, Lab-Remco powder, skipjack extract, tuna extract, skipjack extract, Bouillon, shellfish extract, etc., liver extract, digested serum powder, etc. More preferred organic nitrogen sources are arginine, cysteine, citrulline, lysine, tryptophan, yeast extract, peptones.

Furthermore, in addition to carbon sources and nitrogen sources, microbial growth factors such as extracts, vitamins, metal salts and inorganic compounds can also be added to the medium. Extracts include hemin, heme iron, digested serum powder, liver extract, blood digests and the like. Examples of vitamins include biotin, folic acid, pyridoxal, thiamine, riboflavin, nicotinic acid, nicotinamide, pantothenic acid, vitamin B12, thiooctoic acid, p-aminobenzoic acid, vitamin K and the like. Metal salts and inorganic compounds include potassium dihydrogen phosphate, magnesium sulfate, manganese sulfate, sodium chloride, cobalt chloride, calcium chloride, zinc sulfate, copper sulfate, alum, sodium molybdate, potassium chloride, boric acid, etc. Nickel, sodium tungstate, sodium selenate, sodium selenite, ferrous ammonium sulfate, iron (II) citrate, sodium acetate trihydrate, magnesium sulfate heptahydrate, manganese sulfate tetrahydrate, etc. Can be mentioned. These metals can also be added in the form of mineral yeasts.
A method for producing a culture solution by adding growth cofactors derived from animals and plants such as these inorganic compounds and vitamins is known. The medium can be liquid, semi-solid, or solid. The preferred medium form is a liquid medium.

The production of lactonase by microorganisms belonging to the genus Gordonibacter,
It is induced by adding the precursor of ellagic acid or ellagic acid which is a raw material (substrate) to the culture medium. Examples of ellagic acid precursors include ellagitannins such as punicalagin and geraniin. The raw material (substrate) is preferably added so that the concentration in the medium is 0.01 g / L or more and 20 g / L or less.

In order to recover lactonase produced by microorganisms belonging to the genus Gordonibacter, the culture is recovered after the production of lactonase, reducing agents such as cysteine, 2-mercaptoethanol and dithiothreitol, and phenylmethane. The microorganism is disrupted into a cell-free extract in a buffer solution containing a protease inhibitor such as sulfonyl fluoride (PMFS), pepstatin A, ethylenediaminetetraacetic acid. The cell-free extract can be purified by appropriately combining fractionation by protein solubility, various types of chromatography, and the like. Both can follow the usual law.

<3. Polynucleotide>
Another embodiment of the present invention is a polynucleotide of the following (a) or (b): The details are as described above.
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2;
(B) containing a base sequence having 90% or more homology with the base sequence represented by SEQ ID NO: 1 or 2 and catalyzing a reaction that hydrolyzes at least one of two ester bonds present in ellagic acid Polynucleotide encoding a protein having an activity of

<4. Embodiment using genetic engineering>
In another embodiment of the present invention, there is provided a recombinant vector containing the polynucleotide; a transformant that holds the polynucleotide so that it can be expressed or that holds the vector so that it can express; a step of culturing the transformant A method for producing a protein encoded by the polynucleotide.

A lactonase expression vector can be obtained by inserting the polynucleotide into a known expression vector. A transformant can be obtained by transforming a microorganism or the like using the expression vector, and lactonase can be obtained by culturing the transformant to produce lactonase. Examples of the microorganism include anaerobic bacteria including lactic acid bacteria. Both can follow the usual law.
In addition to microorganisms, various hosts and vector systems have been developed for plants and animals, especially those using straw (Nature 315, 592-594 (1985)), and plants such as rapeseed, corn, and potato. Systems for expressing heterogeneous proteins in large quantities have been developed, and these may be used.

<5. Method of producing urolithin M5>
Another embodiment of the present invention is a method for producing uroritin M5, which comprises the following step (I).
Step (I): a step of contacting one or more selected from the following (i) to (iv) with ellagic acid.
(I) said lactonase;
(Ii) a protein encoded by the polynucleotide;
(Iii) said lactonase or a microorganism producing said protein;
(Iv) Treated product of the microorganism.

  (I) The lactonase, and (ii) the protein encoded by the polynucleotide are each contacted with ellagic acid to hydrolyze at least one of the two ester bonds present in ellagic acid to produce urolitin M5 . In addition, (iii) a microorganism that produces the lactonase or the protein, and (iv) a processed product of the microorganism, in which the lactonase or the protein contained therein is in contact with the ellagic acid, thereby causing two esters present in the ellagic acid. Hydrolysis of at least one of the bonds produces urolitin M5.

(I) The above-mentioned lactonase, (ii) The protein encoded by the above-mentioned polynucleotide is not limited to the purified ones but includes partially purified ones.
In addition, (iv) as a processed product of the microorganism, for example, a microorganism whose cell membrane permeability has been changed by treatment with an organic solvent such as a surfactant or toluene, or a microbial cell was disrupted by treatment with glass beads or an enzyme. Cell-free extracts and partially purified ones can be mentioned.

To contact one or more selected from (i) to (iv) with ellagic acid, water; an organic solvent that is difficult to dissolve in water, such as ethyl acetate, butyl acetate, toluene, chloroform, n-hexane, etc. It can be carried out in an organic solvent; or in a two-phase mixture system of the organic solvent and an aqueous medium such as ethanol or acetone.
In addition, α-cyclodextrin, β-cyclodextrin, γ-cyclodextrin, and derivatives thereof may be added to increase the solubility of the raw material (substrate) ellagic acid and the product urolithin M5. .
This step can also be performed using an immobilized enzyme, a membrane reactor, or the like.
The temperature in this step is preferably 4 ° C. or more, more preferably 25 ° C. or more, while preferably 60 ° C. or less, more preferably 50 ° C. or less.
The pH is preferably 5 or more, more preferably 6 or more, while preferably 10 or less, more preferably 9.5 or less.
The concentration of the raw material (substrate) ellagic acid in the reaction solution is 0.01 g / L or more, preferably 0.1 g / L or more, more preferably 1.0 g / L or more, while 100 g / L The content is preferably 50 g / L or less, more preferably 20 g / L or less.

The present production method may include the step of quantifying the obtained uroritin M5 (quantitative step). The quantification method can follow a conventional method. For example, to the culture solution, ethyl acetate added with an acid such as formic acid as necessary is added, vigorously stirred and then centrifuged to take out an ethyl acetate layer. The same operation is carried out several times as necessary, and the ethyl acetate layers are combined to obtain a urolitine extract. The extract is concentrated under reduced pressure using an evaporator or the like, dried to dryness, and dissolved in methanol. This is filtered using a membrane such as a polytetrafluoroethylene (PTFE) membrane, and the insoluble matter is removed and quantified using high performance liquid chromatography. Examples of the conditions for high performance liquid chromatography include, but are not limited to, the following.
[High-performance liquid chromatography conditions]
Column: Inertsil ODS-3 (250 × 4.6 mm) (manufactured by GL Science)
Eluent: water / acetonitrile / acetic acid = 74/25/1
Flow rate: 1.0 mL / min
Column temperature: 40 ° C
Detection: UV (305 nm)

In addition, the present production method may include the step of purifying the obtained urolitin M5 (purification step) and the step of concentration (concentration step). As purification treatment in the purification process, sterilization of microorganisms by heat or the like; sterilization by centrifugation, microfiltration (MF), ultrafiltration (UF), nanofiltration (NF), etc .; removal of solids and polymer substances; Treatments such as extraction and crystallization with an organic solvent or an ionic liquid; chromatography such as adsorption using a hydrophobic adsorbent, ion exchange resin, activated carbon column or the like; Examples of the concentration treatment in the concentration step include concentration by an evaporator, a reverse osmosis membrane or the like.
Furthermore, the solution containing urolitin M5 can also be powdered by lyophilization, spray drying and the like. In powdering, excipients such as lactose, dextrin and corn starch can also be added.

<6. Method of producing urolithin C>
Another embodiment of the present invention is a method for producing urolithin C, comprising the above step (I) and the following (II), wherein the steps (I) and (II) are carried out in the same system.
Step (II): a step of causing a microorganism having the ability to produce urolitin C from urolitin M5 to produce urolitin C from the urolitin M5.

In step (II), for example, as described in Examples, in a solution containing urolithin M5, a microorganism having the ability to produce urolithin C from urolithin M5 is cultured, and urolithin C is produced from urolithin M5. And so on. Examples of the microorganism include microorganisms belonging to the genus Gordonibacter. Preferred microorganisms belonging to the genus Gordonibacter include <1. Examples include microorganisms belonging to the genus Gordonibacter described in the section <Lactonase>. In addition, as culture conditions for microorganisms belonging to the genus Gordonibacter,
<2. Method for producing lactonase> Gordonibacter described in the column
The explanation of the culture conditions of microorganisms belonging to the genus is cited.

Steps (I) and (II) are “performed in the same system” means that urolithin M5 produced in step (I) is used as it is as urolithin M5 in step (II), and urolithin is used in step (II). It means that a series of flow until C is generated is continuously performed in the same system. That is, it means that the step of separating and / or purifying urolithin M5 produced in step (I) is not included between step (I) and step (II), for example.
The present production method may include the step of quantifying the obtained urolitin C (quantitative step), the step of purifying (purification step), and the step of concentration (concentration step). The details of those are described above in <5. Method for Producing Urolitin M5> The description in the section is incorporated.
Furthermore, the solution containing urolitin C can also be powdered by lyophilization, spray drying and the like. In powdering, excipients such as lactose, dextrin and corn starch can also be added.

<7. Method of producing urolithin A>
Another embodiment of the present invention comprises the above steps (I) and (II) and the following (III), wherein the above steps (I) and (II) are carried out in the same system, and The following process (II
A method for producing uroritin A, wherein I) is carried out in the same system, or steps (I) to (III) are carried out in the same system.
Step (III): a step of causing a microorganism having an ability to produce urolitin A from urolitin C to produce urolitin A from the urolitin C.
In addition, the above-mentioned definition is used for the above “done in the same system”.

In step (III), for example, as described in Examples, in a solution containing urolithin C, a microorganism having an ability to produce urolithin A from urolithin C is cultured, and urolithin A is produced from urolithin C. And so on. Examples of the microorganism include microorganisms belonging to the genus Clostridium, and more specifically, microorganisms belonging to Clostridium bolteae, microorganisms belonging to Clostridium asparagiforme, Clostridium asparagiforme, Microorganisms belonging to Clostridium citroniae can be mentioned. The microorganism may be used alone or in combination of two or more.
Among microorganisms belonging to Clostridium bolthae, D
SM 29485, DSM 15670, and JCM 12243 are more preferable, and DSM 15670 is more preferable.
Among the microorganisms belonging to Clostridium asparagiforme, the DSM 15981 strain is preferred.
Among microorganisms belonging to Clostridium citroniae, the DSM 19261 strain is preferred.
The above microorganisms may be used alone or in combination of two or more, regardless of the genus, species, or strain.
In the present specification, the accession number of the strain starting from the word "DSM" is DSMZ (Deutsche
Sammlung von Mikroorganismen und (Zellkulturen GmbH) is a number assigned to a microorganism stored. In addition, the accession number of the strain starting from the wording JCM is a number assigned to the microorganism stored in RIKEN BioResource Center.

As culture conditions and the like of a microorganism having the ability to produce urolitin A from urolitin C, the above-mentioned <2. Method for producing lactonase> Gordonibacter described in the column
The explanation of the culture conditions of microorganisms belonging to the genus is cited.

The present production method may include the step of quantifying the obtained urolitin A (quantitative step), the step of purifying (purification step), and the step of concentration (concentration step). The details of those are described above in <5. Method for Producing Urolitin M5> The description in the section is incorporated.
Furthermore, the solution containing urolitin A can also be powdered by lyophilization, spray drying and the like. In powdering, excipients such as lactose, dextrin and corn starch can also be added.

<8. Method of producing urolithin M6>
Another embodiment of the present invention is a method for producing uroritin M6, which comprises the above step (I) and the following (IV), wherein the steps (I) and (IV) are carried out in the same system.
Step (IV): A step of causing a microorganism having the ability to produce urolithin M6 from urolithin M5 to produce urolithin M6 from urolithin M5.
In addition, about the above-mentioned "it is performed in the same system", the existing definition is used.

In step (IV), for example, as described in Examples, in a solution containing urolithin M5, a microorganism having the ability to produce urolithin M6 from urolithin M5 is cultured, and urolithin M6 is produced from urolithin M5. And so on. Examples of the microorganism include microorganisms belonging to the genus Gordonibacter. Preferred microorganisms belonging to the genus Gordonibacter include <1. Examples include microorganisms belonging to the genus Gordonibacter described in the section <Lactonase>. In addition, as culture conditions and the like of the microorganism belonging to the genus Gordonibacter, the above-mentioned <2. Production method of lactonase> The description of culture conditions and the like of the microorganism belonging to the genus Gordonibacter described in the section "column" is incorporated.

The present production method may include the step of quantifying the obtained urolitin M6 (quantitative step), the step of purifying (purification step), and the step of concentration (concentration step). The details of those are described above in <5. Method for Producing Urolitin M5> The description in the section is incorporated.
Furthermore, the solution containing urolitin M6 can also be powdered by lyophilization, spray drying and the like. In powdering, excipients such as lactose, dextrin and corn starch can also be added.

<9. Method of producing urolithin D>
Another embodiment of the present invention is a method for producing uroritin D, which comprises the above step (I) and the following (V), and the steps (I) and (V) are carried out in the same system.
Step (IV): a step of causing a microorganism having an ability to produce urolitin D from urolitin M5 to produce urolitin D from the urolitin M5.
In addition, the above-mentioned definition is used for the above “done in the same system”.

In step (V), for example, as described in Examples, in a solution containing urolithin M5, a microorganism having the ability to produce urolithin D from urolithin M5 is cultured, and urolithin D is produced from urolithin M5. And so on. Examples of the microorganism include microorganisms belonging to the genus Gordonibacter. Preferred microorganisms belonging to the genus Gordonibacter include <1. Examples include microorganisms belonging to the genus Gordonibacter described in the section <Lactonase>.
In addition, as culture conditions and the like of the microorganism belonging to the genus Gordonibacter, the above-mentioned <2. Production method of lactonase> The description of culture conditions and the like of the microorganism belonging to the genus Gordonibacter described in the section "column" is incorporated.

The present production method may include the step of quantifying the obtained uroritin D (quantitative step), the step of purifying (purification step), and the step of concentration (concentration step). The details of those are described above in <5. The description in the column “Method for producing urolithin M5>” is incorporated.
Furthermore, the solution containing urolitin D can also be powdered by lyophilization, spray drying and the like. In powdering, excipients such as lactose, dextrin and corn starch can also be added.

  Hereinafter, the present invention will be described in more detail by way of specific examples, but the present invention is not limited to these examples.

[Example 1: Cloning of lactonase gene]
Genomic DNA was prepared from Gordonibacter urolithinfaciens strain DSM 27213 according to a conventional method. Using this as a template, the lactonase gene was amplified by PCR using the following primer set and inserted into the expression vector pET-21b (+) to construct pET-21b (+) _ GuUroH + 119.
5'- AATGG ATCC GCGGGAGCCGAAAGTTACACCGATC TACTCGGTAA-3 '(SEQ ID NO: 5)
5'- TATGAATTCCTACAGTGTAAACAGCTTTCGCCGCCGTTGCGCCC-3 '(SEQ ID NO: 6)

[Example 2: Expression of Lactonase in E. coli]
E. coli Rosetta 2 (DE3) strain was transformed with pET-21b (+) _ GuUroH + 119 by the Ca method.
The transformant obtained was shake-cultured for 2 hours at 37 ° C. in LB medium containing 5 mL of 34 μg / mL chloramphenicol and 30 μg / mL kanamycin. IPTG was added to the culture solution to 1 mM, and induction culture was further performed at 37 ° C. for 3 hours.
The obtained culture broth was centrifuged to prepare wet cells. The resulting wet cells were suspended in 0.3 mL of BugBuster Master Mix (manufactured by Novagen) and gently shaken at room temperature to disrupt the cells.

[Example 3: Expression analysis of lactonase]
The cell lysate prepared in Example 2 was analyzed by SDS-PAGE. The acrylamide concentration was 12.5%, and AE-1440Ez Standard (manufactured by ATTO CORPORATION) was used as a protein molecular weight marker. As a result, a band thought to be lactonase was observed, and its molecular weight was 42,400. In general, molecular weight measurement by SDS-PAGE is considered to include an error of about 10%.

[Example 4: Production of urolithin M5]
Using the cell disruption solution prepared in Example 2, the reaction was carried out at 37 ° C. for 24 hours in a reaction solution containing an initial concentration of ellagic acid of 1 mg / mL (about 3.3 mM).
100 μL of the reaction solution was sampled, and 200 mL of dimethylacetamide containing 1% formic acid was added and mixed. The obtained diluted solution was centrifuged, and the supernatant was analyzed by high performance liquid chromatography (HPLC). The conditions are as shown in the following HPLC condition 1.
As a result, 0.267 mM urolitin M5 was detected.

<HPLC condition 1>
Column: Cosmosil 5C18-AR-II (4.6 × 150)
Eluent A: 1% formic acid B: acetonitrile containing 1% formic acid Flow rate: 1 mL / min
Column temperature: 40 ° C
Detection: UV (349 nm)

[Example 5: Construction of an expression plasmid as a His-tagged protein of lactonase]
In the same manner as in Example 1, the lactonase gene was cloned by PCR using genomic DNA derived from Gordonibacter urolithinfaciens DSM 27213 as a template, and using the following primer set, and pET-28a (+) By insertion, an expression plasmid pET-28a_GuUroH-Histag (N) was constructed which can be expressed as a protein in which a His-tag was added to the N-terminal side of lactonase.
5'-GCCGGATCCATGGGCAGACAACAAGGTCATCGACATCAACATG-3 '(sequence number 7)
5'- TATGAATTCCTACAGTGTAAACAGCTTTCGCCGCGCTTGGCCCC-3 '(SEQ ID NO: 8)

[Example 6: Expression of lactonase in E. coli]
E. coli Rosetta2 (DE3) strain was transformed with pET-28a_GuUroH-Histag (N) by the Ca method.
The transformant obtained was shake-cultured at 37 ° C. for 2.5 hours in LB medium containing 5 mL of 34 μg / mL chloramphenicol and 30 μg / mL kanamycin. IPTG was added to the culture solution to a final concentration of 0.1 mM, and induction culture was further performed at 30 ° C. for 4 hours.
The obtained culture broth was centrifuged to prepare wet cells. The resulting wet cells were suspended in 0.3 mL of BugBuster MasteMix (manufactured by Novagen) and gently shaken at room temperature to disrupt the cells. The resulting crushed liquid was centrifuged to prepare a soluble fraction as a supernatant and an insoluble fraction as a precipitate.

[Example 7: Expression analysis of lactonase]
The soluble and insoluble fractions prepared in Example 6 were analyzed by SDS-PAGE. The acrylamide concentration was 12.5%, and AE-1440Ez Standard (manufactured by ATTO CORPORATION) was used as a protein molecular weight marker. As a result, bands believed to be lactonase were observed in both the soluble and insoluble fractions, and the molecular weight was 43,800 (including His-tag). In general, molecular weight measurement by SDS-PAGE is considered to include an error of about 10%.

[Example 8-1: Confirmation of lactonase activity]
In the same manner as in Example 6, cells at 7 ° C. for 7 hours were disrupted with IPTG at a final concentration of 0.1 mM to prepare a cell-free extract. The obtained cell-free extract was reacted at 37 ° C. for 7 hours to quantify urolitin M5 produced from ellagic acid as a raw material (substrate) by HPLC. The conditions are as in the above HPLC condition 1.
As a result, the specific activity of the cell-free extract was 15.7 mU / mg-protein. Note that 1 U refers to the activity of catalyzing the production of 1 μmol of urolitin M5 in 1 minute under the above conditions.

[Example 8-2: Confirmation of optimum pH of lactonase activity]
The same experiment as in Example 8-1 was performed using the following buffer to confirm the optimum pH for the lactonase activity. However, the temperature was 37 ° C., and the reaction time was 3 hours.
PH 2.5, 3, 3.5: 20 mM citrate buffer pH 3.5, 4, 4.5, 5, 5.5: 20 mM acetate buffer pH 6, 6.5, 7, 7.5 8: 20 mM potassium phosphate buffer • pH 7.5, 8, 8.5, 9: 20 mM Tris-HCl buffer • pH 9.5, 10, 10.5, 11: 20 mM carbonate buffer • pH 11.5, 12 : 20 mM sodium phosphate buffer The results are shown in FIG. FIG. 1 shows the relative activity of lactonase at each pH when the lactonase activity at pH 9 is taken as 100. In the pH range of 7.0 to 9.0, the lactonase activity exhibited 80% or more of the maximum activity.

[Example 8-3: Confirmation of optimum temperature of lactonase activity]
The same experiment as in Example 8-1 was performed using 20 mM potassium phosphate buffer (pH 6.5) to confirm the optimum temperature for the lactonase activity. However, the reaction time was 3 hours. As temperature, 10, 15, 20, 28, 32, 37, 42, 50, 55, 60, 70 ° C was adopted.
The results are shown in FIG. FIG. 2 shows the relative activity of lactonase at each temperature, where the lactonase activity at a temperature of 50 ° C. is 100. In the vicinity of the temperature range of 42 ° C. or more and 55 ° C. or less, the lactonase activity exhibited 80% or more of the maximum activity.

[Example 9: Purification of lactonase]
The cell-free extract obtained by the method of Example 6 was purified using a His-trap column.
HisTrap equilibrated with wash solution A (20 mM KPB (pH 7.4), 0.5 M NaCl, 20 mM imidazole)
The cell-free extract was added to HP (5 mL) (manufactured by GE Healthcare), and after adsorbing lactonase, the column was washed with the same washing solution A. Thereafter, the lactonase was eluted with eluent B (20 mM KPB (pH 7.4), 0.5 M NaCl, 500 mM imidazole).
The purified enzyme showed a single band by SDS-PAGE, and its specific activity was 444 mU / mg-protein.

[Example 10: Production example of urolithin M5 from ellagic acid]
The transformant obtained in Example 6 was cultured with shaking in LB medium containing 5 mL of 34 μg / mL chloramphenicol and 30 μg / mL kanamycin at 37 ° C. for 15 hours. The culture solution was inoculated into 7 mL of the same medium, cultured at 37 ° C. for 38 hours, 0.2 mg of ellagic acid (final concentration of about 0.1 mM) was added, and further cultured for 12 hours.
100 μL of the culture solution was sampled, and 200 mL of dimethylacetamide containing 1% formic acid was added and mixed. The dilution obtained was centrifuged and the supernatant was analyzed by HPLC. The conditions are as in the above HPLC condition 1.
As a result, 0.076 mM urolitin M5 and 0.008 mM ellagic acid were detected.

Comparative Example 1
The procedure of Example 10 was repeated except that a plasmid-free host (E. coli Rosetta2 (DE3) strain) was used instead of the transformant.
As a result, urolitin M5 was not detected.

Example 11 Production Example of Urolitin M5 to Urolitin M5
To ABB medium (Oxoid), urolithin M5 was added to a final concentration of 3.3 mM, and then heat-sterilized, and the gas phase was N ₂ : CO ₂ : H ₂ (80% / 10% / 10%). ) The basic medium was replaced with gas. In the basal medium, the strain Gordonivacta urolithifaciens DSM 27213 was inoculated and anaerobically cultured at 37 ° C. After completion of the culture, an equal amount of DMSO was added to 1 mL of the culture solution to dissolve urolitins, and quantitative analysis of the urolitins was performed by HPLC. The conditions are as shown in the following HPLC condition 2.
As a result, 0.406 mM urolithin M6 was produced by culturing for 14 days.

<HPLC condition 2>
Column: Inertsil ODS-3 (φ 4.6 mm × 250 mm, 5 μm) (manufactured by GL Science)
Eluent A: 1% formic acid B: acetonitrile containing 1% formic acid Flow rate: 1 mL / min
Column temperature: 40 ° C
Detection: UV (305 nm)

Example 12 Production Example of Urolitin C from Urolitin M5
To ABB medium (Oxoid), urolithin M5 was added to a final concentration of 3.3 mM, and then heat-sterilized, and the gas phase was N ₂ : CO ₂ : H ₂ (80% / 10% / 10%). ) The basic medium was replaced with gas. In the basal medium, the strain Gordonivacta urolithifaciens DSM 27213 was inoculated and anaerobically cultured at 37 ° C. After completion of the culture, an equal amount of DMSO was added to 1 mL of the culture solution to dissolve urolitins, and quantitative analysis of the urolitins was performed by HPLC. The conditions are as in the above HPLC condition 2.
As a result, 0.0707 mM urolithin C was produced by culturing for 14 days.

Example 13 Production Example 1 of urolitin C to urolitin A
After adding urolithin C as a precursor of urolithin A to an ABB medium (manufactured by Oxoid) to a final concentration of 1.0 g / L, the mixture is sterilized by heating and the gas phase is N ₂ : CO ₂ : H _2. A medium replaced with gas (80% / 10% / 10%) was used as a basal medium. Clostridium Borteae JCM 12243 strain, DSM 15670 strain, or DSM 29485 strain was inoculated into the basal medium and cultured anaerobically at 37 ° C. After completion of the culture, urolitins were extracted with an equal volume of ethyl acetate relative to 5 mL of the culture solution, and the obtained ethyl acetate phase was concentrated under reduced pressure to dryness. The dried product thus obtained was redissolved in 0.5 mL of methanol, and quantitative analysis of urolithins was performed by HPLC. The conditions are as in the above HPLC condition 2. In addition, urolitins manufactured by DALTON PHARMA were used as a standard and dissolved in DMSO.
As a result, 89% of the added urolithin C,
100% and 89% were converted to urolitin A.

Example 14 Production Example 2 of urolitin C to urolitin A
As a result of carrying out in the same manner as in Example 13 except that culturing was carried out for 5 days using Clostridium asparagiforme DSM 15981 strain, 95% of the added urolithin C was converted to urolithin A.

Example 15 Production Example 3 of Urolitin C to Urolitin A
As a result of carrying out in the same manner as in Example 13 except that culturing was carried out for 5 days using Clostridium citrononiae DSM 19261 strain, 82% of the added urolithin C was converted to urolithin A.

Example 16 Production Example 4 of Urolitin C to Urolitin A
Clostridium bortaeae JCM 12243 strain and Goldonibacter pamelaeae DSM 19378 strain were inoculated in ABB medium (Oxoid) containing 0.1% ellagic acid (manufactured by SIGMA) and cultured in the same manner as in Example 13. As a result, 67% of the added ellagic acid was converted to urolitin A by culture for 2 weeks.

Example 17 Production Example 5 of Urolitin C to Urolitin A
As a result of culturing in the same manner as in Example 16 except that Clostridium bortaeae JCM 12243 strain and Gordonibacter urolithifaciens DSM 27213 strain were used. As a result of culturing for 2 weeks, 62% of the added ellagic acid was urolithin A. Was converted to

[Example 18: Production Example 6 of urolitin A from urolitin C]
As a result of culturing in the same manner as in Example 16 except that Clostridium asparagiforme DSM 15981 strain and Gordonibacter urolithifaciens DSM 27213 strain were used, 60% of the added ellagic acid was obtained by culturing for 5 days. It was converted to urolitin A.

[Example 19: Production Example 7 of urolitin A from urolitin C]
As a result of culturing in the same manner as in Example 16 except that Clostridium citrononiae DSM 19261 strain and Gordonibacter urolithifaciens DSM 27213 strain were used, 60% of the added ellagic acid was found to be urolithin A after 5 days of culture. Was converted to

Example 20 Production Example of Urolitin D from Urolitin M5
To ABB medium (Oxoid), urolithin M5 was added to a final concentration of 3.3 mM, and then heat-sterilized, and the gas phase was N ₂ : CO ₂ : H ₂ (80% / 10% / 10%). ) The basic medium was replaced with gas. In the basal medium, the strain Gordonivacta urolithifaciens DSM 27213 was inoculated and anaerobically cultured at 37 ° C. After completion of the culture, an equal amount of DMSO was added to 1 mL of the culture solution to dissolve urolitins, and quantitative analysis of the urolitins was performed by HPLC. The conditions are as in the above HPLC condition 2.
As a result, 0.011 mM urolithin M6 was produced by culturing for 14 days.

  The present invention provides a lactonase advantageous for industrial production of urolithins. The lactonase enables efficient production of urolitin M5, and enables production of urolitins via the urolitin M5. Urolitins are useful as materials for pharmaceuticals, cosmetics and functional foods, and the present invention is very useful industrially.

Claims (15)

Lactonase having the following property (1):
(1) It has an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds present in ellagic acid. The lactonase according to claim 1, further having the following properties (2) to (4):
(2) the optimum pH is 7.0 or more and 9.0 or less;
(3) the optimum temperature is 42 ° C. or higher and 55 ° C. or lower;
(4) The molecular weight is from 37,800 to 46,200. The lactonase according to claim 1 or 2, derived from a microorganism belonging to the genus Gordonibacter. The microorganism belonging to the genus Gordonibacter (Gordonibacter) is a microorganism belonging to Gordonibacter urolithinfaciens, a microorganism belonging to Gordonibacter pamelaeae (Gordonibacter pamelaeae), and Gordonibacter fehimominis (Gordonibacter) Lactonase according to claim 3, selected from the group consisting of microorganisms belonging to faecihominis). Lactonase, which is a protein of the following (A) or (B):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4;
(B) In the amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4, present in ellagic acid consisting of amino acids in which 1 to several amino acids are substituted or deleted, or in which 1 to several amino acids are inserted or added A protein having an activity of catalyzing a reaction of hydrolyzing at least one of two ester bonds. The manufacturing method of the lactonase of Claim 1 or 2 including the process of culture | cultivating the microbe which belongs to Gordonibacter (Gordonibacter) genus. The following polynucleotide (a) or (b):
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2;
(B) containing a base sequence having 90% or more homology with the base sequence represented by SEQ ID NO: 1 or 2 and catalyzing a reaction that hydrolyzes at least one of two ester bonds present in ellagic acid Polynucleotide encoding a protein having an activity of   A recombinant vector comprising the polynucleotide of claim 7.   A transformant, wherein the polynucleotide according to claim 7 is expressibly retained or the vector according to claim 8 is expressably retained.   A method for producing a protein encoded by the polynucleotide according to claim 7, comprising the step of culturing the transformant according to claim 9. A method for producing urolithin M5, comprising the following step (I):
Step (I): a step of contacting one or more selected from the following (i) to (iv) with ellagic acid.
(I) Lactonase according to any one of claims 1 to 5;
(Ii) a protein encoded by the polynucleotide according to claim 7;
(Iii) a microorganism that produces the lactonase or the protein;
(Iv) Treated product of the microorganism. A method for producing urolitin C, which comprises the following steps (I) and (II), wherein the steps (I) and (II) are carried out in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) the lactonase according to any one of claims 1 to 5;
(Ii) a protein encoded by the polynucleotide according to claim 7;
(Iii) a microorganism that produces the lactonase or the protein;
(Iv) Treated product of the microorganism.
Step (II): a step of causing a microorganism having the ability to produce urolithin C from the urolithin M5 to produce urolithin C from the urolithin M5. A method for producing urolitin A, comprising the following steps (I) to (III), wherein the steps (I) to (III) are performed in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) Lactonase according to any one of claims 1 to 5;
(Ii) a protein encoded by the polynucleotide of claim 7;
(Iii) said lactonase or a microorganism producing said protein;
(Iv) Treated product of the microorganism.
Step (II): a step of causing a microorganism having the ability to produce urolitin C from the urolitin M5 to produce urolitin C from the urolitin M5.
Step (III): a step of causing a microorganism having the ability to produce urolitin A from the urolitin C to produce urolitin A from the urolitin C. A method for producing uroritin M6, which comprises the following steps (I) and (IV), wherein the steps (I) and (IV) are carried out in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) the lactonase according to any one of claims 1 to 5;
(Ii) a protein encoded by the polynucleotide according to claim 7;
(Iii) said lactonase or a microorganism producing said protein;
(Iv) Treated product of the microorganism.
Step (IV): A step of causing a microorganism having the ability to produce urolithin M6 from urolithin M5 to produce urolithin M6 from urolithin M5. A method for producing uroritin D, comprising the following steps (I) and (V), wherein the steps (I) and (V) are performed in the same system:
Step (I): contacting one or more selected from the following (i) to (iv) with ellagic acid to produce urolitin M5;
(I) Lactonase according to any one of claims 1 to 5;
(Ii) a protein encoded by the polynucleotide of claim 7;
(Iii) a microorganism that produces the lactonase or the protein;
(Iv) Treated product of the microorganism.
Step (V): A step of causing a microorganism having an ability to produce urolithin D from urolithin M5 to produce urolithin D from urolithin M5.

Images